Methods for characterizing and utilizing drug-condensate interactions
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2020-05-15
- Publication Date
- 2026-08-14
Smart Images

Figure 0007905182000021 
Figure 0007905182000022 
Figure 0007905182000023
Abstract
Description
Technical Field
[0001] Related Applications This application claims the benefit of U.S. Provisional Application No. 62 / 848,539, filed May 15, 2019, and U.S. Provisional Application No. 62 / 927,073, filed October 28, 2019, the contents of which are hereby incorporated by reference in their entirety.
[0002] Federal Government Support This invention was made with government support under GM123511, CA213333, and CA155258 awarded by the National Institutes of Health, and PHY1743900 awarded by the National Science Foundation. The United States government has certain rights in this invention.
Background Art
[0003] Transcription factors and cofactors that occupy super-enhancers form liquid-like condensates that compartmentalize and concentrate the transcriptional machinery at important cell identity genes. Tumor cells acquire large super-enhancers of driver cancer genes, which contributes to the transcriptional dysregulation that is characteristic of cancer.
Summary of the Invention
[0004] This specification demonstrates that transcription condensates are related to the driving force of carcinogenesis and provide a framework for novel intervention sites in cancer treatment. The discovery that multiple key proteins of the transcription mechanism are present within these structures can make previously drug-challenging targets (due to their disorder) attractive drug targets. Unexpectedly, this specification demonstrates that some drugs (e.g., small molecules) can enter transcription condensates independently of the presence of drug targets. Methods disclosed herein for measuring the extent to which a drug can enter a condensate and the specificity of the drug to different types of condensates (e.g., transcription condensates, heterochromatin or repressive condensates, splicing speckle condensates, nucleolus, chromatin condensates, Polycomb condensates, DNA damage repair condensates) provide useful information regarding drug exposure and off-target effects. Methods disclosed herein can determine how much of a drug is distributed into the condensate and how much is distributed outside the condensate to help determine the efficacy of a candidate in a cell or organism. Methods are also provided for regulating the incorporation of a drug into a condensate by adjusting the number of aromatic side chains of the drug or condensate components. In addition, determining how a drug functions in a condensate may enable the adoption of known drugs in new applications.
[0005] Some aspects of the present invention relate to a method for characterizing a drug, comprising contacting the drug with a composition comprising a condensate having at least one component, and measuring the uptake of the drug into the condensate. In some embodiments, the uptake of the drug into the condensate is detected without using a detectable tag on the drug. In some embodiments, the uptake of the drug into the condensate is detected using Raman spectroscopy, spectrometry and quantitative phase-contrast microscopy, or a spin-down assay. In some embodiments, the drug includes a detectable tag. In some embodiments, the component or condensate includes a detectable tag. In some embodiments, the detectable tag is a fluorescent tag.
[0006] In some embodiments, the method includes contacting a drug having a detectable tag with a composition containing a condensate, measuring the uptake of the drug having the detectable tag into the condensate, contacting the composition containing the condensate and the drug having the detectable tag with a control drug that does not have a detectable tag, and again measuring the uptake of the drug having the detectable tag into the condensate.
[0007] In some embodiments, the method includes contacting a drug with a plurality of condensates having one or more different components. In some embodiments, the method includes contacting a drug with a plurality of compositions, each having a condensate having at least one different component. In some embodiments, the method includes contacting a plurality of drugs with a plurality of compositions, each having a condensate containing the same component.
[0008] In some embodiments, at least one component is a transcription condensate component, a heterochromatin condensate component, a condensate component physically associated with mRNA initiation, a condensate component physically associated with mRNA elongation, a chromatin condensate component, a Polycomb condensate component, or a DNA damage repair condensate component. In some embodiments, at least one component is a mediator, a mediator component, MED1, BRD4, POLII (i.e., POL2), SRSF2, FIB1, NPM1, HP1α, a histone, a histone tail, a component of Polycomb repression complex 1 (PRC1) (e.g., CBX2), or 53BP1. In some embodiments, at least one component is a superenhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a component or functional part of a DNA damage repair condensate. In some embodiments, the component includes an intrinsically disordered region (IDR).
[0009] In some embodiments, the components include detectable tags that differ from the drug. In some embodiments, drug uptake is measured in comparison to a control. In some embodiments, the uptake of multiple drugs is measured and compared to one another.
[0010] In some embodiments, the drug can bind to the target. In some embodiments, the condensate does not contain the target. In some embodiments, the target is mainly located outside the condensate. In some embodiments, the target is mainly located inside the condensate. In some embodiments, the target is a therapeutic target. In some embodiments, the target is an enzyme, receptor, ligand, oncogene, oncogene product, or transcription factor. In some embodiments, the target is genomic DNA. In some embodiments, the composition contains the target.
[0011] In some embodiments, the relative amount of a drug that is incorporated into or not incorporated into the condensate is measured. In some embodiments, the condensate is physically associated with DNA.
[0012] In some embodiments, the condensate is present within cells. In some embodiments, the cells are diseased cells. In some embodiments, the condensate is present in vitro. In some embodiments, the drug is a small molecule, polypeptide, or nucleic acid. In some embodiments, the drug is a known chemotherapeutic agent. In some embodiments, the drug is a chemotherapeutic agent candidate. In some embodiments, the drug is cisplatin or a derivative thereof, or comprises it. In some embodiments, the drug is JQ1(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetate(S)-tert-butyl) or a derivative thereof. In some embodiments, the drug is tamoxifen or a derivative thereof, or comprises it.
[0013] Some aspects of the present invention relate to a method for characterizing a first agent, comprising contacting the first agent with a composition comprising a condensate having at least one component, wherein the condensate contains at least a second agent, and measuring the ability of the first agent to cause the elimination of the second agent from the condensate. In some embodiments, the second agent comprises a detectable tag. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, the condensate component is a target of the second agent.
[0014] Some aspects of the present invention relate to compositions comprising a drug having a condensate and a therapeutic target, wherein the condensate does not contain a therapeutic target. In some embodiments, the therapeutic target is genomic DNA.
[0015] As shown in the following embodiments, dyes that do not preferentially distribute into a condensate can be modified to preferentially distribute into the condensate by coupling with a drug or part. Some aspects of the present invention relate to a method for regulating the distribution of a first drug into a condensate, comprising coupling the first drug with a second drug, thereby regulating the distribution of the first drug into the condensate. In some embodiments, the condensate is selected from a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, or a nucleolus. In some embodiments, the distribution of the first drug into the condensate is increased. In some embodiments, the distribution of the first drug into the condensate is decreased. In some embodiments, the therapeutic efficacy of the coupled first drug is increased compared to the uncoupled first drug. In some embodiments, the side effects of the coupled first drug are reduced compared to the uncoupled first drug.
[0016] Furthermore, as shown in the following examples, increasing the aromatic side chain content of a drug increases the distribution of the drug into the MED1 in vitro condensate (i.e., droplet). Some aspects of the present invention relate to methods for regulating the distribution of a drug into the condensate by modifying the drug to increase or decrease the number of aromatic side chains. In some embodiments, the distribution of a modified drug into the condensate is increased compared to an unmodified drug. In some embodiments, the distribution of a modified drug is decreased compared to an unmodified drug.
[0017] Several aspects of this disclosure relate to a method for screening candidate drugs with regulated condensate distribution, comprising modifying a drug having a certain condensate distribution coefficient, and measuring the condensate distribution coefficient of the modified drug, wherein if the modified drug has a different distribution coefficient than the original drug, the modified drug is identified as a candidate drug with regulated condensate distribution. In some embodiments, the condensate distribution coefficient of the modified drug is measured in an in vitro condensate. In some embodiments, the condensate distribution coefficient of the modified drug is measured in an intracellular condensate. In some embodiments, a candidate drug is identified as an improved candidate drug if it has an increased distribution into condensates that have a therapeutic target for the candidate drug. In some embodiments, a candidate drug is identified as an improved candidate drug if it has a decreased distribution into condensates that do not have a therapeutic target for the candidate drug. In some embodiments, a candidate drug with regulated condensate distribution is a chemotherapeutic drug. In some embodiments, the modification includes increasing or decreasing the number of aromatic side chains of the drug.
[0018] Some aspects of the present invention relate to a method for reducing the transcription of oncogenes, comprising contacting the transcription condensate with a drug to adjust the composition of the transcription condensate associated with the oncogene, or to dissolve or dissociate the transcription condensate.
[0019] In some embodiments, the drug dissolves the transcription condensate, cleaves the transcription condensate from the genomic DNA containing the oncogene, or eliminates one or more components of the transcription condensate. In some embodiments, the drug is an inhibitor, intercalator, or cyclin-dependent kinase inhibitor. In some embodiments, the drug binds to components of the transcription condensate. In some embodiments, the drug preferentially concentrates within the transcription condensate. In some embodiments, the condensate is located inside a cell. In some embodiments, the cell is a cancer cell.
[0020] In some embodiments, the drug is administered to a subject having cancer. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.
[0021] Some aspects of the present invention relate to a method for treating a subject requiring treatment for a cancer characterized by the transcription of an oncogene, comprising administering to the subject an agent that modulates the composition of a transcription condensate associated with the oncogene, or that dissolves or dissociates the transcription condensate. In some embodiments, the agent is an inhibitor, an intercalator, or a cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of the transcription condensate. In some embodiments, the agent preferentially concentrates within the transcription condensate. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.
[0022] In some embodiments, the subject is human. In some embodiments, the drug is administered orally, subcutaneously, topically, or intravenously. In some embodiments, the drug is a small molecule, polypeptide, or nucleic acid.
[0023] Some aspects of this disclosure relate to a method for inhibiting transcription associated with a transcription condensate, comprising inhibiting the binding of a nuclear receptor associated with the transcription condensate to a cofactor having an LXXLL domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain.
[0024] In some embodiments, the nuclear receptor is a nuclear hormone receptor, estrogen receptor, or retinoic acid receptor α. In some embodiments, the cofactor is MED1. In some embodiments, the transcription of oncogenes is inhibited. In some embodiments, transcription condensates are present in cells. In some embodiments, the cells are cancer cells. In some embodiments, the peptide is administered to the subject. In some embodiments, the subject has cancer.
[0025] Some aspects of the present invention relate to a method for inhibiting transcription associated with a transcription condensate, comprising inhibiting the binding of a nuclear receptor having an LXXLL-binding domain and associated with the transcription condensate to a cofactor having an LXXLL domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain.
[0026] In some embodiments, the nuclear receptor is a nuclear hormone receptor, estrogen receptor, or retinoic acid receptor α. In some embodiments, the cofactor is MED1. In some embodiments, the transcription of oncogenes is inhibited. In some embodiments, transcription condensates are present in cells. In some embodiments, the cells are cancer cells. In some embodiments, the peptide is administered to the subject. In some embodiments, the subject has cancer.
[0027] Some embodiments of the present invention relate to a composition comprising cells having a first condensate containing a first detectable label and a second condensate having a different second detectable label, wherein the first and second condensates are different types of condensates selected from super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleolus, chromatin condensates, Polycomb condensates, or DNA damage repair condensates. In some embodiments, the composition further comprises a drug in contact with the cells. In some embodiments, the drug is a known therapeutic agent. In some embodiments, the drug is a candidate therapeutic agent. In some embodiments, the second detectable label is detectably distinguishable from the first detectable label.
[0028] Some embodiments of the present invention relate to a composition comprising a first in vitro condensate, a second in vitro condensate, and a drug in contact with the first and second in vitro condensates. In some embodiments, at least one of the first in vitro condensate, the second in vitro condensate, and the drug includes a detectable label. In some embodiments, the composition further comprises a third in vitro condensate and optionally a fourth in vitro condensate, each in contact with the drug. In some embodiments, at least one of the in vitro condensates includes a transcription condensate, a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a polycomb condensate, or a component or functional fragment of a DNA damage repair condensate. Some embodiments relate to an article comprising a first in vitro condensate in contact with a drug, a second in vitro condensate in contact with the same drug, and a multiwell plate separating the first and second in vitro condensates into separate wells. In some embodiments, the article further comprises at least a third in vitro condensate in contact with the drug. In some embodiments, the article further comprises at least a fourth in vitro condensate in contact with the drug. The first, second, third, and fourth in vitro condensates may each contain components or functional fragments of a different condensate (e.g., a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a polycomb condensate, or a DNA damage repair condensate). The first, second, third, and fourth in vitro condensates may each contain a different detectable label.
[0029] Some aspects of the present invention relate to a method for evaluating whether differential expression of one or more condensate components by drug-resistant cells causes or contributes to resistance, the method comprising providing drug-resistant cells, contacting the drug-resistant cells with the drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control.
[0030] Some aspects of the present invention relate to a method for evaluating whether differential expression of one or more condensate components by drug-resistant cells causes or contributes to resistance, the method comprising providing condensates isolated from drug-resistant cells, contacting the condensates with the drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control.
[0031] Some aspects of the present invention relate to a method for evaluating whether differential expression of one or more condensate components by drug-resistant cells causes or contributes to resistance, the method comprising providing an in vitro condensate (e.g., a droplet) containing differential amounts of condensate components or fragments thereof that are differentially expressed in drug-resistant cells, contacting the condensate with the drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control.
[0032] Some aspects of the present invention relate to a method for evaluating whether differential expression of one or more condensate components by drug-resistant cells causes or contributes to resistance, the method comprising: providing an in vitro condensate (e.g., a droplet) containing a mutant condensate component or a fragment thereof corresponding to a mutant condensate component in drug-resistant cells; contacting the condensate with the drug; and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control.
[0033] Some aspects of the present invention relate to a method for characterizing a drug-resistant condensate, comprising contacting the condensate with one or more second drugs, and evaluating at least one of the localization, concentration, or therapeutic activity of the drugs, and / or the morphology, stability, or solubility of the condensate. In some embodiments, the second drug is contacted with cells containing the drug-resistant condensate. In some embodiments, the condensate is isolated from the cells. In some embodiments, the condensate is an in vitro condensate (e.g., a droplet). In some embodiments, the condensate comprises mutant condensate components or fragments thereof related to resistance to the drug.
[0034] The patent or application file shall contain at least one color drawing. A copy of the patent or patent application publication containing the color drawing shall be provided by the Patent Office upon request and payment of the necessary fees. [Brief explanation of the drawing]
[0035] [Figure 1] A schematic diagram illustrating that changes in the transcription apparatus are characteristic of cancer is shown. Excerpt from Bradner, Hnisz and Young, Cell 2017. [Figure 2] This demonstrates the identification of super-enhancers. Super-enhancers are large clusters of enhancers that regulate genes with significant roles in cell identity and are occupied by proteins rich in very high-density intrinsically disordered domains and high levels of eRNA. (Excerpt from Hnisz et al., Cell (2013)). [Figure 3] This shows that tumor cells can nucleate through small DNA changes in driver oncogenes and acquire extremely long super-enhancers that are particularly sensitive to transcriptional drugs. Figures extracted from Mansour et al. Science (2014) and Loven et al. Cell (2013). [Figure 4]This study demonstrates that transcription factors and mediator coactivators contribute to condensate formation in superenhancers. See Sabari, Dall'Agnese et al., Science 2018; Cho, Spille et al., Science 2018; and Boija, Klein et al., Cell 2018. [Figure 5] This demonstrates that biomolecular condensates can be generated by phase separation. (Excerpt from Brangwynne CP.JCB 2013.) [Figure 6] This indicates that transcription condensates are involved in oncogene expression and are available therapeutic targets. TxEx: Transcription enzyme; TF: Transcription factor; CoA: Coactivator; SE-driven oncogene: Oncogene driven by a super-enhancer. [Figure 7A] This shows that transcription condensates containing driver transcription factors (TFs) and the mediator MED1 subunit are generated in the MYC oncogene in human tumor tissue. H&E staining of breast cancer carcinoma and ER+ breast cancer is also shown. [Figure 7B] This shows that transcription condensates containing the driver transcription factor (TF) and the mediator MED1 subunit are generated in the MYC oncogene in human tumor tissue. It shows antibody against MED1 (MED1 IF) or antibody against the estrogen receptor (ER IF), followed by immunofluorescence microscopy of ER+ breast cancer tissue using Myc RNA FISH. The upper right panel (magnified merged image) shows co-localization of MED1 and Myc transcriptions within the condensate. The lower right panel shows co-localization of estrogen receptor and Myc transcriptions within the condensate. [Figure 7C]This shows that transcription condensates containing the driver transcription factor (TF) and the mediator MED1 subunit are generated in the MYC oncogene in human tumor tissue. It shows antibody against MED1 (MED1 IF) or antibody against the estrogen receptor (ER IF), followed by immunofluorescence microscopy of ER+ breast cancer tissue using Myc DNA FISH. The upper right panel (magnified merged image) shows co-localization of MED1 and the Myc gene within the condensate. The lower right panel shows co-localization of the estrogen receptor and the Myc gene within the condensate. [Figure 8] This shows that mediator condensates are present in MYCs of various cancer cell types. [Figure 9] This study demonstrates that ER bound to DNA promotes MED1 condensate formation. In in vitro droplet assays, MED1 and ER formed droplets in the presence of DNA containing ER binding sites, but not in the presence of control DNA or in the absence of DNA. All tests were performed in the presence of estrogen. [Figure 10A] This study demonstrates that ligand-dependent condensate formation links phase separation to oncogene expression. It also shows that MED1 co-localizes with Myc DNA in the condensate in the presence of estrogen, but does not co-localize in the absence of estrogen or in the presence of both estrogen and tamoxifen. [Figure 10B] We demonstrate that ligand-dependent condensate formation links phase separation to oncogene expression. We also show that MYC expression increases in the presence of estrogen and decreases to a constitutive level in the presence of both estrogen and tamoxifen. [Figure 10C] This shows that ligand-dependent condensate formation links phase separation to oncogene expression. It also shows that ER is incorporated into the condensate in the presence of estrogen, but not in the presence of both estrogen and tamoxifen. ER droplets are shown in the top row, MED1 droplets in the middle row, and a merged image of ER and MED1 droplets is shown in the bottom row. [Figure 10D]This study demonstrates that ligand-dependent condensate formation links phase separation to oncogene expression. It also shows a significant increase in ER enrichment ratio in MED1 condensates in the presence of estrogen. [Figure 11] The transcription condensate is shown to be a multi-component structure. Co-localization of BRD4, p300, CDK7, CDK6, proteasomes, and topoisomerase with Myc transcription in the condensate was demonstrated using IF and Myc FISH. p300 and CDK7 were detected in ovarian cancer cells. All other components were detected in the breast cancer cell line MCF7. [Figure 12] This demonstrates that the transcription condensate has a multi-component structure. [Figure 13] This document presents tools for analyzing the effects of small molecules on transcription condensates. HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, POL2-GFP, or HP1a-GFP (Mock) all form condensates within the nucleus. [Figure 14A] This study demonstrates that JQ1 dissolves genome transcription condensates. It also shows that JQ1 reduces or eliminates the number of MED1, BRD4, and POL2 condensates. [Figure 14B] This study demonstrates that JQ1 lyses genomic transcription condensates. The results of a photobleached fluorescence recovery (FRAP) assay using fluorescently labeled BRD4 are shown. The presence of JQ1 significantly increased the rate at which BRD4 replaced condensates irradiated with light, resulting in significantly faster recovery (10 seconds vs. 120 seconds) due to the replacement of photobleached BRD4 with fluorescent BRD4. [Figure 14C] JQ1 demonstrates the lysis of genome transcription condensates. It shows higher levels of BRD4 with the standard enhancer (TE) compared to the super enhancer (SE). [Figure 14D]The left panel shows that JQ1 dissolves genomic transcription condensates. The right panel shows that gene expression induced by the super-enhancer is more sensitive to JQ1 inhibition than that induced by the normal enhancer. The right panel shows that JQ1 reduces BRD4-induced genomic occupation to a greater extent with the super-enhancer compared to the normal enhancer. [Figure 15] This demonstrates that antimetabolites have no effect on transcription condensates. Specifically, neither 5 μM 5-FU nor 5 μM 5-Aza had a detectable effect on MED1, BRD4, or POL2 condensates. [Figure 16] This study demonstrates the effects of various inhibitors on MED1, BRD4, and POL2 condensates in HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, and POL2-GFP. [Figure 17] This study demonstrates the effects of various intercalators on MED1, BRD4, and POL2 condensates in HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, and POL2-GFP. [Figure 18] This study demonstrates the effects of various CDK inhibitors on condensates containing MED1, BRD4, and POL2 in HCT116 colon cancer cell lines endogenously tagged with MED1-GFP, BRD4-GFP, and POL2-GFP. [Figure 19] This provides a model of the effects of drugs on transcription condensates. Bortezomib, mitoxantrone, daunorubicin, THZ1, and dinaciclib induce total lysis of condensates. See Figures 16–18. Prolonged exposure to JQ1 (e.g., 24 hours) caused genomic release and condensate hardening, similar to exposure to A485 and palbociclib. See Figures 14, 16, and 18. Short-term exposure to JQ1 (e.g., 5 minutes) caused the elimination of some condensate components (i.e., selective elimination), similar to exposure to U0216. See Figures 14 and 16. [Figure 20]Figures A and B show that small molecules approach condensates in vitro. Figure 20A (left panel) shows that estrogen receptor (ER) (green) and MED1 (red) colocalize in an in vitro droplet in the presence of estrogen, but estrogen receptor was not incorporated into the condensate in the presence of estrogen and tamoxifen. The top of the right column in Figure 20A shows that cells with an ER-bound LAC sequence have condensates containing reduced ER (green) and MED1 (red) in the presence of tamoxifen. The bottom of the right column shows the relative fluorescence intensities of ER and MED1 in the presence and absence of tamoxifen. The top of Figure 20B shows the structures of fluorescently labeled tamoxifen (FLTX1) and Cy5 dye (of similar molecular weight). The bottom of Figure 20B shows that FLTX1 is incorporated into the condensate containing MED1, but Cy5 dye of similar size is not. [Figure 21] This shows that tamoxifen "removes" fluorescent tamoxifen from the MED1 droplet. The top row shows that the MED1 droplet is unaffected by the addition of FLTX1, or FLTX1 and tamoxifen. The bottom row shows that FLTX1 is incorporated into the MED1 droplet but is diluted by the addition of 10-fold excess tamoxifen, confirming that FLTX1 and tamoxifen have similar condensate incorporation characteristics. [Figure 22] The images show that fluorescent tamoxifen specifically enriches the MED1 condensate. The lower left panel shows that FLTX1 is incorporated into the MED1 droplet. MED1 is a component of the transcription condensate. The lower right panel shows that FLTX1 is not incorporated into the heterochromatin protein 1 (HP1a) droplet. HP1a is a component of the heterochromatin condensate. Importantly, FLTX1 was incorporated into the MED1 droplet in the absence of its target, the estrogen receptor. [Figure 23]This shows that drugs that dissolve condensates enrich the MED1 condensates. Mitoxantrone, curcumin, and daunorubicin each exhibit fluorescent activity and induce condensate dissolution. The lower panel of Figure 23 shows that these drugs are immediately taken up into the MED1 droplet. [Figure 24] The image shows an ER / MED1 droplet in contact with a fluorescent peptide (left side). Upon exposure to estrogen, the estrogen receptor undergoes a structural change that allows it to interact with the LXXLL domain of MED1 (right side). [Figure 25] This study demonstrates that when LXXLL peptide (QNPILTSLLQITG; SEQ ID NO: 1) is added to an ER / MED1 droplet, the peptide is incorporated into the MED1 droplet, resulting in a decrease in the distribution of ER within that MED1 droplet. [Figure 26] This shows the uptake of peptides into MED1 / ER droplets in the presence of estrogen. Polyproline (poly-P) and RNA polymerase II CTD repeat YSPTSPS peptide (CTD) had no effect on ER / MED1 droplet formation, but polyglutamic acid (poly-E) (acidic) and polylysine (poly-K) peptides (basic) abolished MED1 / ER droplet formation. [Figure 27] This study demonstrates the uptake of a cell membrane-permeable LXXLL peptide with an HIV-TAT tag into U2OS cells, showing that peptides can be visualized in living cells. [Figure 28A] This section shows nuclear condensates in human tissue and in vitro. It also presents a model illustrating the possible behavior of small molecules within nuclear condensates. [Figure 28B] This shows nuclear condensates in human tissue and in vitro. It also shows immunofluorescence of scaffolding proteins of various nuclear condensates in the nucleus, stained with Hoechst and imaged at 100x using a fluorescence confocal microscope, from tissue biopsies of benign and malignant human breast tissue (Figure 28B). [Figure 28C]This shows nuclear condensates in human tissue and in vitro. It also shows immunofluorescence of scaffolding proteins of various nuclear condensates in nuclei stained with Hoechst and imaged at 100x using a fluorescence confocal microscope in tissue biopsies from benign and malignant colon tissue (Figure 28C). [Figure 28D] This shows nuclear condensates in human tissue and in vitro. A schematic diagram of an in vitro droplet formation assay for measuring the distribution of small molecules within nuclear condensates is also shown. [Figure 28E] This shows nuclear condensates in human tissue and in vitro. It also shows an in vitro droplet assay demonstrating the behavior of fluorescein dye in the presence of six protein condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein and 5 μM fluorescein, and imaged at 150x confocal fluorescence microscopy. The quantitative determination of drug enrichment is shown on the right, with error bars representing SEM results. [Figure 29A] This shows the distribution behavior of small molecule drugs into nuclear condensates in a droplet assay. Six nuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29A) were treated with 5 μM cisplatin-TMR and imaged at 150x confocal fluorescence microscopy. Quantification of drug enrichment within droplets is shown on the right side of each panel, with error bars representing SEM results. [Figure 29B] This shows the distribution behavior of small molecule drugs into nuclear condensates in a droplet assay. Six nuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29B) were treated with 50 μM mitoxantrone and imaged at 150x confocal fluorescence microscopy. Quantification of drug enrichment within droplets is shown on the right side of each panel, with error bars representing SEM results. [Figure 29C]This shows the distribution behavior of small molecule drugs into nuclear condensates in a droplet assay. Six nuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29C) were treated with 100 μM FLTX1 and imaged at 150x confocal fluorescence microscopy. Quantitative drug enrichment within the droplets is shown on the right side of each panel, with error bars representing SEM results. [Figure 29D] This shows the distribution behavior of small molecule drugs into nuclear condensates in a droplet assay. Six nuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29D) were treated with 5 μM THZ1-TMR and imaged at 150x confocal fluorescence microscopy. Quantification of drug enrichment within droplets is shown on the right side of each panel, with error bars representing SEM results. [Figure 29E] This shows the distribution behavior of small molecule drugs into nuclear condensates in a droplet assay. Six nuclear condensates formed in 125 mM NaCl and 10% PEG containing 10 μM protein (Figure 29E) were treated with 1 μM JQ1-ROX and imaged at 150x confocal fluorescence microscopy. Quantification of drug enrichment within droplets is shown on the right side of each panel, with error bars representing SEM results. [Figure 30A] This demonstrates that the concentration of low-molecular-weight molecules within condensates affects drug activity. We present an in vitro droplet assay of MED1 and HP1α condensates formed in 125 mM NaCl and 10% PEG containing 5 nM 450 bp DNA, 10 μM MED1, and 5 μM cisplatin-TR, and imaged at 150x confocal fluorescence microscopy. [Figure 30B] This demonstrates that low-molecular-weight concentration within condensates affects drug activity. The image shows bioanalytical tracing of DNA contained within MED1 or HP1α droplets exposed to the indicated concentrations of cisplatin. [Figure 30C]This demonstrates that the concentration of small molecules within condensates affects drug activity. (Top) A schematic diagram of an assay for determining the location of platinumized DNA in various nuclear condensates is shown. (Bottom) Co-immunofluorescence of platinumized DNA and indicated proteins in HCT116 cells treated with 50 μM cisplatin for 6 hours. Imaging was performed at 100x confocal fluorescence microscopy. Quantification of overlap is shown on the right. [Figure 30D] This demonstrates that the concentration of low-molecular-weight molecules within condensates affects drug activity. (Top) A schematic diagram of the live-cell condensate lysis assay is shown. (Bottom) HCT116 cells with endogenously tagged MED1, HP1α, or FIB1, treated with 50 μM cisplatin for 12 hours. Quantification of MED1, HP1α, or FIB1 condensate scores is shown on the right. [Figure 30E] This demonstrates that low molecular weight concentration within condensates affects drug activity. The image shows MED1 ChIP-seq in HCT116 cells treated with the vehicle or 50 μM cisplatin for 6 hours. (Left) Mean read density of MED1 with super-enhancer and normal enhancer (error bars indicate minimum and maximum) and (right) Gene track of MED1 ChIP with MYC super-enhancer and AQPEP normal enhancer. [Figure 30F] This demonstrates that the concentration of low-molecular-weight molecules within condensates affects drug activity. A metaplot of cisplatin-DNA-Seq in cisplatin-treated HeLa cells is shown comparing a super-enhancer and a standard enhancer. [Figure 31A] This shows the tamoxifen activity and resistance in MED1 condensates. A schematic diagram illustrating tamoxifen resistance due to ER mutations and MED1 overexpression in breast cancer is also shown. [Figure 31B] This study demonstrates tamoxifen activity and resistance in MED1 condensates. It also shows an in vitro droplet assay of the indicated type of GFP-labeled ER in the presence of estrogen and + / - 100 μM tamoxifen. Droplets are formed in 125 mM NaCl and 10% PEG containing 10 μM of each protein and 100 μM of estrogen. [Figure 31C] This shows the tamoxifen activity and resistance in MED1 condensates. (Left) Immunofluorescence of MED1, imaged at 100x confocal fluorescence microscopy, in tamoxifen-sensitive (MCF7) and resistant (TAMR7) ER+ breast cancer cell lines. (Upper right) Quantification of MED1 condensate size in breast cancer cells. (Lower right) Relative amount of MED1 by Western blot in the shown breast cancer cell lines. Error bars indicate SEM. [Figure 31D] This study demonstrates tamoxifen activity and resistance in MED1 condensates. In vitro droplet assays of ER in the presence of 100 μM estrogen, + / - 100 μM tamoxifen, and either 5 μM (low) or 20 μM (high) MED1 are shown. Droplets were formed with 5 μM ER in 125 mM NaCl and 10% PEG and imaged at 150x confocal fluorescence microscopy. Error bars represent SEM. [Figure 31E] This shows the tamoxifen activity and resistance in MED1 condensates. It also shows an in vitro droplet assay using either 5 μM (low) or 20 μM (high) of MED1 in 125 mM NaCl and 10% PEG containing 100 μM FLTX1. Error bars represent SD. [Figure 31F] This study demonstrates tamoxifen activity and resistance in MED1 condensates. It also presents a model of tamoxifen resistance resulting from changes in drug affinity (due to ER mutations) or concentration (due to MED1 overexpression). [Figure 32A] The images show nuclear condensates in cell lines and human tumor tissue. The images also show mouse embryonic stem cells, imaged by confocal fluorescence microscopy, that either express proteins endogenously tagged with mEGFP (MED1, BRD4, SRSF2), proteins endogenously tagged with mCherry (HP1α), or cells transfected with constructs expressing GFP-labeled proteins (NPM1, FIB1). [Figure 32B]This shows intranuclear condensates in cell lines and human tumor tissue. Clinical data from biopsied breast and colon cancer specimens are also presented. [Figure 32C] The images show intranuclear condensates in cell lines and human tumor tissue. They also show H&E staining of ER-positive breast cancer and colon adenocarcinoma. [Figure 33A] This shows the volume and number of intranuclear condensates in normal and tumor tissue. It also shows the volume of intranuclear condensates in normal and malignant breast tissue (upper part), and in normal and malignant colon tissue (lower part). Values represent percentage nuclear volume and standard deviation. There were no significant differences between individual intranuclear condensates in normal and malignant conditions. [Figure 33B] This section shows the volume and number of intranuclear condensates in normal and tumor tissue. A table showing the average volume of intranuclear condensates in normal and malignant tissue is also provided. [Figure 33C] The volume and number of intranuclear condensates in normal and tumor tissue are shown. A table showing the average number of intranuclear condensates in normal and malignant tissue is also provided. [Figure 34A] This shows the proteins that form nuclear condensates. A schematic diagram of the construct used to purify nuclear condensate proteins is shown. For MED1 and BRD4 proteins, only the IDR (intrinsically disordered region) was used, while for HP1α, SRSF2, NPM1, and FIB1 proteins, the full-length proteins were used. [Figure 34B] This table shows the proteins that form nuclear condensates. (Top) The number of hydrophobic amino acids, phenylalanine (F), tryptophan (W), and tyrosine (Y), in the IDR and full-length proteins is shown. MED1 IDR has the most hydrophobic residues. (Bottom) A table of positively charged interactors (CIE+) and negatively charged interactors (CIE) for the IDR or full-length nuclear condensate protein. These results suggest that the MED1 protein may be involved in π-system-controlled interactions. [Figure 35A]This shows in vitro droplets of proteins that form condensates. Confocal microscopy of the in vitro droplet formation assay of the indicated GFP-labeled proteins in 125 mM NaCl and 10% PEG is shown. For MED1 and BRD4 proteins, only the IDR (Intradensitometer Drip) portion is shown. [Figure 35B] In vitro droplets of condensate-forming proteins are shown. Confocal microscopy images of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 nuclear condensates at the indicated salt concentrations (125 mM, 350 mM, 650 mM, and 1000 mM NaCl) are shown, and the experiment was performed using 10 μM of protein in 10% PEG. [Figure 36] A schematic diagram of the enrichment ratio calculation is shown. The droplet is defined in the protein channel, and the maximum drug intensity is measured in that region to obtain the drug interior (left panel). The background is measured in the drug channel in the region defined by the protein channel in the in vitro droplet reaction product that contains protein but not drug (middle panel). The drug diffusion intensity is measured in the droplet reaction product that does not contain protein (right panel). [Figure 37A] This shows the distribution of small molecules within the nuclear condensate. Confocal microscopy of an in vitro droplet formation assay using only the small molecules shown, without any added proteins to the reactants (4.4 kDa dextran, fluorescein, and Hoechst). All of the small molecules alone exhibit scattered fluorescence signals, indicating that they do not form droplets on their own. [Figure 37B] This shows the distribution of small molecules within the nuclear condensates. Confocal microscopy images are shown illustrating the behavior of Hoechst (Figure 37B) in six types of nuclear condensates formed in vitro in 125 mM NaCl and 10% PEG. [Figure 37C]This shows the distribution of small molecules within the nuclear condensates. Confocal microscopy images (Figure 37C) show the behavior of 4.4 kDa dextran in six types of nuclear condensates formed in vitro in 125 mM NaCl and 10% PEG. Quantitative results are shown on the right, and error bars represent SEM results. Both Hoechst and dextran diffuse freely through the tested condensates without exclusion or enrichment. A schematic diagram of the assay is shown at the top. [Figure 37D] This shows the distribution of small molecules within the nuclear condensate. Confocal microscopy images of fluorescently labeled 4.4 kDa, 10 kDa, 40 kDa, and 70 kDa dextran in MED1 condensates are shown. Experiments were performed using dextran labeled with 10 μM protein and 0.1 mg / ml TRITC in 125 mM salt and 16% Ficol. Smaller dextran sizes (4.4 kDa and 10 kDa) can freely diffuse through the condensate, while larger dextran sizes (40 kDa and 70 kDa) are partially excluded from the MED1 condensate. This indicates that the effective pore size of the condensate studied is at least 10 kDa. [Figure 38A] This demonstrates that the properties of the small molecule drug, rather than its fluorescence portion, govern its distribution within the condensate. Confocal microscopy of an in vitro droplet formation assay using only the indicated small molecule drugs (cisplatin, FLTX1, THZ1, mitoxantrone, and JQ1), without any added proteins to the reactants, is shown. The small molecule drugs alone all exhibit scattered fluorescence signals, indicating that they do not form droplets on their own. [Figure 38B] This demonstrates that the properties of the small molecule drug, rather than its fluorescence portion, govern its distribution within the condensate. Confocal microscopy shows enrichment of ROX and Texas Red into MED1 droplets formed in 125 mM NaCl and 10% PEG. Neither of the two dyes used on the visualized drugs enriched the MED1 condensate. [Figure 38C]This demonstrates that the properties of the small molecule drug, rather than its fluorescence, govern its distribution within the condensate. A schematic diagram of an in vitro drug eviction experiment is shown. Labeled cisplatin is added to a MED1 droplet to form a MED1 droplet concentrated with cisplatin-TR. Unlabeled transplatin or unlabeled cisplatin is added to the droplet mixture, and the amount of labeled cisplatin-TR remaining in the droplet is measured after eviction. Transplatin (a clinically ineffective trans isomer of cisplatin) cannot eviction cisplatin-TR, but high concentrations of unlabeled cisplatin can. [Figure 38D] This demonstrates that the properties of the small molecule drug, rather than its fluorescence, govern its distribution within the condensate. A schematic diagram of an in vitro drug displacement experiment from a droplet is shown. A graph showing the enrichment of FLTX1 into the MED1 droplet upon tamoxifen addition, as measured by confocal microscopy, is also shown. Tamoxifen was able to displace FLTX1 from the MED1 droplet. All error bars shown represent SEM data. [Figure 39A] This demonstrates that small molecule drugs can be concentrated 100-fold within MED1 condensates. Quantitative phase-contrast microscopy of MED1 droplets formed in 125 mM NaCl and 10% PEG is shown. The color bar indicates the optical phase delay (φ) in degrees. From the phase images, the average MED1 concentration in each condensate was calculated. [Figure 39B] This demonstrates that small molecule drugs can be concentrated 100-fold within MED1 condensates. Graphs show the MED1 concentrations in in vitro droplets with no drug added, with 5 μM cisplatin added, or with 50 μM mitoxantrone added. Data points represent the population mean (individual condensates of n=272, 115, and 85 for each condition). Error bars represent the standard deviation. [Figure 39C]This shows that small molecule drugs can be concentrated 100-fold within the MED1 condensate. Different concentrations of cisplatin or mitoxantrone were added to MED1 droplets, and the concentrations of the drugs remaining in the solution were measured by UV spectroscopy. Combining the spectroscopic measurements with the estimated total volume of the MED1 condensate phase obtained from the measurements in Figure 39B, it was estimated that the distribution ratio of cisplatin was up to 600-fold and that of mitoxantrone was approximately 100-fold. [Figure 40A] This shows the association of drug targets with transcription condensates. Immunofluorescence of MED1, HP1α, CDK7, ER, and BRD4 is shown along with MYC RNA FISH. CDK7, ER, and BRD4 are found at the bright spots of MYC, consistent with the finding that MED1, a marker of transcription condensates, is present at the bright spots of the MYC oncogene. These results reproduce the results obtained by ChIP-Seq at this locus. In contrast, the signal for HP1α, a marker of heterochromatin condensates, is not found in MYC. Analysis of mean and random images is shown on the right. [Figure 40B] This diagram illustrates the association of drug targets with transcription condensates. A schematic diagram (top) of an in vitro droplet assay showing the mixing of nuclear condensate proteins (MED1 or HP1α) with various drug target proteins (CDK7, ER, or BRD4) is shown, along with distribution into the nuclear condensate as measured by confocal microscopy. (Center) In vitro droplet assay using MED1, ER, HP1α, and BRD4 at 10 μM, and CDK7 at 200 nM. Droplets are formed in 125 mM NaCl, 10% PEG, and droplet formation buffer. All drug targets tested were enriched into the MED1 condensate. ER was found to enrich into the MED1 and HP1α condensates, consistent with previous reports and ER's ability to associate with coactivators and corepressors. (Bottom) Quantification of target protein enrichment into the condensates shown. Error bars represent SEM. [Figure 41]This image shows the distribution behavior of various small molecule drugs within the mediator complex. Confocal microscopy images of drugs (THZ1, mitoxantrone, cisplatin, FLTX1, fluorescein, and 4.4 kDa dextran) in condensates of the mediator complex. The mediator was imaged in bright-field, and the small molecules were imaged using channels that emit fluorescence. Experiments were performed in 10% PEG and 125 mM NaCl. The distribution behavior of various small molecule drugs within the mediator complex replicates the distribution behavior of drugs within the MED1 condensate. Quantification of enrichment is shown on the right, and error bars represent SEM results. [Figure 42] This image shows the distribution behavior of various small molecule drugs into MED1 condensates formed in Ficol. Confocal microscopy images of the enrichment behavior of small molecule drugs (THZ1, mitoxantrone, cisplatin, FLTX1, fluorescein, and JQ1) into MED1 condensates in the presence of 125 mM NaCl and 20% Ficol. The distribution behavior of the small molecules is similar regardless of the crowder used to form the MED1 droplets. Quantification of enrichment is shown on the right, with error bars representing SEM results. [Figure 43] Figures 43A and 43B demonstrate the high mobility of cisplatin molecules within the MED1 droplet. Figure 43A shows confocal microscopy images of photobleaching-fluorescence recovery (FRAP) of TR-cisplatin and MED1 in condensates formed using 5 μM TR-cisplatin and 10 μM protein in the presence of 125 mM NaCl and 10% PEG. Figure 43B shows the quantification of FRAP (error bars represent SEM). [Figure 44A] This shows that specific chemical moieties govern the concentration of MED1 condensates. This is a description of a low-molecular-weight borondipyromethene (BODIPY) library. [Figure 44B]This shows that a specific chemical moiety governs the concentration within the MED1 condensate. The fluorescence intensity of the probe library within the MED1 droplet, measured by confocal microscopy, is shown. Experiments were performed in 125 mM NaCl and 10% PEG using 10 μM MED1 and 1 μM small molecules. Fluorescence of the BODIPY molecule alone is highlighted in red. [Figure 44C] This study demonstrates that specific chemical moieties govern the concentration of MED1 condensates. The fluorescence intensities of 18 randomly selected probes from the library are shown in the absence of the MED1 protein, demonstrating that they exhibit similar fluorescence intensities. [Figure 44D] This shows that specific chemical moieties govern the concentration of MED1 condensates. The top 5 (left) and bottom 5 (right) moieties ranked by fluorescence intensity, along with the R2 and R1 side chains, are shown. [Figure 45A] This study demonstrates that aromatic residues in MED1 contribute to the distribution of small molecules into MED1 condensates, but are not necessarily required for condensate formation. Confocal microscopy images of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 nuclear condensates formed in 125 mM NaCl and 10% PEG, along with a 5 μM small molecule probe that ranked highest in fluorescence intensity within the MED1 condensates, are shown. The probe was particularly concentrated within the MED1 condensates, indicating that the chemical characteristics of the probe selectively interact with those of the MED1 condensates. The top-ranking probes concentrated within the MED1 condensates showed preference for BODIPY molecules modified with aromatic rings, suggesting that the π system may contribute to the interaction between small molecules and MED1. [Figure 45B]This study demonstrates that aromatic residues in MED1 contribute to the distribution of small molecules into MED1 condensates, but are not necessarily required for condensate formation. A schematic diagram of the MED1 IDR mutant protein is shown. The π system governs the interactions of supramolecular assemblies, where π-π or π-polar interactions play a significant role. To investigate whether these interactions govern the distribution of small molecules into MED1 condensates, and prompted by the discovery that MED1 IDR is rich in aromatic and basic amino acid residues compared to other proteins studied here, aromatic mutants of MED1 IDR (all 30 aromatic residues changed to alanine) and basic mutants of MED1 IDR (all 114 basic residues changed to alanine) were created. [Figure 45C] This study demonstrates that aromatic residues of MED1 contribute to the distribution of small molecules into MED1 condensates, but are not necessarily required for condensate formation. In Figure 45C, the ability of MED1 mutants to form droplets was tested by confocal microscopy using wild-type MED1, basic MED1 mutant (all basic amino acids substituted with alanine), and aromatic MED1 mutant (all aromatic amino acids substituted with alanine) in the presence of 125 mM NaCl and 10% PEG. The basic MED1 mutant showed impaired ability to form droplets in vitro. This indicates that basic residues of MED1 are required for homotype interactions that govern droplet formation. The aromatic MED1 mutant formed droplets similarly to those of the wild-type MED1 protein. [Figure 45D] This study demonstrates that aromatic residues in MED1 contribute to the distribution of small molecules into MED1 condensates, but are not necessarily required for condensate formation. It also shows the role of MED1 aromatic residues in the uptake of aromatic small molecule probes. Confocal microscopy images and quantification of top-hit BODIPY probes in addition to MED1 or MED1 aromatic mutants show a significant reduction in the distribution behavior of aromatic probes into MED1 aromatic mutant droplets. Experiments were performed using 10 μM protein and 5 μM small molecules in 10% PEG and 125 mM NaCl. [Figure 45E]This study demonstrates that aromatic residues of MED1 contribute to the distribution of small molecules into MED1 condensates, but are not necessarily required for condensate formation. Confocal microscopy images and quantitative analysis of cisplatin in addition to MED1 or MED1 aromatic mutants are shown, indicating a significant reduction in the distribution behavior of cisplatin within MED1 aromatic mutant droplets. Experiments were performed in 10% PEG and 125 mM NaCl using 10 μM protein and 5 μM cisplatin-TR. In summary, these results suggest that the π system contributes to the distribution of small molecules into MED1 condensates. All error bars represent SEM. [Figure 46] This shows that DNA can be compartmentalized and enriched within nuclear condensates. (Top) A schematic diagram of a droplet assay showing proteins, DNA, and cisplatin mixed under droplet-forming conditions and then centrifuged to separate the droplet phase from the dilute phase. The amount of DNA in the two phases is then measured using a bioanalyzer. DNA is enriched in the MED1 and HP1α droplet phase (left) compared to the MED1 and HP1α dilute phase (right). [Figure 47A] This demonstrates that the concentration of small molecules within specific condensates can influence target binding. HCT116 cells were treated with DMSO or 50 μM cisplatin for 6 hours, followed by immunofluorescence of cisplatin. The antibody recognized only platinum-enhanced DNA in cisplatin-treated cells, supporting antibody specificity. [Figure 47B] This demonstrates that the concentration of small molecules within specific condensates can influence target binding. (Left) Shows that HCT116 cells tagged with mEGFP-MED1 treated with JQ1 for 24 hours result in a reduction of MED1 condensates. (Right) Metaplot of MED1 ChIP-Seq in HCT116 cells treated with DMSO versus JQ1. [Figure 47C]This study demonstrates that the concentration of small molecules within specific condensates can influence target binding. To determine whether a decrease in MED1 condensates leads to a decrease in DNA platinumization at the MYC locus, cells were treated with JQ1, followed by cisplatin. MYC DNA FISH and MED1 immunofluorescence showed a loss of signal in platinumized DNA after JQ1 treatment. This suggests that the presence of MED1 condensates contributes to DNA platinumization at this locus. [Figure 47D] This demonstrates that the concentration of small molecules within specific condensates can affect target binding. (Left) MED1 ChIP-Seq track in MYC in HCT116 cells treated with DMSO or JQ1, showing loss of MED1 load after JQ1 treatment. (Right) Quantification of cisplatin IF signal at MYC DNA FISH focus in HCT116 cells treated with DMSO or JQ1. Error bars represent SEM. [Figure 48A] This shows the genotyping of endogenously tagged cell lines. A schematic image of mEGFP-tagged (MED1) cells in HCT116 colon cancer cells (Figure 48A) and genotyping on an agarose gel are shown. [Figure 48B] This shows the genotyping of endogenously tagged cell lines. A schematic image of mEGFP-tagged (Figure 48B) HP1α in HCT116 colon cancer cells and genotyping on agarose gel are shown. [Figure 48C] This shows the genotyping of endogenously tagged cell lines. A schematic image of mEGFP-tagged (FIB1) cells in HCT116 colon cancer cells (Figure 48C) and genotyping on an agarose gel are shown. [Figure 48D] This shows the genotyping of endogenously tagged cell lines. A schematic image of mEGFP-tagged (Figure 48D) NPM1 cells in HCT116 colon cancer cells and genotyping on agarose gel are shown. [Figure 48E] This shows the genotyping of endogenously tagged cell lines. Agarose gels expressing FIB1 and NPM1 are also shown. [Figure 48F] This shows the genotyping of endogenously tagged cell lines. A schematic image of mEGFP-tagged (Figure 48F) BRD4 in HCT116 colon cancer cells and genotyping on agarose gel are shown. [Figure 48G] This shows the genotyping of endogenously tagged cell lines. A schematic image of mEGFP-tagged (SRSF2) in HCT116 colon cancer cells (Figure 48G) and genotyping on an agarose gel are shown. [Figure 49A] This demonstrates the highly dynamic nature of intracellular nuclear condensates. FRAP of mEGFP-tagged (Figure 49A) MED1 cells in the HCT116 cell line (error bars represent SEM) (n=7). [Figure 49B] This demonstrates the highly dynamic nature of intracellular nuclear condensates. FRAP of mEGFP-tagged (Figure 49B) HP1α in the HCT116 cell line (error bars represent SEM) (n=7). [Figure 50A] This shows the lysis of MED1 condensates in cells during prolonged cisplatin treatment. It shows HCT116 cells with GFP-tagged MED1, treated with DMF or 50 μM cisplatin for 3, 6, or 12 hours. Quantification is shown on the right, and error bars represent standard deviation (SD). [Figure 50B] This shows the lysis of MED1 condensates in cells during prolonged cisplatin treatment. It also shows a cell viability assay of GFP-MED1-expressing HCT116 cells treated with DMF or 50 μM cisplatin for 12 hours. [Figure 51] The effects of cisplatin on various nuclear condensates are shown. Figure 24 shows HCT116 cells containing one of the following GFP-tagged endogenously: MED1, BRD4, HP1α, FIB1, NPM1, or SRSF2, treated with 50 μM cisplatin for 12 hours. Consistent with the selective enrichment of cisplatin and BRD4 within the MED1 condensate, cisplatin specifically disrupts the MED1 and BRD4 condensates. [Figure 52]This graph shows the reduction in genomic occupancy by MED1 after cisplatin treatment. The graph shows MED1 ChIP-seq after 6 hours of treatment with DMSO or 50 μM cisplatin. Genomic-level MED1 binding decreases after cisplatin treatment. [Figure 53A] This section characterizes MED1 condensates in MCF7 cells. Western blots of MED1 in MCF7 cells and MCF cells infected with the MED1-mEGFP lentiviral vector are shown. [Figure 53B] This shows the characterization of MED1 condensates in MCF7 cells. It also shows the FRAP of MED1-mEGFP in MCF7 cells expressing this fusion protein via a lentiviral vector. Quantitative results are shown on the right, and the black bars represent the 95% confidence interval of the best fit line. [Figure 53C] This document characterizes MED1 condensates in MCF7 cells. MCF7 cells expressing MED1-mEGFP were grown under estrogen-free conditions, then stimulated with 100 nM estrogen for 15 minutes, and imaged using a confocal fluorescence microscope for 4 minutes. [Figure 53D] This section characterizes MED1 condensates in MCF7 cells. Figure 53C shows the quantitative determination of the size and intensity of the fused MED1 condensates. [Figure 54A] This shows estrogen and tamoxifen-dependent MED1 condensate formation in the MYC oncogene. DNA FISH and immunofluorescence are shown in estrogen-deficient MCF7 cells treated with 100 nM estrogen or 100 nM estrogen and 5 μM tamoxifen for 24 hours. Analysis of mean and random images is shown on the right. [Figure 54B] This shows estrogen and tamoxifen-dependent MED1 condensate formation in the MYC oncogene. RT-qPCR showing relative expression of MYC RNA in estrogen-stimulated, estrogen- and estrogen- and tamoxifen-treated, and estrogen-deficient MCF7 cells is also shown. Error bars represent SEM results. [Figure 55]This shows that FLTX1 is enriched within intracellular MED1 condensates. (Left) Schematic diagram of MED1 or HP1α anchored to LAC sequences in U2OS cells that produce MED1 or HP1α condensates. (Center) Representative image of isolated U2OS cell nuclei exposed to FLTX1, containing either MED1 or HP1α anchored to LAC sequences. An enlarged image of the LAC sequence is shown in an inset, and a merged image is shown on the right. (Right) Quantification of FLTX1 enrichment in LAC sequences to which either MED1 or HP1α is anchored. Error bars represent SEM. ESR1 is not expressed in this osteosarcoma cell line. [Figure 56] This shows hormone therapy-resistant ESR1 mutations obtained from patients. The plot of ER mutation frequencies obtained from a set of 220 patients from the cBioPortal database shows the locations of ER point mutations with hotspots at 537 and 538. [Figure 57A] This shows the enrichment ratios of ER and ER variants in MED1 droplets. It also quantifies the enrichment ratios of ER or variant ER in MED1 droplets in the presence of estrogen or estrogen and tamoxifen. [Figure 57B] Figures 57A and 57B show the enrichment ratios of ER and ER variants in MED1 droplets. (Left) Representative images of the mutant ER distributed within the MED1 droplet are shown. The enrichment ratios are shown on the right. Both experiments in Figures 57A and 57B are performed in 125 mM NaCl, 10% PEG, 10 μM of each protein, and 100 μM estrogen, with or without 100 μM of the indicated ligand. All error bars represent standard deviation (SD). [Figure 58A] This shows MED1 overexpression in tamoxifen-resistant breast cancer cells. A schematic diagram is shown demonstrating the drug concentration within condensates when condensate volume increases due to overexpression of scaffold proteins. [Figure 58B]This shows MED1 overexpression in tamoxifen-resistant breast cancer cells. Assuming drug restriction in the system, the concentration of the drug in the MED1 droplet is expected to decrease as the condensate volume increases (Figure 58B). Western blots of MED1 and actin in MCF7 cells (tamoxifen-sensitive) and TAMR7 cells (tamoxifen-resistant derivatives of MCF7) show higher MED1 levels in TAMR7 cells. The quantification of Western blots, which is the average of three experiments, is shown below. [Figure 58C] This shows MED1 overexpression in tamoxifen-resistant breast cancer cells. It also shows the volume and number of MED1 condensates per nucleus, and quantification of MED1 condensates in tamoxifen-sensitive and resistant cell lines. [Figure 59] Figures A and B show the increase in MED1 condensate size with increasing MED1 concentration. Figure 59A shows the droplet size in pixels of an in vitro droplet assay performed using 5 μM (low) or 20 μM (high) MED1-GFP in 125 mM NaCl and 10% PEG. Quantitative values are shown to the right, and error bars represent standard deviation (SD). Figure 59B shows a schematic phase diagram of MED1, demonstrating that as the total concentration of MED1 increases, the protein concentration in the droplet phase is maintained while the droplet size increases. [Figure 60]Figure 60 (left) shows a schematic diagram of the Lac sequence assay. U2OS cells with 50,000 copies of Lac binding sites are transfused with a construct expressing the DNA-binding domain (DBD) of Lac fused to the ligand-binding domain (LBD) of the estrogen receptor. When the transcription machinery is recruited to that site, the mediator condensate can be detected by immunofluorescence. (center) U2OS-Lac cells were transfused with a construct overexpressing construct + / -MED1 expressing the DBD of Lac fused to the LBD of the ER and GFP. The cells were grown in estrogen-depleted medium, treated with 10 nM estrogen + / - 10 nM tamoxifen, then fixed and subjected to MED1 IF. The upper panel shows the location of the ER-LBD in the Lac sequence, and the lower panel shows the MED1 IF. The inserted image shows a magnified view. (Right side) Quantification of relative MED1 enrichment in the Lac sequence. Error bars represent standard deviation (SD). [Figure 61A] An in silico model illustrating the distribution of small molecules within a condensate is presented. To demonstrate the behavior of small molecule drugs binding to targets contained within the condensate, a simple model was developed in which both the drug and the target are contained within the condensate, with percentage target binding as readable information. In this model, target distribution is unaffected by drug binding. Figure 61A shows a table of values used to construct the model of drug binding within the condensate, obtained from known values for ER and tamoxifen. The volume percentage values of the condensate were obtained from the analysis of MED1 IF in human ER + breast cancer biopsies. [Figure 61B] An in silico model illustrating the distribution of small molecules within a condensate is shown. Binding to the target as a function of drug concentration in the simulation is also shown. The dashed line represents the system where the target and drug diffuse freely through the cell. The red and blue lines represent the system where the target and drug are concentrated within the condensate. The blue line represents target binding within the condensate where the drug and target are concentrated, while the red line represents target binding in the dilute phase of the nucleoplasm. Overall, these data indicate that, at a given concentration, the drug binds to a higher percentage of target molecules inside the condensate compared to outside. [Figure 61C]An in silico model illustrating the distribution of small molecules into a condensate is shown. The proportion of bound targets at a given concentration of the drug and at various distribution coefficients of the drug are shown. The dotted line represents target binding under diffusion conditions. Overall, this simulation shows that as the distribution coefficient of the drug into the condensate increases, the percentage of bound targets at a given concentration increases. [Figure 61D] An in silico model illustrating the distribution of small molecules within condensates is shown. Target binding by the drug is shown in a larger condensate setting. Simulations of target binding as a function of drug concentration are shown for a normal condensate volume (2% of the nuclear volume) versus a larger condensate volume (4% of the nuclear volume). Diffusion control is shown by a dashed line. Overall, these data suggest that the effect of a drug on binding to its target may be lower in larger condensates. [Modes for carrying out the invention]
[0036] Detailed description of the invention Unless otherwise specified, the implementation of this invention will typically involve the use of prior art in cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant nucleic acid (e.g., DNA) technology, immunology, and RNA interference (RNAi), which are within the scope of the skills of those skilled in the art. Some non-exclusive descriptions of these techniques can be found in the following publications: Ausubel, F., et al., (eds.), Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, all John Wiley & Sons, NY (as of December 2008); Sambrook, Russell, and Sambrook, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001; Harlow, E. and Lane, D., Antibodies - A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988; Freshney, RI, “Culture of Animal Cells, A Manual of Basic Technique”, 5th ed., John Wiley & Sons, Hoboken, NJ, 2005. Non-limiting information regarding therapeutics and human diseases can be found in Goodman and Gilman's *The Pharmacological Basis of Therapeutics*, 11th edition, McGraw Hill, 2005, and Katzung, B. (ed.) *Basic and Clinical Pharmacology*, McGraw-Hill / Appleton & Lange; 10th edition (2006) or 11th edition (July 2009).Non-limiting information on genes and genetic disorders can be found in McKusick, VA: Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore: Johns Hopkins University Press, 1998 (12th edition), or in the following more recent online databases: Online Mendelian Inheritance in Man, OMIM®. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD) (as of May 1, 2010), ncbi.nlm.nih.gov / omim / , and Online Mendelian Inheritance in Animals (OMIA) (a database of genes, genetic disorders, and genetic traits in animal species other than humans and mice), omia.angis.org.au / contact.shtml. All patents, patent applications, and other publications (e.g., scientific articles, books, websites, and databases) described herein are incorporated in their entirety by reference. In the event of any conflict between this specification and any of the incorporated references, this specification (including any modifications thereto that may be made based on the incorporated references) shall prevail. Unless otherwise specified, the standard meanings of terms accepted in the art are used herein. Standard abbreviations for various terms are used herein.
[0037] The inventors have surprisingly discovered that some drugs are incorporated into condensates that do not contain their targets. (See Figure 22.) This has significant derivative effects on drug efficacy. For example, drug efficacy may be lower if the drug is sequestered within the condensate and interaction with its target is prevented. Alternatively, drug efficacy may be lower if the condensate prevents the drug from accessing its target. This phenomenon may help explain why some candidate drugs show high activity against therapeutic targets in vitro but not the same activity in cells or organisms. This may also explain the surprising observation that inhibition of global gene regulators such as BRD4 or CDK7 can selectively affect oncogenes that have acquired long super-enhancers. Selective distribution of inhibitors such as JQ1 and THZ1 into super-enhancer condensates would preferentially disrupt transcription at those loci. Furthermore, the inventors have surprisingly discovered that the condensates enrich some clinically important small molecule cancer drugs in such a way that their pharmacodynamic properties are altered. Therefore, condensates can concentrate low-molecular-weight substances, thereby directing their biological activity.
[0038] Accordingly, several aspects of the present invention relate to a method for characterizing a drug, comprising contacting the drug with a composition (e.g., a solution) containing a condensate having at least one component, and measuring the uptake of the drug into the condensate. In some embodiments, the method further comprises determining whether the drug is a therapeutic candidate based on whether both the target and the drug are present at effective concentrations either inside or outside the condensate in a suitable cell. In some embodiments, the method further comprises characterizing a plurality of drugs (e.g., candidate drugs) and selecting one or more lead drugs having a desired or optimal condensate distribution profile (e.g., concentrating in the condensate of a suitable cell if the drug target is inside the condensate, or concentrating outside the condensate if the drug target is outside the condensate). As used herein, the term “drug” means any compound or substance, e.g., but not limited to small molecules, nucleic acids, polypeptides, peptides, drugs, ions, etc. "A drug" can be any chemical substance, entity, or part, including, but not limited to, synthetic proteinaceous and non-proteinaceous entities, as well as naturally occurring proteinaceous and non-proteinaceous entities. In some embodiments, the drug is nucleic acid, nucleic acid analog, protein, antibody, peptide, aptamer, and, but not limited to, proteins, oligonucleotides, ribozymes, DNA enzymes, glycoproteins, siRNA, lipoproteins, aptamers, nucleic acid, amino acid, or carbohydrate oligomers, as well as modifications and combinations thereof. In some embodiments, the drug is selected from the group consisting of nucleic acids, small molecules, polypeptides, and peptides. In certain embodiments, the drug is a small molecule having a chemical moiety. For example, chemical moieties include unsubstituted or substituted alkyl moieties, aromatic moieties, or heterocyclyl moieties, including macrolides, leptomycin, and related natural products or analogs thereof. The compound may be known to have the desired activity and / or properties, or it may be selected from a diverse library of compounds. In some embodiments, the drug is small enough to diffuse into the condensate.In some embodiments, the agent has a concentration of less than approximately 4.4 kDa. In some embodiments, the agent has a distribution coefficient of at least 100, 150, 200, 300, 350, 400, 450, 500, 550, 600, 650, 700, or greater for the condensates described herein. In some embodiments, the agent has a distribution coefficient of less than approximately 10, 20, 50, 100, 150, 200, 300, 350, 400, 450, 500, 550, or 600 for the condensates described herein.
[0039] In some embodiments, the drug is a low molecular weight. The term “low molecular weight” refers to an organic molecule with a mass of less than about 2 kilodaltons (kDa). In some embodiments, the low molecular weight is less than about 1.5 kDa or less than about 1 kDa. In some embodiments, the low molecular weight is less than about 800 daltons (Da), 600 Da, 500 Da, 400 Da, 300 Da, 200 Da, or 100 Da. Often, the low molecular weight has a mass of at least 50 Da. In some embodiments, the low molecular weight is a non-molecular weight. In some embodiments, the low molecular weight is not an amino acid. In some embodiments, the low molecular weight is not a nucleotide. In some embodiments, the low molecular weight is not a sugar. In some embodiments, the low molecular weight may contain multiple carbon-carbon bonds and one or more functional groups important for structural interactions (e.g., hydrogen bonding) with one or more heteroatoms and / or proteins, such as amine, carbonyl, hydroxyl, or carboxyl groups, and in some embodiments, at least two functional groups. The low molecular weight often contains one or more carbocyclic or heterocyclic structures and / or aromatic or polyaromatic structures, optionally substituted with one or more of the above functional groups. In some embodiments, the low molecular weight contains at least one, at least two, at least three, or more aromatic side chains.
[0040] In some embodiments, the drug is a protein or polypeptide. The term “polypeptide” refers to a polymer of amino acids linked by peptide bonds. A protein is a molecule containing one or more polypeptides. Peptides are relatively short-chain polypeptides, typically about 2 to 100 amino acids (aa) in length, e.g., 4 to 60aa; 8 to 40aa; 10 to 30aa. The terms “protein,” “polypeptide,” and “peptide” can be used interchangeably. Generally, polypeptides may contain only standard amino acids, or one or more non-standard amino acids (which may be naturally occurring or unnatural amino acids) and / or, in various embodiments, amino acid analogs. “Standard amino acids” are any of the 20 L-amino acids commonly used in the synthesis of proteins by mammals and encoded by the genetic code. “Non-standard amino acids” are amino acids not commonly used in the synthesis of proteins by mammals. Non-standard amino acids include naturally occurring amino acids (other than the 20 standard amino acids) and unnatural amino acids. Amino acids, for example, one or more amino acids in a polypeptide, can be modified by covalent bonds, for example, by addition, or by partial addition, for example, by alkyl groups, alkanoyl groups, carbohydrate groups, phosphate groups, lipids, polysaccharides, halogens, linkers for conjugation, protecting groups, or low molecular weight groups (e.g., fluorophores). In some embodiments, the agent is a protein or polypeptide containing at least five, at least ten, at least fifteen, at least twenty, at least twenty-five, at least thirty, or more aromatic amino acids.
[0041] In some embodiments, the drug consists of or contains DNA or RNA.
[0042] In some embodiments, the drug is a peptide mime. The terms “mimicking,” “peptide mime,” and “peptide mimetic” are used interchangeably herein and generally refer to peptides, partial peptides, or non-peptide molecules that mimic the tertiary bond structure or activity of a selected native peptide or protein functional domain (e.g., binding motif or active site). These peptide mimes include recombinantly modified or chemically modified peptides, and non-peptide drugs, such as small molecule drug mimes.
[0043] The drug may be a known drug. The type of drug is not limited and may be any suitable drug. In some embodiments, the drug may be an anticancer drug. In some embodiments, the known drug is for treating a human disease or condition.
[0044] In some embodiments, the drug is a chemotherapeutic agent or a derivative thereof. In some embodiments, the chemotherapeutic agent is actinomycin D, aldesleukin, alitretinoin, all-trans retinoic acid / ATRA, altretamine, amsacrin, asparaginase, azacitidine, azathioprine, Bacillus calmette-Guérin / BCG, bendamustine hydrochloride, bexarotene, bicalutamide, bleomycin, bortezomib, busulfan, capecitabine, carboplatin, carfilzomib, carmustine, chlorambucil, cisplatin / Cithplatin Suplatinum, cladribine, cyclophosphamide / cytophosphan, cytabarine, dacarbazine, daunorubicin / daunomycin, denileukin difutitox, dexrazoxane, docetaxel, doxorubicin, epirubicin, etoposide, fludarabine, fluorouracil (5-FU), gemcitabine, goserelin, hydrocortisone, hydroxyurea, idarubicin, ifosfamide, interferon α, irinotecan (CPT-11) Lapatinib, lenalidomide, leuprolide, mechloretamine / chlormethine / mustine / HN2, mercaptopurine, methotrexate, methylprednisolone, mitomycin, mitotane, mitoxantrone, octreotide, oprelbequine, oxaliplatin, paclitaxel, pamidronate, pegaspargase, pegfilgrastim, PEG interferon, pemetrexed, pentostatin, phenylalanine mustard, plicamycin / mitramycin The drugs are selected from prednisone, prednisolone, procarbazine, raloxifene, romiplostim, salglamostim, streptozosin, tamoxifen, temozolomide, temsirolimus, teniposide, thalidomide, thioguanine, thiophosphoamide / thiotepa, thiotepa, topotecan hydrochloride, toremifene, tretinoin, barrubicin, vinblastine, vincristine, vindesine, vinorelbine, vorinostat, zoledronic acid, and combinations thereof. In some embodiments, the drug is cisplatin or a derivative thereof, or comprises it.In some embodiments, the agent is JQ1(2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-yl)acetate(S)-tert-butyl) or a derivative thereof. In some embodiments, the agent is tamoxifen or a derivative thereof.
[0045] In some embodiments, the drug comprises a protein transduction domain (PTD). A PTD, or transcellular peptide (CPP), is a peptide or peptoid that can cross the plasma membrane of many, though not all, mammalian cells. PTDs can either bind to the PTD or enhance the uptake of a portion present within the PTD. Often, such peptides are arginine-rich. For example, PTDs of the Tat protein from human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2) have been extensively studied and used to transport cargo into mammalian cells. See, for example, Fonseca SB, et al., Adv Drug Deliv Rev., 61(11):953-64, 2009; Heitz F, et al., Br J Pharmacol., 157(2):195-206, 2009, incorporated herein by reference, and any of the references above. In some embodiments, the transcellular peptide is HIV-TAT.
[0046] In some embodiments, the drug can bind to a target. In some embodiments, the target is present in a composition containing a condensate. In some embodiments, the target is primarily present outside the condensate (e.g., at least 51%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, or more). In some embodiments, the concentration of the target outside the condensate is at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 50 times, at least 100 times, or more, compared to the concentration of the target inside the condensate. In some embodiments, the target is primarily present within the condensate (e.g., at least 51%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99%, or more). In some embodiments, the concentration of the target within the condensate is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 50, at least 100, or more than the concentration of the target outside the condensate.
[0047] In some embodiments, the agent is a candidate agent as described herein. In some embodiments, the agent is obtained from an agent modified to regulate its uptake into the condensate of interest. In some embodiments, the agent is obtained by coupling or linking a first agent and a second agent as described herein.
[0048] As shown in the following examples, it has been found that molecules having aromatic rings are preferentially concentrated in the MED1 condensate. Therefore, in some embodiments, the agent is modified to increase or decrease the number of aromatic rings. In some embodiments, the agent is modified to increase the number of aromatic rings by at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 35, about 40, about 45, about 50, or more. In some embodiments, the drug (e.g., consisting of or containing a small molecule) is modified to include at least one or at least two or more aromatic rings, as shown by the R1 and R2 groups provided in Figure 44A. In some embodiments, the drug (e.g., consisting of or containing a small molecule) is modified to include at least one or at least two or more aromatic rings selected from the components M66, K19, M101, M195, K18, M103, and M66 shown in Figure 44A. In some embodiments, the drug (e.g., consisting of or containing a small molecule) is modified to include at least two or three structures, as shown in each row below the “Top 5 Probes” provided in Figure 44D.
[0049] In some embodiments, the drug consists of or comprises a peptide, polypeptide, or protein, and the number of aromatic rings is increased by the substitution of one or more non-aromatic amino acid residues with aromatic amino acid residues (e.g., phenylalanine, tryptophan, tyrosine, and / or histidine). In some embodiments, the drug consists of or comprises a peptide, polypeptide, or protein, and the number of aromatic rings is increased by the addition of one or more aromatic amino acids. In some embodiments, the aromatic amino acid residue is not histidine. In some embodiments, the aromatic amino acid residue is phenylalanine. In some embodiments, the aromatic amino acid residue is a non-natural or non-standard amino acid residue (e.g., L-DOPA (l-3,4-dihydroxyphenylalanine)).
[0050] In some embodiments, the drug consists of or comprises a peptide, polypeptide, or protein, the number of aromatic rings being reduced by the substitution of one or more aromatic amino acids with non-aromatic amino acids (e.g., alanine). In some embodiments, the number of aromatic rings is reduced by the removal or modification of one or more aromatic amino acids.
[0051] In some embodiments, the number of aromatic rings is reduced by the removal, modification, and / or substitution of two or more aromatic amino acids.
[0052] In some embodiments, the modified agent has increased affinity for condensates (e.g., transcription condensates, heterochromatin condensates, splicing speckle condensates, nucleolus, chromatin condensates, Polycomb condensates, DNA damage repair condensates, or condensates physically associated with mRNA initiation or elongation complexes). In some embodiments, the modified agent has increased affinity for condensates containing specific condensate components (e.g., mediators, mediator components, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α). In some embodiments, the modified agent has increased affinity for condensates containing specific mediator components or multiple mediator components (e.g., MED1). In some embodiments, the condensate contains condensate components having one or more aromatic side chains (e.g., MED1). In some embodiments, the modified agent has at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 50 times, and at least 100 times higher affinity for the condensate than the corresponding unmodified agent.
[0053] In some embodiments, the modified agent has a reduced affinity for condensates (e.g., transcription condensates, heterochromatin condensates, splicing speckle condensates, nucleolus, chromatin condensates, Polycomb condensates, DNA damage repair condensates, or condensates physically associated with mRNA initiation or elongation complexes). In some embodiments, the modified agent has a reduced affinity for condensates containing specific condensate components (e.g., mediators, mediator components, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α). In some embodiments, the modified agent has a reduced affinity for condensates containing specific mediator components or multiple mediator components (e.g., MED1). In some embodiments, the condensate contains condensate components having one or more aromatic side chains. In some embodiments, the modified agent has at least half, at least one-third, at least one-quarter, at least one-fifth, at least one-sixth, at least one-seventh, at least one-eighth, at least one-ninth, at least one-tenth, at least one-twentieth, at least one-fiftieth, and at least one-hundredth the affinity for condensates compared to the corresponding unmodified agent.
[0054] In some embodiments, the modified agent has an affinity for the second agent. In some embodiments, the modified agent can increase the concentration or amount of the second agent in the condensate by at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 50, at least 100, or more, compared to the concentration or amount of the second agent in the condensate in the absence of the modified agent. In some embodiments, the modified agent can reduce the concentration or amount of the second agent in the condensate by at least 1 / 2, at least 1 / 3, at least 1 / 4, at least 1 / 5, at least 1 / 6, at least 1 / 7, at least 1 / 8, at least 1 / 9, at least 1 / 10, at least 1 / 20, at least 1 / 50, at least 1 / 100, or less, compared to the concentration or amount of the second agent in the condensate in the absence of the modified agent.
[0055] The target is not limited. In some embodiments, the target is an anti-cancer target. In some embodiments, the target is an enzyme (e.g., oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, kinase, cyclin-dependent kinase, MAPK, phosphatidylinositol kinase, sphingosine kinase, carbohydrate kinase, nucleoside phosphate kinase, nucleoside diphosphate kinase), a receptor (e.g., nuclear receptor), an oncogene, a transcription factor, or a signaling factor. In some embodiments, the target is genomic DNA. In some embodiments, the target is any component described herein.
[0056] As used herein, condensate refers to a phase-separated multimolecular aggregate. In some embodiments, condensate refers to an in vitro condensate (which may be referred to herein as a “droplet”). In some embodiments, the in vitro condensate is artificially prepared in solution by one or more condensate components. In some embodiments, the in vitro condensate includes components that mimic condensates found in cells. In some embodiments, the in vitro condensate is isolated from cells.
[0057] Any suitable means for isolating condensates from cells or compositions are incorporated herein. In some embodiments, condensates are chemically precipitated or immunoprecipitated. In some embodiments, condensates are isolated by centrifugation (e.g., about 5,000xg, 10,000xg, 15,000xg for about 5-15 minutes; about 10,000xg for about 10 minutes). Condensates may be isolated from cells by lysing of the cell nuclei under suitable buffer conditions using a homogenizer (i.e., a dance-type homogenizer), followed by centrifugation and / or filtration to separate the condensates.
[0058] In some embodiments, the condensates are located within cells. The condensates may be naturally occurring condensates. In other embodiments, the condensates may occur in transgenic cells or otherwise manipulated cells. In some embodiments, the condensates may include detectable tags. In some embodiments, the detectable tags are located on the condensate components. In some embodiments, the detectable tags are incorporated into the condensates. The detectable tags (which may also be referred to herein as detectable labels) are not limited and may be any detectable tags described herein. In some embodiments where multiple detectable tags exist, the detectable tags may be detectable in different ways.
[0059] In some embodiments, the condensate may be a transcription condensate, a heterochromatin condensate, a splicing speckle condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, a DNA damage repair condensate, or a condensate physically associated with an mRNA initiation complex or elongation complex. In some embodiments, the condensate may be an in vitro condensate having one or more components of a transcription condensate, a heterochromatin condensate, a splicing speckle condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, a DNA damage repair condensate, or a condensate physically associated with an mRNA initiation complex or elongation complex. In some embodiments, the condensate is physically associated with DNA (e.g., genomic DNA, intracellular genomic DNA). In some embodiments, the condensate, components of the condensate, a drug, or a method for evaluating the characterization of the condensate is described in PCT / US2019 / 023694, filed March 22, 2019 (which is incorporated herein by reference in its entirety). In some embodiments, the condensate (e.g., in vivo condensate, ex vivo condensate, in vitro condensate, or droplet) contains condensate components that are overexpressed in cancer cells resistant to anticancer drugs, and such overexpression is associated with resistance to anticancer drugs. In some embodiments, the amount of condensate components in the condensate overexpressed in cancer cells resistant to anticancer drugs is greater than the amount present in the condensate of cancer cells that do not overexpress those condensate components. In some embodiments, the volume of the condensate containing the condensate components overexpressed in cancer cells resistant to anticancer drugs is greater than the volume of the condensate found in cancer cells that do not overexpress those condensate components.
[0060] In some embodiments, at least one component of the condensate is a mediator, a mediator component, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α. In some embodiments, at least one component is a component of an intranuclear condensate. In some embodiments, at least one component is a component of a superenhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a splicing speckle condensate, a nucleolus, a chromatin condensate, a polycomb condensate, a DNA damage repair condensate, or a functional fragment of such a component. In some embodiments, at least one component is a component of a condensate present in the nucleus or a functional fragment thereof. In some embodiments, at least one component of the condensate includes an intrinsically disordered region (IDR).
[0061] As used herein, “transcription condensate” is a phase-separated multimolecular aggregate that occurs at a transcription site and is a cooperative, high-density assembly of multiple components that may include transcription factors, cofactors (e.g., coactivators), chromatin regulators, DNA, non-coding RNA, nascent RNA, RNA polymerase II, kinases, proteasomes, topoisomerases, and / or enhancers (see Figures 4, 11, and 12). As used herein, “super-enhancer condensate” is a transcription condensate that occurs at a super-enhancer. Super-enhancers are known in the art; see, for example, U.S. Patent Application Publication 20140287932A1, incorporated herein by reference. As used herein, “heterochromatin condensate” is a phase-separated multimolecular aggregate that is physically associated with heterochromatin (e.g., occurs on heterochromatin). Heterochromatin condensates have been shown to be associated with the repression of gene transcription. As used herein, a condensate physically associated with an mRNA start complex or elongation complex is a phase-separated multimolecular aggregate occurring in the relevant complex. In some embodiments, the condensate physically associated with the elongation complex contains splicing factors. In some embodiments, the condensate physically associated with the elongation complex is a splicing speckle. As used herein, a “splicing speckle” (sometimes also referred to as a nuclear speckle or interchromatin granule group) is a condensate rich in splicing factors. See, for example, Y. Chen, A.S. Belmont, Genome organization around nuclear speckles. Curr. Opin. Genet. Dev. 55, 91-99 (2019), incorporated herein by reference. As used herein, a “nucleolus” or “nucleoli” (plural) is a condensate containing RNA and proteins that occurs in the nucleus.See, for example, M. Feric et al., Coexisting Liquid Phases Underlie Nucleolar Subcompartments. Cell. 165, 1686-1697 (2016), incorporated herein by reference. As used herein, “chromatin condensate” is a phase-separated multimolecular aggregate that is physically associated with chromatin. See, as used herein, Gibson et al., Organization of Chromatin by Intrinsic and Regulated Phase Separation. Cell (2019), incorporated herein by reference. As used herein, “Polycomb condensate” is a phase-separated multimolecular aggregate that is physically associated with chromatin and can repress gene transcription. See Plys, et al., Phase separation of Polycomb-repressive complex 1 is governed by a charged disordered region of CBX2, Genes Dev. 2019 Jul 1;33(13-14):799-813, incorporated herein by reference. As used herein, “DNA damage repair condensates” are phase-separated multimolecular aggregates that physically associate with double-strand DNA breaks. See Pessina et al., Functional transcription promoters at DNA double-strand breaks mediate RNA-driven phase separation of damage-response factors, Nature Cell Biology volume 21, pp. 1286-1299 (2019), incorporated herein by reference.
[0062] In some preferred embodiments of the methods disclosed herein, the condensate is a transcription condensate or an in vitro condensate containing one or more components of a transcription condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a super-enhancer condensate or an in vitro condensate containing one or more components of a super-enhancer condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a splicing speckle condensate or an in vitro condensate containing one or more components of a splicing speckle condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a heterochromatin condensate or an in vitro condensate containing one or more components of a heterochromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a nucleolus or an in vitro condensate containing one or more components of a nucleolus. In some preferred embodiments of the methods disclosed herein, the condensate is a chromatin condensate or an in vitro condensate comprising one or more components of a chromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a polycomb condensate or an in vitro condensate comprising one or more components of a polycomb condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a DNA damage repair condensate or an in vitro condensate comprising one or more components of a DNA damage repair condensate.
[0063] As used herein, the terms “condensate components,” etc., refer to peptides, proteins, nucleic acids, signaling molecules, lipids, etc., that are part of a condensate (e.g., transcription condensate, super-enhancer condensate, splicing speckle condensate, heterochromatin condensate, nucleolus, chromatin condensate, Polycomb condensate, or DNA damage repair condensate) or have the ability to become part of a condensate. In some embodiments, components are present within the condensate. In some embodiments, components are necessary for condensate formation or stability. In some embodiments, components are not necessary for condensate formation or stability. In some embodiments, the components are proteins or peptides and include one or more intrinsically disordered domains (e.g., IDRs of the activation domain of a transcription factor, IDRs interacting with the activation domain of a transcription factor, IDRs of signaling factors, IDRs of methylated DNA-binding proteins, IDRs of gene silencing factors, IDRs of polymerases, IDRs of splicing factors, IDRs of small nucleolar ribonucleoproteins, IDRs of nucleophosmins, IDRs of histones, IDRs of CBX2, IDRs of 53BP1). In some embodiments, the components are non-structural members of the condensate (e.g., not required for the integrity of the condensate). In some embodiments, the condensate contains, consists of, or essentially consists of one, two, three, four, five, six, seven, eight, nine, ten, or more components. In some embodiments, the condensate (e.g., in vitro condensate) does not contain nucleic acids. In some embodiments, the condensate (e.g., in vitro condensate) does not contain RNA. In some embodiments, the components are protein or nucleic acid fragments.
[0064] As shown in the following examples, substitution of basic amino acids with alanine in MED1 impaired the ability of mutant MED1 to form droplets (i.e., in vitro condensates) in solution. Therefore, in some embodiments, the condensate components are naturally occurring proteins or polypeptides modified to increase or decrease the number of basic amino acid residues, thereby regulating the ability of the condensate components to form condensates (e.g., droplets). In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or all basic amino acid residues are replaced with non-basic amino acid residues (e.g., alanine or other neutral amino acids, e.g., asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, etc.). In some embodiments, at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more basic amino acid residues are replaced by non-basic amino acid residues. In some embodiments, at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more basic amino acid residues are added to the condensate components.
[0065] In some embodiments, the ability of the modified condensate component to form condensates (e.g., droplets) is reduced to at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 1.2, at least about 1.25, at least about 1.3, at least about 1.5, at least about 1.4, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 1.2, at least about 1.25, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.8, at least about 1.9, at least about 1.2, at least about 1.5 In some embodiments, the ability of the modified condensate component to form condensates (e.g., droplets) is increased by at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 1.6 times, at least about 1.7 times, at least about 1.8 times, at least about 1.9 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 20 times, at least about 50 times, and at least about 100 times compared to the unmodified condensate component.
[0066] As shown in the following examples, substitution of aromatic amino acids with alanine in MED1 impaired the ability of the modified MED1 droplet to incorporate drugs containing aromatic substituents. Therefore, in some embodiments, the condensate components are naturally occurring proteins or polypeptides modified to increase or decrease the number of aromatic amino acid residues, thereby regulating the ability of the condensate components to incorporate drugs containing aromatic substituents. In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or all aromatic amino acid residues are replaced with non-aromatic amino acid residues (e.g., alanine or other neutral amino acids, e.g., asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, etc.). In some embodiments, at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more aromatic amino acid residues are replaced by non-aromatic amino acid residues. In some embodiments, at least one, two, three, four, five, six, seven, eight, nine, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more aromatic amino acid residues are added to the condensate components.
[0067] In some embodiments, the ability of a condensate containing a modified condensate component to incorporate an agent containing an aromatic substituent is reduced to at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 1.2, at least about 1.25, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.7, at least about 1.8, at least about 1.9, at least about 1.2, at least about 1.25, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least about 1.8, at least about 1.9, at least about 1.20, at least about 1.50, and at least about 1.00 compared to the corresponding condensate containing an unmodified condensate component. In some embodiments, the ability of a condensate containing a modified condensate component to incorporate a drug containing an aromatic substituent is increased by at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 1.6 times, at least about 1.7 times, at least about 1.8 times, at least about 1.9 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 20 times, at least about 50 times, and at least about 100 times compared to the corresponding condensate containing an unmodified condensate component.
[0068] In some specific embodiments, a method for obtaining a drug having a desired partition coefficient is provided herein, comprising (a) providing a first drug having a certain partition coefficient and at least a second drug identical to the first drug except that one or more non-aromatic amino acids are replaced with aromatic amino acids and / or one or more aromatic amino acids are added, and (b) measuring the partition coefficient of the second drug, thereby obtaining a drug having a desired partition coefficient.
[0069] Regions of intrinsic disorder, also known as intrinsically disordered regions (IDRs), intrinsically disordered domains, or intrinsically disordered domains, can be found in numerous protein components of condensates. Each of these terms is used interchangeably throughout this disclosure. IDRs lack stable secondary and tertiary structures. In some embodiments, IDRs can be identified by the method disclosed in Ali, M., & Ivarsson, Y. (2018). High-throughput discovery of functional disordered regions. Molecular Systems Biology, 14(5), e8377. IDRs are known in the art, and any preferred method for identifying IDRs may be used.
[0070] In some embodiments, the components are signaling factors, methylated DNA-binding proteins, BRD4, mediators, mediator components, MED1, MED15, transcription factors, RNA polymerases, DNA sequences (e.g., enhancer DNA sequences, methylated DNA sequences, super-enhancer DNA sequences, the 3' end of a transcribed gene, signal response elements, hormone response elements, oncogenes, or parts thereof), gene silencing factors, splicing factors, elongation factors, initiation factors, histones (e.g., modified histones), cofactors, RNA (e.g., ncRNA), mediators, RNA polymerases (e.g., RNA polymerase II), kinases (e.g., cyclin-dependent kinases, CDK7, CDK8), proteasomes, or topoisomerases. In some embodiments, the components are MED1, BRD4, POLII, SRSF2, FIB1, NPM1, histones, CBX2, 53BP1, or HP1α, or functional fragments thereof (e.g., fragments containing IDRs). In some embodiments, the cofactor comprises an LXXLL motif. In some embodiments, the cofactor comprises an LXXLL motif and, when bound to a ligand (e.g., a congener ligand, a naturally occurring ligand, a synthetic ligand), has an increased binding titer to a TF (e.g., a nuclear receptor, a master transcription factor). Cofactors having an LXXLL motif are known in the art. In some embodiments, the component is a fragment of a cofactor comprising an IDR and an LXXLL motif. In some embodiments, the component is a protein or nucleic acid. The component is not limited and may be any condensate component identified in the art.
[0071] As used herein, “mediator components” include or consist of polypeptides whose amino acid sequence is identical to that of naturally occurring mediator complex polypeptides. Naturally occurring mediator complex polypeptides may be, for example, any of the approximately 30 polypeptides found in mediator complexes that arise in or are isolated from cells (see, e.g., Conaway et al., 2005; Kornberg, 2005; Malik and Roeder, 2005). In some embodiments, naturally occurring mediator components are any of Med1 to Med31 or any naturally occurring mediator polypeptide known in the art. For example, naturally occurring mediator complex polypeptides may be Med6, Med7, Med10, Med12, Med14, Med15, Med17, Med21, Med24, Med27, Med28, or Med30. In some embodiments, the mediator polypeptide is a subunit found in the Med11, Med17, Med20, Med22, Med8, Med18, Med19, Med6, Med30, Med21, Med4, Med7, Med31, Med10, Med1, Med27, Med26, Med14, and Med15 complexes. In some embodiments, the mediator polypeptide is a subunit found in the Med12 / Med13 / CDK8 / cyclin complex. The mediator is described in more detail in PCT International Patent Application WO2011 / 100374, the teachings of which are incorporated herein by reference in their entirety.
[0072] In some embodiments, the components of the condensate are TCF7L2, TCF7, TCF7L1, LEF1, β-catenin, SMAD2, SMAD3, SMAD4, STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6, The signaling factor is selected from the group consisting of and NF-κB. In some embodiments, the signaling factor includes one or more intrinsically disordered domains. In some embodiments, the condensate includes a master transcription factor.
[0073] In some embodiments, the components of the condensate are methylated DNA-binding proteins that preferentially bind to methylated DNA. In some embodiments, the methylated DNA-binding proteins are MECP2, MBD1, MBD2, MBD3, or MBD4. In some embodiments, the methylated DNA-binding proteins are associated with gene silencing. In some embodiments, the components are repressors associated with heterochromatin. In some embodiments, the methylated DNA-binding proteins are HP1α, TBL1R (transducin β-like protein), HDAC3 (histone deacetylase 3), or SMRT (retinoic acid and thyroid hormone receptor silencing mediator).
[0074] In some embodiments, the components of the condensate are RNA polymerase associated with the mRNA initiation complex and elongation complex. In some embodiments, the RNA polymerase is RNA polymerase II or the C-terminal region of RNA polymerase II. In some embodiments, the C-terminal region of RNA polymerase II includes an intrinsically disordered region (IDR). In some embodiments, the IDR includes a phosphorylation site. In some embodiments, the components are splicing factors selected from SRSF2, SRRM1, or SRSF1.
[0075] In some embodiments, the components of the condensate are transcription factors. In some embodiments, the transcription factors are OCT4, p53, MYC, or GCN4, NANOG, MyoD, KLF4, SOX family transcription factors, GATA family transcription factors, or nuclear receptors (e.g., nuclear hormone receptors, estrogen receptors, retinoic acid receptor α).
[0076] In some embodiments, the nuclear receptor (NR) is a member of nuclear receptor subfamily 0, nuclear receptor subfamily 1, nuclear receptor subfamily 2, nuclear receptor subfamily 3, nuclear receptor subfamily 4, nuclear receptor subfamily 5, or nuclear receptor subfamily 6. In some embodiments, the nuclear receptor is NR1D1 (nuclear receptor subfamily 1 group D member 1), NR1D2 (nuclear receptor subfamily 1 group D member 2), NR1H2 (nuclear receptor subfamily 1 group H member 2; also known as liver X receptor β), NR1H3 (nuclear receptor subfamily 1 group H member 3; also known as liver X receptor α), NR1H4 (nuclear receptor subfamily 1 group H member 4), NR1I2 (nuclear receptor subfamily 1 group I member 2; also known as pregnane X receptor), NR1I3 (nuclear receptor subfamily 1 group I member 3; also known as constitutive androstan receptor), NR1I4 (nuclear receptor subfamily NR2C1 (Nuclear Receptor Subfamily 2 Group C Member 1), NR2C2 (Nuclear Receptor Subfamily 2 Group C Member 2), NR2E1 (Nuclear Receptor Subfamily 2 Group E Member 1), NR2E3 (Nuclear Receptor Subfamily 2 Group E Member 3), NR2F1 (Nuclear Receptor Subfamily 2 Group F Member 1), NR2F2 (Nuclear Receptor Subfamily 2 Group F Member 2), NR2F6 (Nuclear Receptor Subfamily 2 Group F Member 6), NR3C1 (Nuclear Receptor Subfamily 3 Group C Member 1; also known as: Glucocorticoid Receptor), NR3C2 (Nuclear Receptor Subfamily 3 Group C Member 2;Also known as: Aldosterone receptor, mineralocorticoid receptor), NR4A1 (nuclear receptor subfamily 4 group A member 1), NR4A2 (nuclear receptor subfamily 4 group A member 2), NR4A3 (nuclear receptor subfamily 4 group A member 3), NR5A1 (nuclear receptor subfamily 5 group A member 1), NR5A2 (nuclear receptor subfamily 5 group A member 2), NR6A1 (nuclear receptor subfamily 6 group A member 1), NR0B1 (nuclear receptor subfamily 0 group B member 1), NR0B2 (nuclear receptor subfamily 0 group B member 2), RARA (retinoic acid receptor, α), RARB (retinoic acid receptor, β), RARG (retinoic acid receptor, γ), RXRA (retinoid X receptor, α; also known as: nuclear receptor subfamily 2 group B member 1), RX These include RB (retinoid X receptor, β; also known as nuclear receptor subfamily 2 group B member 2), RXRG (retinoid X receptor, γ; also known as nuclear receptor subfamily 2 group B member 3), THRA (thyroid hormone receptor, α), THRB (thyroid hormone receptor, β), AR (androgen receptor), ESR1 (estrogen receptor 1), ESR2 (estrogen receptor 2; also known as ERβ), ESRRA (estrogen-related receptor α), ESRRB (estrogen-related receptor β), ESRRG (estrogen-related receptor γ), PGR (progesterone receptor), PPARA (peroxisome proliferator-activated receptor α), PPARD (peroxisome proliferator-activated receptor δ), PPARG (peroxisome proliferator-activated receptor γ), or VDR (vitamin D (1,25-dihydroxyvitamin D3) receptor).
[0077] In some embodiments, the nuclear receptor is a naturally occurring cleaved form of a nuclear receptor produced by protein cleavage, e.g., cleaved RXRα or cleaved estrogen receptor. In some embodiments, the nuclear receptor is an HSP70 client. For example, androgen receptors (AR) and glucocorticoid receptors (GR) are HSP70 clients. Extensive information on NRs can be found in Germain, P., et al., Pharmacological Reviews, 58:685-704, 2006, which provides an overview of the names and structures of nuclear receptors, and in other articles in the same issue of Pharmacological Reviews for a review of the NR subfamily. In some embodiments, the HSP90A client is a steroid hormone receptor (e.g., estrogen, progesterone, glucocorticoid, mineralocorticoid, or androgen receptor), PPARα, or PXR. In some embodiments, the nuclear receptor (NR) is a ligand-dependent NR. Ligand-dependent NRs are characterized by the fact that ligand binding to the NR modulates the activity of the NR. In some embodiments, ligand-dependent binding of a ligand to an NR causes a structural change in the NR that results in, for example, nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR. In some embodiments, the NR is a mutant lacking one or more of the activities of wild-type NR upon ligand binding (e.g., nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR). In some embodiments, the NR is a mutant that has ligand-independent activity that is ligand-dependent in wild-type NR (e.g., nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR). In some embodiments, the nuclear receptor activates transcription when bound to a congener ligand. In some embodiments, the nuclear receptor is a mutant nuclear receptor that activates transcription in the absence of a congener ligand.
[0078] In some embodiments of the methods disclosed herein, the transcription factor is a human transcription factor identified in Lambert, et al., Cell. 2018 Feb 8;172(4):650-665. In some embodiments, the nuclear receptor activates transcription when bound to a congener ligand. In some embodiments, the nuclear receptor is a mutant nuclear receptor that activates transcription in the absence of a congener ligand, or has a higher level of transcriptional activity (e.g., at least 1.5 times, at least 2 times, at least 3 times, or higher) in the absence of a congener ligand compared to the wild-type nuclear receptor in the presence of a native ligand (e.g., a congener ligand). In some embodiments, the nuclear receptor is a mutant nuclear transcription factor that modulates transcription to a different degree compared to the wild-type nuclear receptor in the presence of a congener ligand. In some embodiments, the transcription factor is an oncogenic fusion transcription factor. In some embodiments, the oncogenic fusion transcription factor is selected from MLL rearrangements, EWS-FLI, ETS fusions, BRD4-NUT, and NUP98 fusions. The oncogenic transcription factor may be any oncogenic transcription factor identified in the art.
[0079] In some embodiments, the components of the condensate are components found in the transcription condensate. In some embodiments, the components of the transcription condensate include transcription factors, cofactors, chromatin regulators, DNA, non-coding RNA, nascent RNA, RNA polymerase II, kinases, proteasomes, topoisomerases, and / or enhancers. In some embodiments, the transcription factors are, for example, OCT4, p53, MYC, GCN4, NANOG, MyoD, KLF4, SOX family transcription factors, GATA family transcription factors, nuclear receptors, or oncogenic fusion transcription factors.
[0080] In some embodiments, the components of the condensate are components found in the nucleolus. In some embodiments, the nucleolar components are rRNA processing factors, POL1, FIB1, nucleophosmin, ribosomal DNA genes, and / or POLR1E.
[0081] In some embodiments, drug uptake into the condensate is detected without the use of detectable tags. In some embodiments, the drug spontaneously fluoresces. In some embodiments, the drug has a color that distinguishes it from the condensate and / or the background or areas outside the condensate. In some embodiments, drug uptake is detected by Raman spectroscopy (see, e.g., Smith et al., Analyst, 2016, 141, pp. 3590-3600). In some embodiments, drug uptake is detected by nuclear magnetic resonance (NMR). In some embodiments, drug uptake is detected by mass spectrometry. In some embodiments, drug uptake is detected by spectroscopic and quantitative phase-contrast microscopy. In some embodiments of the drug, uptake is detected by coherence-controlled holographic microscopy. In some embodiments, drug uptake is detected by spin-down assays. It will also be understood that drug uptake into the condensate may be detected by detecting the amount or ratio of the drug not incorporated into the condensate.
[0082] In some embodiments, the incorporation of a drug into a condensate is detected by isolating the condensate from the drug that has not been incorporated into it, and then measuring the drug remaining in the condensate. Any suitable method for isolating the condensate may be used, and is not limited to this. In some embodiments, the condensate is isolated by removing it from cells containing the condensate. In some embodiments, the condensate is isolated by removing it from an in vitro composition (e.g., a solution) containing the condensate. In some embodiments, the condensate is crosslinked to aid in the isolation of the condensate. In some embodiments, the isolated condensate is destroyed and the amount or ratio of the drug is measured. Any suitable method for destruction, including physical and / or chemical means, may be used. In some embodiments, the condensate may be destroyed by increasing or decreasing the salt concentration or crowding agent in the solution. In some embodiments, the condensate may be destroyed by ultrasonic treatment, centrifugation, or by changing the temperature. In some embodiments, the drug derived from the destroyed condensate is measured by chromatography (e.g., HPLC).
[0083] In some embodiments, the uptake of the drug into the condensate is measured in comparison to a control. The control may be a compound known to be uptaken into the condensate under suitable physiological conditions. The control may be a compound having similar physical or chemical properties to the drug and having a known uptake profile into the condensate. In some embodiments, the enrichment ratio or distribution coefficient of the drug (i.e., the relative concentration of the drug inside and outside the condensate) is determined. In some embodiments, the enrichment ratio is determined by measuring the fluorescence of a fluorescent tag on the drug both inside and outside the condensate. In some embodiments, the enrichment ratio is detected by the method described in the Examples section. Methods for determining the enrichment ratio and distribution coefficient are known in the art and are not limited thereto. In some embodiments, the amount of the drug distributed into the condensate is determined. In some embodiments, the drug includes a detectable tag. In some embodiments, the uptake of the drug into the condensate is measured using the detectable tag. As used herein, the terms “detectable tag” or “detectable label” include, but are not limited to, detectable labels such as fluorophores, radioisotopes, chromogenic substrates, or enzymes; heterologous epitopes for which specific antibodies are commercially available, such as FLAG tags; heterologous amino acid sequences that are ligands for commercially available binding proteins, such as Strep tags and biotin; fluorescent quenchers, which are typically used in conjunction with fluorescent tags on other polypeptides; and complementary bioluminescent or fluorescent polypeptide fragments. Tags, which are detectable labels or complementary bioluminescent or fluorescent polypeptide fragments, can be measured directly (for example, by measuring fluorescence or radioactivity, or by incubating with a suitable substrate or enzyme to induce a detectable color change by spectrophotometric measurement of the associated polypeptide compared to an unassociated polypeptide). Tags, which are heterologous epitopes or ligands, are typically detected using a second component that binds to them, such as an antibody or binding protein, where the second component is associated with the detectable label. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, the condensate components and the agent include a detectable tag.In some embodiments, the component comprises a detectable tag different from the agent.
[0084] The method of calculating the uptake of the agent into the condensate is not limited and can be any method known in the art. In some embodiments, the enrichment ratio of the agent is determined by the method shown in FIG. 36. In some embodiments, the enrichment ratio of an agent (e.g., an agent having a detectable tag or an agent having a detectable property) in a particular condensate is determined by providing the condensate in a solution containing the agent, detecting the intensity of the agent within the condensate by confocal microscopy, and obtaining a drug 内部 value; providing the condensate in a solution not containing the agent, detecting the background intensity within the condensate, and obtaining a background value; and providing the agent in a solution not containing the condensate, detecting the intensity of the agent, and obtaining a drug 拡散 value, wherein the enrichment ratio is (drug 内部 - background) / (drug 拡散 ). In some embodiments, the distributed agent can be determined experimentally by spectroscopic measurement and quantitative phase microscopy. In some embodiments, a sample composed of two coexisting phases is considered and named the dilute phase and the condensate phase, with volume ratios Φ 希薄 and Φ 凝縮 = 1. When the agent is also present in the sample at an average concentration of c s 合計 , by mass conservation, c 合計 = c 希薄 Φ 希薄 + c 凝縮 Φ 凝縮 (1) is required.
[0085] where c 希薄 and c 凝縮 are the concentrations of the agent in the dilute phase and the condensate phase, respectively. The partition coefficient of the agent into the condensate phase is defined as P = c 凝縮 / c 希薄 . By this definition and the requirement that the sum of the volume ratios of the phases is 1, Equation (1) becomes c 合計 = c希薄 (1-Φ 凝縮 )+c 希薄 PΦ 凝縮 (2) It could be written as follows.
[0086] This formula can be simplified and streamlined.
number
[0087] c 合計 / c 希薄 The ratio is estimated by fluorescence spectroscopy, as described below, while Φ 凝縮 This is estimated by the lever principle (M. Rubinstein, RH Colby, Polymer Physics (Oxford University Press, 2003)) as follows: Let s be the concentration of condensate protein (e.g., MED1), and by conservation of mass, similar to equation 1, s 合計 =s 希薄 Φ 希薄 +s 凝縮 Φ 凝縮 We obtain this equation. This equation can be rearranged by again using the necessary condition that the volume ratio of the coexisting phases is 1 in total.
number
[0088] In the formula, s 合計 and s 希薄 For example, it is measured by spectrophotometric method using optical absorption at 280 nm, s 凝縮 This is measured, for example, by quantitative phase-contrast microscopy using a holographic microscope with controlled coherence.
[0089] Using Lambert-Beer's Law, Equation 5
number
[0090] In the formula, A is the measured absorbance (in absorbance units (AU)), I0 is the intensity of incident light at a given wavelength, I is the transmission intensity, L is the length of the path through the sample, and c is the concentration of the absorbing species. For each and wavelength, ε is a known constant as molar absorbance or extinction coefficient. This constant is a fundamental molecular property in a given solvent at a specific temperature and pressure, and has units of 1 / M*cm.
[0091] In some embodiments, the amount of drug distributed can be measured using a spin-down assay. Specifically, a known concentration of the drug is added along with the condensate components to form droplets. The mixture is then centrifuged to pelletize the droplets, the supernatant is collected, and the concentration of the drug in the supernatant is measured. The amount of drug distributed can then be determined by subtracting the concentration of the drug in the supernatant from the known total concentration of the added drug.
[0092] In some embodiments, quantitative phase measurements may be performed using a coherence-controlled holographic microscope, for example, as detailed in the following embodiments. Software may be used to construct corrected phase images from the obtained holograms. In some embodiments, each phase image is spatially partitioned based on intensity, and each partitioned object is contained in a window,
number
[0093] In the equation, φ(x, y) is the phase intensity at the pixel position (x, y), λ is the illumination wavelength, Δn is the refractive index difference between the condensate and the surrounding dilute phase, and H(x, y|R) is the projected height over a radius of R. The fitting parameters for Equation 6 are Δn and R. It is assumed that PEG does not distribute to the condensate, and the average scaffold concentration in each filtered condensate is
number
[0094] In the formula, n0 is the refractive index of the buffer in the absence of the scaffold and PEG, and n 希薄 dn / ds is the refractive index of the dilute phase, and both are measured using a digital refractometer. The refractive index increase of the condensed protein, dn / ds, can be estimated from the amino acid composition.
[0095] In some embodiments, drug-target interactions in the presence of condensates can be modeled. Such modeling may be useful, for example, for determining the effective partition coefficient and / or concentration of a drug that is therapeutically effective against a target. In some embodiments, the modeling may be the simplified model shown in the examples herein. This simplified model was developed for drug-target interactions in the presence of condensates. The species involved are drug (D) (i.e., the agent), target (T), and drug-target complex (DT). Bulk / dilute nuclear phase (n) and volume ratio f=V 凝縮物 / V 核 It is assumed that only two types of phases exist, including the condensate phase (c). In equilibrium, the following distribution conditions apply:
number
[0096] In the formula, p D , p T This is the distribution coefficient between the drug and the target. [D] c This represents the concentration of species D in the condensate phase (and similarly for other components / phases). In this model, the drug and target are K D It forms a complex with mutually independent dissociation constants.
number
[0097] To solve for the equilibrium concentrations of various species present at total concentrations [D]0 and [T]0, species equilibrium is written as follows:
number
[0098] These six concentrations are solved using two equations and four constraints (two based on partition equilibrium and two based on reaction equilibrium). In Figures 61A-61D, the ratio of bound targets is defined as follows:
number
[0099] A similar expression is used for the proportion of bound targets in the nuclear (bulk or dilute) phase. If a control is plotted, the plotted proportion is the one that occurs when only one phase is present (f=0).
[0100] The presence of a detectable tag on a drug may, in some cases, alter the activity of the drug's uptake into a condensate. However, if the labeled drug uptake into the condensate can be washed out with an excess of the unlabeled drug, the uptake of the labeled drug into the condensate is not regulated by the label. Therefore, in some embodiments, the method disclosed herein includes contacting a drug having a detectable tag with a composition containing a condensate, measuring the uptake of the drug having the detectable tag into the condensate, contacting the condensate and the composition (e.g., a solution) containing the drug having the detectable tag with a control drug without a detectable tag (i.e., the same drug without a detectable tag), and measuring the uptake of the drug having the detectable tag into the condensate again. In some embodiments, at least an equivalent concentration of the control drug is used for contact. In some embodiments, an excess of the control agent (e.g., at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 50 times, at least 100 times, or higher) is brought into contact. In some embodiments, a condensate containing the tagged agent is brought into contact with a gradually increasing gradient of the control agent, and the loss of the tagged agent is measured continuously or at discrete intervals. In some embodiments, the method may further include bringing the condensate (e.g., a droplet) into contact with the tagged agent and isomers of the agent having lower distribution coefficients to the condensate. In some embodiments, the isomers of the agent are not detectedly distributed within the condensate. In some embodiments, when the tagged agent in the condensate comes into contact with a target, the release of the target from the condensate is triggered. In some embodiments, contact between the tagged drug in the condensate and an isomer of the tagged drug that does not distribute to the condensate to a recognizable extent does not reduce the amount of target released after binding to the tagged target compared to the tagged target in the absence of the isomer. In some embodiments, the isomer is transplatin, an isomer of cisplatin, the tagged drug is tagged cisplatin, and the target is an estrogen receptor.
[0101] In some embodiments, the components of the condensate include a detectable tag. In some embodiments, both the drug and the components of the condensate include a detectable tag. The detectable tag is not limited and may be any detectable tag disclosed herein. In some embodiments, DNA or RNA incorporated into or associated with the condensate includes a detectable tag.
[0102] Some specific embodiments that characterize the agents disclosed herein are as follows:
[0103] Tracking / Competitive Droplet Assay:
[0104] In some embodiments, a method is provided herein for determining whether a first agent modulates the uptake of a second agent into a condensate, the method comprising: (a) measuring the uptake of the second agent into the condensate in the presence of the first agent; and (b) comparing the uptake of the second agent into the condensate in the presence of the first agent to a reference, thereby determining whether the first agent modulates the uptake of the second agent into the condensate. In some embodiments, the reference is based on the uptake of the second agent in the condensate in the absence of the first agent. The first and second agents may be, but are not limited to, any agents described herein. In some embodiments, at least the first or second agent is a low-molecular-weight substance as described herein.
[0105] In some embodiments, a method is provided herein for determining whether a first agent modulates the uptake of a second agent into a condensate, the method comprising: (a) measuring the uptake of the second agent into the condensate in the absence of the first agent; (b) measuring the uptake of the second agent into the condensate in the presence of the first agent; and (c) comparing the uptake of the second agent into the condensate in the absence of the first agent with the uptake of the second agent into the condensate in the presence of the first agent, thereby determining whether the first agent modulates the uptake of the second agent into the condensate.
[0106] In some embodiments, a method is provided herein for determining whether a first agent modulates the uptake of a second agent into a condensate, the method comprising: (a) mixing a condensate and a second agent to form a reaction composition, wherein the condensate components include a first detectable tag and the second agent includes a second detectable tag, and the signals of the first and second detectable tags are identifiable; (b) measuring the uptake of the second agent into the condensate in the absence of the first agent; (c) mixing the first agent into the reaction composition; (d) measuring the uptake of the second agent into the condensate in the presence of the first agent; and (e) comparing the uptake of the second agent into the condensate in the absence of the first agent with the uptake of the second agent into the condensate in the presence of the first agent, thereby determining whether the first agent modulates the uptake of the second agent into the condensate.
[0107] In some embodiments, a method for determining whether a first agent modulates the uptake of a second agent into a condensate, comprising: (a) mixing a composition containing the components of the condensate and a second agent to form a reaction composition and induce the formation of the condensate in the reaction composition, wherein the condensate components include a first detectable tag and the second agent includes a second detectable tag, and the signals of the first and second detectable tags are identifiable; and (b) the condensate in the absence of the first agent A method is provided herein that includes (c) measuring the uptake of a second agent into the reaction composition; (d) mixing the first agent into the reaction composition; (e) measuring the uptake of the second agent into the condensate in the presence of the first agent; and (e) comparing the uptake of the second agent into the condensate in the absence of the first agent with the uptake of the second agent into the condensate in the presence of the first agent, thereby determining whether the first agent modulates the uptake of the second agent into the condensate. In some embodiments, measuring the uptake of the agent into the condensate includes the use of techniques including Raman spectroscopy, spectrometry, quantitative phase-contrast microscopy, fluorescence microscopy including quantitative fluorescence microscopy, and / or spin-down assays. In some embodiments, the first agent and / or the second agent include detectable tags, e.g., fluorescent tags or labels. In some embodiments, the condensate includes components including detectable tags, e.g., fluorescent tags or labels. In some embodiments, the first agent is unlabeled, and the second agent includes a detectable tag such as a fluorescent label. In some embodiments, the second agent includes the first agent and a detectable tag such as a fluorescent label. In some embodiments, measuring the uptake of the agent into a condensate involves quantifying the signal intensity of the agent in a range of one or more condensates, where the range of one or more condensates is based on the labeled components of the condensates as described in the measurement techniques disclosed herein and / or shown in the figures accompanying this specification.
[0108] In some embodiments, a method is provided herein for determining whether an agent modulates the uptake of condensate components into a condensate, the method comprising: (a) measuring the uptake of condensate components into the condensate in the presence of the agent; and (b) comparing the uptake of condensate components into the condensate in the presence of the agent to a reference, thereby determining whether the agent modulates the uptake of condensate components into the condensate. In some embodiments, the reference is based on the uptake of condensate components into the condensate in the absence of the agent. In some embodiments, the condensate includes two or more condensate components, for example, a first component and a second component. In some embodiments, a method is provided herein for determining whether a drug modulates the uptake of a first condensate component into a condensate, wherein, in the absence of the drug, the condensate includes the first condensate component and a second condensate component, and the method comprises (a) measuring the uptake of the first condensate component into the condensate in the absence of the drug; (b) measuring the uptake of the first condensate component into the condensate in the presence of the drug; and (c) comparing the uptake of the first condensate component into the condensate in the presence of the drug with the uptake of the first condensate component into the condensate in the presence of the drug, thereby determining whether the drug modulates the uptake of the first condensate component into the condensate. In some embodiments, measuring the uptake of the drug and / or condensate components into the condensate includes the use of techniques including Raman spectroscopy, spectroscopic measurements, quantitative phase-contrast microscopy, fluorescence microscopy including quantitative fluorescence microscopy, and / or spin-down assays. In some embodiments, the agent includes a detectable tag, such as a fluorescent tag or label. In some embodiments, one or more condensate components include a detectable tag, such as a fluorescent tag or label.In some embodiments, a first condensate component includes a first detectable tag, and a second condensate component includes a second detectable tag, wherein the first and second detectable tags are identifiable (e.g., fluoresce at different wavelengths). In some embodiments, measuring the incorporation of a condensate component into a condensate involves quantifying the signal intensity of the condensate component in a range of one or more condensates, wherein the range of one or more condensates is based on the labeled components of the condensates as described in and / or shown in the figures of the measurement techniques disclosed herein.
[0109] Identification of drugs with a desired condensation coefficient
[0110] In some embodiments, methods for identifying agents having a desired condensate partition coefficient are provided herein. In some embodiments, methods for identifying agents having a desired condensate partition coefficient are provided herein, comprising (a) measuring the condensate partition coefficient of the agent; and (b) comparing the condensate partition coefficient of the agent with a reference, thereby identifying the agent having the desired condensate partition coefficient. The agent may be, but is not limited to, any agent described herein. In some embodiments, the agent is a low-molecular-weight substance as described herein.
[0111] In some embodiments, a method for identifying an agent having a desired condensate partition coefficient is used to screen a plurality of agents and / or select a specific agent having a desired condensate partition coefficient. In some embodiments, the condensate partition coefficient of a first agent is measured in the absence of a second agent. For example, in some embodiments, a method is provided herein for identifying one or more agents having a desired condensate partition coefficient from a plurality of agents, wherein the plurality of agents include a first agent and a second agent, and the method comprises (a) measuring the condensate partition coefficient of the first agent; (b) measuring the condensate partition coefficient of the second agent; and (c) comparing the condensate partition coefficient of the first agent with the condensate partition coefficient of the second agent, thereby identifying one or more agents having a desired condensate partition coefficient from the plurality of agents. The first and second agents may be, but are not limited to, any agents described herein. In some embodiments, at least the first or second agent is a low-molecular-weight substance as described herein.
[0112] In some embodiments, the condensate partition coefficient of a first agent in a condensate is measured in the presence of a second agent (e.g., a competitive assay). For example, in some embodiments, a method is provided herein for identifying one or more agents from a plurality of agents having a desired condensate partition coefficient, wherein the plurality of agents include a first agent and a second agent, and the method comprises (a) measuring the condensate partition coefficient of the first agent in the absence of the second agent; (b) measuring the condensate partition coefficient of the first agent in the presence of the second agent; and (c) comparing the condensate partition coefficient of the first agent in the absence of the second agent with the condensate partition coefficient of the first agent in the presence of the second agent, thereby identifying one or more agents from the plurality of agents having a desired condensate partition coefficient. In some embodiments, measuring the condensate distribution coefficient of a drug into a condensate involves the use of techniques including Raman spectroscopy, spectroscopic measurements, quantitative phase-contrast microscopy, fluorescence microscopy including quantitative fluorescence microscopy, and / or spin-down assays. In some embodiments, the first drug and / or the second drug include a detectable tag, e.g., a fluorescent tag or label. In some embodiments, the condensate includes components that include a detectable tag, e.g., a fluorescent tag or label. In some embodiments, measuring the condensate distribution coefficient of a drug in a condensate involves quantifying the signal intensity of the drug in a range of one or more condensates, where the range of one or more condensates is based on the labeled components of the condensates as described in and / or shown in the figures of the measurement techniques disclosed herein.
[0113] isomer
[0114] In some embodiments, the first and second agents are isomers of each other (e.g., cisplatin and transplatin), such as structural isomers, stereoisomers, enantiomers, diastereoisomers, cis / trans isomers, conformers, or rotational isomers, and the methods described herein may be used to identify one or more isomers having a desired condensate partition coefficient by screening multiple isomers.
[0115] For example, in some embodiments, a method is provided herein for identifying one or more isomers having a desired condensate partition coefficient, the method comprising: (a) measuring the condensate partition coefficient of a first isomer agent; (b) measuring the condensate partition coefficient of a second isomer agent; and (c) comparing the condensate partition coefficient of the first isomer agent with the condensate partition coefficient of the second isomer agent, thereby identifying one or more isomers having a desired condensate partition coefficient. In some embodiments, the first isomer agent and the second isomer agent are isomers of each other. In some embodiments, the first isomer agent and the second isomer agent are low molecular weight. The isomer agents are not limited and may be any agents described herein.
[0116] In some embodiments, a method is provided herein for identifying one or more isomers having a desired condensate partition coefficient, the method comprising: (a) measuring the condensate partition coefficient of a first isomer agent in the absence of a second isomer agent; (b) measuring the condensate partition coefficient of the first isomer agent in the presence of the second isomer agent; and (c) comparing the condensate partition coefficient of the first isomer agent in the absence of the second isomer agent with the condensate partition coefficient of the first isomer agent in the presence of the second isomer agent, thereby identifying one or more isomers having a desired condensate partition coefficient.
[0117] In some embodiments, a disclosed method for identifying one or more isomers having a desired condensate distribution coefficient may include referring to a composition comprising a mixture of different isomers, e.g., a racemic mixture of isomers. For example, in some embodiments, a method is provided for identifying an isomer having a desired condensate distribution coefficient, comprising (a) measuring the condensate distribution coefficient of a first isomer drug; and (b) comparing it with the condensate distribution coefficient of a racemic mixture comprising the first isomer drug, thereby identifying the isomer having the desired condensate distribution coefficient. In some embodiments, the racemic mixture is a known therapeutic agent (e.g., an anticancer drug). In some embodiments, a particular isomer of a drug will have a desirable condensate distribution coefficient compared to other isomeric forms of the drug. Accordingly, in some embodiments, a pure isomeric composition having a desired condensate distribution coefficient and a method for preparing such pure isomeric composition are provided herein, comprising identifying an isomeric drug having a desired condensate distribution coefficient according to a method disclosed herein.
[0118] labeled nucleic acid
[0119] In some embodiments, a method is provided herein for contacting a condensate (e.g., a droplet) having nucleic acid condensate components and / or containing nucleic acid with an agent capable of adding a portion to the nucleic acid and detecting the addition of the portion. In some embodiments, the amount of the added portion is compared to a control or reference level. In some embodiments, the agent is an agent modified by the method disclosed herein, and the control or reference level is the amount of portion added by the unmodified agent. In some embodiments, the portion is or includes a detectable tag used to detect the addition of the portion. In some embodiments, the addition of the portion modulates the expression of a gene product related to the nucleic acid, and the expression of the gene product is used to detect the addition of the portion. In some embodiments, the portion is a plantination portion. In some embodiments, after contact with the agent, the addition of the portion is measured by HPLC.
[0120] In some embodiments, a method is provided herein for contacting a condensate (e.g., a droplet) having nucleic acid condensate components and / or containing nucleic acid with an agent capable of removing a portion from the nucleic acid and detecting the removal of such portion. In some embodiments, the amount of the removed portion is compared to a control or reference level. In some embodiments, the agent is a modified agent by the method disclosed herein, and the control or reference level is the amount of portion removed by an unmodified agent. In some embodiments, the portion is or includes a detectable tag used to detect the removal of the portion or the portion remaining in the nucleic acid. In some embodiments, the removal of the portion modulates the expression of a gene product related to the nucleic acid, and the expression of the gene product is used to detect the removal of the portion. In some embodiments, the portion is methylation. In some embodiments, after contact with the agent, the removal of the portion is measured by HPLC.
[0121] Assay using anchored condensate components
[0122] In some embodiments, a method for characterizing a drug is provided herein, comprising providing a fusion construct comprising a condensate component or a functional fragment thereof and a nucleic acid-binding domain, wherein the nucleic acid-binding domain is in contact with a nucleic acid that can bind to the nucleic acid-binding domain, and contacting the fusion construct with the drug, thereby characterizing the drug. In some embodiments, the fusion construct anchors a condensate comprising the condensate component or functional fragment to the nucleic acid, and the drug is brought into contact with the condensate. In some embodiments, in addition to the fusion construct, the drug is brought into contact with one or more condensate components that can form a condensate together with the fusion construct.
[0123] In some embodiments, the fusion construct includes MED1 or an IDR of MED1. In some embodiments, the fusion construct includes HP1α or an IDR of HP1α. In some embodiments, the fusion construct includes an activated domain of ESR1 or ESR1. In some embodiments, one or more condensate components that can form condensates together with the fusion construct include the same condensate components as the fusion construct. In some embodiments, the fusion construct includes an IDR of MED1, and one or more condensate components include MED1. In some embodiments, the fusion construct includes an IDR of HP1α, and one or more condensate components include HP1α. In some embodiments, the fusion construct includes an activated domain of HP1αESR1, and one or more condensate components include MED1.
[0124] In some embodiments, the nucleic acid binding domain is LacI, and the nucleic acid includes a lac operator sequence (e.g., a lac sequence).
[0125] In some embodiments, the fusion construct further includes detectable tags. The detectable tags are not limited and may be any detectable tags disclosed herein. In some embodiments, the detectable tags are fluorescent tags. In some embodiments, condensate components other than the condensate components or functional fragments of the fusion construct include detectable tags. The detectable tags are not limited and may be any detectable tags disclosed herein. In some embodiments, the detectable tags are fluorescent tags. In some embodiments, both the fusion construct and the condensate components other than the condensate components or functional fragments of the fusion construct each include detectable tags. In some embodiments, the fusion construct and the condensate components other than the condensate components or functional fragments of the fusion construct each include detectable tags, and the ability of an agent to regulate the amount of condensate components associating with the fusion construct is measured by detecting the colocalization of each detectable tag.
[0126] In some embodiments, the fusion construct further includes a linker between the nucleic acid-binding domain and the condensate component or functional fragment. The linker is not limited and may be any linker described herein. In some embodiments, the linker is GAPGSAGSAAGGSG (SEQ ID NO: 16).
[0127] Drug-resistant aggregates
[0128] Some aspects of this disclosure relate to methods for evaluating whether differential expression of one or more condensate components by drug-resistant cells causes or contributes to resistance.
[0129] In some embodiments, the method includes providing drug-resistant cells, contacting the drug-resistant cells with a drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes corresponding non-resistant cells. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. The method for evaluating the localization, concentration, and / or therapeutic activity of the drug is not limited and may include any method disclosed herein. In some embodiments, the cells include condensates having a detectable label. In some embodiments, the drug contacted with the cells includes a detectable label. In some embodiments, both the intracellular condensates and the drug include detectable labels. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule.
[0130] In some embodiments, the method includes providing condensates isolated from drug-resistant cells, contacting the condensates with a drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes corresponding condensates derived from non-resistant cells. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. The method for evaluating the localization, concentration, and / or therapeutic activity of the drug is not limited and may include any method disclosed herein. In some embodiments, the condensates include a detectable label. In some embodiments, the drug includes a detectable label. In some embodiments, both the condensates and the drug include a detectable label. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule.
[0131] In some embodiments, the method includes providing an in vitro condensate (e.g., a droplet) containing differential amounts of condensate components or fragments thereof that are differentially expressed in drug-resistant cells, contacting the condensate with a drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes a corresponding condensate that does not contain differential amounts of condensate components or fragments thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. The method for evaluating the localization, concentration, and / or therapeutic activity of the drug is not limited and may include any method disclosed herein. In some embodiments, the condensate includes a detectable label. In some embodiments, the drug includes a detectable label. In some embodiments, both the condensate and the drug include a detectable label. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule. In some embodiments, the condensate components include IDR, mediators, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or functional fragments thereof. In some embodiments, the differential amount of condensate components is at least 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, or more than the amount of condensate components found in the condensates of non-resistant cells. In some embodiments, the differential amount of condensate components is about 1.5 times, about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, about 9 times, about 10 times, about 15 times, about 20 times, or less than 50 times the amount of condensate components found in the condensates of non-resistant cells.
[0132] In some embodiments, the method includes providing an in vitro condensate (e.g., a droplet) containing a mutant condensate component or fragment thereof corresponding to a mutant condensate component in drug-resistant cells, contacting the condensate with a drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control includes a corresponding condensate containing a non-mutant form of the condensate component or fragment thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. The method for evaluating the localization, concentration, and / or therapeutic activity of the drug is not limited and may include any method disclosed herein. In some embodiments, the condensate includes a detectable label. In some embodiments, the drug includes a detectable label. In some embodiments, both the condensate and the drug include a detectable label. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule. In some embodiments, the mutant condensate components include IDRs and are mutant mediators, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or functional fragments thereof.
[0133] Several aspects of this disclosure relate to characterizing drug-resistant condensates, which includes contacting the condensates with one or more second agents and evaluating at least one of the localization, concentration, or therapeutic activity of the agents and / or the morphology, stability, or solubility of the condensates. In some embodiments, the method includes determining whether the second agent counteracts the drug-resistant effect (e.g., drug resistance) induced by the first agent (e.g., determining whether contact with the second agent reduces the size of the condensates or removes them).
[0134] In some embodiments, the method includes providing drug-resistant cells, contacting the drug-resistant cells with a second drug, and evaluating at least one of the localization, concentration, or therapeutic activity of the second drug, and / or the morphology, stability, or solubility of the condensate. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. In some embodiments, the cells include condensates having a detectable label. In some embodiments, the drug contacted with the cells includes a detectable label. In some embodiments, both the intracellular condensate and the second drug include a detectable label. The second drug is not limited and may be any drug disclosed herein. In some embodiments, the second drug is a small molecule. In some embodiments, the cells are contacted with both the second drug and the drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable label. In some embodiments, the size or solubility of the condensate is evaluated in comparison to a control. In some embodiments, the method includes determining whether a second agent counteracts the effect of drug resistance (e.g., drug resistance) induced by the first agent (for example, determining whether contact with the second agent reduces the size of the condensate or removes the condensate).
[0135] In some embodiments, the method includes providing condensates isolated from drug-resistant cells, contacting the condensates with a second drug, and evaluating at least one of the localization, concentration, or therapeutic activity of the second drug and / or the morphology, stability, or dissolution of the condensates. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. In some embodiments, the condensates include a detectable label. In some embodiments, the second drug includes a detectable label. In some embodiments, both the condensates and the second drug include a detectable label. The second drug is not limited and may be any drug disclosed herein. In some embodiments, the second drug is a small molecule. In some embodiments, the condensates are contacted with both the second drug and the drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable label. In some embodiments, the size or dissolution of the condensates is evaluated in comparison to a control. In some embodiments, the method includes determining whether a second agent counteracts the effect of drug resistance (e.g., drug resistance) induced by the first agent (for example, determining whether contact with the second agent reduces the size of the condensate or removes the condensate).
[0136] In some embodiments, the method includes providing an in vitro condensate (e.g., a droplet) containing differential amounts of condensate components or fragments thereof that are differentially expressed in drug-resistant cells, contacting the condensate with a second drug, and evaluating at least one of the localization, concentration, or therapeutic activity of the second drug and / or the morphology, stability, or solubility of the condensate. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. In some embodiments, the condensate includes a detectable label. In some embodiments, the second drug includes a detectable label. In some embodiments, both the condensate and the second drug include detectable labels. The second drug is not limited and may be any drug disclosed herein. In some embodiments, the second drug is a small molecule. In some embodiments, the condensate is contacted with both the second drug and the drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable label. In some embodiments, the condensate components include mediators, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or functional fragments thereof, including IDR. In some embodiments, the differential amount of condensate components is at least 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, or more than the amount of condensate components found in condensates of non-resistant cells. In some embodiments, the differential amount of condensate components is about 1.5 times, about 2 times, about 3 times, about 4 times, about 5 times, about 6 times, about 7 times, about 8 times, about 9 times, about 10 times, about 15 times, about 20 times, or less than 50 times the amount of condensate components found in condensates of non-resistant cells. In some embodiments, the size or dissolution of the condensate is evaluated in comparison to a control. In some embodiments, the method includes determining whether a second agent counteracts the effect of drug resistance (e.g., drug resistance) induced by the first agent (for example, determining whether contact with the second agent reduces the size of the condensate or removes the condensate).
[0137] In some embodiments, the method includes providing an in vitro condensate (e.g., a droplet) containing a mutant condensate component or fragment thereof corresponding to a mutant condensate component in drug-resistant cells, contacting the condensate with a second drug, and evaluating at least one of the localization, concentration, or therapeutic activity of the second drug and / or the morphology, stability, or solubility of the condensate. In some embodiments, the control includes a corresponding condensate containing a non-mutant condensate component or fragment thereof. In some embodiments, the drug-resistant cells are cancer cells. Cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. In some embodiments, the condensate includes a detectable label. In some embodiments, the second drug includes a detectable label. In some embodiments, both the condensate and the second drug include a detectable label. The second drug is not limited and may be any drug disclosed herein. In some embodiments, the second drug is a small molecule. In some embodiments, the condensate is brought into contact with both a second drug and a drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable label. In some embodiments, the mutant condensate components include an IDR and have a mutation, such as a mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof. In some embodiments, the size or dissolution of the condensate is evaluated in comparison to a control. In some embodiments, it is evaluated whether the second drug counteracts the drug resistance effect to the drug (e.g., whether contact with the second drug reduces the size of the condensate or removes the condensate).
[0138] High-throughput screening
[0139] In some embodiments, high-throughput screening (HTS) is performed to characterize multiple drugs and / or multiple different condensates (e.g., two or more of the following: super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleolus, chromatin condensates, Polycomb condensates, or DNA damage repair condensates; or two or more types of in vitro condensates including super-enhancer condensate components, splicing speckle condensate components, heterochromatin condensate components, nucleolus components, chromatin condensates, Polycomb condensates, or DNA damage repair condensates). High-throughput screening may utilize cell-free assays or cell-based assays (e.g., cells containing condensates, in vitro condensates, as described herein). High-throughput screening often involves testing a large number of compounds efficiently, for example, in parallel. For example, tens of thousands or hundreds of thousands of compounds may be routinely screened over a short period, e.g., hours to days. In many cases, such screening is performed in a multiwell plate containing at least 96 wells or in other containers where multiple physically separated depressions or recesses are present in the substrate. High-throughput screening often involves the use of automation, such as liquid handling, imaging, data acquisition, and processing. Specific general principles and techniques that may be applied to embodiments of the HTS of the present invention are described in Macarron R & Hertzberg RP. Design and implementation of high-throughput screening assays. Methods Mol Biol., 565:1-32, 2009 and / or An WF & Tolliday NJ., Introduction: cell-based assays for high-throughput screening. Methods Mol Biol. 486:1-12, 2009, and / or references in either of these.Useful methods are also disclosed in William P. Janzen's *High Throughput Screening: Methods and Protocols (Methods in Molecular Biology)* (2002) and Jorg Huser's *High-Throughput Screening in Drug Discovery (Methods and Principles in Medicinal Chemistry)* (2006).
[0140] In some embodiments of the methods disclosed herein, multiple agents (e.g., 10, 50, 100, 1,000, 10,000, 100,000, or more) are brought into contact with a condensate, and the uptake of the agents into the condensate is measured or determined. In some embodiments, the condensates brought into contact with multiple agents contain the same components. In some embodiments, at least a portion of the condensates contain different components.
[0141] In some embodiments of the methods disclosed herein, a drug is brought into contact (sequentially or more preferably in parallel) with a plurality of compositions, each having a condensate having at least one different component. In some embodiments, each of the plurality of compositions is contained in a separate container (e.g., a separate well of a multiwell plate).
[0142] In some embodiments, several different agents are brought into contact with condensates having the same components. In some embodiments, the uptake of several different agents is compared. In some embodiments, each of the different agents involves a gradual change, which allows for the identification of key properties of the agent that modulates uptake into the condensate.
[0143] In some embodiments of the methods disclosed herein, a drug is brought into contact with a composition (e.g., a solution) comprising several condensates having different components. In some embodiments, the condensates having different components are identified by different detectable tags. In some embodiments, the condensates include nucleic acids. In some embodiments, the nucleic acids are DNA or RNA. In some embodiments, the nucleic acids include detectable tags (e.g., fluorescent tags).
[0144] In some embodiments, the agent is in contact with the condensate for 1 minute to 48 hours. In some embodiments, the agent is in contact with the condensate for about 1 minute, about 5 minutes, about 10 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 2 hours, about 3 hours, about 5 hours, about 8 hours, about 10 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or longer. In some embodiments, the uptake of the agent into the condensate is evaluated over multiple points in time as described herein, or continuously monitored (e.g., the first 5 minutes, the first 10 minutes, or the first hour after contact, up to 48 hours or longer). As will be apparent to those skilled in the art, the uptake of the agent and its action on the condensate may include both a rapid phase and a long-term phase.
[0145] Some aspects of the present invention relate to a method for regulating the distribution of a first agent into a condensate, comprising coupling the first agent to a second agent, thereby regulating the distribution of the first agent into the condensate. In some embodiments, the condensate is a transcription condensate. In some embodiments, the condensate is selected from a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a Polycomb condensate, or a DNA damage repair condensate. The method of coupling the agent to the second agent is not limited and may be any suitable method disclosed in the art. In some embodiments, the first and second agents are coupled by covalent bonds. In some embodiments, the first and second agents are coupled by non-covalent or ionic bonds. In some embodiments, the first and second agents are coupled by a linker. In some embodiments, the first and second agents are conjugated to each other. In some embodiments, the first agent has therapeutic activity.
[0146] As used herein, the term “linker” refers to a chemical group or molecule that covalently links the first and second drugs. In some embodiments, the linker is located between or sandwiched between two groups, molecules, or parts, and is covalently linked to each of them, thereby linking the two drugs. In some embodiments, the linker is an amino acid or a group of amino acids. In some embodiments, the linker is an organic molecule, group, or chemical part. In some embodiments, the linker contains or consists of a polypeptide. In some embodiments, the linker may contain or consist of one or more glycine residues, and in some embodiments, one or more serine and / or threonine residues. In some embodiments, the linker contains one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelfth, thirteenth, twelfth, fifteen In some embodiments, the linker comprises an oligoglycine sequence. Any suitable linker known in the art may be used, but is not limited to them. For example, in some embodiments, if the first and second drugs are proteins, the linker may be a polypeptide (e.g., a polypeptide linking the C-terminus of one drug to the N-terminus of the other drug).
[0147] In some embodiments, the distribution of a first agent into the condensate (e.g., the distribution coefficient) is increased by coupling with a second agent. In some embodiments, the distribution coefficient increases by at least about 1.1 times, at least about 1.2 times, at least about 1.3 times, at least about 1.4 times, at least about 1.5 times, at least about 1.6 times, at least about 1.7 times, at least about 1.8 times, at least about 1.9 times, at least about 2 times, at least about 2.5 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 20 times, at least about 50 times, and at least about 100 times compared to the uncoupled agent. As used herein, the distribution coefficient or enrichment ratio is the ratio of the concentrations of a compound (e.g., agent) inside the condensate of interest and outside the condensate of interest (e.g., the surrounding solution). In some embodiments, the partition coefficient of the uncoupled drug is less than about 5, less than about 2, about 1, less than about 1, less than about 0.5, or less than about 0.1. In some embodiments, the partition coefficient of the coupled first drug is greater than 1, greater than about 1.5, greater than about 2, greater than about 3, greater than about 4, greater than about 5, greater than about 10, greater than about 20, greater than about 50, or greater than about 100. In some embodiments, the partition coefficient of the coupled drug increases by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the uncoupled drug. In some embodiments, the condensate contains a therapeutic target of the first drug.
[0148] In some embodiments, the distribution of the first agent into the condensate (e.g., the distribution coefficient) is reduced. In some embodiments, the distribution coefficient is reduced to at least about half, at least about one-third, at least about one-quarter, at least about one-fifth, at least about one-sixth, at least about one-seventh, at least about one-eighth, at least about one-ninth, at least about one-tenth, at least about one-twentieth, at least one-fiftieth, or at least one-hundredth compared to the uncoupled agent. In some embodiments, the distribution coefficient is reduced by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more compared to the uncoupled agent. In some embodiments, the partition coefficient of the uncoupled drug is about 10 or greater, about 5 or greater, about 2 or greater, about 1 or greater, or about 0.5 or greater. In some embodiments, the partition coefficient of the coupled first drug is less than about 10, less than about 5, less than about 2, less than about 1, less than about 0.5, less than about 0.1, or less than about 0.01. In some embodiments, the condensate does not contain the therapeutic target of the first drug.
[0149] In some embodiments, the uncoupled second agent preferentially distributes into the condensate of interest. In some embodiments, the uncoupled second agent has a distribution coefficient greater than 1, about 1.5, about 2, about 3, about 4, about 5, about 10, about 20, about 50, or about 100. In some embodiments, the second agent has a distribution coefficient with respect to the condensate of interest that is at least 2 times, at least 5 times, at least 10 times, at least 15 times, at least 20 times, at least 50 times, at least 100 times, or at least 400 times higher than that of the first agent. In some embodiments, the second agent has a distribution coefficient with respect to the condensate of interest that is at least 1 / 2, at least 1 / 5, at least 1 / 10, at least 1 / 15, at least 1 / 20, at least 1 / 50, at least 1 / 100, or at least 1 / 400 of that of the first agent. In some embodiments, the second agent is a low molecule having a high partition coefficient with respect to the condensate of interest. In some embodiments, the second agent is a low molecule having a partition coefficient greater than 10, greater than 20, greater than 30, greater than 50, or greater than 100 with respect to the condensate of interest.
[0150] In some embodiments, the uncoupled second agent is preferentially evicted from the condensate of interest. In some embodiments, the uncoupled second agent has a partition coefficient of 0.9, 0.8, 0.5, 0.1, 0.05, or less than 0.01. In some embodiments, the second agent is a low molecule with a low partition coefficient with respect to the condensate of interest. In some embodiments, the second agent is a low molecule with a partition coefficient of less than 0.5, less than 0.1, less than 0.05, or less than 0.01 with respect to the condensate of interest. The second agent, which is used to concentrate the first agent bound to the second agent in or evict it from the condensate of interest, may be a low molecule that is nontoxic to the target to which it is administered, and in some embodiments, has no significant biological activity of its own. The second agent (e.g., a low molecular weight) may comprise one or more functional groups that are suitable for reacting with the second functional group for binding the agent of interest in order to modify the distribution behavior of the agent of interest with respect to one or more condensates.
[0151] In some embodiments, the therapeutic efficacy of the coupled first agent is increased compared to the uncoupled first agent. In some embodiments, the therapeutically effective dose of the coupled first agent is reduced to at least about half, at least about one-third, at least about one-quarter, at least about one-fifth, at least about one-sixth, at least about one-seventh, at least about one-eighth, at least about one-ninth, at least about one-tenth, at least about one-twentieth, at least about one-fiftieth, or at least one-hundredth compared to the uncoupled first agent. In some embodiments, the therapeutically effective dose of the coupled first agent is reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the uncoupled first agent.
[0152] In some embodiments, one or more side effects of the coupled first drug are reduced compared to the uncoupled first drug (e.g., reduced in severity or duration, or eliminated). In some embodiments, the coupled first drug has increased therapeutic efficacy and reduced side effects compared to the uncoupled first drug.
[0153] Some aspects of this disclosure relate to a method for screening candidate drugs having regulated condensate partitioning, comprising modifying a drug having a certain condensate partition coefficient, and measuring the condensate partition coefficient of the modified drug, wherein if the modified drug has a different partition coefficient than the original drug, the modified drug is identified as a candidate drug having regulated condensate partitioning. The modification may be by well-known chemical operations and modifications of pharmaceuticals. In some embodiments, the modification increases or decreases the solubility of the drug. In some embodiments, the modification modifies the electrostatic properties of the drug. In some embodiments, the modification is the coupling of a portion or a second drug that preferentially partitions into a desired condensate. In some embodiments, the modification is the coupling of a portion or a second drug that does not preferentially partition into one or more types of condensates (e.g., super-enhancer condensates, nucleoli, etc.).
[0154] In some embodiments, the condensate partition coefficient of the modified drug is measured in in vitro condensates. In some embodiments, the condensate partition coefficient of the modified drug is measured in intracellular condensates.
[0155] In some embodiments, a candidate drug is identified as an improved candidate drug if it has an increased distribution into a condensate containing the therapeutic target for the candidate drug. In some embodiments, a candidate drug is identified as an improved candidate drug if its distribution increases by at least about 2 times, at least about 3 times, at least about 4 times, at least about 5 times, at least about 6 times, at least about 7 times, at least about 8 times, at least about 9 times, at least about 10 times, at least about 20 times, at least about 50 times, or at least about 100 times compared to the unmodified drug. In some embodiments, a candidate drug is identified as an improved candidate drug if its distribution increases by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the unmodified drug.
[0156] In some embodiments, a candidate drug is identified as an improved candidate drug if it has a reduced distribution into a condensate that does not have a therapeutic target for the candidate drug. In some embodiments, a candidate drug is identified as an improved candidate drug if its distribution is reduced to at least about half, at least about one-third, at least about one-fourth, at least about one-fifth, at least about one-sixth, at least about one-seventh, at least about one-eighth, at least about one-ninth, at least about one-tenth, at least about one-twentieth, at least one-fiftieth, or at least one-hundredth compared to the unmodified drug. In some embodiments, a candidate drug is identified as an improved candidate drug if its distribution is reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the unmodified drug.
[0157] In some embodiments, a candidate drug is identified as an improved candidate drug when the amount of the candidate drug in the condensate of interest (e.g., total number of candidate drug molecules, concentration of candidate drug) is adjusted compared to the unmodified drug. In some embodiments, the amount of the candidate drug in the condensate of interest increases. In some embodiments, this increase corresponds to an increase in the distribution coefficient into the condensate of interest. However, this increase may also be due to an increase in the availability of the candidate drug for uptake into the condensate. For example, the candidate drug may have a reduced distribution into condensates of interest, thereby enabling uptake of the candidate drug into the condensate of interest. In some embodiments, the amount of the candidate drug in the condensate of interest decreases.
[0158] In some embodiments, modifying the distribution of a first agent into a condensate (e.g., by modifying the first agent, e.g., by coupling the first agent to a second agent to create a candidate agent) results in an increase in the concentration of the modified or coupled first agent in the condensate compared to the concentration of the unmodified / uncoupled first agent present in the condensate. In some embodiments, modification or coupling of the first agent increases the distribution coefficient of the first agent into the condensate. In some embodiments, modification or coupling of the first agent reduces the distribution of the first agent into different condensates (e.g., condensates of no interest) where the first agent would otherwise be concentrated if not modified or coupled. In some embodiments, modification or coupling of the first agent decreases the distribution coefficient of the first agent into the condensate. In some embodiments, modification or coupling of the first agent increases the distribution of the first agent into different condensates (e.g., condensates of no interest) where the first agent would otherwise be concentrated if not modified or coupled.
[0159] In some embodiments, candidate agents having regulated condensate distribution are chemotherapeutic agents.
[0160] Some embodiments of the present invention relate to a composition comprising cells having a first condensate containing a first detectable label and a second condensate having a different second detectable label. In some embodiments, the first and second condensates are different types of condensates selected from super-enhancer condensates, splicing speckle condensates, heterochromatin condensates, nucleolus, chromatin condensates, polycomb condensates, or DNA damage repair condensates. In some embodiments, at least one of the condensates is a transcription condensate. In some embodiments, the composition further comprises a drug in contact with the cells. In some embodiments, the drug is a known therapeutic agent. In some embodiments, the drug is a candidate therapeutic agent.
[0161] Some embodiments of the present invention relate to a composition comprising a first in vitro condensate, a second in vitro condensate, and a drug in contact with the first and second in vitro condensates. In some embodiments, the first and second in vitro condensates are isolated from each other. In some embodiments, at least one of the first in vitro condensate, the second in vitro condensate, and the drug includes a detectable label. In some embodiments, the composition further comprises a third in vitro condensate and optionally a fourth in vitro condensate, each in contact with the drug. In some embodiments, at least one of the in vitro condensates includes components of a super-enhancer condensate, splicing speckle condensate, heterochromatin condensate, nucleolus, chromatin condensate, polycomb condensate, or DNA damage repair condensate. In some embodiments, a multiwell plate (e.g., a 96-well plate) is disclosed herein having a first in vitro condensate in contact with a drug and a second in vitro condensate in contact with the same drug, wherein the first and second in vitro condensates each contain different components and the first and second in vitro condensates are located in different wells of the multiwell plate.
[0162] Several embodiments relate to an article comprising a first in vitro condensate in contact with a drug, a second in vitro condensate in contact with the same drug, and a multiwell plate separating the first and second in vitro condensates into separate wells. In some embodiments, the article further comprises at least a third in vitro condensate in contact with the drug. In some embodiments, the article further comprises at least a fourth in vitro condensate in contact with the drug. The first, second, third, and fourth in vitro condensates may each contain components of a different condensate (e.g., a super-enhancer condensate, a splicing speckle condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a polycomb condensate, or a DNA damage repair condensate). The first, second, third, and fourth in vitro condensates may each contain a different detectable label.
[0163] In some embodiments, the agents disclosed herein are brought into contact with the condensate at an overall concentration of about 1 nM to 500 μM. For example, the agent may be added to a solution containing the condensate to obtain an overall concentration in the solution of about 1 nM to 500 μM. In some embodiments, the agent is brought into contact with the condensate at an overall concentration of 10 nM to 100 nM, 10 nM to 1 μM, 1 μM to 10 μM, 10 μM to 100 μM, or 100 μM to 500 μM. In some embodiments, the agent is added to a composition (e.g., a solution) containing the condensate to obtain an overall concentration of about 1 nM to 500 μM. In some embodiments, the agent is added to a composition containing the condensate to obtain an overall concentration of 10 nM to 100 nM, 10 nM to 1 μM, 1 μM to 10 μM, 10 μM to 100 μM, or 100 μM to 500 μM.
[0164] In some embodiments, the condensates are present within cells. The type of cell is not limited. In some embodiments, the cells are mammalian cells, e.g., human or mouse cells. In some embodiments, the cells are somatic cells. In some embodiments, the cells are pluripotent stem cells. In some embodiments, the cells are germ cells, stem cells, or zygotes. In some embodiments, the cells are primary cells. In some embodiments, the cells are diseased cells. In some embodiments, the cells are cancer cells. In some embodiments, the cells are leukocytes or fibroblasts. In some embodiments, the cells are cells isolated from an embryo.
[0165] In some embodiments, the cells are cells isolated from a patient having a disease, disorder, or condition. In some embodiments, the cells are derived from the cells of a patient having a disease, disorder, or condition. In some embodiments, the cells are differentiated cells of induced pluripotent stem cells derived from the cells of a patient having a disease, disorder, or condition. In some embodiments, the cells are induced pluripotent stem cells derived from the cells of a patient having a disease, disorder, or condition. In some embodiments, the cells are genetically modified cells expressing one or more condensate components having detectable labels. In some embodiments, the genetically modified cells express at least two different condensate components having different detectable labels and / or labels that are detectably distinguishable from each other. In some embodiments, the genetically modified cells express at least three different condensate components having different detectable labels and / or labels that are detectably distinguishable from each other. In some embodiments, the genetically modified cells express at least four different condensate components having different detectable labels and / or labels that are detectably distinguishable from each other. In some embodiments, each type of labeled condensate component is a component of a different condensate (e.g., super-enhancer condensate, splicing speckle condensate, heterochromatin condensate, nucleolus, chromatin condensate, Polycomb condensate, or DNA damage repair condensate). In some embodiments, genetically modified cells express labeled super-enhancer components and labeled nucleolus components. In some embodiments, the labels of different condensate components are detectably distinguishable from each other.
[0166] The terms “disease,” “disorder,” or “condition” are used interchangeably and may refer to any change in the health and / or normal function of an organism, e.g., a physical or mental abnormality, resulting in pain, discomfort, dysfunction, distress, degeneration, or death in the affected individual. Diseases include any disease known to those skilled in the art. In some embodiments, a disease is a chronic disease, for example, which typically lasts or persists for at least 3 to 6 months or longer, e.g., 1, 2, 3, 5, 10 years or longer, or indefinitely. A disease may have a characteristic set of symptoms and / or signs that commonly occur in the individual suffering from the disease. Diseases, their diagnosis, and treatment methods are described in standard medical textbooks, e.g., Longo, D., et al. (eds.), Harrison's Principles of Internal Medicine, 18th Edition; McGraw-Hill Professional, 2011, and / or Goldman's Cecil Medicine, Saunders; 24th edition (August 5, 2011). In certain embodiments, the disease is a polygenic disorder (also called a complex disorder, multifactorial disorder, or polygenetic disorder). Such a disease may be related to the effects of multiple genes, sometimes in combination with environmental factors (e.g., certain physical or chemical or biological agents, e.g., exposure to viruses; lifestyle factors, e.g., diet, smoking, etc.). Polygenetic disorders can be any disorder in which multiple genes (e.g., specific alleles of such genes, specific polymorphisms in such genes) are known or suspected to contribute to the risk of developing the disorder and / or to the manner in which the disorder manifests (e.g., its severity, age of onset, rate of progression, etc.). In some embodiments, polygenetic disorders are disorders with a genetic component, as indicated by familial clustering (generally occurring in more specific families within the general population), but do not follow Mendel's laws of inheritance (e.g., the disorder does not clearly follow a dominant, recessive, X-linked, or Y-linked inheritance pattern).In some embodiments, complex genetic diseases are not usually controlled by variants with a strong effect on a single gene (similar to Mendelian diseases). In some embodiments, complex genetic diseases can be familial and sporadic. Examples include, for example, Parkinson's disease, Alzheimer's disease, and various types of cancer. Examples of complex genetic diseases include many common diseases such as hypertension, diabetes (e.g., type 2 diabetes), cardiovascular disease, cancer, and stroke (ischemic, hemorrhagic). In some embodiments, a disease, such as a complex genetic disease, is a mental disease, a neurological disease, a neurodevelopmental disease, a neurodegenerative disease, a cardiovascular disease, an autoimmune disease, cancer, a metabolic disease, or a respiratory disease. In some embodiments, at least one gene is associated with a familial complex genetic disease.
[0167] In some embodiments, the disease is cancer, and the term is used interchangeably to generally refer to a disease characterized by one or more tumors, e.g., one or more malignant or potentially malignant tumors. As used herein, the term “tumor” encompasses abnormal proliferation, including abnormal cell proliferation. As is known in the art, tumors are typically characterized by excessive cell proliferation that is not properly controlled (e.g., not responding normally to physiological influences and signals that normally limit proliferation) and may exhibit one or more of the following characteristics: dysplasia (e.g., lack of normal cell differentiation resulting in an increased number or proportion of immature cells); anaplasia (e.g., greater loss of differentiation, loss of much structural tissue, cell pleomorphism, abnormalities, e.g., large hyperchromic nuclei, high nucleocytoplasmic ratio, atypical mitosis, etc.); invasion of adjacent tissues (e.g., rupture of the basement membrane); and / or metastasis. Malignant tumors have a tendency to grow persistently and have the ability to spread, for example, by invading locally and / or metastasizing locally and / or to distant sites, whereas benign tumors are often confined to the site of origin and are often self-limiting in terms of proliferation. The term “tumor” includes malignant solid tumors, such as carcinoma (cancer arising from epithelial cells), sarcoma (cancer arising from mesenchymal cells), and malignant tumors that do not necessarily have a detectable solid tumor mass (e.g., certain hematological malignancies).Cancers include, but are not limited to, breast cancer; biliary tract cancer; bladder cancer; brain cancer (e.g., glioblastoma, medulloblastoma); cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; stomach cancer; hematological malignancies including acute lymphoblastic leukemia and acute myeloid leukemia; T-cell acute lymphoblastic leukemia / lymphoma; pilocytic cell leukemia; chronic lymphocytic leukemia, chronic myeloid leukemia, multiple myeloma; adult T-cell leukemia / lymphoma; neoplasm in situ including Bowen's disease and Paget's disease; liver cancer; lung cancer; lymphoma including Hodgkin's disease and lymphocytic lymphoma; neuroblastoma; melanoma. Examples include oral cancer, which includes squamous cell carcinoma; ovarian cancer, which includes ovarian cancer arising from epithelial cells, stromal cells, germ cells, and mesenchymal cells; neuroblastoma, pancreatic cancer; prostate cancer; rectal cancer; sarcomas, which include angiosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma, and osteosarcoma; kidney cancer, which includes renal cell carcinoma and Wilms' tumor; skin cancer, which includes basal cell carcinoma and squamous cell carcinoma; testicular cancer, which includes germ cell tumors, such as seminomas, non-seminomas (teratomas, choriocarcinomas), stromal tumors, and germ cell tumors; and thyroid cancer, which includes thyroid adenocarcinoma and medullary carcinoma. It will be understood that various different types of tumors can occur in specific organs, and these may differ, for example, in terms of clinical features and / or pathological features and / or molecular markers. Tumors occurring in various different organs are, for example, in the WHO Classification of Tumors series, 4. th ed or 3 rdThis is described in the ed (Pathology and Genetics of Tumors series), the International Agency for Research on Cancer (IARC), WHO Press, Geneva, Switzerland, all of which are incorporated herein by reference. In some embodiments, cancer is one in which mutation or overexpression of a particular gene is known or suspected to play a role in the development, progression, recurrence, etc., of cancer. In some embodiments, such genes are targets of genetic modification by the methods described herein. In some embodiments, the gene is an oncogene, proto-oncogene, or tumor suppressor gene. The term “oncogene” encompasses nucleic acids that, when expressed, may increase or contribute to the likelihood of cancer development or progression. Sequences in normal cells (“proto-oncogenes”) may be activated and, through mutation and / or abnormal expression, become oncogenes (which may be named “activated oncogenes”). In various embodiments, oncogenes may include the complete coding sequence of a gene product, or a portion that retains at least partially the oncogenicity of the complete sequence, or a sequence that codes for a fusion protein. Oncogenic mutations can result in, for example, changes in protein activity (e.g., increased), loss of proper regulation, or changes in RA or protein levels (e.g., increased). Abnormal expression can result from, for example, chromosomal rearrangements that lead to juxtaposition with regulatory elements such as enhancers, epigenetic mechanisms, or amplification, which can lead to increased amounts of proto-oncogene products or their generation in inappropriate cell types. Proto-oncogenes often encode proteins that regulate or are involved in cell proliferation, differentiation, and / or apoptosis. These proteins include, for example, various transcription factors, chromatin remodelers, growth factors, growth factor receptors, signaling molecules, and apoptosis regulators. A TSG can be any gene whose loss or reduction of function of its expression product may increase or contribute to the likelihood of cancer development or progression. Loss or reduction of function may result from, for example, mutation or epigenetic mechanisms.Many TSGs typically encode proteins that function to suppress or negatively regulate cell proliferation and / or to promote apoptosis. Exemplary cancer genes of the methods disclosed herein include, for example, MYC, SRC, FOS, JUN, MYB, RAS, RAF, ABL, ALK, AKT, TRK, BCL2, WNT, HER2 / NEU, EGFR, MAPK, ERK, MDM2, CDK4, GLI1, GLI2, IGF2, TP53, and the like. Exemplary TSGs include, for example, RB, TP53, APC, NF1, BRCA1, BRCA2, PTEN, CDK inhibitory proteins (e.g., pl6, p21), PTCH, WT1, and the like. It will be understood that the names of many of these cancer genes and TSGs encompass multiple family members, and numerous other TSGs are known. In some embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is ER+ breast cancer. In some embodiments, the breast cancer is resistant to tamoxifen and contains an ER mutation. In some embodiments, the breast cancer is resistant to tamoxifen and overexpresses condensate components.
[0168] In some embodiments, the disease is a cardiovascular disease, such as atherosclerotic heart disease or vascular disease, congestive heart failure, myocardial infarction, cerebrovascular disease, peripheral arterial disease, cardiomyopathy.
[0169] In some embodiments, the disease is a mental disorder, a neurological disorder, or a neurodevelopmental disorder, such as schizophrenia, depression, bipolar disorder, epilepsy, autism, addiction. Neurodegenerative diseases include, for example, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, frontotemporal dementia.
[0170] In some embodiments, the disease is an autoimmune disease, e.g., acute disseminated encephalomyelitis, alopecia areata, antiphospholipid antibody syndrome, autoimmune hepatitis, autoimmune myocarditis, autoimmune pancreatitis, polyglandular autoimmune syndrome, autoimmune uveitis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), type 1 diabetes (e.g., juvenile diabetes), multiple sclerosis, scleroderma, ankylosing spondylitis, sarcoma, pemphigus vulgaris, bullous pemphigoid, psoriasis, myasthenia gravis, systemic lupus erythematosus, rheumatoid arthritis, juvenile arthritis, psoriatic arthritis These include inflammation, Behçet's syndrome, Reiter's disease, Berger's disease, dermatomyositis, polymyositis, antineutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatosis with polyangiitis (also known as Wegener's granulomatosis), microscopic polyangiitis, and Churg-Strauss syndrome), scleroderma, Sjögren's syndrome, anti-glomerular basement membrane antibody disease (including Goodpasture syndrome), dilated cardiomyopathy, primary biliary cirrhosis, thyroiditis (e.g., Hashimoto's thyroiditis, Graves' disease), transverse myelitis, and Guillain-Barré syndrome.
[0171] In some embodiments, the disease is a respiratory disease, such as allergies, asthma, chronic obstructive pulmonary disease, pulmonary hypertension, pulmonary fibrosis, and sarcoidosis, which affect the respiratory system.
[0172] In some embodiments, the disease is a kidney disease, such as polycystic kidney disease, lupus, renal impairment (nephrotic syndrome or nephritis), or glomerulonephritis (of any kind).
[0173] In some embodiments, the disease is, for example, age-related vision loss or hearing loss.
[0174] In some embodiments, the disease is an infectious disease, such as any disease caused by a virus, bacteria, fungus, or parasite.
[0175] In some embodiments, diseases exhibit hypermethylation (e.g., abnormal hypermethylation) or demethylation (e.g., abnormal demethylation) in the genomic sequence. For example, Fragile X syndrome exhibits hypermethylation of FMR-1. In some embodiments, the methods described herein may be used to treat or prevent diseases or disorders exhibiting abnormal methylation (e.g., hypermethylation or demethylation). In some embodiments, the agents disclosed herein preferentially integrate with condensates associated with abnormal methylation. For example, condensates (e.g., transcription condensates) may occur in regions associated with abnormally methylated sites or hypomethylated sites that cause abnormal gene transcription. In some embodiments, the agents described herein preferentially incorporate into such condensates and regulate (e.g., reduce) abnormal gene transcription. In some embodiments, the demethylated or hypomethylated sites are associated with oncogenes. In other embodiments, condensates (e.g., splicing speckle condensates, heterochromatin condensates) may occur in regions associated with abnormal hypermethylation that causes abnormal gene transcription. In some embodiments, the agents described herein are preferentially incorporated into such condensates and regulate abnormal gene transcription.
[0176] It will be understood that the classification of diseases in this specification is not intended to be limiting. Those skilled in the art will understand that various diseases can be appropriately classified into multiple different groups.
[0177] In some embodiments, the method further includes characterizing the incorporation (e.g., enrichment ratio) of multiple drugs (e.g., promising candidate drugs, promising candidate drugs from families with different structural features) into condensates for, for example, lead optimization, in vivo toxicity or efficacy testing, or Phase I clinical trials. In some embodiments, the steps include characterizing a candidate drug for a condensate or group of condensates, and (1) selecting a candidate that is not undesirably sequestered in a condensate(or more) that does not contain the target or is not expected to be active, or (2) selecting a candidate that is not enriched in a condensate(or more) that contains the target or is expected to be active, or at least not evicted from it. When optimizing a lead compound and selecting from a number of different optimized candidates, the method can help avoid selecting a candidate that is more likely than other candidates to enrich in condensates that do not contain the target (or a candidate that is more likely than other candidates to enrich in condensates that contain the target).
[0178] Some aspects of the present invention relate to a method for characterizing a first agent, comprising contacting the first agent with a composition comprising a condensate having at least one component such that the condensate contains at least a second agent, and measuring the ability of the first agent to cause the second agent to be removed from the condensate. Such a method may be useful, for example, for identifying an agent (first agent) that releases the second agent from the condensate. The release of an agent from the condensate may enhance the therapeutic activity of the agent, for example, if the therapeutic target of the second agent is not present in the condensate. Furthermore, such a method may be useful for identifying a first agent that has a higher affinity for a target in the condensate than the second agent.
[0179] In some embodiments, measuring the ability of the first agent to cause the removal of the second agent from the condensate includes measuring the loss of the second agent from the condensate (for example, by measuring the change in the amount, concentration, or ratio of the second agent inside or outside the condensate). The measurement may be performed by any method described herein (for example, by the spontaneous fluorescence or color of the second agent, Raman spectroscopy, NMR, mass spectrometry, chromatography, etc.). In some embodiments, the second agent has a detectable tag. In some embodiments, the second agent is measured by the detectable tag.
[0180] The first and second agents are not limited and may be any agents described herein. The condensate components are also not limited and may be any condensate components described herein. In some embodiments, the condensate components are transcription condensate components. In some embodiments, the condensate components are located inside cells. The cells are not limited and may be any cells described herein. In some embodiments, the condensate is an in vitro condensate.
[0181] In some embodiments, the condensate components are targets of the second agent (for example, the second agent specifically binds to the condensate components). In some embodiments, the first agent removes the second agent from its target (for example, removes the second agent from the condensate).
[0182] Some aspects of the present disclosure relate to compositions comprising a condensate and a drug having a therapeutic target, wherein the condensate does not contain, or preferentially does not contain, the therapeutic target. In some embodiments, the condensate includes a detectable tag (e.g., the condensate includes a component having a detectable tag). In some embodiments, the drug has a detectable tag. In some embodiments, the drug and the condensate have detectable tags (e.g., different detectable tags).
[0183] Destruction of oncogenes
[0184] The inventors have for the first time demonstrated the presence of condensates containing MED1 and ER at Myc RNA transcription sites in primary breast cancer. See, for example, Figure 7. The presence of MED1 in Myc RNA transcription site condensates has also been confirmed in colon cancer, Burkitt lymphoma, multiple myeloma, prostate cancer, and breast cancer cell lines. See, for example, Figures 8-9. Other condensate components, including topoisomerase, proteasomes, CDK6, CDK7, p300, and BRD4, have also been found in Myc RNA transcription site condensates. See Figure 11. Using colon cancer cell lines and GFP-labeled MED1, BRD4, or POL2, it has been shown that various inhibitors, intercalators, and cyclin-dependent kinase inhibitors can lyse condensates at Myc RNA transcription sites, induce genomic release from condensates, or selectively remove components from condensates. See Figures 14 and 16-19. Finally, it is shown herein that ER is not incorporated into the condensate in the presence of tamoxifen, and that the drug that dissolves the condensate is enriched within the condensate before it dissolves. See Figures 20, 22, and 24.
[0185] Accordingly, several embodiments of the present invention relate to a method for reducing the transcription of an oncogene, comprising modifying the composition of a transcription condensate associated with the oncogene, dissolving the transcription condensate, or dissociating the transcription condensate. In some embodiments, the transcription condensate is modified by contacting the transcription condensate with a drug. In some embodiments, the drug dissolves the transcription condensate, cleaves the transcription condensate from the genomic DNA containing the oncogene, or eliminates one or more components of the transcription condensate.
[0186] The drug is not limited and may be any drug described herein. In some embodiments, the drug is an inhibitor, an intercalator, or a cyclin-dependent kinase inhibitor. In some embodiments, the drug binds to components of the transcription condensate. In some embodiments, the components are BRD4, p300, CDK7, CDK6, proteasomes, topoisomerases, transcription factors (e.g., nuclear receptors, estrogen receptors), mediators, mediator components, or enhancers. In some embodiments, the drug binds to components of the transcription condensate and either lyses the transcription condensate, cleaves the transcription condensate from genomic DNA containing oncogenes, or eliminates one or more components of the transcription condensate (e.g., eliminates the component to which the drug is bound or a component that is a binding partner of the component to which the drug is bound).
[0187] In some embodiments, the agent preferentially dissolves the transcription condensate, cleaves the transcription condensate from genomic DNA containing oncogenes, or, if the condensate contains one or more specific condensate components, eliminates one or more components of the transcription condensate. The components may be and are not limited to any components described herein. In some embodiments, the components may be BRD4, p300, CDK7, CDK6, proteasomes, topoisomerases, transcription factors (e.g., nuclear receptors, estrogen receptors), mediators, mediator components, or enhancers.
[0188] In some embodiments, the condensate is an in vitro condensate as described herein. In some embodiments, the condensate may be present within cells. The cells are not limited and may be any cells described herein. In some embodiments, the cells are cancer cells. In some embodiments, the cells are colon cancer cells, lymphoma cells, multiple myeloma cells, prostate cancer cells, or breast cancer cells.
[0189] In some embodiments, the cells are present in a subject. In some embodiments, the subject is a mammal (e.g., human, non-human primate, rodent, dog, cat, cow). In some embodiments, the subject is a human having cancer. The cancer is not limited and can be any cancer described herein. In some embodiments, the cancer has deregulation of Myc gene expression. In some embodiments, the agent reduces the transcription of the MYC cancer gene in the subject's cancer cells by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more. In some embodiments, the cancer has deregulation of a cancer gene selected from SRC, FOS, JUN, MYB, RAS, ABL, HOXI1, HOXI1 1L2, TAL1 / SCL, LMO1, LMO2, EGFR, MYCN, MDM2, CDK4, GLI1, IGF2, activated EGFR, mutant genes such as FLT3-ITD, mutant forms of TP53, PAX3, PAX7, BCR / ABL, HER2 / NEU, FLT3R, FLT6-ITD, SRC, ABL, TAN1, PTC, B-RAF, PML-RAR-α, E2A-PRX1, and NPM-ALK, and fusions of members of the PAX and FKHR gene families. In some embodiments, the agent reduces the transcription of the cancer gene in the subject's cancer cells by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 99%, or more.
[0190] In some embodiments, a drug is administered to a subject having cancer, thereby treating the cancer. As used herein, “treatment” encompasses any treatment of a disease or condition (e.g., cancer) in a mammal, particularly a human, and includes: (a) preventing the onset of symptoms of the disease or condition (e.g., cancer) in a subject who may be predisposed to the disease or condition but has not yet begun to experience symptoms; (b) suppressing the disease or condition (e.g., preventing its onset); or (c) alleviating the disease or condition (e.g., resulting in improvement of one or more symptoms that cause regression of the disease or condition). The method of administration is not limited and may be any preferred method of administration.
[0191] The drug may be administered in a pharmaceutically acceptable liquid formulation, which may typically contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, suitable carriers, adjuvants, and optionally other therapeutic components.
[0192] The drug may be formulated in solid, semi-solid, liquid, or gaseous form, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, inhalants, and injections, as well as preparations of a standard form for oral administration, parenteral administration, or surgical procedures. The present invention also encompasses pharmaceutical compositions formulated for topical administration (e.g., by implants).
[0193] Compositions suitable for oral administration may be provided as individual units such as capsules, tablets, or licks, each containing a predetermined amount of the active agent. Other compositions include suspensions of aqueous or non-aqueous liquids, such as syrups, elixirs, or emulsions.
[0194] In some embodiments, the drug may be administered directly to tissue. Direct administration to tissue may be achieved by direct injection. The drug may be administered once, or alternatively, they may be administered in multiple doses. If administered in multiple doses, the peptide may be administered via different routes. For example, the first (or first few) doses may be administered directly to the affected tissue, while subsequent doses may be systemic.
[0195] For oral administration, compositions can be readily formulated by mixing the drug with a pharmaceutically acceptable carrier known in the art. Such carriers enable the formulation of the drug as tablets, pills, sugars, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral intake by the subject being treated. Pharmaceutical formulations for oral use can be obtained as solid excipients. The resulting mixture may be optionally ground, and the granular mixture may be processed after adding suitable excipients to obtain tablets or sugar cores, as needed. Suitable excipients include fillers, such as sugars containing lactose, sucrose, mannitol, or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If necessary, disintegrants such as cross-linked polyvinylpyrrolidone, agar, or alginic acid, or their salts such as sodium alginate, may be added. Optionally, oral formulations may be formulated in saline or buffer to neutralize internal acidic conditions, or they may be administered without any carrier.
[0196] The sugar core is provided with a suitable coating. For this purpose, a concentrated sugar solution may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbo polgel, polyethylene glycol, and / or titanium dioxide, a lacquer solution, and a suitable organic solvent or solvent mixture. Dyes or pigments may be added to the tablet or sugar coating for identification or to characterize different combinations of active compound doses.
[0197] Pharmaceutical formulations that can be used orally include push-fit capsules made of gelatin, and soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. Push-fit capsules contain the active ingredient mixed with the active ingredient, a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate, and optionally a stabilizer. In soft capsules, the active compound can be dissolved or suspended in a suitable liquid, such as fatty oil, liquid paraffin, or liquid polyethylene glycol. In addition, stabilizers may be added. Microspheres formulated for oral administration may be used. Such microspheres have been described in detail in the art. All formulations for oral administration must be in a dose suitable for such administration. For buccal administration, the composition may take the form of tablets or lollipops formulated in the conventional way.
[0198] Compounds may be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion, if systemic delivery is desired. Formulations for injection may be provided in unit dosage forms, for example, in ampoules or multi-dose containers with added preservatives. Compositions may take the form of suspensions, liquids, or emulsions in oily or aqueous vehicles and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants.
[0199] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, and include physiological saline and buffer media. Parenteral vehicles include sodium chloride solution, ringer's dextrose, dextrose and sodium chloride, Ringer's lactate solution, or non-volatile oils. Intravenous vehicles include fluids and nutritional supplements, and electrolyte supplements (e.g., ringer's dextrose-based). Preservatives and other additives, such as antimicrobial agents, antioxidants, chelating agents, and inert gases, may also be present. If the target response is insufficient with the initial dose applied, higher doses (or doses with a greater effect via a more localized or different delivery route) may be used up to the extent permitted by the patient's tolerance. In some embodiments, multiple daily doses are considered to achieve an appropriate systemic concentration of the compound. In some embodiments, the method further includes administering an effective amount of at least one chemotherapeutic agent to the subject. The chemotherapeutic agent is not limited and may be any suitable chemotherapeutic agent known in the art.
[0200] Some aspects of the present invention relate to a method for treating a subject requiring treatment for a cancer characterized by the transcription of an oncogene, the method comprising administering to the subject an agent that modifies the composition of a transcription condensate associated with the oncogene, or that dissolves or dissociates the transcription condensate.
[0201] The drug is not limited and may be any drug described herein. In some embodiments, the drug is a small molecule, polypeptide, or nucleic acid. In some embodiments, the drug is a drug that has been shown to be preferentially sequestered within a transcription condensate that associates with an oncogene, or to have components of a transcription condensate that associate with an oncogene. In some embodiments, the drug is an inhibitor, intercalator, or cyclin-dependent kinase inhibitor. In some embodiments, the drug binds to components of the transcription condensate. The components are not limited and may be any transcription condensate components described herein (e.g., mediator components, MED1). In some embodiments, the drug is preferentially concentrated within the transcription condensate.
[0202] Cancer is not limited to any cancer described herein. In some embodiments, cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.
[0203] The subjects are not limited and may be any subjects described herein. In some embodiments, the subjects are human.
[0204] The drug may be present in the composition. The composition is not limited and may be any composition described herein. The method of administering the drug is also not limited and may be any method of administration described herein. In some embodiments, the drug is administered orally, subcutaneously, topically, or intravenously.
[0205] Inhibition of transcription mediated by nuclear receptors
[0206] Some aspects of the present invention relate to a method for inhibiting transcription associated with a transcription condensate, comprising inhibiting the binding of a nuclear receptor having an LXXLL-binding domain and associated with the transcription condensate to a cofactor having an LXXLL domain by contacting the condensate with a peptide that binds to the LXXLL-binding domain of the nuclear receptor.
[0207] The nuclear receptor is not limited as long as it can bind to a cofactor having an LXXLL domain, at least when bound to its ligand. In some embodiments, the nuclear receptor is a nuclear hormone receptor, an estrogen receptor, or a retinoic acid receptor α. The cofactor is not limited as long as it has an LXXLL domain. Cofactors having an LXXLL motif are known in the art. In some embodiments, the cofactor is MED1.
[0208] In some embodiments, the binding of nuclear receptors to cofactors is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9%, or more, compared to baseline levels (e.g., untreated control cells or condensates). In some embodiments, transcription associated with transcription condensates is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9%, or more, compared to a baseline level (e.g., untreated control cells or condensates). In some embodiments, transcription of an oncogene is inhibited. The oncogene is not limited and may be any oncogene described herein. In some embodiments, the oncogene is Myc.
[0209] In some embodiments, the transcription condensate is an in vitro transcription condensate. In some embodiments, the transcription condensate is present within a cell. The cell is not limited and may be any cell described herein. In some embodiments, the cell is a cancer cell. The cancer is not limited and may be any cancer described herein. In some embodiments, the methods disclosed herein may be used to treat a disease or condition associated with abnormal activity or expression of nuclear receptors. The disease or condition may be any one described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer.
[0210] The peptide is not limited insofar as it binds to the LXXLL binding domain. In some embodiments, the peptide contains, consists of, or essentially consists of the peptide sequence QNPILTSLLQITG (SEQ ID NO: 1). In some embodiments, the peptide contains, consists of, or essentially consists of an acidic residue (e.g., polyglutamic acid) or a basic residue (e.g., polylysine).
[0211] In some embodiments, the peptide includes a protein transduction domain (PTD). The PTD is not limited and may be any PTD described herein. In some embodiments, the PTD is HIV-TAT.
[0212] In some embodiments, peptides are administered to a subject to treat a disease or condition associated with abnormal activity or expression of nuclear receptors. The disease or condition may be any of those described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer. The method of administration is not limited and may be any method of administration of the drug as described herein. In some embodiments, peptides are administered as a composition. The composition is not limited and may be any composition described herein for the administration of the drug.
[0213] Some aspects of the present invention relate to a method for inhibiting transcription associated with a transcription condensate, comprising inhibiting the binding of a nuclear receptor having an LXXLL-binding domain and associated with the transcription condensate to a cofactor having an LXXLL domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain of the cofactor.
[0214] In some embodiments, the binding of nuclear receptors to cofactors is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9%, or more, compared to baseline levels (e.g., untreated control cells or condensates). In some embodiments, transcription associated with transcription condensates is inhibited by at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, about 99.5%, about 99.9%, or more, compared to a baseline level (e.g., untreated control cells or condensates). In some embodiments, transcription of an oncogene is inhibited. The oncogene is not limited and may be any oncogene described herein. In some embodiments, the oncogene is Myc.
[0215] In some embodiments, the transcription condensate is an in vitro transcription condensate. In some embodiments, the transcription condensate is present within a cell. The cell is not limited and may be any cell described herein. In some embodiments, the cell is a cancer cell. The cancer is not limited and may be any cancer described herein. In some embodiments, the methods disclosed herein may be used to treat a disease or condition associated with abnormal activity or expression of nuclear receptors. The disease or condition may be any one described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer.
[0216] The peptide is not limited insofar as it binds to the LXXLL domain. In some embodiments, the peptide includes a protein transduction domain (PTD). The PTD is not limited and may be any PTD described herein. In some embodiments, the PTD is HIV-TAT.
[0217] In some embodiments, peptides are administered to a subject to treat a disease or condition associated with abnormal activity or expression of nuclear receptors. The disease or condition may be any of those described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer. The method of administration is not limited and may be any method of administration of the drug as described herein. In some embodiments, peptides are administered as a composition. The composition is not limited and may be any composition described herein for the administration of the drug.
[0218] Inhibition of transcription related to the overexpression of condensate components
[0219] As shown in the following examples, tamoxifen-resistant ER+ breast cancer cell lines overexpressing MED1 contain MED1-containing condensates with a larger volume than those containing MED1 in breast cancer cells that do not overexpress MED1. Furthermore, the examples show that when tamoxifen is brought into contact with a MED1 in vitro condensate (e.g., a droplet) having a four-fold increase in MED1 levels, the condensate contains a much lower concentration of tamoxifen.
[0220] Accordingly, some aspects of the present invention relate to methods for suppressing the growth or proliferation of cancer cells that exhibit resistance to anticancer agents (e.g., tamoxifen) by overexpressing condensate components (e.g., MED1). In some embodiments, the method includes inhibiting the expression of condensate components or the activity that forms condensates. In some embodiments, the method includes contacting the condensate with modified condensate components that increase the distribution of the anticancer agent into the condensate. For example, in some embodiments, the condensate components may be modified to increase the content of aromatic side chains, thereby increasing the affinity of the condensate containing the modified components for agents having aromatic side chains. In some embodiments, a condensate having an increased level of condensate components may be contacted with an anticancer agent and an agent having affinity for the condensate, thereby increasing the concentration of the anticancer agent in the condensate. In some embodiments, the anticancer agent may be modified to increase its distribution into the condensate. For example, in some embodiments, the anticancer agent (e.g., tamoxifen) may be modified to increase the number of aromatic side chains, thereby increasing its distribution into a condensate containing condensate components having aromatic side chains.
[0221] Another aspect of the present invention involves determining whether a cancer that overexpresses a gene and exhibits resistance to an anticancer drug contains larger condensates than the corresponding condensates in a cancer that does not overexpress the gene. In some embodiments, the overexpressed gene is related to resistance to the anticancer drug. In some embodiments, the concentration of the anticancer drug in the increased condensates from the resistant cancer is compared to the concentration of the anticancer drug in a non-resistant cancer that does not overexpress the gene.
[0222] Some embodiments further include providing an enlarged condensate or an in vitro condensate (e.g., a droplet) containing an overexpressed gene product derived from a resistant cancer. In some embodiments, the enlarged condensate or in vitro condensate is contacted with one or more modified anticancer agents, and the concentration of the modified anticancer agents in the contacted condensate is determined. In some embodiments, a library of modified anticancer agents is contacted with the condensate, and the concentration of the modified anticancer agents is determined to screen for modified anticancer agents effective against resistant cancers.
[0223] *** The description of embodiments of this disclosure is not intended to be exhaustive or to limit the disclosure to the exact form disclosed. Specific embodiments of the disclosure and examples for the disclosure are described herein for illustrative purposes, but various equivalent modifications are possible within the scope of the disclosure, as will be understood by those skilled in the art. For example, while method steps or functions are shown in a given order, alternative embodiments may perform the functions in a different order, or the functions may be performed substantially simultaneously. The teachings of the disclosure provided herein may be applied to other procedures or methods as needed. The various embodiments described herein may be combined to provide further embodiments. The aspects of the disclosure may be modified as needed to use the compositions, functions, and concepts of the above-mentioned references and uses to provide further other embodiments of the disclosure. These and other modifications may be made herein in consideration of forms for carrying out the invention.
[0224] Certain elements of any of the embodiments described above may be combined with or used in place of elements of other embodiments. Furthermore, while advantages related to specific embodiments of this disclosure are described in the context of those embodiments, other embodiments may also demonstrate such advantages, and not all embodiments are necessarily required to demonstrate such advantages in order to fall within the scope of this disclosure.
[0225] All specified patents and other publications are incorporated herein by express reference, for example, to describe and disclose the methods described in such publications that may be used in connection with the present invention. These publications are provided only for their disclosures prior to the filing date of this application. In this regard, this should not be construed as an acceptance that the inventors have no prior rights to such disclosures for prior invention or prior publication or for any other reason. All statements regarding the dates or content of these documents are based on information available to the applicant and do not constitute any endorsement of the accuracy of the dates or content of these documents.
[0226] Those skilled in the art will readily understand that the present invention can be well adapted to achieve its purpose and obtain the described results and benefits, as well as what is inherent therein. The details of the descriptions and examples herein represent specific embodiments and are illustrative, and are not intended to limit the scope of the invention. Those skilled in the art will conceive of modifications and other uses therein. These modifications are included within the scope of the gist of the invention. It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention.
[0227] When used herein, the articles “a” and “an” should be understood to include plural references unless expressly otherwise stated in this specification and in the claims. A claim or statement containing “or” between one or more members of a group is deemed to apply unless otherwise stated or otherwise evident from the context, if one, two or more, or all of the members of that group are present in, used in, or otherwise related to a given product or process. The present invention includes embodiments in which exactly one member of a group is present in, used in, or otherwise related to a given product or process. The present invention also includes embodiments in which two or more, or all, of the members of a group are present in, used in, or otherwise related to a given product or process. Furthermore, unless specifically stated or unless it is obvious to those skilled in the art that a contradiction or inconsistency would occur, the present invention should be understood to provide all variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the enumerated claims are introduced into another claim (or any other related claim) dependent on the same basic claim. All embodiments described herein are intended to be applicable to all different aspects of the Invention as necessary. Any embodiment or aspect may be freely combined with one or more other such embodiments or aspects as necessary. Where elements are presented enumerated, for example, in Markush group form or similar form, each subgroup of the element is also disclosed, and any element(s) may be removed from the group. Generally, where the Invention or an aspect of the Invention is considered to include certain elements, features, etc., it should be understood that a particular embodiment or aspect of the Invention consists of, or essentially consists of, such elements, features, etc. For brevity, such embodiments may not be specifically described herein in these terms. It should also be understood that any embodiment or aspect of the Invention may be expressly excluded from the claims, regardless of whether specific exclusions are described herein.For example, any one or more active agents, additives, components, any drug, type of organism, disorder, subject, or combination thereof may be excluded.
[0228] Where the claims or description relate to a composition, unless otherwise specified, or unless it is obvious to those skilled in the art that a contradiction or inconsistency would occur, it should be understood that a method of preparing or using a composition according to any of the methods disclosed herein, and a method of using a composition for any of the purposes disclosed herein, are aspects of the present invention. Where the claims or description relate to a method, unless otherwise specified, or unless it is obvious to those skilled in the art that a contradiction or inconsistency would occur, it should be understood that, for example, a method of preparing a composition useful for carrying out such method, and a product produced by such method, are aspects of the present invention.
[0229] Where a range is given herein, the present invention encompasses embodiments in which an endpoint is included, embodiments in which an endpoint is excluded, and embodiments in which one endpoint is included and the other is excluded. Unless otherwise specified, it should be assumed that both endpoints are included. Furthermore, unless otherwise specified, or unless otherwise evident from the context and the understanding of those skilled in the art, values expressed as a range should be understood to mean any specific value or subrange within the range expressed in different embodiments of the present invention, up to one-tenth of the lower limit unit of the range, unless the context clearly indicates otherwise. Where a set of numerical values is expressed herein, the present invention also encompasses embodiments relating to a range defined by any value between any two values in that set, and it should be understood that the lowest value may be the minimum value and the highest value may be the maximum value. As used herein, numerical values include values expressed as percentages. In any embodiment of the present invention in which “about” or “approximately” precedes a numerical value, the present invention encompasses embodiments in which exact values are listed. In any embodiment of the present invention in which "about" or "approximately" is not placed before a numerical value, the present invention also includes embodiments in which "about" or "approximately" is placed before a value.
[0230] "Approximately" or "about" generally means a number within 1% in both directions (greater than or less than a certain number), or in some embodiments, a number within 5%, or in some embodiments, a number within 10% (unless such a number unacceptably exceeds 100% of the possible values). Unless explicitly stated otherwise, in any method claimed herein that includes two or more actions, the order of the actions of the method is not necessarily limited to the order in which the actions of the method are enumerated, but it should be understood that the present invention includes embodiments in which the order is thus limited. Also, unless explicitly stated otherwise, or it should be understood that any product or composition described herein may be considered "isolated." [Examples]
[0231] Example 1
[0232] Formation of in vitro condensates:
[0233] It is known that numerous condensate components form in vitro condensates. Generally, one or more condensate components are added to a solution (e.g., aqueous solution) at different concentrations in the presence of a salt (e.g., NaCl) and optionally a crowding agent (e.g., polyethylene glycol, Ficol). See, for example, Boija et al, Cell, vol.175, no.7, pp.1842-1855 (2018); Sabari et al., Science, vol.361, pp.361-371 (2018); Bergeron-Sandoval et al., Cell, vol.165, no.5, pp.1067-1079 (2016). May 19;165(5):1067-1079 (in particular these related methods are incorporated herein). In some embodiments, an in vitro condensate containing MED1 is formed by adding about 10 μM of MED1 to a solution containing 150 μM NaCl and 10% PEG (e.g., PEG-8000). In some embodiments, an in vitro condensate containing MED1 and estrogen receptor (ER) is formed by adding about 10 μM of each of MED1 and ER to a solution containing 150 μM NaCl and 10% PEG (e.g., PEG-8000) or 16% Ficol-400.
[0234] Condensation imaging
[0235] Methods for imaging in vitro and intracellular condensates have been taught in the art and are not limited thereto. In some embodiments, deconvolution microscopy, structured illumination microscopy, or interference microscopy are used to image condensates. See, for example, Boija et al., Cell, vol. 175, no. 7, pp. 1842-1855 (2018) and Sabari et al., Science, vol. 361, pp. 361-371 (2018) (in particular these relevant methods are incorporated herein).
[0236] In some specific embodiments, cells containing the relevant condensates are grown on a 35 mm glass plate and imaged in 2i / LIF medium using an LSM880 confocal microscope equipped with an Airyscan detector. The cells are heated to 37°C and imaged on a stage supplemented with humidified air at 37°C. In addition, the microscope is surrounded by an incubation chamber heated to 37°C. A ZEN black edition, version 2.3 (Zeiss, Thornwood NY) may be used for acquisition. Images may be acquired using a Plan-Apochromat 63x / 1.4 oil immersion objective lens in super-resolution (SR) mode with an Airyscan detector. Raw Airyscan images may be processed using a ZEN 2.3 (Zeiss, Thornwood NY).
[0237] In some embodiments, DNA-FISH or RNA-FISH may be used to locate the relevant condensates within cells by labeling the location of the relevant RNA transcription or genomic DNA (e.g., Myc). See, for example, Boija et al, Cell, vol. 175, no. 7, pp. 1842-1855 (2018). This technique may be used in combination with other methods disclosed herein (e.g., fluorescence microscopy of tagged drugs) to determine whether a drug colocalizes with the relevant condensates.
[0238] To analyze in vitro phase separation imaging experiments, MATLAB® scripts can be written to identify droplets and characterize their size, aspect ratio, enrichment ratio, and partition coefficient. Under any specific experimental conditions, histogram peaks and intensity thresholds based on size thresholds (2-pixel radius) can be used to partition the image, at which point regions of interest can be defined, and signal intensities inside and outside droplets can be quantified.
[0239] Calculation of the distribution coefficient
[0240] As used herein, the partition coefficient or enrichment ratio is the ratio of the concentrations of a compound (e.g., a drug) inside a condensate and outside the condensate (e.g., the surrounding solution). The distribution coefficient of a drug may be obtained as described herein using any suitable technique for determining the concentration of the drug, e.g., the microscopy technique described herein. In some embodiments, the distribution coefficient in live-cell imaging may be calculated using Fiji. Using a single focal plane for each cell, the average signal intensity within the condensate may be quantified and compared with the average signal intensity from 8 to 12 non-heterochromatin regions within the nuclear boundary of the cell. The heterochromatin regions and nuclear boundaries may be defined by Hoechst channels. For quality control, the distribution coefficient may be calculated for cells having more than 3 heterochromatin formations within a selected plane.
[0241] Example 2
[0242] The nucleus contains diverse phase-separated condensates that compartmentalize and concentrate biomolecules with different physicochemical properties. It was hypothesized whether these condensates concentrate small molecule cancer drugs in a way that alters their pharmacodynamic properties. It was discovered that anti-cancer drugs concentrate within specific protein condensates in vitro, and this occurs independently of the drug target due to their physicochemical properties. This behavior was also observed in tumor cells where drug distribution affected drug activity. Altering the properties of the condensates was found to influence drug concentration and activity. These results suggest that the selective distribution and concentration of small molecules within condensates contribute to the pharmacodynamics of drugs, and that a further understanding of this phenomenon could advance disease treatment.
[0243] The 5 to 10 billion protein molecules in a cell are compartmentalized within membrane-enclosed and unmembrane-enclosed organelles (1-3). Numerous unmembrane-enclosed organelles are phase-separated biomolecular condensates with different physicochemical properties that can absorb and concentrate specific proteins and nucleic acids (4-17). Selective distribution to condensates can also occur for small molecule drugs whose targets reside within these condensates (Figure 28A), and therefore, it was hypothesized that the therapeutic index and efficacy of such compounds may be related to their ability to distribute into condensates containing their targets. To test this idea, this study focused on collecting nuclear condensates previously reported in various cell lines, demonstrating their presence in both normal human and tumor cells. Subsequently, in vitro condensate droplet assays were developed using key components of each nuclear condensate to enable testing of small molecules.
[0244] While nuclear condensates had been described in various cultured cell lines, the presence of transcription condensates, splicing condensates, heterochromatin condensates, and nucleolar condensates in cells of primary human normal and primary human malignant tissues had not yet been demonstrated. Each of these condensates contains one or more proteins that can function as both a condensate marker and a scaffold for condensate formation in in vitro droplet assays (10-12, 18-32). Specifically, transcription condensates are characterized by the condensate-forming proteins MED1 and BRD4 (10, 12, 19), splicing speckles by SRSF2 (11, 20), heterochromatin by HP1α (21, 22), and nucleolar condensates by FIB1 and NPM1 (23-25) (Figure 32A). To determine whether such condensates can be observed in cells of healthy and malignant human tissues, the inventors collected biopsies of ductal epithelium, invasive ductal carcinoma, normal colon, and colon cancer (Figures 32B, 32C). Immunofluorescence revealed nuclear structures containing these marker proteins in both normal and transformed tissues (Figures 1B, 1C). The size and number of nuclear structures showed a broad distribution as expected for dynamic biomolecular condensates, and no significant differences were observed between benign and malignant tissues (Figures 33A-33C). However, tumor cells acquire long super-enhancers in driver oncogenes (33), which can form tumor-specific transcription condensates, as described below.
[0245] Assays were developed to model these nuclear condensates and to study the behavior of small molecules within these droplets (Figure 28D). The proteins characterizing each nuclear condensate have been previously shown to form condensates independently in vitro (10, 11, 21, 23). Fluorescently labeled recombinant versions of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 (Figure 34) were prepared and purified, and the ability of these proteins to form droplets was confirmed in in vitro assays (Figures 35A, 35B). To investigate the partitioning behavior of small molecules, the dyes fluorescein (332Da) and Hoechst (452Da) were initially added, followed by an average of 4.4 kilodaltons (kDa) of fluorescently labeled dextran, to solutions containing each of the six protein condensates. The dyes and dextran appeared to diffuse through all condensates without substantially partitioning (Figures 28E, 36, 37A-37D). Since small molecule drugs are generally smaller than 1 kDa, these results suggest that, unless there are other factors besides size that affect distribution, small molecule drugs can diffuse freely through these nuclear condensates.
[0246] Next, we attempted to determine whether various clinically important drugs with targets present in nuclear condensates also exhibit free diffusion across these condensates. We initially focused on cisplatin and mitoxantrone, members of the antitumor compound class, which can be modified to have fluorescent properties (cisplatin) by platinumization or intercalation of DNA (34) or are intrinsically fluorescent (mitoxantrone). When added to droplet-forming buffers containing purified MED1, BRD4, SRSF2, HP1α, FIB1, or NPM1, cisplatin was found to be selectively enriched within MED1 droplets with a partition coefficient of up to 600 (Figures 39A-39C) (Figures 29A, 38A). Fluorescence modification of cisplatin did not appear to contribute to this behavior in vitro, as modified drugs could be displaced from the condensates by unmodified cisplatin, and isomers of cisplatin did not exhibit the same behavior (Figures 38B-38D). Mitoxantrone was also enriched in the MED1 condensate, as well as in the FIB1 and NPM1 condensates (Figures 29B, 38A, 39A-39C). Consistent with these results, it is known that mitoxantrone enriches in nucleoli where FIB1 and NPM1 are present (35, 36). These results indicate that the condensates formed in vitro possess physicochemical properties that allow for the selective enrichment of specific small molecule drugs even in the absence of drug targets.
[0247] Antineoplastic drugs targeting transcription factors expected to be contained within transcription condensates in cells were selected for further study. These targets included a) the estrogen receptor (ER), a transcription factor and nuclear hormone receptor; b) CDK7, a cyclin-dependent kinase that functions in transcription initiation and cell cycle regulation; and c) BRD4, a bromodomain protein and coactivator involved in oncogene regulation (Figure 40). To monitor drug behavior using confocal fluorescence microscopy, a fluorescent tamoxifen analog targeting the ER (FLTX1), as well as modified fluorescent THZ1 and JQ1 targeting CDK7 and BRD4, respectively (37, 38), were used. These compounds were added in parallel with droplet formation assays using MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 proteins. FLTX1 and THZ1 were preferentially enriched within the MED1 droplet (Figures 29C-29D, 38A), and this behavior was not attributable to the fluorescence moiety (Figures 38B, 38D). JQ1 showed a different enrichment pattern, being enriched within the MED1, BRD4, and NPM1 droplets (Figures 29E, 38A, 38B). Supporting these results, it was found that the low molecules enriched within the MED1 condensate were also enriched within condensates formed from purified complete mediator complexes (Figure 41) and MED1 condensates formed with alternative crowding agents (Figure 42). The targets of these three compounds (the bromodomains of ERα, CDK7, and BRD4) are not present in these in vitro condensates, but are present in super-enhancers that form condensates in vivo along with transcription factors and mediators (10, 12, 39) (Figures 40A, 40B). This suggests that the ability of some small molecules to preferentially concentrate in the same condensates as their protein targets may contribute to the pharmacological properties of these drugs.
[0248] To gain further insight into the nature of the interactions governing the enrichment of small molecules within the condensate, the study focused on MED1-IDR condensates. Photobleaching-recovery fluorescence (FRAP) experiments demonstrated the high mobility of cisplatin molecules in these condensates (Figures 43A, 43B). This suggests that the condensates create a biochemical environment that promotes drug concentration in a state of dynamic, high mobility. To gain insight into the chemical characteristics of small molecules that may contribute to selective association with MED1 within the condensate, a library of 81 small molecules was used in which the fluorescent molecule borondipyrrometene (BODIPY) was modified with various combinations of chemical side groups (Figure 44A), and the relative ability of these molecules to enrich within the MED1 condensate was measured by confocal fluorescence microscopy. It was found that molecules containing aromatic rings preferentially enriched within the MED1 condensate (Figures 44A-44D, Figure 45A). This suggests that π-π interactions or π-cation interactions are part of the physicochemical properties that favor the distribution of small molecules into MED1 condensates. The number of aromatic amino acids in MED1 exceeds that of other condensate-forming proteins studied herein (Figure 34B), which may contribute to such interactions. To investigate this possibility, mutant MED1 proteins were created in which all 30 aromatic amino acids were mutated to alanine, and their ability to form condensates and enrich small molecules was tested (Figure 45B). The aromatic mutant MED1 protein retained the ability to form droplets in vitro, suggesting that aromatic amino acids are not required for droplet formation (Figure 45C), but small molecule probes containing aromatic rings and the polar molecule cisplatin no longer distributed into condensates formed by the aromatic mutant MED1 protein (Figures 45D, 45E). These results suggest that the aromatic residues in MED1 condensates contribute to the physicochemical properties that selectively enrich these small molecules.
[0249] The ability of small molecules to concentrate within specific condensates was expected to influence target binding and, consequently, the pharmacodynamics of the drug. To investigate this, the ability of MED1 and HP1α condensates to incorporate DNA (Figure 30A) was utilized, and the relative efficiency of cisplatin-induced DNA platinumization by cisplatin in MED1 condensates, where cisplatin is concentrated, was measured compared to HP1α condensates, where cisplatin diffuses freely (Figure 29A). DNA and proteins were mixed under droplet formation conditions, and once the DNA was strongly distributed into the droplet phase (Figure 46), these condensates were treated with cisplatin, and DNA platinumization was visualized by size shift using a bioanalyzer. The results showed that DNA was platinumized more efficiently in MED1 condensates than in HP1α condensates, consistent with the expectation that increased cisplatin concentration in MED1 condensates would lead to enhanced target binding (Figure 30B). When cisplatin is concentrated within cellular mediator condensates, DNA co-localized with the mediator condensates is expected to be preferentially platinumized. To test this idea, co-immunofluorescence was performed on cisplatin-treated HCT116 colon cancer cells using an antibody that specifically recognizes platinum-plated DNA (40) (Figure 47A) together with antibodies specific to MED1, HP1α, or FIB1. Consistent with cisplatin's preference over MED1 condensates in vitro, platinum-plated DNA was found to frequently co-localize with MED1 condensates but not with HP1α or FIB1 condensates (Figure 30C). To determine whether cisplatin's ability to bind to DNA depends on the presence of MED1 condensates, cells were treated with JQ1, which induced a loss of MED1 condensates (Figure 47B), and a corresponding decrease in platinum-plated DNA was observed in the MYC oncogene (Figures 47C, 47D). These results are consistent with the idea that the enrichment of small molecules within specific condensates may affect the efficiency of target binding.
[0250] In cells, preferential modification of DNA within MED1-containing condensates is expected to selectively disrupt these condensates upon prolonged treatment. To verify this, HCT116 colon cancer cells were genetically engineered to express GFP-labeled marker proteins for each of six types of nuclear condensates (Figures 48A-48F, 49A, and 49B). Upon exposure to cisplatin, a selective and progressive reduction of MED1 condensates was observed (Figures 30D, 50A, 50B, and 51). Consistent with this, cisplatin treatment induced preferential loss of MED1 ChIP-seq signaling in super-enhancers (Figures 40E and 52). Furthermore, data from high-throughput sequencing (41) of platinum-enhanced DNA pulldown revealed that cisplatin-modified DNA preferentially resided in super-enhancers (SEs) where MED1 was enriched (Figure 30F and 42). These results are consistent with reports that cisplatin preferentially modifies transcribed genes (41, 43), and we argue that this effect is due to preferential distribution to condensates. In summary, these results suggest a model in which cisplatin preferentially modifies SE DNA, which in turn leads to the lysis of these condensates. Previous studies have shown that various tumor cells become highly dependent on oncogene expression driven by super-enhancers (44-48). This may explain why platinum-based drugs, which can broadly modify DNA, are effective therapeutic agents in a variety of cancers (49).
[0251] To assess whether drug response and resistance are related to distribution within the condensate, the behavior of tamoxifen, another clinically important anti-cancer drug, was investigated (Figure 31A). ERα is incorporated into the MED1 condensate in an estrogen-dependent manner in vitro (12). This was confirmed by a droplet assay, revealing that the addition of tamoxifen resulted in the elimination of ERα from the MED1 condensate (Figure 31B). Due to its significant role in carcinogenesis and responsiveness to estrogen (50), the effects of estrogen and tamoxifen on the MED1 condensate in breast cancer cells were further investigated, focusing on the MYC oncogene. The MED1 condensate was observed on the MYC oncogene in the ER+ breast cancer cell line MCF7 (Figures 40A, 53A-53D). DNA FISH, along with MED1 IF, revealed that estrogen enhances the formation of MED1 condensates in MYC oncogenes, and that treatment with tamoxifen reduces these (Figures 54A and 54B). MED1 artificial condensates without ER enriched FLTX1 at the condensate site (Figure 55). This indicates that ER is not required for the distribution of FLTX1 into cellular MED1 condensates. These results are consistent with a model in which ERα interacts with MED1 condensates in an estrogen-dependent, tamoxifen-sensitive manner to drive oncogene expression in breast cancer cells.
[0252] The mechanisms that cause drug resistance can provide clues about drug activity in clinical settings. Tamoxifen resistance has long been an unresolved clinical challenge and can be mediated by multiple mechanisms, including ERα mutations and MED1 overexpression (Figures 31A, 56) (51, 52). To investigate whether ERα mutations alter the behavior of ERα in condensates, we created mutant ERα proteins from four patients and tested their distribution in the presence of tamoxifen. In contrast to WT ERα, condensates composed of patient-derived ERα mutants and MED1 were not destroyed by treatment with tamoxifen (Figures 31B, 57A, 57B). Point mutations in ERα reduced affinity for tamoxifen by approximately 10-fold (52), indicating that when this affinity is reduced, the concentration of the drug in droplets is insufficient to eliminate these mutant ER proteins.
[0253] MED1 overexpression is associated with tamoxifen resistance and poor prognosis in breast cancer (51), but it is unclear why overexpression of one subunit of the mediator complex causes resistance. It was hypothesized that overexpressed MED1 is incorporated into transcription condensates containing clusters of mediator molecules (39), thereby expanding their volume and diluting available tamoxifen (Figure 58A). It was found that tamoxifen-resistant breast cancer cell line TAMR7 (53), derived from the tamoxifen-sensitive cell line MCF7, produces four-fold higher levels of MED1 protein (Figure 58B). The volume of condensates containing MED1 is twice as large in these cells (Figures 31C, 58C). When modeled in an in vitro droplet assay, it was found that a four-fold increase in MED1 levels resulted in a corresponding increase in droplet size (Figures 59A, 59B). Furthermore, 100 μM tamoxifen prevented the uptake of ERα into MED1 condensates (Figures 31B, 31D), but it was found to be considerably less effective in preventing the uptake of ERα into larger MED1 condensates generated by higher levels of MED1 (Figure 31D). To confirm that tamoxifen levels are more diluted in larger droplets, enrichment with the fluorescent tamoxifen analog FLTX1 into MED1 droplets was measured, and it was found that larger condensates had lower concentrations of the drug (Figure 31E). These results were reproduced in cells where aggregates of anchored ERα molecules formed MED1 condensates (the condensates were removed by tamoxifen, but tamoxifen could not dissociate ERα-MED1 condensates when MED1 was overexpressed) (Figure 60). These results support a tamoxifen-resistant model in which MED1 overexpression leads to the formation of larger transcription condensates, in which tamoxifen is diluted, and thus less effective in separating the ER from the condensates (Figure 31F).
[0254] These results demonstrate that drugs can be selectively distributed within condensates, that this may occur due to physicochemical properties that exist independently of the drug's molecular target, and that cells can develop drug resistance through mechanisms that alter condensates. This may also explain the surprising observation that inhibition of global gene regulators such as BRD4 or CDK7 can selectively affect oncogenes that have acquired long super-enhancers (46). Selective distribution of inhibitors such as JQ1 and THZ1 into super-enhancer condensates would preferentially disrupt transcription at their respective loci. These results also have significance for the future development of effective disease treatments. Effective target binding depends on measurable factors such as drug distribution within condensates (Figures 61A-61D). Therefore, the types of condensate assays described herein may help optimize the distribution of small molecule drugs into condensates, target binding, and therapeutic index.
[0255] Materials and methods
[0256] cell line
[0257] The cell line was obtained as shown: TamR7 (ECACC 16022509). V6.5 mouse embryonic stem cells were donated by R. Jaenisch of the Whitehead Institute. V6.5 is a male cell line derived from a cross of C57BL / 6(F)×129 / sv(M). MCF7 cells were donated by R. Weinberg of the Whitehead Institute. HCT116 cells were used from ATCC (CCL-247). V6.5 mouse embryonic stem cells endogenously tagged with MED1-mEGFP(10), BRD4-mEGFP(10), SRSF2-mEGFP(11), or HP1α-mEGFP were used. Cells were negative for mycoplasma testing. The CRISPR / Cas9 system was used to generate endogenously tagged genetically modified ESCs and HCT116 cells. Target-specific sequences were cloned into plasmids containing an sgRNA backbone, a codon-optimized version of Cas9, and BFP or mCherry. Homologous recombination repair templates were cloned into pUC19 using NEBuilder HiFi DNA Master Mix (NEB E2621S). Homologous repair templates, consisting of mCherry or mEGFP cDNA sequences flanked by 800 bp homology arms, were amplified from genomic DNA using PCR. To create genetically modified cell lines, 750,000 cells were transfected using 833 ng of Cas9 plasmid and 1,666 ng of non-linear homologous repair. PCR genotyping was performed using Phusion polymerase (Thermo Scientific F531S). Products were amplified according to kit recommendations and visualized on a 1% agarose gel. The following primers were used for PCR genotyping:
[0258] HP1α-mCherry_fwd(mES):AACGTGAAGTGTCCACAGATTG(Sequence ID 2)
[0259] HP1α-mCherry_rev(mES):TTATGGATGCGTTTAGGATGG(Sequence ID 3)
[0260] HP1α-GFP_fwd(HCT116):CCAAGGTGAGGAGGAAATCA(SEQ ID NO: 4)
[0261] HP1α-GFP_rev(HCT116):CACAGGGAAGCAGAAGGAAG(SEQ ID NO: 5)
[0262] MED1α-GFP_fwd(HCT116):GAAGTTGAGAGTCCCCATCG(Sequence ID 6)
[0263] MED1-GFP_rev(HCT116):CGAGCACCCTTCTCTTCTTG(SEQ ID NO: 7)
[0264] BRD4-GFP_fwd(HCT116):CTGCCTCTTGGGCTTGTTAG(SEQ ID NO: 8)
[0265] BRD4-GFP_rev(HCT116):TTTGGGGAGAGGAGACATTG(SEQ ID NO: 9)
[0266] SRSF2-GFP_fwd(HCT116):CAAGTCTCCTGAAGAGGAAGGA(Sequence ID 10)
[0267] SRSF2-GFP_rev(HCT116):AAGGGCTGTATCCAAACAAAAAC(Sequence ID 11)
[0268] FIB1-GFP_fwd(HCT116):CCTTTTAATCAGCAACCCACTC(Sequence ID 12)
[0269] FIB1-GFP_rev(HCT116):GTGACCGAGTGAGAATTTACCC(Sequence ID 13)
[0270] NPM1-GFP_fwd(HCT116):TCAAATTCCTGAGCTGAAGTGA(Sequence ID 14)
[0271] NPM1-GFP_rev(HCT116):AACACGGTAGGGAAAGTTCTCA(SEQ ID NO: 15)
[0272] cell culture
[0273] V6.5 mouse embryonic stem cells (mES) were grown under 2i+LIF conditions. The mES cells were grown on 0.2% gelatinized (Sigma, G1890) tissue culture plates. The media used for the 2i+LIF medium conditions were as follows: 967.5 mL of DMEM / F12 (GIBCO 11320), 5 mL of N2 supplement (GIBCO 17502048), 10 mL of B27 supplement (GIBCO 17504044), 0.5 mM L-glutamine (GIBCO 25030), 0.5X non-essential amino acids (GIBCO 11140), 100 U / mL of penicillin-streptomycin (GIBCO 15140), 0.1 mM of β-mercaptoethanol (Sigma), 1 μM of PD0325901 (Stemgent 04-0006), 3 μM of CHIR99021 (Stemgent 04-0004), and 1000 U / mL of Recombinant LIF (ESGRO ESG1107). TrypLE Express Enzyme (Life Technologies, 12604021) was used to detach cells from the plate. TrypLE was quenched in FBS / LIF medium ((DMEM K / O (GIBCO, 10829-018), 1X non-essential amino acids, 1% penicillin-streptomycin, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol, and 15% fetal bovine serum, FBS (Sigma Aldrich, F4135)). Cells were centrifuged at 1000 rpm for 3 minutes at room temperature, resuspended in 2i medium, and 5 × 10⁶ cells were extracted. 6 The cells were seeded in a 15 cm petri dish.
[0274] MCF7 cells and HCT116 cells were grown in complete DMEM medium (DMEM (Life Technologies 11995073), 10% fetal bovine serum, FBS (Sigma Aldrich, F4135), 1% L-glutamine (GIBCO, 25030-081), 1% penicillin-streptomycin (Life Technologies, 15140163)). For growth under estrogen-free conditions, MCF7 cells in standard medium were washed three times with PBS, and then the medium was changed to an estrogen-free medium containing phenol red-free DMEM (Life Technologies 21063029), 10% activated carbon-treated FBS (Life Technologies A3382101), 1% L-glutamine (GIBCO, 25030-081), and 1% penicillin-streptomycin (Life Technologies, 15140163) for 48 hours before use.
[0275] TamR7 cells were grown in TAMR7 medium (phenol red-free DMEM / F12 (Life Technologies 21041025), 1% L-glutamine (GIBCO, 25030-081), 1% penicillin-streptomycin (Life Technologies, 15140163), 1% fetal bovine serum, FBS (Sigma Aldrich, F4135), 6 ng / mL insulin (Santa Cruz Biotechnology, sc-360248)). For subculturing, cells were washed with PBS (Life Technologies, AM9625). TrypLE Express Enzyme (Life Technologies, 12604021) was used to detach cells from the plate. TrypLE was quenched in the indicated medium.
[0276] Living cell imaging
[0277] Cells were grown in glass dishes (Mattek P35G-1.5-20-C). Before imaging the cells, the culture medium was replaced with phenol red-free 2i medium, and imaging was performed using an Andor Revolution spinning disk confocal microscope. Raw Andor images were processed using FIJI. For imaging of mESCs, coated glass dishes were used (5 μg / ml poly-L-ornithine (Sigma-Aldrich, P4957) at 37°C for 30 minutes, and 5 μg / ml laminin (Corning, 354232) at 37°C for 2-16 hours). For imaging of FIB1 and NPM1 in mES cells, GFP-labeled NPM1 or FIB1-encoding vectors were transfused using lipofectamine 3000 according to the package instructions as described above.
[0278] Immunofluorescence of tissue samples
[0279] Fresh frozen mammary and colon tissues were purchased from BioIVT. Frozen mammary tissues were fixed in 2% PFA in PBS for 30 minutes to 1 hour. Fixed tissues were incubated in 30% sucrose in PBS at 4°C for 4 days. Tissues were embedded in OCT and frozen. Fresh frozen colon tissues were embedded in OCT and frozen. Tissues were sectioned into 10 μm sections using a cryostat at a temperature setting of -25°C or -30°C. Sections were stored at -20°C. For IF, sections were allowed to reach room temperature and fixed in 4% PFA in PBS for 10 minutes. After washing three times with PBS, tissues were permeabilized with 0.5% TX100 in PBS, washed three times with PBS, and blocked in 4% BSA in PBS for 30 minutes. Primary antibody was diluted in 4% BSA in PBS, added to tissue samples, and incubated overnight at RT. After washing three times with PBS, the sample was incubated with a secondary antibody diluted 1:500 in 4% BSA in PBS. The sample was washed with PBS, and the DNA was stained with 20 μm / mL Hoechst 33258 (Life Technologies, H3569) for 5 minutes and mounted using Vectashield (VWR, 101098-042). Images were acquired using an Elyra super-resolution microscope at the Harvard Center for Biological Imaging. Images were post-processed using Fiji Is Just ImageJ (https: / / fiji.sc / ).
[0280] Determination of the volume of nuclear condensates
[0281] Image acquisition: Ten z-intersections were imaged. The nuclear contours were manually defined using Fiji Is Just ImageJ (https: / / fiji.sc / ), and the volume of each nucleus was calculated as nuclear region (μm) * number of imaged z-intersections (10) * voxel depth (0.1 μm).
[0282] The volume of condensates within the nucleus was measured using a custom Python script and the scikit-image package. Condensates were partitioned from 3D images of protein channels according to the following two criteria: (1) an intensity threshold three standard deviations above the image mean; and (2) a size threshold (minimum condensate size of 10 pixels). The estimated volume of the partitioned areas was then calculated by multiplying width (μm) * height (μm) * voxel depth (0.1 μm). For each protein element, the average volume and standard deviation of condensates in healthy and malignant tissues were reported. The number of condensates per nucleus was defined as the number of partitioned areas contained within the periphery of a defined nucleus. For each protein element, the average number and standard deviation of condensates per nucleus in healthy and malignant tissues were reported. The percentage of nuclear volume occupied by condensates was calculated as follows: (Σ volume of all detected condensates in the nucleus) / (estimated nuclear volume).
[0283] antibody
[0284] The following antibodies were used in immunofluorescence: NPM1 (ab10530), BRD4 (ab128874), MED1 (ab64965), HP1a (ab109028), FIB1 (ab5821), SRSF2 (ab11826), ER (ab32063), CDK7 (sc-7344), cisplatin-modified DNA (ab103261), 568 goat anti-rat A11077, goat anti-rabbit IgG Alexa Fluor 488, and Life Technologies A11008.
[0285] Protein purification
[0286] Human cDNA was cloned into a modified T7 pET expression vector. The base vector was genetically engineered to include a 6×HIS at the 5' end, followed by either BFP, mEGFP, or mCherry, and a 14-amino acid linker sequence "GAPGSAGSAAGGSG" (SEQ ID NO: 16). These sequences (generated by PCR) were inserted in frame with the linker amino acids using NEBuilder® HiFi DNA Assembly Master Mix (NEB E2621S). All expression constructs were sequenced to confirm sequence identity.
[0287] For protein expression, plasmids were transformed into LOBSTR cells (donated by Chessman Lab) and grown as follows: Fresh bacterial colonies containing the tagged MED1 construct were seeded in LB medium containing kanamycin and chloramphenicol and grown overnight at 37°C. The cells were diluted 1:30 in 500 ml of room temperature LB medium containing newly added kanamycin and chloramphenicol and grown at 16°C for 1.5 hours. IPTG was added to 1 mM and growth was continued for 20 hours. The cells were collected and cryopreserved. Cells containing all other expression plasmids were treated in the same manner, except that they were grown at 37°C for 5 hours after IPTG induction.
[0288] Cell pellets of SRSF1 and SRSF2-IDR were resuspended in 15 ml of denaturing buffer (50 mM Tris 7.5, 300 mM NaCl, 10 mM imidazole, 8 M urea) containing the cOmplete protease inhibitor (Roche, 11873580001) and sonicated (10 cycles of 15 seconds ON, 60 seconds OFF). The lysate was clarified by centrifugation at 12,000 g for 30 minutes and added to 1 ml of Ni-NTA agarose (Invitrogen, R901-15) pre-equilibriumized with 10 volumes of the same buffer. The tubes containing this agarose lysate slurry were rotated at room temperature for 1.5 hours, then centrifuged at 3,000 rpm for 10 minutes, washed with 2 × 5 ml of lysis buffer, and eluted with 3 × 2 ml of lysis buffer containing 250 mM imidazole. The eluate was incubated at room temperature with rotation for at least 10 minutes, and the protein was collected by centrifugation at 3,000 rpm for 10 minutes. The fraction was electrophoresed on a 12% acrylamide gel, and appropriately sized proteins were first dialyzed against a buffer containing 50 mM Tris pH 7.5, 500 mM NaCl, 1 mM DTT, and 4 M urea, followed by dialyzation against the same buffer containing 2 M urea, and finally dialyzed twice against a urea-free buffer containing 10% glycerol. Any precipitate after dialyzation was removed by centrifugation at 3,000 rpm for 10 minutes. All other proteins were purified in a similar manner by resuspending the cell pellet in 15 ml of buffer containing 50 mM Tris pH 7.5, 500 mM NaCl, and a cOmplete protease inhibitor, sonicating, and centrifugation at 12,000 x g for 30 minutes at 4°C. The lysate was added to 1 ml of pre-equilibrated Ni-NTA agarose and rotated at 4°C for 1.5 hours. The resin slurry was centrifuged at 3,000 rpm for 10 minutes, washed with 2 × 5 ml of lysis buffer containing 50 mM imidazole, and eluted by rotating three times in 2 ml of lysis buffer containing 250 mM imidazole and incubating for more than 10 minutes. Subsequently, the slurry was centrifuged and gel analyzed.Fractions containing appropriately sized proteins were dialyzed twice with either a buffer containing 50 mM Tris 7.5, 125 mM NaCl, 10% glycerol, and 1 mM DTT at 4°C, or an HP1a construct, with the buffer being replaced twice with the same buffer containing 500 mM NaCl.
[0289] The following human proteins or protein fragments were used for production:
[0290] NPM1: Total length, amino acids 1-294
[0291] SRSF2: Total length, amino acids 1-221.
[0292] HP1α: Total length, amino acids 1-191
[0293] MED1: Amino acids 600-1581.
[0294] MED1: Aromatic mutant, amino acids 600-1581, all aromatic residues have been replaced with alanine.
[0295] MED1: Basic mutant, amino acids 600-1581, all basic residues have been replaced with alanine.
[0296] BRD4: Amino acids 674-1351
[0297] FIB1: Total length, amino acids 1-321
[0298] ER and ER variants: full length, amino acids 1-595 (WT).
[0299] Data acquisition from Cbioportal
[0300] Regarding the mutation frequency in patients, we queried cbioportal (www.cbioportal.org / ) for ESR1 mutations present in arbitrary breast cancer sequencing datasets.
[0301] Drugs and small molecules
[0302] The drugs and small molecules were obtained and processed as follows: Hoechst 33258 (Life Technologies H3569) was obtained and used in liquid form. Fluorescein (Sigma F2456) was dissolved in DMSO at 10 mM and then further diluted in droplet-forming buffer for use. Dextran of 4.4 kDa (Sigma T1037), 10 kDa (Invitrogen D1816), 40 kDa (Invitrogen D1842), or 70 kDa (Invitrogen D1864) size, conjugated to either TRITC or FITC, ROX (Life Technologies 12223012), and Texas Red (Sigma Aldrich 60311-02-6), was diluted in droplet-forming buffer. FLTX1 (AOBIO 4054) was dissolved in DMSO and then further diluted in droplet-forming buffer. THZ1-TMR and JQ1-ROX were synthesized as follows to obtain the molecular structures shown in Figures 2D-E: Cisplatin conjugated with Texas Red (Ursa Bioscience) was dissolved in DMSO to 2 mM and then diluted in droplet-forming buffer for further use. Mitoxantrone (Sigma F6545) was dissolved in DMSO and then diluted in droplet-forming buffer for further use. Chemical structures were created using ChemDraw software.
[0303] The unlabeled molecules used in the cell elimination experiments were as follows: JQ1 (Cayman Chemical 11187), cisplatin (Selleck S1166), transplatin (Toku-E T108), tamoxifen (Sigma Aldrich T5648), and 4-hydroxytamoxifen (Sigma H7904).
[0304] In vitro droplet assay
[0305] Recombinant BFP, GFP, or mCherry fusion proteins were concentrated and desalted to the appropriate protein concentration and 125 mM NaCl using an Amicon Ultra centrifugal filter (30K MWCO, Millipore). The recombinant proteins were added to droplet-forming buffer (50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT) along with the indicated amounts of salt and the indicated crowding agent (Ficol or PEG). The protein solutions were immediately loaded into a 384-well glass-bottom plate (Cellvis P384-1.5HN) and imaged using an Andor confocal microscope with a 150x objective lens. Unless otherwise indicated, the images shown are droplets placed on coverslips.
[0306] The concentrations of drugs and small molecules used in the droplet experiment were as follows:
[0307] Texas Red Cisplatin: 5 µM
[0308] FLTX1: 100μM
[0309] Mitoxantrone: 50 μM
[0310] Fluorescein: 5 μM
[0311] Hoechst: 1 mg / mL
[0312] Labeled dextran: 0.05 mg / mL
[0313] THZ1-TMR: 5μM
[0314] JQ1-ROX: 1μM
[0315] ROX: 1 μM
[0316] TR: 5μM
[0317] For the displacement experiment, 5 μM labeled cisplatin-TR was added to the MED1 droplet reaction mixture (10 μM MED1, 50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT, 10% PEG) to form a MED1 droplet concentrated with cisplatin-TR. Unlabeled transplatin or unlabeled cisplatin (vehicle, 10 μM, 100 μM, or 500 μM) was added to the droplet mixture, and the amount of labeled cisplatin-TR remaining in the droplet was measured after displacement. To form a MED1 droplet concentrated with FLTX1, 100 μM fluorescent FLTX1 was added to the MED1 droplet reaction mixture (10 μM MED1, 50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT, 10% PEG). A 1 mM non-fluorescent version of the drug, tamoxifen, was added to the droplet mixture, and the amount of fluorescent FLTX1 remaining in the droplet was measured after displacement. To analyze the removal of ER from the MED1 condensate, fluorescently labeled ER and MED1 were mixed in droplet-forming buffer at the indicated concentrations along with the indicated components in the presence of 100 μM estrogen (Sigma E8875). For the conditions with tamoxifen treatment, 4-hydroxytamoxifen (Sigma H7904) was then added to a final concentration of 100 μM, and imaging was performed using a confocal fluorescence microscope as described above.
[0318] For droplet assays with fluorescent DNA, a 451-base-pair DNA fragment was commercially synthesized into a vector having adjacent M13F and M13R primer binding sites. Primers M13F and M13R covalently bound to Cy5 fluorophores were commercially synthesized, and the fragment was amplified using these primers. The DNA fragment was then purified from a PCR reaction and diluted in droplet formation buffer for use in droplet assays as described. To test the ability of recombinant CDK7 to partition into MED1 or HP1α droplets, recombinant CDK activation complex (Millipore 14-476) was supplemented at 0.4 mg / mL in 150 mM NaCl at pH 7.5. One vial of monoreactive dye Cy5 (Amersham PA23001) was resuspended in 30 μL of 0.2 M sodium bicarbonate (pH 9.3) in 150 mM NaCl. 5 μL of this reaction was added to 5 μL of protein and incubated at room temperature for 1 hour. The free dye was removed by passing the sample through Zeba Spin Desalting Columns, 40MWCO (87764, Thermo Scientific), as described in the accompanying documentation, and the protein was added to a final concentration of 1 μM in droplet formation buffer containing 1 mM DTT in 125 mM NaCl. This protein was used in droplet assays as needed.
[0319] For screening the modified BODIPY library of 80 modified BODIPY molecules, as previously described (54), molecules were selected from a larger library collection. These molecules were diluted to 1 mM in DMSO and then to 10 μM in droplet formation buffer. MED1-IDR-BFP droplets were formed with 5 μM protein in droplet formation buffer containing 125 mM NaCl and 10% PEG. The probe was added to this reactant to a final concentration of 1 μM, and the mixture was added to one well of a 384-well plate and imaged at 150x with an Andor confocal fluorescence microscope in the 488 (BODIPY) and 405 (protein) channels. These images were quantified using the pipeline described above, and the maximum 488 signal intensity within the droplet defined by the 405 channel was quantified. These values were then ranked to determine the top and bottom "hits". To ensure comparable fluorescence intensity for the probes, 18 random probes at 1 μM concentrations were imaged in droplet-forming buffer, and the average fluorescence intensity within the field of view was determined. Using the same method, fluorescence intensity was measured for BODIPY alone (Sigma 795526), in both MED1 droplet and diffusion states.
[0320] FRAP, an in vitro droplet containing a drug.
[0321] For FRAP in vitro droplets, five laser pulses were applied to the MED1 channel with a 50us pause time, and twenty laser pulses were applied to the cisplatin channel with a 100μs pause time. Recovery was imaged every second using an Andor microscope during the indicated time. Fluorescence intensity was measured using FIJI. Post-bleach FRAP recovery data was averaged over six replicate tests for each channel.
[0322] Calculation of drug enrichment ratio
[0323] To analyze in vitro droplet experiments, a custom Python script was written using the scikit-image package to identify droplets and characterize their size, shape, and intensity. Droplets were partitioned from the average image of the captured channel according to the following various criteria: (1) an intensity threshold three standard deviations above the mean of the image; (2) a size threshold (minimum droplet size of 20 pixels); and (3) a minimum circularity of 0.8 (where 1 is a perfect circle) (circularity = 4π·area / perimeter²). After partitioning, the average intensity of each droplet was calculated while correcting for background by excluding pixels near the phase interface and subtracting the intensity of the dark image of only the droplet-forming buffer. For each experiment, droplets identified in the fluorescent protein channel were quantified from 10 independent fields of view. The maximum signal intensity within the droplet was calculated for each channel, and the maximum intensity in the drug channel was named "maximum drug intensity". To obtain the intensity of the drug or dye alone in a diffused state (named "diffused drug intensity"), the compound was added to droplet formation buffer at the same concentration used in the droplet assay. This was then imaged using a confocal fluorescence microscope. The resulting images were processed with FIJI to obtain the fluorescence intensity of the field of view. To obtain the fluorescence intensity of protein droplets leaking into the drug channel (named "background intensity"), the protein droplets were imaged in the fluorescence channel where the drug fluoresces and processed as described above to obtain the average maximum intensity within the droplets across 10 images. The enrichment ratio was obtained using the following formula: [(maximum drug intensity) - (background intensity)] / (diffused drug intensity). The box plot shows the distribution of all droplets. Each point represents an individual droplet.
[0324] Chromatin immunoprecipitation (ChIP) and sequencing
[0325] MCF7 cells were grown in complete DMEM medium until 80% confluence. The cells were crosslinked with 1% formaldehyde in PBS for 15 minutes, followed by quenching with a final concentration of 125 mM glycine on ice. The cells were washed with cold PBS and collected by scraping in cold PBS. The collected cells were pelleted at 1000 g for 3 minutes at 4°C, rapidly frozen in liquid nitrogen, and stored at 80°C. All buffers contained a freshly prepared cOmplete protease inhibitor (Roche, 11873580001). Frozen cross-linked cells were thawed on ice, then resuspended in lysis buffer I (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton® X-100, protease inhibitor), rotated at 4°C for 10 minutes, and then centrifuged at 1350 rcf at 4°C for 5 minutes. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitor), rotated at 4°C for 10 minutes, and then centrifuged at 1350 rcf at 4°C for 5 minutes. The pellet was resuspended in sonication buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA pH 8.0, 0.1% SDS, and 1% Triton® X-100 (protease inhibitor)), and then sonicated using a Misonix 3000 sonicator (10 cycles of 30 seconds each on ice (18-21W), with 60 seconds of rest on ice between cycles). The sonicated lysate was clarified by centrifugation at 16,000 rcf for 10 minutes at 4°C. The input material was set aside, and the remainder was incubated overnight at 4°C with magnetic beads conjugated with Bethyl A300-405A CDK7 antibody to enrich the CDK7-bound DNA fragments.The beads were washed twice with each of the following buffers: Washing buffer A (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 0.1% sodium deoxycholate, 1% Triton® X-100, 0.1% SDS), Washing buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% sodium deoxycholate, 1% Triton® X-100, 0.1% SDS), Washing buffer C (20 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA pH 8.0, 0.5% sodium deoxycholate, 0.5% IGEPAL) The solution consisted of C-630 (0.1% SDS), wash buffer D (TE containing 0.2% Triton® X-100), and TE buffer. DNA was eluted from the beads by incubation at 65°C for 1 hour with intermittent vortexing in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS). The crosslinks were reversed overnight at 65°C. To purify the eluted DNA, 200 mL of TE was added, followed by degradation of RNA by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubation at 37°C for 2 hours. Proteins were degraded by adding 10 mL of 20 mg / mL proteinase K (Invitrogen, 25530049) and incubation at 55°C for 2 hours. Phenol:chloroform:isoamyl alcohol extraction was performed, followed by ethanol precipitation. Next, the DNA was resuspended in 50 mL of TE and used for sequencing. ChIP libraries were prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library Kit according to the kit instructions. After library preparation, the ChIP libraries were electrophoresed on a 2% gel using a PippinHT with a collection size window of 200–600 bases. The final libraries were quantified by qPCR using the Roche KAPA Library Quantification Kit and sequenced using an Illumina HiSeq 2500 in 40-base single-read mode.
[0326] HCT116 cells were grown in complete DMEM medium until 80% confluence, followed by treatment with JQ1 or DMSO for 24 hours, then permeabilized (10 minutes at 37°C with a solution of tx100 in PBS at a ratio of 1:1000 in medium), and subsequently treated with DMF or cisplatin for 6 hours. Cells were crosslinked with 1% formaldehyde in PBS for 15 minutes, followed by quenching with a final concentration of 125 mM glycine on ice. Cells were washed with cold PBS and collected by scraping in cold PBS. Collected cells were pelleted at 1000g for 3 minutes at 4°C, rapidly frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared cOmplete protease inhibitor (Roche, 11873580001). Frozen cross-linked cells were thawed on ice, then resuspended in lysis buffer I (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton® X-100, protease inhibitor), rotated at 4°C for 10 minutes, and then centrifuged at 1350 rcf at 4°C for 5 minutes. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitor), and then sonicated using a Misonix 3000 sonicator (10 cycles of 30 seconds each (18-21W) on ice, with 60 seconds of rest on ice between cycles). The sonicated lysate was clarified by centrifugation at 16,000 rcf for 10 minutes at 4°C. The input material was set aside, and the remainder was incubated overnight at 4°C with magnetic beads conjugated with Bethyl A300-405A CDK7 antibody to enrich the DNA fragments conjugated by CDK7.The beads were washed twice with each of the following buffers: Washing buffer A (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 0.1% sodium deoxycholate, 1% Triton® X-100, 0.1% SDS), Washing buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% sodium deoxycholate, 1% Triton® X-100, 0.1% SDS), Washing buffer C (20 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA pH 8.0, 0.5% sodium deoxycholate, 0.5% IGEPAL) The solution consisted of C-630 (0.1% SDS), wash buffer D (TE containing 0.2% Triton® X-100), and TE buffer. DNA was eluted from the beads by incubation at 65°C for 1 hour with intermittent vortexing in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS). The crosslinks were reversed overnight at 65°C. To purify the eluted DNA, 200 mL of TE was added, followed by degradation of RNA by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubation at 37°C for 2 hours. Proteins were degraded by adding 10 mL of 20 mg / mL proteinase K (Invitrogen, 25530049) and incubation at 55°C for 2 hours. Phenol:chloroform:isoamyl alcohol extraction was performed, followed by ethanol precipitation. Next, the DNA was resuspended in 50 mL of TE and used for sequencing. ChIP libraries were prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library Kit according to the kit instructions. After library preparation, the ChIP libraries were electrophoresed on a 2% gel using a PippinHT with a collection size window of 200–600 bases. The final libraries were quantified by qPCR using the Roche KAPA Library Quantification Kit and sequenced using an Illumina HiSeq 2500 in 40-base single-read mode.
[0327] HCT116 cells were grown in complete DMEM medium until 80% confluence, followed by treatment with JQ1 or DMSO for 24 hours, then permeabilized (10 minutes at 37°C with a solution of tx100 in PBS at a ratio of 1:1000 in medium), and subsequently treated with DMF or cisplatin for 6 hours. Cells were crosslinked with 1% formaldehyde in PBS for 15 minutes, followed by quenching with a final concentration of 125 mM glycine on ice. Cells were washed with cold PBS and collected by scraping in cold PBS. Collected cells were pelleted at 1000g for 3 minutes at 4°C, rapidly frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared cOmplete protease inhibitor (Roche, 11873580001). Frozen cross-linked cells were thawed on ice, then resuspended in lysis buffer I (50 mM HEPES-KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton® X-100, protease inhibitor), rotated at 4°C for 10 minutes, and then centrifuged at 1350 rcf at 4°C for 5 minutes. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitor), rotated at 4°C for 10 minutes, and then centrifuged at 1350 rcf at 4°C for 5 minutes. The pellet was resuspended in sonication buffer (20 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton® X-100, 0.1% sodium deoxycholate, 0.1% SDS, protease inhibitor), and then sonicated using a Misonix 3000 sonicator (10 cycles of 30 seconds each on ice (18-21W), with 60 seconds of rest on ice between cycles). The sonicated lysate was clarified by centrifugation at 16,000 rcf for 10 minutes at 4°C. The input material was set aside, and the remainder was incubated overnight at 4°C with magnetic beads conjugated to MED1 antibody (Bethyl A300-793A) to enrich the DNA fragments conjugated by MED1.The beads were washed with each of the following buffers: twice with sonicated buffer (20 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton® X-100, 0.1% sodium deoxycholate, 0.1% SDS), once with high-salt sonicated buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton® X-100, 0.1% sodium deoxycholate, 0.1% SDS), once with LiCl washing buffer (20 mM Tris pH 8.0, 1 mM EDTA, 250 mM LiCl, 0.5% NP-40, 0.5% sodium deoxycholate), and once with TE buffer. DNA was eluted from the beads by incubation in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS) at 65°C for 15 minutes with stirring. The crosslinks were reversed at 65°C for 12 hours. To purify the eluted DNA, 200 mL of TE was added, and then RNA was degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 hours. Proteins were degraded by adding 4 μl of 20 mg / mL proteinase K (Invitrogen, 25530049) and incubated at 55°C for 30 minutes. The DNA was purified using the Qiagen PCR purification kit, eluted in 30 μl of buffer EB, and used for sequencing. The ChIP library was prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library Kit according to the kit instructions. After library preparation, the ChIP libraries were electrophoresed on a 2% gel using a PippinHT with a collection size window of 200–400 bases. The final libraries were quantified by qPCR using the Roche KAPA Library Quantification Kit and sequenced using an Illumina HiSeq 2500 in 50-base single-read mode.
[0328] ChIP-Seq data were aligned with the mm9 version of the mouse reference genome using bowtie, with the parameters -k 1, -m 1, -best, and -l set to read length. Wiggle files to display bin read coverage were created using MACS with the paramet...
Claims
1. A method for characterizing a first drug, wherein the method is i) Contacting the first agent with a composition containing a condensate, wherein the condensate contains the second agent before contacting the first agent, and ii) Measuring the ability of the first agent to cause the removal of the second agent from the condensate. Includes, Here, the condensate is a transfer condensate, A method wherein both the first drug and the second drug are low-molecular-weight substances.
2. The method according to claim 1, comprising a tag on which the first drug and / or the second drug can be detected.
3. The method according to claim 2, wherein the detectable tag is a fluorescent tag.
4. The method according to claim 2 or 3, wherein the detectable tag does not affect the distribution characteristics of the condensates of the first and / or second agents.
5. The method according to any one of claims 1 to 4, wherein the first drug is an isomer of the second drug.
6. The method according to any one of claims 1 to 5, wherein the composition containing the condensate is a cell composition containing the condensate within the cell.
7. The method according to any one of claims 1 to 5, wherein the composition containing the condensate does not contain cells.
8. The ability of the first agent to cause the removal of the second agent from the condensate is i) the amount of the second agent remaining in the condensate after contacting the first agent with the composition; ii) The amount of the second agent outside the condensate after contacting the first agent with the composition; and / or iii) The ratio of the second agent to the inside and outside of the condensate after contacting the first agent with the composition. The method according to any one of claims 1 to 7, measured by
9. The method according to any one of claims 1 to 8, wherein measuring the ability of the first agent to cause the removal of the second agent from the condensate involves using a technique selected from one or more of the following: Raman spectroscopy, spectrometry, mass spectrometry, nuclear magnetic resonance, chromatography, quantitative phase-contrast microscopy, fluorescence microscopy, and spin-down assay.
10. The method according to any one of claims 1 to 9, wherein the composition is brought into contact with a gradually increasing amount of the first agent, and the removal of the second agent from the condensate is measured continuously or at discrete intervals.
11. The method according to any one of claims 1 to 10, wherein the method comprises contacting the first agent with a plurality of compositions, each comprising a condensate having at least one different component.
12. The method according to any one of claims 1 to 11, wherein the method comprises contacting a plurality of first agents with a plurality of compositions, each containing a condensate having the same constituent elements.
13. The method according to any one of claims 1 to 12, wherein the constituent elements of the condensate are a mediator, a mediator component, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α.
14. The method according to any one of claims 1 to 13, wherein the condensate is a super-enhancer condensate.
15. The method according to any one of claims 1 to 14, wherein the constituent elements of the condensate include an intrinsically modified region (IDR).
16. The method according to any one of claims 2 to 15, wherein the components of the condensate include a detectable tag that is different from the first agent and / or the second agent.
17. The method according to any one of claims 1 to 16, wherein the first drug can bind to a target.
18. The method according to claim 17, wherein the target is genomic DNA or a protein.
19. The method according to claim 17 or 18, wherein the condensate does not contain the target.
20. The method according to claim 17 or 18, wherein the target is mainly located outside the condensate.
21. The method according to claim 17 or 18, wherein the target is mainly present within the condensate.
22. The method according to any one of claims 17 to 21, wherein the target is a therapeutic target.
23. The method according to any one of claims 17 to 22, wherein the target is an enzyme, receptor, ligand, oncogene, oncogene product, or transcription factor.
24. The method according to any one of claims 17 to 23, wherein the composition comprises the target.
25. The method according to any one of claims 1 to 24, wherein the relative amount of the first agent incorporated into the condensate or not incorporated into the condensate is measured.
26. The method according to any one of claims 1 to 25, wherein the condensate is physically associated with DNA.
27. The method according to any one of claims 6 and 8 to 26, wherein the cells are diseased cells.
28. The method according to claim 27, wherein the lesion cells are cancer cells.
29. The method according to any one of claims 1 to 28, wherein the first agent and / or the second agent is a chemotherapeutic agent.
30. The method according to any one of claims 1 to 28, wherein the first drug and / or the second drug is a candidate chemotherapy agent.
Citation Information
Patent Citations
Nucleic acids and corresponding proteins designated 161p2f10b useful in cancer treatment and detection
JP2006509492A
Methods and compositions for regulating the Wnt pathway
JP2013544798A
Method for Detecting Transcription Factor-Protein Interactions
US20140121122A1
Novel screening method for substance using fluorescent molecular probe
WO2006070941A1
Mutant FUS model for als
WO2018170794A1