Compounds and methods for reducing IFNAR1 expression
Patent Information
- Application Number
- JP2023577660
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-06-18
- Filing Date
- 2022-06-17
- Publication Date
- 2026-08-21
- Estimated Expiration
- 2042-06-17
Smart Images

Figure 0007909553000001 
Figure 0007909553000002 
Figure 0007909553000003
Abstract
Description
[Technical Field]
[0001] Sequence List This application is filed electronically along with a sequence listing. The sequence listing is provided as BIOL0386WOSEQ_ST25.txt, created on June 13, 2022, and is 64KB in size. The electronic information of this sequence listing is incorporated herein by reference in its entirety.
[0002] Oligomer compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of IFNAR1 RNA in cells or animals, and, in certain cases, for reducing the amount of IFNAR1 protein in cells or animals. Such oligomer compounds, methods, and pharmaceutical compositions are useful for treating neurological diseases or conditions associated with neuroinflammation, including Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia. [Background technology]
[0003] Aicardi-Goutieres syndrome (AGS) is a progressive inflammatory encephalopathy associated with several neuropathological symptoms, including seizures, feeding difficulties, dystonia, convulsions, motor developmental delay, language developmental delay, and social skills developmental delay. Imaging of AGS patients reveals white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, brain atrophy, basal ganglion calcification, and microencephalopathy, and patients also have elevated levels of interferon alpha (IFNa) and lymphocytosis in the cerebrospinal fluid. AGS is associated with mutations in one of ten genes: TREX1 (DNA exonuclease), RNASEH2A, B, or C (subunits of RNASEH2), SAMHD1 (dNTP hydrolase), ADAR1 (RNA editing enzyme), MDA5 (dsRNA sensor), USP18 (negative regulator of type I IFN signaling), LSM11, and RNU7-1 (components of replication-dependent histone premRNA processing complex). Mutations in any one of these genes result in abnormal activation of the antiviral response and high levels of IFNa (Adang, et al., 2020, J. Child Neurol., 35, 7016; Rodero, et al., 2016, J. Esp. Med., 213, 2527-2538).
[0004] Interferon alpha and beta receptor subunit 1 (IFNAR1) is one of the two components of the interferon alpha receptor involved in type I interferon signaling. Type I interferon signaling is elevated in AGS patients and is considered an important mediator in neuropathology. Elevated levels of type I interferon signaling are also associated with diseases or conditions such as stroke, brain injury, Alzheimer's disease, neuropsychiatric systemic lupus erythematosus, neuromyelitis optica, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, and neuroinflammation associated with telangiectatic ataxia (Wlodarczyk, et al., 2021, Glia 69, 943-953, Santar, et al., 2009, J.Immunol.182, 1192-1201, Zeng, et al., 2019, Arthritis Res.Ther.21, 205.017, Karageorgas, et al., 2011, J Biomed Biotechnol 2011, 273907, Roy, et al., 2020, J Clin Invest.130, 1912-1930, Witcher,2021,J.Neurosci.JN-RM-2469-2420, Blank,et al.,2016,Immunity 44,901-912, Hartlova,et al.,2015,Immunity 44,901-912,McDonugh,et al.,2017,J Neurosci.37,8292-8308). Overexpression of IFNa in transgenic mice leads to increased levels of type I interferon signaling, resulting in neurodegenerative changes, T cell infiltration, B cell infiltration, microglia activation, reactive astrocytosis, endothelial cell activation, and calcification of the thalamus and cerebellum (Hofer, et al., 2013, Cytokine & Growth Factor Reviews 24, 257-267; Klok, et al., 2015, Ann. Clin. Transl. Neurol., 2, 774-779).Type I interferon signaling induces the expression of hundreds of genes, including interferon-inducing proteins with tetratricopeptide repeat 1 (Ifit1), interferon-inducing proteins with tetratricopeptide repeat 3 (Ifit3), and interferon regulator 7 (Irf7) (Li, et al., 2018, J. Biol. Chem. 292, P5845-P5859). Crossing a mouse model of Alzheimer's disease with IFNAR1 knockout mice suppressed type I interferon signaling, resulting in an anti-inflammatory response in glial cells and reduced neuroinflammation (Minter, MR, et al., 2016, Acta Neuropathologica Commun. 4:72). [Overview of the project]
[0005] The oligomeric compounds, methods, and pharmaceutical compositions of specific embodiments described herein are useful for reducing or inhibiting IFNAR1 expression in cells or animals. In certain embodiments, IFNAR1 RNA or protein levels can be reduced in cells or animals. In certain embodiments, the subject has Aicardi-Goutieres syndrome. In certain embodiments, the subject has a disease or disorder associated with mutations in TREX1, RNASEH2A, RNASEH2B, RNASEH2C, SAMHD1, ADAR1, MDA5, USP18, LSM11, or RNU7-1.
[0006] Methods for treating diseases or conditions associated with elevated type I interferon signaling are also provided, and in certain embodiments, the disease or disorder is AGS, stroke, epilepsy, neuroinflammation after traumatic brain injury, neuroautoimmune disease, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or telangiectatic ataxia. [Modes for carrying out the invention]
[0007] Please understand that the above summary and the following detailed explanation are illustrative and descriptive only, and not limiting. In this specification, the use of the singular includes the plural unless otherwise explicitly stated. Where used herein, the use of "or" means "and / or" unless otherwise explicitly stated. Furthermore, the use of the term "contains," as well as other forms such as "contains" and "includes," is not limiting. Also, terms such as "element" or "component" include both elements and components containing one unit, and elements and components containing two or more subunits, unless otherwise explicitly stated.
[0008] The headings of sections used herein are for structural purposes only and should not be construed as limiting the subject matter described herein. All documents or parts of documents listed in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference as some, and all, of the documents considered herein.
[0009] definition Unless otherwise specified, the nomenclature, procedures, and techniques used in relation to analytical chemistry, organic synthesis chemistry, and medicinal and pharmaceutical chemistry described herein are well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and data referenced throughout this disclosure are incorporated herein by reference in their entirety.
[0010] Unless otherwise specified, the following terms have the meanings described below.
[0011] As used herein, “2'-deoxynucleoside” means a nucleoside containing a 2'-H(H)deoxyfuranosyl sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside containing a 2'-β-D-deoxyribosyl sugar moiety having a β-D-ribosyl configuration similar to that found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may contain a modified nucleic acid base or an RNA nucleic acid base (uracil).
[0012] As used herein, "2'-MOE" means a 2'-O(CH2)2OCH3 group instead of the 2'-OH group in the furanosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" means a sugar moiety having a 2'-O(CH2)2OCH3 group instead of the 2'-OH group in the furanosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in a β-D-ribosyl configuration. "MOE" means O-methoxyethyl.
[0013] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.
[0014] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached at the 5-position. 5-methylcytosine is a modified nucleic acid base.
[0015] As used herein, “alleviate” in relation to treatment means that at least one symptom or feature is alleviated compared to the same symptom or feature in the absence of treatment. In certain embodiments, alleviation is a decrease in the severity or frequency of the symptom or feature, a delay in the onset of the symptom or feature, or a delay in the progression of the severity or frequency of the symptom or feature. In certain embodiments, the symptom or feature is one or more of the following: seizures, difficulty feeding, dystonia, convulsions, motor development delay, language development delay, social skills development delay, white matter abnormalities, T-cell infiltration, B-cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, and microencephalopathy. In certain embodiments, the feature is the level of IFNa or lymphocytosis in the cerebrospinal fluid of the subject.
[0016] As used herein, “group” means multiple molecules of the same molecular formula.
[0017] As used herein, “chiralally enriched” with respect to a population means multiple molecules of the same molecular formula in which the number or percentage of molecules in the population containing a particular stereochemistry at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemistry at the same particular chiral center if the particular chiral center were stereorandom, as defined herein. A chiral enriched population of molecules having multiple chiral centers in each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is an oligomeric compound containing a modified oligonucleotide. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate nucleoside bond. In certain embodiments, the chiral center is at the phosphorus atom of a mesylphosphoramide nucleoside bond.
[0018] As used herein, “chiralally controlled” with respect to nucleoside bonds means that the bond is concentrated in a particular stereochemical configuration.
[0019] As used herein, “antisense agent” means an antisense compound and, optionally, one or more additional features such as a sense compound. RNAi is not claimed, but my thinking behind keeping it was that I thought there would be a basis for distinguishing the compound from the siRNA sequence.
[0020] As used herein, “cerebrospinal fluid” or “CSF” means the fluid that fills the space surrounding the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.
[0021] As used herein, “conjugate group” means an atomic group that is directly bonded to an oligonucleotide. A conjugate group comprises a conjugate moiety and a conjugate linker that bonds the conjugate moiety to an oligonucleotide.
[0022] As used herein, “conjugate linker” means a group of atoms containing at least one bond that links a single bond or conjugate portion to an oligonucleotide.
[0023] As used herein, “conjugate moiety” means a covalent group of atoms that modifies one or more properties of a molecule compared to an identical molecule lacking a conjugate moiety, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
[0024] As used herein, “deoxy region” means a region of 5 to 12 consecutive nucleotides, where at least 70% of the nucleoside is a β-D-2'-deoxyribosyl sugar moiety. In certain embodiments, the deoxy region is a gap in a gapmer.
[0025] As used herein, “nucleoside bond” refers to a covalent bond between adjacent nucleosides within an oligonucleotide. As used herein, “modified nucleoside bond” refers to any nucleoside bond other than a phosphodiester nucleoside bond.
[0026] As used herein, “bound nucleoside” means nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides between bound nucleosides).
[0027] As used herein, “motif” means the pattern of unmodified and / or modified sugar moieties, nucleic acid bases, and / or nucleoside bonds in an oligonucleotide.
[0028] As used herein, “modified nucleoside” means a nucleoside containing a modified acid-base and / or modified sugar moiety.
[0029] As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between the two atoms of the sugar to form a second ring.
[0030] As used herein, “nucleic acid base” means an unmodified or modified nucleic acid base. A nucleic acid base is a heterocyclic moiety. As used herein, “unmodified nucleic acid base” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, “modified nucleic acid base” is an unmodified group of atoms other than A, T, C, U, or G that can pair with at least one other nucleic acid base. “5-methylcytosine” is a modified nucleic acid base. A universal base is a nucleic acid base that can pair with any one of the five unmodified nucleic acid bases.
[0031] As used herein, “nucleic acid sequence” means the sequence of nucleic acid bases in a nucleic acid or oligonucleotide, independent of any sugar or nucleoside bond modifications.
[0032] As used herein, "nucleoside" means a compound or fragment of a compound comprising a nucleic acid base and a sugar moiety. The nucleic acid base and sugar moiety are either unmodified or modified, independently of each other.
[0033] As used herein, “oligomer compound” means an oligonucleotide and, optionally, one or more additional features such as a conjugate group or terminal group. The oligomer compound may or may not be paired with a second oligomer compound complementary to the first oligomer compound. “Single-stranded oligomer compound” is an unpaired oligomer compound.
[0034] As used herein, “oligonucleotide” means a chain of linked nucleosides connected via nucleoside-nucleoside bonds, where each nucleoside and nucleoside-nucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleoside-nucleoside bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside modifications or nucleoside-nucleoside modifications.
[0035] As used herein, “oligonucleotide” means a chain of linked nucleosides connected via nucleoside-nucleoside bonds, where each nucleoside and nucleoside-nucleoside bond may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide in which at least one nucleoside or nucleoside-nucleoside bond is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not contain any nucleoside modifications or nucleoside-nucleoside modifications.
[0036] As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administration to an animal. Certain such carriers enable the formulation of a pharmaceutical composition into, for example, pills, tablets, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral administration by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.
[0037] As used herein, “pharmaceutically acceptable salt” means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart any undesirable toxicological effects to the parent compound.
[0038] As used herein, “pharmaceutical composition” means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a particular cell line.
[0039] As used herein, “stereorandom” or “stereorandom chiral center” in the context of a group of molecules of the same molecular formula means a chiral center that is not controlled during synthesis or enriched after synthesis for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if it is the result of a synthetic method not designed to control the stereochemical configuration. For example, in a group of molecules containing a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as, but not necessarily the same as, the number of molecules having the (R) configuration of the stereorandom chiral center. In certain embodiments, the stereorandom chiral center is not racemic because, for example, one absolute configuration is dominant after synthesis due to the action of a non-chiral reagent near the enriched stereochemistry of an adjacent sugar moiety. In certain embodiments, the stereorandom chiral center is located on the phosphorus atom of a stereorandom phosphorothioate or mesylphosphoamide nucleoside bond.
[0040] As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2'-OH(H) ribosyl moiety found in RNA (“unmodified RNA sugar moiety”) or a 2'-H(H) deoxyribosyl sugar moiety found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen atom at each of the 1', 3', and 4' positions, one oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or sugar surrogate.
[0041] As used herein, “symptom or feature” means any physical feature or test result indicating the presence or degree of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or testing the subject. In certain embodiments, the feature is evident by an invasive diagnostic test, including but not limited to a post-mortem examination. In certain embodiments, the feature is evident by a brain MRI scan.
[0042] As used herein, “target nucleic acid” and “target RNA” mean nucleic acids on which the oligomeric compound is designed to act. Target RNA means RNA transcripts, and unless otherwise specified, includes pre-mRNA and mRNA.
[0043] As used herein, “target region” means the portion of a target nucleic acid with which an oligomeric compound is designed to hybridize.
[0044] As used herein, “end group” means a chemical group or atomic group covalently bonded to the end of an oligonucleotide.
[0045] As used herein, “antisense activity” means any detectable and / or measurable change that may result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of the target nucleic acid or the protein encoded by such target nucleic acid compared to the target nucleic acid level or target protein level in the absence of the antisense compound.
[0046] As used herein, “gapmer” means a modified oligonucleotide comprising an internal region located between one or more external regions having one or more nucleosides, wherein the nucleosides constituting the internal region are chemically distinct from the nucleosides constituting the external regions, and the modified oligonucleotide assists in RNase H cleavage. The internal region may be referred to as a “gap,” and the external region may be referred to as a “wing.” In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counted from the 5' end of the internal region. Unless otherwise indicated, “gapmer” means a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. As used herein, “MOE gapmer” refers to a gapmer having a gap containing a 2'-β-D-deoxynucleoside and a wing containing a 2'-MOE nucleoside. Unless otherwise indicated, gapmers may contain one or more modified nucleoside bonds and / or modified nucleic acid bases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications.
[0047] As used herein, “hybridization” means the annealing of oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common mechanism of hybridization involves hydrogen bonding between complementary nucleic acid bases, which may be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.
[0048] As used herein, “RNAi agent” means an antisense agent that acts to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid, at least in part via RISC or Ago2. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNAs, including microRNA mimes. RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, RNAi agents modulate the amount and / or activity of the target nucleic acid. The term RNAi agent excludes antisense agents that act via RNase H.
[0049] As used herein, “RNase H agent” means an antisense agent that acts to modulate a target nucleic acid and / or the protein encoded by the target nucleic acid via RNase H. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H compound may contain a conjugate group and / or terminal groups. In certain embodiments, the RNase H agent modulates the amount and / or activity of the target nucleic acid. The term RNase H agent excludes antisense agents that act primarily via RISC / Ago2.
[0050] As used herein, “to treat” means to improve the disease or condition of interest by administering the oligomeric compound described herein. In certain embodiments, treating the subject means improving symptoms of the same condition in the absence of treatment. In certain embodiments, treatment means reducing the severity or frequency of symptoms, delaying the onset of symptoms, delaying the progression of symptoms, or delaying the severity or frequency of symptoms.
[0051] As used herein, “therapeutic dose” means the amount of a drug or composition that provides a therapeutic effect to an animal. For example, a therapeutic dose that improves the symptoms of a disease.
[0052] Specific Embodiments Embodiment 1. Modified oligonucleotide according to the following chemical structure
[0053] [ka]
[0054] (Sequence ID 10), or a salt thereof.
[0055] Embodiment 2. The modified oligonucleotide according to Embodiment 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt.
[0056] Embodiment 3. Modified oligonucleotide according to the following chemical structure
[0057] [ka]
[0058] (Sequence ID 10).
[0059] Embodiment 4. Modified oligonucleotide according to the following chemical structure
[0060] [ka]
[0061] (Sequence ID 11), or a salt thereof.
[0062] Embodiment 5. The modified oligonucleotide according to Embodiment 4, which is a sodium salt or a potassium salt.
[0063] Embodiment 6. Modified oligonucleotide according to the following chemical structure
[0064] [ka]
[0065] (Sequence ID 11).
[0066] Embodiment 7. Modified oligonucleotide according to the following chemical structure
[0067] [ka]
[0068] (Sequence ID 12), or a salt thereof.
[0069] Embodiment 8. The modified oligonucleotide according to Embodiment 7, which is a sodium salt or a potassium salt.
[0070] Embodiment 9. Modified oligonucleotide according to the following chemical structure
[0071] [ka]
[0072] (Sequence ID 12).
[0073] Embodiment 10. Modified oligonucleotide according to the following chemical structure
[0074] [ka]
[0075] (Sequence ID 9), or a salt thereof.
[0076] Embodiment 11. The modified oligonucleotide according to Embodiment 10, which is a sodium salt or a potassium salt.
[0077] Embodiment 12. Modified oligonucleotide according to the following chemical structure
[0078] [ka]
[0079] (Sequence ID 9).
[0080] Embodiment 13. Modified oligonucleotide according to the following chemical structure
[0081] [ka]
[0082] (Sequence ID 13), or a salt thereof.
[0083] Embodiment 14. The modified oligonucleotide described in Embodiment 13, which is a sodium salt or a potassium salt.
[0084] Embodiment 15. Modified oligonucleotide according to the following chemical structure
[0085] [ka]
[0086] (Sequence ID 13).
[0087] Embodiment 16. Modified oligonucleotide according to the following chemical structure
[0088] [ka]
[0089] (Sequence ID 14), or a salt thereof.
[0090] Embodiment 17. The modified oligonucleotide according to Embodiment 16, which is a sodium salt or a potassium salt.
[0091] Embodiment 18. Modified oligonucleotide according to the following chemical structure
[0092] [Chemical]
[0093] (SEQ ID NO: 14).
[0094] Embodiment 19. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO: 10), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside linkage, o is a phosphodiester nucleoside linkage, the oligomeric compound.
[0095] Embodiment 20. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, m C es T eo T eo Teo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (Sequence number 11), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond.
[0096] Embodiment 21. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m Ce (SEQ ID NO: 12), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage, said oligomeric compound.
[0097] Embodiment 22. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C es m C e (SEQ ID NO: 9), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond.
[0098] Embodiment 23. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m C ds T ds T eo m C es m C es T e (Sequence No. 13), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond.
[0099] Embodiment 24. An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, T es T eo m C eo G eo m C eo m C eo Tds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (SEQ ID NO: 14), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage, said oligomeric compound.
[0100] [[ID=5!]]Embodiment 25. A population of modified oligonucleotides according to any one of Embodiments 1 to 18, or a population of oligomeric compounds according to any one of Embodiments! 9 to 24, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom, said population.
[0101] <00!0913>Embodiment 26. A modified oligonucleotide according to any one of Embodiments 1 to 18, an oligomeric compound according to any one of Embodiments 19 to 24, or a population of modified oligonucleotides or a population of oligomeric compounds according to Embodiment 25, and a pharmaceutically acceptable diluent, a pharmaceutical composition.
[0102] Embodiment 27. The pharmaceutical composition according to Embodiment 26, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline.
[0103] Embodiment 28. The pharmaceutical composition according to Embodiment 27, wherein the pharmaceutical composition essentially consists of the modified oligonucleotide, the oligomer compound, or the population, and artificial cerebrospinal fluid or phosphate-buffered saline.
[0104] Embodiment 29. A method comprising administering to a subject a modified oligonucleotide described in any of Embodiments 1 to 18, an oligomeric compound described in any of Embodiments 19 to 24, or a group of modified oligonucleotides or oligomeric compounds described in Embodiment 25, or a pharmaceutical composition described in any of Embodiments 26 to 28.
[0105] Embodiment 30. A method for treating a disease related to type I interferon signaling, comprising administering to a subject having a disease related to type I interferon signaling a therapeutically effective amount of a modified oligonucleotide described in any of Embodiments 1 to 18, an oligomeric compound described in any of Embodiments 19 to 24, or a group of modified oligonucleotides or oligomeric compounds described in Embodiment 25, or a pharmaceutical composition described in any of Embodiments 26 to 28, thereby treating the disease related to type I interferon signaling.
[0106] Embodiment 31. The method according to Embodiment 30, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.
[0107] Embodiment 32. The method according to Embodiment 30 or 31, wherein the disease is related to an increase in the level of interferon alpha.
[0108] Embodiment 33. The method according to any one of Embodiments 30 to 32, wherein administration of the modified oligonucleotide, the oligomeric compound, a group of the modified oligonucleotides or a group of the oligomeric compounds, or the pharmaceutical composition reduces seizures, dystonia, convulsions, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, or cerebellar myelopathy in the subject, improves feeding, motor development, language development, or social skills development in the subject, or reduces interferon alpha or lymphocyte plaque in the cerebrospinal fluid of the subject.
[0109] Embodiment 34. A method for reducing the expression of IFNAR1 in cells, comprising contacting the cells with a modified oligonucleotide described in any of Embodiments 1 to 18, an oligomeric compound described in any of Embodiments 19 to 24, a group of modified oligonucleotides or a group of oligomeric compounds described in Embodiment 25, or a pharmaceutical composition described in any of Embodiments 26 to 28.
[0110] Embodiment 35. The method according to Embodiment 34, wherein the cells are neurons or glial cells, and optionally, the cells are astrocytes or microglia cells.
[0111] Embodiment 36. The method according to any one of Embodiments 29 to 33, wherein the subject is a human.
[0112] Embodiment 37. The method according to Embodiment 34 or 35, wherein the cells are human cells.
[0113] Embodiment 38. Use of a modified oligonucleotide according to any of Embodiments 1 to 18, an oligomeric compound according to any of Embodiments 19 to 24, a group of modified oligonucleotides or a group of oligomeric compounds according to Embodiment 25, or a pharmaceutical composition according to any of Embodiments 26 to 28, for the treatment of a disease related to type I interferon signaling.
[0114] Embodiment 39. Use of a modified oligonucleotide according to any of Embodiments 1 to 18, an oligomeric compound according to any of Embodiments 19 to 24, a group of modified oligonucleotides or a group of oligomeric compounds according to Embodiment 25, or a pharmaceutical composition according to any of Embodiments 26 to 28, in the manufacture of a pharmaceutical for treating a disease related to type I interferon signaling.
[0115] Embodiment 40. The use according to Embodiment 38 or 39, wherein the disease is related to an increase in the level of interferon alpha.
[0116] Embodiment 41. The use according to any one of Embodiments 38 to 40, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia.
[0117] 1. Compound number 1489477 In a particular embodiment, compound number 1489477 is characterized as a 6-10-4 MOE gapmer having the sequence CTTTTTCTGCTCTTATACGC (SEQ ID NO: 11) (from 5' to 3'), where nucleosides 1-6 and 17-20 (from 5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, and between 6 and 7 The nucleoside bonds between 17 and 18 are phosphodiester nucleoside bonds, and the nucleoside bonds between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.
[0118] In certain embodiments, compound number 1489477 is represented by the following chemical notation: m C es T eo T eo T eo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (Sequence number 11), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleobase, e is a 2’-MOE sugar moiety, d is a 2’-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.
[0119] In certain embodiments, Compound No. 1489477 is represented by the following chemical structure.
[0120]
Chemical Structure
[0121] (SEQ ID NO: 11) Structure 1. Compound No. 1489477
[0122] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 1.
[0123] In certain embodiments, the sodium salt of Compound No. 1489477 is represented by the following chemical structure.
[0124]
Chemical Structure
[0125] (SEQ ID NO: 11) Structure 2. Sodium salt of Compound No. 1489477
[0126] 2. Compound No. 1489494 In a particular embodiment, compound number 1489494 is characterized as a 6-10-4 MOE gapmer having the sequence CTGTTTTACATTTTTTTTCC (SEQ ID NO: 12) (from 5' to 3'), where nucleosides 1-6 and 17-20 (from 5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, and between 6 and 7 The nucleoside bonds between 17 and 18 are phosphodiester nucleoside bonds, and the nucleoside bonds between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.
[0127] In certain embodiments, compound number 1489494 is represented by the following chemical notation: m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m C e (Sequence No. 12), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.
[0128] In a particular embodiment, compound number 1489494 is represented by the following chemical structure.
[0129] [ka]
[0130] (Sequence ID 12) Structure 3. Compound number 1489494
[0131] In certain embodiments, the oligomer compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 3.
[0132] In a particular embodiment, the sodium salt of compound number 1489494 is represented by the following chemical structure.
[0133] [ka]
[0134] (Sequence ID 12) Structure 2. Sodium salt of compound number 1489494
[0135] 3. Compound number 1489525 In a particular embodiment, compound number 1489525 is characterized as a 5-10-5 MOE gapmer having the sequence (from 5' to 3') TTTATCCAATTATCCATCCC (SEQ ID NO: 9), where nucleosides 1-5 and 16-20 (from 5' to 3') are each 2'-MOE nucleosides, and nucleosides 6-15 are each 2'-β-D-deoxynucleosides, between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 16 and 17, and 17 The nucleoside bond between and 18 is a phosphodiester nucleoside bond, and the nucleoside bonds between nucleosides 1 and 2, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 18 and 19, and 19 and 20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.
[0136] In certain embodiments, compound number 1489525 is represented by the following chemical notation: T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C es m C e (Sequence ID 9), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.
[0137] In a particular embodiment, compound number 1489525 is represented by the following chemical structure.
[0138] [ka]
[0139] (Sequence ID 9) Structure 5. Compound number 1489525
[0140] In certain embodiments, the oligomer compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 5.
[0141] In a particular embodiment, the sodium salt of compound number 1489525 is represented by the following chemical structure.
[0142] [ka]
[0143] (Sequence ID 9) Structure 6. Sodium salt of compound number 1489525
[0144] 4. Compound number 1492069 In a particular embodiment, compound number 1492069 is characterized as a 5-10-5 MOE gapmer having the sequence TCGCCTAATTTTTCTCTCAC (SEQ ID NO: 10) (from 5' to 3'), where nucleosides 1-5 and 16-20 (from 5' to 3') are each 2'-MOE nucleosides, and nucleosides 6-15 are each 2'-β-D-deoxynucleosides, between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 16 and 17, and 17 The nucleoside bond between and 18 is a phosphodiester nucleoside bond, and the nucleoside bonds between nucleosides 1 and 2, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 18 and 19, and 19 and 20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.
[0145] In certain embodiments, compound number 1492069 is represented by the following chemical notation: T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (Sequence code 10), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.
[0146] In a particular embodiment, compound number 1492069 is represented by the following chemical structure.
[0147] [ka]
[0148] (Sequence ID 10) Structure 7. Compound number 1492069
[0149] In certain embodiments, the oligomer compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 7.
[0150] In a particular embodiment, the sodium salt of compound number 1492069 is represented by the following chemical structure.
[0151] [ka]
[0152] (Sequence ID 10) Structure 8. Sodium salt of compound number 1492069
[0153] 5. Compound number 1492082 In a particular embodiment, compound number 1492082 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') TTTCATATTTGTTACTTCCT (SEQ ID NO: 13), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, and between 6 and 7 The nucleoside bonds between 17 and 18 are phosphodiester nucleoside bonds, and the nucleoside bonds between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.
[0154] In certain embodiments, compound number 1492082 is represented by the following chemical notation: T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m C ds T ds T eo m C es m C es T e (Sequence No. 13), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.
[0155] In a particular embodiment, compound number 1492082 is represented by the following chemical structure.
[0156] [ka]
[0157] (Sequence ID 13) Structure 9. Compound number 1492082
[0158] In certain embodiments, the oligomer compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 9.
[0159] In a particular embodiment, the sodium salt of compound number 1492082 is represented by the following chemical structure.
[0160] [ka]
[0161] (Sequence ID 13) Structure 10. Sodium salt of compound number 1492082
[0162] 6. Compound number 1492131 In a particular embodiment, compound number 1492131 is characterized as a 6-10-4 MOE gapmer having the sequence (5' to 3') TTCGCCTAATTTTTCTCTCA (SEQ ID NO: 14), where nucleosides 1-6 and 17-20 (5' to 3') are each 2'-MOE nucleosides, and nucleosides 7-16 are each 2'-β-D-deoxynucleosides, between nucleosides 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, and between 6 and 7. The nucleoside bonds between 17 and 18 are phosphodiester nucleoside bonds, and the nucleoside bonds between nucleosides 1 and 2, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 18 and 19, and 19 and 20 are phosphorothioate nucleoside bonds, with each cytosine being 5-methylcytosine.
[0163] In certain embodiments, compound number 1492131 is represented by the following chemical notation: T es T eo m C eo G eo m C eo m C eo T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (Sequence ID 14), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, o is a phosphodiester nucleoside bond.
[0164] In a particular embodiment, compound number 1492131 is represented by the following chemical structure.
[0165] [ka]
[0166] (Sequence ID 14) Structure 11. Compound number 1492131
[0167] In certain embodiments, the oligomer compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 11.
[0168] In a particular embodiment, the sodium salt of compound number 1492131 is represented by the following chemical structure.
[0169] [ka]
[0170] (Sequence ID 14) Structure 12. Sodium salt of compound number 1492131
[0171] I. A specific oligonucleotide In certain embodiments, oligomeric compounds comprising oligonucleotides consisting of bound nucleosides are provided herein. The oligonucleotide may be an unmodified oligonucleotide (RNA or DNA) or a modified oligonucleotide. The modified oligonucleotide comprises at least one modification to the unmodified RNA or DNA. That is, the modified oligonucleotide comprises at least one modified nucleoside (a nucleoside containing a modified sugar and / or a modified nucleic acid base) and / or at least one modified internucleoside bond.
[0172] A. A specific modified nucleoside A modified nucleoside contains either a modified sugar moiety, a modified nucleic acid base, or both a modified sugar moiety and a modified nucleic acid base.
[0173] 1. A specific sugar portion In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituents, none of which bridge two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridged substituents may be at any position of the furanosyl ring, including but not limited to substituents at the 2', 3', 4', and / or 5' positions. Suitable 2'- substituents for the non-bicyclic modified sugar moiety include, but are not limited to, 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl").
[0174] In certain embodiments, the modified furanosyl sugar moiety and the nucleoside incorporating such modified furanosyl sugar moiety are further defined by their isomer configuration. For example, the 2'-deoxyfuranosyl sugar moiety may have seven isomer configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has an additional stereocenter at the 2'-position compared to the 2'-deoxyfuranosyl sugar moiety; therefore, such a sugar moiety has a total of 16 possible isomer configurations. Unless otherwise specified, the 2'-modified sugar moieties described herein are in the β-D-ribosyl isomer configuration.
[0175] 2. Certain modified nucleic acid bases In certain embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleic acid bases. An example of a modified nucleic acid base is 5-methylcytosine.
[0176] This is a slightly different type of snowflake Then there is the manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al al.,US5,175,273、Urdea et al.,US5,367,066、Benner et al.,US5,432,272、Matteucci et al.,US5,434,257、Gmeiner et al.,US5,457,187、Cook et al al.,US5,459,255、Froehler et al.,US5,484,908、Matteucci et al.,US5,502,177、Hawkins et al.,US5,525,711、Haralambidis et al.,US5,552,540、Cook et al al.,US5,587,469、Froehler et al.,US5,594,121、Switzer et al.,US5,596,091、Cook et al.,US5,614,617、Froehler et al.,US5,645,985、Cook et al al.,US5,681,941 Cook et al.,US5,811,534 Cook et al.,US5,750,692 Cook et al.,US5,948,903 Cook et al.,US5,587,470 Cook et al al.,US5,763,588, Froehler et al.,US5,830,653, Cook et al.,US5,808,027, Cook et al.,US6,166,199, and Matteucci et al al.,US6,005,096.
[0177] 3. Certain modified nucleoside bonds The naturally occurring nucleoside linkages of RNA and DNA are 3'-5' phosphodiester links. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified nucleoside linkages. Two main classes of nucleoside linkages are defined by the presence or absence of a phosphorus atom. Typical phosphorus-containing nucleoside linkages include, but are not limited to, phosphates, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S") containing phosphodiester links ("P=O") (also referred to as unmodified or native links). Modified nucleoside linkages may be used to modify, typically increase, the nuclease resistance of oligonucleotides compared to native phosphate linkages. In certain embodiments, nucleoside linkages having chiral atoms may be prepared as racemic mixtures or as distinct enantiomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside bonds are well known to those skilled in the art.
[0178] Representative nucleoside bonds containing a chiral center include, but are not limited to, phosphorothioates. Modified oligonucleotides containing chiral nucleoside bonds may be prepared as a population of modified oligonucleotides containing stereorandom nucleoside bonds, or as a population of modified oligonucleotides containing phosphorothioates or other bonds containing a chiral center in a particular stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate nucleoside bonds, and all phosphorothioate nucleoside bonds are stereorandom. Such modified oligonucleotides may be produced using synthetic methods that result in a random selection of the stereochemical configuration of each phosphorothioate bond. Nevertheless, each individual phosphorothioate in each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing one or more specific phosphorothioate nucleoside bonds in a particular independently selected stereochemical configuration. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate bonds is present in at least 99% of the molecules in the population. Such chiralally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, e.g., Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and the methods described in WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, each modified oligonucleotide containing (Rp) and / or (Sp) phosphorothioates comprises one or more of the following formulas, where "B" represents a nucleic acid base.
[0179] [ka]
[0180] Unless otherwise indicated, the chiral nucleoside bonds of the modified oligonucleotides described herein may be stereorandom or in a specific stereochemical configuration.
[0181] B. A specific motif In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises one or more modified nucleosides containing a modified nucleic acid base. In certain embodiments, a modified oligonucleotide comprises one or more modified internucleoside bonds. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleic acid bases, and / or internucleoside bonds of the modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleic acid bases, and internucleoside bonds are each independent of each other. Thus, a modified oligonucleotide can be described by its sugar motif, nucleic acid base motif, and / or internucleoside bond motif (wherein used herein, the nucleic acid base motif describes a modification to the nucleic acid base that is independent of the sequence of the nucleic acid base).
[0182] 1. A specific sugar motif In certain embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged along the oligonucleotide or its region in a defined pattern or sugar motif. In certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications considered herein.
[0183] Gapmer oligonucleotides In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (5'-wing, gap, and 3'-wing) form a contiguous sequence of nucleosides, where at least a portion of the sugar moieties of each nucleoside in the wings differs from at least a portion of the sugar moieties of the nucleosides in the gap. Specifically, the sugar moieties of at least the nucleosides in each wing closest to the gap (the 3'-side nucleoside of the 5'-wing and the 5'-side nucleoside of the 3'-wing) differ from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to each other. In certain embodiments, the gap comprises one or more nucleosides having sugar moieties that differ from the sugar moieties of one or more other nucleosides in the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmer).
[0184] In certain embodiments, the gapmer wing contains 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of the gapmer contain a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of the gapmer contain a modified sugar moiety.
[0185] In certain embodiments, the gap of the gapmer contains 7 to 12 nucleosides. In certain embodiments, each nucleoside in the gapmer contains a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside in the gapmer contains a modified sugar moiety.
[0186] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, the gap-side nucleoside of each wing / gap junction contains a 2'-deoxyribosyl sugar moiety, and the wing-side nucleoside of each wing / gap junction contains a modified sugar moiety. In certain embodiments, each nucleoside of the gap contains a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of the gapmer contains a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of the gapmer contains a modified sugar moiety. In certain embodiments, one nucleoside of the gap contains a modified sugar moiety, and each remaining nucleoside of the gap contains a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of the gapmer contains a 2'-OMe sugar moiety.
[0187] In this specification, the lengths (number of nucleosides) of the three regions of a gapmer may be given using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three bound nucleosides in each wing and ten bound nucleosides in the gap. If such nomenclature is followed by a specific modification, that modification is a modification in each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five bound 2'-MOE nucleosides in the 5'-wing, ten bound 2'-β-D-deoxynucleosides in the gap, and five bound 2'-MOE nucleosides in the 3'-wing. The 6-10-4MOE gapmer consists of six bound 2'-MOE nucleosides in the 5'-wing, ten bound 2'-β-D-deoxynucleosides in the gap, and four bound 2'-MOE nucleosides in the 3'-wing. The 3-10-3cEt gapmer consists of three bound cEt nucleosides in the 5'-wing, ten bound 2'-β-D-deoxynucleosides in the gap, and three bound cEt nucleosides in the 3'-wing.
[0188] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer.
[0189] In a particular embodiment, the modified oligonucleotide has a sugar motif selected from 5' to 3':eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.
[0190] In certain embodiments, the modified oligonucleotide has a sugar motif selected from 5' to 3':eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.
[0191] In a particular embodiment, the modified oligonucleotide has a sugar motif selected from 5' to 3':kkkddddddddddkkk, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "k" represents a cEt modified sugar moiety.
[0192] 2. A specific nucleic acid base motif In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleic acid bases arranged along the oligonucleotide or its region in a defined pattern or motif. In certain embodiments, each nucleic acid base is modified. In certain embodiments, none of the nucleic acid bases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleic acid bases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleic acid bases are 5-methylcytosine, and all of the other nucleic acid bases of the modified oligonucleotide are unmodified nucleic acid bases.
[0193] In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside containing a modified nucleic acid base. In certain such embodiments, one nucleoside containing a modified nucleic acid base is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety.
[0194] 3. A specific nucleoside bond motif In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside bonds arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside bond is a phosphodiester internucleoside bond (P=O). In certain embodiments, each internucleoside bond of the modified oligonucleotide is a phosphorothioate internucleoside bond (P=S). In certain embodiments, each internucleoside bond of the modified oligonucleotide is independently selected from phosphorothioate internucleoside bonds and phosphodiester internucleoside bonds. In certain embodiments, each phosphorothioate internucleoside bond is independently selected from stereorandom phosphorothioate, (Sp)phosphorothioate, and (Rp)phosphorothioate.
[0195] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all nucleoside bonds within the gap are modified. In certain such embodiments, some or all of the nucleoside bonds within the wings are unmodified phosphodiester nucleoside bonds. In certain embodiments, the terminal nucleoside bonds are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the nucleoside bond motif includes at least one phosphodiester nucleoside bond in at least one wing, where at least one phosphodiester bond is not a terminal nucleoside bond, and the remaining nucleoside bonds are phosphorothioate nucleoside bonds. In certain such embodiments, all phosphorothioate bonds are stereorandom. In certain embodiments, all phosphorothioate bonds in the wings are (Sp)phosphorothioate, and the gap includes at least one Sp,Sp,Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing such nucleoside-linking motifs.
[0196] In certain embodiments, the modified oligonucleotide has a (5' to 3'):sooosssssssssssss nucleoside linkage motif, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage.
[0197] II. Certain Oligomer Compounds In certain embodiments, oligomeric compounds comprising oligonucleotides (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups are provided herein. A conjugate group comprises one or more conjugate moieties and a conjugate linker that attaches the conjugate moieties to an oligonucleotide. The conjugate group may be attached to either end or both ends and / or any internal position of the oligonucleotide. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, a conjugate group attached to either end or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.
[0198] Examples of terminal groups include, but are not limited to, conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.
[0199] A. A specific conjugate group In certain embodiments, the oligonucleotide is covalently bonded to one or more conjugate groups. In certain embodiments, the conjugate groups modify one or more properties of the bound oligonucleotide, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cell distribution properties, cell uptake properties, charge properties, and clearance properties.
[0200] In certain embodiments, the conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is conjugated to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced by another moiety, e.g., a non-carbohydrate (preferably cyclic) support to which a carbohydrate ligand is conjugated. A ribonucleotide subunit in which the ribose sugar of the subunit is thus replaced is referred herein to as a ribose-substituted modified subunit (RRMS), which is the modified sugar moiety. The cyclic support can be a carbocyclic system, i.e., one or more ring atoms can be heteroatoms, e.g., nitrogen, oxygen, sulfur. The cyclic support can be a monocyclic system or may include two or more rings, e.g., a fused ring. The cyclic support can be a fully saturated system or may include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.
[0201] In certain embodiments, the conjugate group imparts a novel property to the bound oligonucleotide, such as a fluorophore or reporter group that enables the detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been previously described, for example, the cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NYA Acad. Sci., 1992, 660, 306-309, Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), and thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118, Kabanov et al., FEBS Lett., 1990, 259, 327-330, Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g., dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetate palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al.These are either ,J.Pharmacol.Exp.Ther.,1996,277,923-937, tocopherol groups (Nishina et al.,Molecular Therapy Nucleic Acids,2015,4,e220, and Nishina et al.,Molecular Therapy,2008,16,734-740), or GalNAc clusters (e.g., WO2014 / 179620).
[0202] In a particular embodiment, the conjugate group may include a conjugate moiety selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
[0203] In a particular embodiment, the conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, and the alkyl chain has one or more unsaturated bonds.
[0204] In a particular embodiment, the conjugate group is a lipid having the following structure:
[0205] [ka]
[0206] 1. Conjugate portion The conjugate moiety may include, but is not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and pigments.
[0207] In certain embodiments, the conjugate portion includes an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansyl sarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial agents, or antibiotics.
[0208] 2. Conjugate Linker The conjugate moiety is bonded to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly bonded to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker includes a chain structure such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, a nucleoside, or an amino acid unit.
[0209] In certain embodiments, the conjugate linker contains pyrrolidine.
[0210] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.
[0211] In certain embodiments, conjugate linkers, including the conjugate linker described above, are known in the art to be useful for conjugating a difunctional linkage, for example, a conjugate portion, to a compound such as an oligonucleotide provided herein. Generally, a difunctional linkage includes at least two functional groups. One of the functional groups is selected to react with a specific site of the compound, and the other is selected to react with the conjugate portion. Examples of functional groups used in a difunctional linkage include, but are not limited to, electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In certain embodiments, the difunctional linkage includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl groups.
[0212] Examples of conjugate linkers, but not limited to these, include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers, but not limited to these, include substituted or unsubstituted C1-C 10 Alkyl, substituted, or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 Examples of alkynyl substituents include hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl substituents.
[0213] In certain embodiments, the conjugate linker contains 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker contains 2 to 5 linker nucleosides. In certain embodiments, the conjugate linker contains exactly 3 linker nucleosides. In certain embodiments, the conjugate linker contains a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides contain a modified sugar moiety. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleosides contain an optionally protected heterocyclic base selected from purines, substituted purines, pyrimidines, or substituted pyrimidines. In certain embodiments, the cleavable portion is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable that the linker nucleoside be cleaved from the oligomer compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomer compound via cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
[0214] In this specification, linker nucleosides are not considered part of oligonucleotides. Therefore, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of conjugated nucleosides and / or a specific complementation (%) to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group containing a conjugate linker containing a linker nucleoside, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the complementation (%) of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides, and (2) a conjugate group containing 1 to 10 linker nucleosides consecutive to the nucleosides of the modified oligonucleotide. The total number of consecutively conjugated nucleosides in such an oligomeric compound may exceed 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and without a conjugate group. The total number of consecutively bonded nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker contains 10 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 5 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 3 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 2 or fewer linker nucleosides. In certain embodiments, the conjugate linker contains 1 or fewer linker nucleosides.
[0215] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide. For example, in certain circumstances, an oligomeric compound containing a particular conjugate moiety is readily taken up by a particular cell type, but after the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Therefore, a particular conjugate linker may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group containing at least one cleavable bond. In certain embodiments, the cleavable moiety contains an atomic group having one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.
[0216] In certain embodiments, the cleavable bond is selected from amides, esters, ethers, one or both phosphodiesters, phosphate esters, carbamates, or disulfides. In certain embodiments, the cleavable bond is one or both phosphodiesters. In certain embodiments, the cleavable portion includes phosphate or a phosphodiester. In certain embodiments, the cleavable portion is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0217] In certain embodiments, the cleavable portion comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are bonded to each other and / or to the remainder of the oligomeric compound by cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable portion is a 2'-deoxyribonucleoside that is bonded to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate nucleoside bond and covalently bonded to the conjugated linker or the remainder of the conjugated portion by a phosphate bond or a phosphorothioate bond. In certain such embodiments, the cleavable portion is 2'-deoxyadenosine.
[0218] 3.Cell targeting part In certain embodiments, the conjugate group includes a cell-targeting moiety. In certain embodiments, the conjugate group has the following general formula:
[0219] [ka]
[0220] In the formula, n is between 1 and approximately 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
[0221] In a particular embodiment, n is 1, j is 1, and k is 0. In a particular embodiment, n is 1, j is 0, and k is 1. In a particular embodiment, n is 1, j is 1, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 0. In a particular embodiment, n is 2, j is 0, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 0. In a particular embodiment, n is 3, j is 0, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 1.
[0222] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tether ligand. In certain embodiments, the cell-targeting moiety comprises two tether ligands covalently bonded to the branching group.
[0223] In certain embodiments, each ligand in the cell-targeting moiety has affinity for at least one receptor type on the target cell. In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells. In certain embodiments, each ligand has affinity for the hepatic glycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.
[0224] In certain embodiments, the conjugate group includes a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the following general formula:
[0225] [ka]
[0226] In the formula, n is between 1 and approximately 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.
[0227] In a particular embodiment, n is 1, j is 1, and k is 0. In a particular embodiment, n is 1, j is 0, and k is 1. In a particular embodiment, n is 1, j is 1, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 0. In a particular embodiment, n is 2, j is 0, and k is 1. In a particular embodiment, n is 2, j is 1, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 0. In a particular embodiment, n is 3, j is 0, and k is 1. In a particular embodiment, n is 3, j is 1, and k is 1.
[0228] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tether ligand. In certain embodiments, the cell-targeting moiety comprises two tether ligands covalently bound to the branching group. In certain embodiments, the cell-targeting moiety comprises three tether ligands covalently bound to the branching group.
[0229] III. A specific terminal group In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. The stabilized 5'-phosphate comprises 5'-phosphonates, including but not limited to 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more debasic sugar moieties and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-bonded nucleosides or sugar moieties. In certain such embodiments, the 2'-bonded group is a debasic sugar moiety.
[0230] IV. Antisense Activation In certain embodiments, oligomeric compounds and oligomeric double strands can impart at least one antisense activity by hybridizing to a target nucleic acid. Such oligomeric compounds and oligomeric double strands are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce or inhibit the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds act selectively on one or more target nucleic acids. Such antisense compounds include nucleic acid sequences that hybridize to one or more target nucleic acids to impart one or more desired antisense activities, and that do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in a manner that results in significant undesirable antisense activity.
[0231] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA double helix. The DNA in such an RNA:DNA double helix does not need to be unmodified DNA. In certain embodiments, antisense compounds that are sufficiently "DNA-like" to induce RNase H activity are described herein. In certain embodiments, one or more non-DNA-like nucleosides within the gapmer gap are acceptable.
[0232] In certain antisense activities, the antisense compound or a portion of the antisense compound is incorporated into the RNA-induced silencing complex (RISC), ultimately leading to cleavage of the target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaut. The antisense compound incorporated into RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).
[0233] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.
[0234] Antisense activity can be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity includes observing or detecting changes in the amount of a target nucleic acid or the protein encoded by such a target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or changes in the phenotypic characteristics of a cell or animal.
[0235] V. A specific target nucleic acid In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a region complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA containing introns, exons, and untranslated regions. In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.
[0236] A.IFNAR1 In certain embodiments, the oligomer compound comprises or consists of an oligonucleotide containing a region complementary to the target nucleic acid, the target nucleic acid being IFNAR1 nucleic acid. In certain embodiments, the IFNAR1 nucleic acid has the sequence shown in SEQ ID NO: 1 (GENBANK accession number NC_000021.9, cleaved at 33321001-33363000) or SEQ ID NO: 2 (GENBANK accession number NM_000629.2). In certain embodiments, contacting cells with an oligomer compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of IFNAR1 RNA, and in certain embodiments, reduces the amount of IFNAR1 protein. In certain embodiments, the oligomer compound consists of a modified oligonucleotide. In certain embodiments, the oligomer compound consists of a modified oligonucleotide and a conjugate group.
[0237] B. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide containing a region complementary to the target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in a pharmacologically relevant cell. In certain embodiments, the pharmacologically relevant cell is a neuron or a glial cell. In certain embodiments, the pharmacologically relevant cell is an astrocyte or a microglia cell. In certain embodiments, the pharmacologically relevant cell is a vascular smooth muscle cell, a vascular endothelial cell, or a pericyte.
[0238] VI. Certain methods and uses Certain embodiments provided herein relate to methods for inhibiting IFNAR1 expression, which may be useful for treating neuroinflammation-related diseases, such as diseases associated with elevated type I interferon signaling, or diseases associated with overexpression of type I interferon in a subject, by administering oligomeric compounds, modified oligonucleotides, or oligomeric doubles containing modified oligonucleotides having a nucleic acid base sequence complementary to the IFNAR1 nucleic acid.
[0239] Examples of diseases treatable by the oligomeric compounds, modified oligonucleotides, oligomeric double-strands, and methods provided herein include neurological disorders or conditions associated with neuroinflammation, such as Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia, which are associated with elevated type I interferon signaling or overexpression of type I interferon. In certain embodiments, the method involves administering an oligomeric compound, modified oligonucleotide, or oligomeric double-strand having a nucleic acid base sequence complementary to the IFNAR1 nucleic acid to a target. In certain embodiments, subjects have a neurological disorder or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive impairment, cranial radiation-induced cognitive impairment, viral infection-induced cognitive impairment, neuromyelitis optica, and ataxia telangiectasia. In certain embodiments, a method for treating a neuroinflammatory neurological disorder or condition selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive impairment, cranial radiation-induced cognitive impairment, viral infection-induced cognitive impairment, neuromyelitis optica, and telangiectatic ataxia in a subject comprises administering a therapeutically effective amount of an oligomeric compound, modified oligonucleotide, or oligomeric double-strand having a nucleic acid base sequence complementary to the IFNAR1 nucleic acid to the subject, thereby treating the subject. In certain embodiments, the administration of a therapeutically effective amount of the oligomeric compound or modified oligonucleotide improves the symptoms or characteristics of the neuroinflammatory disorder or condition.In certain embodiments, the symptoms or features are selected from seizures, feeding difficulties, dystonia, convulsions, motor developmental delay, language developmental delay, social skills developmental delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, and microencephalopathy. In certain embodiments, administration of a therapeutically effective amount of an oligomeric compound or modified oligonucleotide reduces type I IFN signaling or lymphocytosis in the cerebrospinal fluid of the subject.
[0240] In certain embodiments, a method for inhibiting the expression of IFNAR1 nucleic acid, e.g., RNA, in a subject having a neuroinflammation-related disease, e.g., a disease associated with elevated type I interferon signaling, or a disease associated with overexpression of type I interferon, comprises administering an oligomeric compound, modified oligonucleotide, or oligomeric double-strand having a nucleic acid base sequence complementary to IFNAR1 nucleic acid to the subject, thereby inhibiting the expression of IFNAR1 nucleic acid in the subject. In certain embodiments, the administration of the oligomeric compound, modified oligonucleotide, or oligomeric double-strand inhibits the expression of IFNAR1 in the brain or spinal cord. In certain embodiments, the subject has a neurological disease or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia. In certain embodiments, a method for inhibiting intracellular IFNAR1 nucleic acid expression comprises contacting cells with an oligomeric compound, modified oligonucleotide, or oligomeric double-strand having a nucleic acid base sequence complementary to IFNAR1 nucleic acid, thereby inhibiting intracellular IFNAR1 nucleic acid expression. In certain embodiments, the cells are glial cells, e.g., astrocytes or microglia. In certain embodiments, the cells are within subjects having neurological disorders or conditions associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorders, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia.
[0241] In certain embodiments, oligomeric compounds, modified oligonucleotides, or oligomeric doubles having a nucleic acid base sequence complementary to the IFNAR1 nucleic acid are shown for use in the treatment of neuroinflammatory diseases, such as diseases associated with elevated type I interferon signaling or diseases associated with IFNa overexpression. In certain embodiments, the disease is a neurological disorder or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune diseases, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia. In certain embodiments, oligomeric compounds, modified oligonucleotides, or oligomeric doubles are used to improve symptoms or characteristics of diseases or conditions associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune diseases, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia. In certain embodiments, the symptoms or characteristics are selected from seizures, feeding difficulties, dystonia, convulsions, motor development delay, language development delay, social skills development delay, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, and microencephalopathy. In certain embodiments, oligomeric compounds, modified oligonucleotides, or oligomeric doubles are used to reduce type I IFN signaling or lymphocytosis in the cerebrospinal fluid of the subject.
[0242] Certain embodiments are shown for oligomeric compounds, modified oligonucleotides, or oligomeric doubles, any of which include modified oligonucleotides having a nucleic acid base sequence complementary to the IFNAR1 nucleic acid, for the manufacture or preparation of pharmaceuticals for treating neuroinflammatory diseases, such as diseases associated with elevated type I interferon signaling or diseases associated with IFNa overexpression. In certain embodiments, the disease is a neurological disorder or condition associated with neuroinflammation selected from Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune diseases, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia. In certain embodiments, the oligomeric compound, modified oligonucleotide, or oligomeric double-strand is for the manufacture or preparation of a pharmaceutical product for improving symptoms or characteristics associated with Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune diseases, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, and telangiectatic ataxia. In certain embodiments, the symptoms or characteristics are selected from seizures, dysphagia, dystonia, convulsions, motor developmental delay, language developmental delay, social skills developmental delay, white matter abnormalities, T-cell infiltration, B-cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, and microencephalopathy. In certain embodiments, the oligomeric compound, modified oligonucleotide, or oligomeric double-strand is for the manufacture or preparation of a pharmaceutical product for use in reducing type I IFN signaling or lymphocytosis in the cerebrospinal fluid of the subject.
[0243] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, or oligomeric double-strand may be any of those described herein.
[0244] VII. Certain Pharmaceutical Compositions In certain embodiments, a pharmaceutical composition comprising one or more oligomeric compounds is provided herein. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or comprises sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or comprises one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or comprises one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS comprises pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or comprises one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade artificial cerebrospinal fluid.
[0245] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition essentially consists of a modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.
[0246] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition essentially consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
[0247] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipients are selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0248] In certain embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inactive substances for the preparation of a pharmaceutical composition or formulation. The compositions and methods for formulating a pharmaceutical composition depend on several criteria, including, but not limited to, the route of administration, the severity of the disease, or the dose administered.
[0249] In certain embodiments, a pharmaceutical composition comprising an oligomeric compound includes any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric compound comprising one or more oligonucleotides can provide (directly or indirectly) a biologically active metabolite or residue thereof upon administration to an animal, including a human. Thus, for example, this disclosure also covers pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Preferred pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups bonded to oligonucleotides, which are cleaved by endogenous nucleases in the body.
[0250] Lipid moieties are used in nucleic acid therapy in various ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into pre-formed liposomes or lipoplexes prepared from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of a drug to muscle tissue.
[0251] In certain embodiments, the pharmaceutical composition includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0252] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceuticals of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.
[0253] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Certain such cosolvent systems include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of anhydrous ethanol containing 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such cosolvent systems can vary considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the cosolvent components may vary; for example, other surfactants may be used instead of Polysorbate 80™, the fraction size of polyethylene glycol may vary, other biocompatible polymers may substitute polyethylene glycol, such as polyvinylpyrrolidone, and other sugars or polysaccharides may substitute dextrose.
[0254] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution such as water, or in a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or saline buffer. In certain embodiments, other components are included (e.g., components that aid solubility or serve as preservatives). In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspension, etc. Certain pharmaceutical compositions for injection are in unit dosage forms, e.g., ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in an oily or aqueous vehicle and may contain formulations such as suspensions, stabilizers, and / or dispersants. Certain solvents suitable for use in pharmaceutical compositions for injection include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes.
[0255] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be illustrated or described in protonated (free acid) form or in ionized and cation-associated (salt) form, but aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, the compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist as a collection of forms, all of which are in equilibrium at multiple positions. The term “oligonucleotide” is intended to include all such forms. Illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such depictions are also intended to include the corresponding forms. In this specification, structures in which the term “its salt” follows the free acid of a compound clearly include all such forms that are fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.
[0256] In certain embodiments, the modified oligonucleotide or oligomer compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomer compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomer compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomer compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0257] In this specification, a specific dose is described. The dose may be in the form of a dosage unit. For clarity, the dose (or dosage unit) of a modified oligonucleotide or oligomer compound in milligrams represents the mass of the modified oligonucleotide or oligomer compound in its free acid form. As described above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating doses, it is assumed that the modified oligonucleotide or oligomer compound exists as solvent-free, sodium acetate-free, anhydrous, and free acid. For example, if the modified oligonucleotide or oligomer compound is in a sodium-containing solution (e.g., physiological saline), the modified oligonucleotide or oligomer compound may be partially or completely deprotonated and associate with Na+ ions. However, even then, the mass of the proton is counted in the weight of the dose, and the mass of the Na+ ion is not counted in the weight of the dose. Therefore, for example, a dose or dosage unit of compound number 1492069 of 10 mg is equal to the number of fully protonated molecules having a weight of 10 mg. This corresponds to 10.59 mg of compound number 1492069 in solvent-free, sodium acetate-free, and sodiated form. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purpose of calculating the dose.
[0258] Non-exclusive disclosure and incorporation by reference Each of the documents and patent publications listed herein is incorporated in their entirety by reference.
[0259] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. References, GenBank accession numbers, ENSEMBL identifiers, etc., listed herein are incorporated herein by reference in their entirety.
[0260] The sequence listings attached to this application identify sequences as either "RNA" or "DNA" where necessary, but in practice, these sequences can be modified with any combination of chemical modifications. Those skilled in the art will readily understand that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain cases, arbitrary. For example, an oligonucleotide containing a nucleoside with a 2'-OH sugar moiety and a thymine base may be described as DNA with a modified sugar (a 2'-OH instead of one 2'-H in the DNA) or as RNA with a modified base (thymine (methylated uracil) instead of uracil in the RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listings, are intended to encompass nucleic acids including any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids having modified nucleic acid bases. As further examples, without limitation, oligomeric compounds having the nucleic acid base sequence "ATCGATCG" include, but are not limited to, those having the sequence "AUCGAUCG" and RNA bases such as "AUCGATCG" and several DNA bases and several RNA bases, and "AT m This includes any oligomeric compound having such a nucleic acid base sequence, including oligomeric compounds having other modified nucleic acid bases such as "CGAUCG". m C represents a cytosine base containing a methyl group at the 5-position.
[0261] Certain compounds described herein (e.g., modified oligonucleotides) have one or more chiral centers and thus give rise to other stereoisomer configurations that can be defined with respect to absolute stereochemistry, such as enantiomers, diastereomers, and other stereoisomer configurations as (R) or (S), as α or β in sugar anomers, or as (D) or (L) in amino acids. Compounds provided herein that are described or described as having a particular stereoisomer configuration include only the compounds indicated. Compounds provided herein that are described or described with an undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms) unless otherwise specified. Similarly, tautomerized forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.
[0262] The compounds described herein include variant forms in which one or more atoms of the element shown are replaced with non-radioactive or radioactive isotopes. For example, the compounds described herein that contain a hydrogen atom are 1 This includes all possible deuterium substitutions for each of the H hydrogen atoms. The isotopic substitutions included by the compounds herein include: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C, 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36This includes, but is not limited to, sulfur (S). In certain embodiments, non-radioactive isotope substitutions can impart novel properties to oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions can make compounds suitable for research purposes such as imaging or for diagnostic purposes. [Examples]
[0263] The following examples illustrate, but do not limit, certain embodiments of the present disclosure. Furthermore, where specific embodiments are provided, the inventors intend for those specific embodiments to be generally applicable. For example, the disclosure of oligonucleotides having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motifs. Furthermore, for example, if a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered preferable unless otherwise indicated.
[0264] Example 1: Design of modified oligonucleotides complementary to human IFNAR1 nucleic acid Modified oligonucleotides complementary to human IFNAR1 nucleic acid were designed as shown in the table below. The "start site" indicates the 5' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The "end site" indicates the 3' nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NC_000021.9, cleaved at 33321001-33363000), SEQ ID NO: 2 (GENBANK accession number NM_000629.2), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to its particular target nucleic acid sequence.
[0265] The modified oligonucleotides in the table below are 5-10-5MOE gapmers. The gapmer has a 20-nucleoside length, and the sugar motif of the gapmer is (5' to 3'):eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has a nucleoside-linking motif (5' to 3'):sooossssssssssssooss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0266] [Table 1]
[0267] The modified oligonucleotides in the table below are 6-10-4MOE gapmers. The gapmer has a 20-nucleoside length, and the sugar motif of the gapmer is (5' to 3'):eeeeeeddddddddddeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The gapmer has a nucleoside-linking motif (5' to 3'):sooooosssssssssssoss, where each "s" represents a phosphorothioate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. Each cytosine residue is 5-methylcytosine.
[0268] [Table 2]
[0269] Example 2: Activity of modified oligonucleotides complementary to human IFNAR1 in transgenic mice The modified oligonucleotides described above were tested in a human IFNAR1 transgenic mouse model. Transgenic mice expressing human IFNAR1 transcripts were generated.
[0270] Exons 1-6 and approximately 4.9 kB of the upstream sequence of the human IFNAR1 gene from fosmid ABCS-41091_400N2 were subcloned into BAC, CTD-2289N21, which contained exons 7-11 and 56 kB of the downstream sequence of the human IFNAR1 gene, to generate a complete IFNAR1 transgene. The manipulated BAC was digested with Not1 to remove the BAC skeleton. Three founder strains were generated by introducing the purified BAC fragment containing the complete human IFNAR1 gene into C57BL / 6 mouse fertilized eggs by pronuclear injection. Strain 17505 was used in the experiments described herein.
[0271] treatment Transgenic mice were divided into groups of two. Each mouse was administered a single ICV bolus of 300 μg of modified oligonucleotide. PBS was administered to groups of 2-4 mice as a negative control.
[0272] RNA analysis Two weeks after treatment, the mice were euthanized, and RNA was extracted from cortical brain tissue and spinal cord for RTPCR analysis using the human primer probe set RTS44352 (forward sequence CTTTCAAGTTCAGTGGCTCCA, specified as SEQ ID NO: 6; reverse sequence CGTTTTGAGGAAAGACACACTG, specified as SEQ ID NO: 7; probe sequence AGTTTTGACATTTTCACAGTCAGGTATTTGTTTCC). The amount of IFNAR1 RNA was measured. Results are expressed as a percentage of human IFNAR1 relative to PBS control, normalized to 18S ribosomal RNA. 18S ribosomal RNA was amplified using the mouse 18S prime probe set PPS54360 (forward sequence GGAACTGAGGCCATGATTAAGA, specified as SEQ ID NO: 3; reverse sequence ACCTCCGACTTTCGTTCTTG, specified as SEQ ID NO: 5; probe sequence AAGACGGACCAGAGCGAAAGCAT).
[0273] [Table 3]
[0274] [Table 4]
[0275] Example 3: Efficacy of modified oligonucleotides complementary to human IFNAR1 RNA in transgenic mice The modified oligonucleotides described above were tested in human IFNAR1 transgenic mice (as described above in this specification).
[0276] treatment Human IFNAR1 transgenic mice were divided into groups of four. Each mouse was administered a single ICV bolus of modified oligonucleotide at the doses shown in the table below. PBS was administered to each group of four mice as a negative control.
[0277] RNA analysis Two weeks after treatment, the mice were euthanized, and RNA was extracted from the spinal cord, cerebral cortex, and cerebellum for quantitative real-time RTPCR analysis of IFNAR1 RNA expression using the primer probe set RTS44352 (described above in this specification). Results are expressed as a percentage of human IFNAR1 RNA relative to PBS control, prepared for 18S PCR (described above in this specification).
[0278] 50% maximum effective dose (ED) of each modified oligonucleotide 50 The following calculation was performed using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). ED 50 The values were calculated from the dose and IFNAR1 RNA levels of individual animals using the following custom equation: Agonist vs. Response - Variable Gradient (4 parameters) Y = Bottom + (Top - Bottom) / (1 + (10^logED50 / X)^HillSlope), with the following constraints: bottom > 0, top = 100.
[0279] As shown in the table below, treatment with modified oligonucleotides resulted in a reduction in the dose-response of IFNAR1 RNA compared to the PBS control.
[0280] [Table 5]
[0281] [Table 6] In one embodiment, the present invention may be described as follows. [Aspect 1] Modified oligonucleotide according to the following chemical structure [ka] (Sequence ID 10), or a salt thereof. [Aspect 2] The modified oligonucleotide according to aspect 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 3] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 10). [Aspect 4] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 11), or a salt thereof. [Aspect 5] The modified oligonucleotide according to aspect 4, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 6] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 11). [Aspect 7] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 12), or a salt thereof. [Aspect 8] The modified oligonucleotide according to aspect 7, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 9] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 12). [Aspect 10] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 9), or a salt thereof. [Aspect 11] The modified oligonucleotide according to aspect 10, which is a sodium salt or a potassium salt. [Aspect 12] Modified oligonucleotide according to the following chemical structure [ka] (Sequence ID 9). [Aspect 13] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 13), or a salt thereof. [Aspect 14] The modified oligonucleotide according to aspect 13, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 15] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 13). [Aspect 16] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 14), or a salt thereof. [Aspect 17] The modified oligonucleotide according to aspect 16, wherein the modified oligonucleotide is a sodium salt or a potassium salt. [Aspect 18] Modified oligonucleotides according to the following chemical structure [ka] (Sequence ID 14). [Aspect 19] An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, T es m C eo G eo m C eo m C es Tds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (Sequence code 10), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond. [Aspect 20] An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, m C es T eo T eo T eo T eo T eo m C ds T ds G ds m C ds T ds m C ds T ds T ds A ds T ds A eo m C es G es m C e (Sequence number 11), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond. [Aspect 21] An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, m C es T eo G eo T eo T eo T eo T ds A ds m C ds A ds T ds T ds T ds T ds T ds T ds T eo T es m C es m C e (Sequence No. 12), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond. [Aspect 22] An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, T es T eo T eo A eo T es m C ds m C ds A ds A ds T ds T ds A ds T ds m C ds m C ds A eo T eo m C es m C es m C e (Sequence ID 9), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond. [Aspect 23] An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, T es T eo T eo m C eo A eo T eo A ds T ds T ds T ds G ds T ds T ds A ds m Cds T ds T eo m C es m C es T e (Sequence No. 13), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond. [Aspect 24] An oligomer compound comprising a modified oligonucleotide according to the following chemical notation, T es T eo m C eo G eo m C eo m C eo T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T es m C es A e (Sequence ID 14), in the formula, A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is a thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The oligomer compound wherein o is a phosphodiester nucleoside interbonding bond. [Aspect 25] A group of modified oligonucleotides according to any one of aspects 1 to 18, or a group of oligomer compounds according to any one of aspects 19 to 24, wherein the phosphorothioate nucleoside bonds of the modified oligonucleotides are stereorandom. [Aspect 26] A pharmaceutical composition comprising a modified oligonucleotide according to any one of aspects 1 to 18, an oligomer compound according to any one of aspects 19 to 24, or a group of modified oligonucleotides or a group of oligomer compounds according to aspect 25, and a pharmaceutically acceptable diluent. [Aspect 27] The pharmaceutical composition according to aspect 26, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate-buffered saline. [Aspect 28] The pharmaceutical composition according to aspect 27, wherein the pharmaceutical composition essentially consists of the modified oligonucleotide, the oligomer compound, or the population, and artificial cerebrospinal fluid or phosphate-buffered saline. [Aspect 29] A method comprising administering to a subject a modified oligonucleotide according to any of aspects 1 to 18, an oligomer compound according to any of aspects 19 to 24, a group of modified oligonucleotides or a group of oligomer compounds according to aspect 25, or a pharmaceutical composition according to any of aspects 26 to 28. [Aspect 30] A method for treating a disease related to type I interferon signaling, comprising administering to a subject having a disease related to type I interferon signaling a therapeutically effective amount of a modified oligonucleotide according to any of aspects 1 to 18, an oligomer compound according to any of aspects 19 to 24, a group of modified oligonucleotides or a group of oligomer compounds according to aspect 25, or a pharmaceutical composition according to any of aspects 26 to 28, thereby treating the disease related to type I interferon signaling. [Aspect 31] The method according to aspect 30, wherein the disease related to type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or ataxia telangiectasia. [Aspect 32] The method according to aspect 30 or 31, wherein the disease is related to an increase in the level of interferon alpha. [Aspect 33] The method according to any one of aspects 30 to 32, wherein administration of the modified oligonucleotide, the oligomer compound, a group of the modified oligonucleotides or a group of the oligomer compounds, or the pharmaceutical composition reduces seizures, dystonia, convulsions, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, or cerebellar myelopathy in the subject, improves feeding, motor development, language development, or social skills development in the subject, or reduces interferon alpha or lymphocyte increase in the cerebrospinal fluid of the subject. [Aspect 34] A method for reducing the expression of IFNAR1 in cells, comprising contacting the cells with a modified oligonucleotide according to any one of aspects 1 to 18, an oligomeric compound according to any one of aspects 19 to 24, a group of modified oligonucleotides or a group of oligomeric compounds according to aspect 25, or a pharmaceutical composition according to any one of aspects 26 to 28. [Aspect 35] The method according to aspect 34, wherein the cells are neurons or glial cells, and optionally, the cells are astrocytes or microglia cells. [Aspect 36] The method according to any one of aspects 29 to 33, wherein the subject is a human. [Aspect 37] The method according to aspect 34 or 35, wherein the cells are human cells. [Aspect 38] Use of a modified oligonucleotide according to any one of aspects 1 to 18, an oligomeric compound according to any one of aspects 19 to 24, a group of modified oligonucleotides or a group of oligomeric compounds according to aspect 25, or a pharmaceutical composition according to any one of aspects 26 to 28, for the treatment of a disease related to type I interferon signaling. [Aspect 39] Use of a modified oligonucleotide according to any one of aspects 1 to 18, an oligomeric compound according to any one of aspects 19 to 24, a group of modified oligonucleotides or a group of oligomeric compounds according to aspect 25, or a pharmaceutical composition according to any one of aspects 26 to 28, in the manufacture of a pharmaceutical product for treating a disease related to type I interferon signaling. [Aspect 40] The use according to aspect 38 or 39, wherein the disease is related to an increase in the level of interferon alpha. [Aspect 41] The use according to any one of aspects 38 to 40, wherein the disease related to type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive impairment, cranial radiation-induced cognitive impairment, viral infection-induced cognitive impairment, neuromyelitis optica, or ataxia telangiectasia.
Claims
1. Modified oligonucleotides following the following chemical structure 【Chemistry 1】 (Sequence ID 10), or a salt thereof.
2. The modified oligonucleotide according to claim 1, which is a sodium salt or a potassium salt.
3. Modified oligonucleotides following the following chemical structure 【Chemistry 2】 (Sequence No. 10).
4. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation, wherein T es m C eo G eo m C eo m C es T ds A ds A ds T ds T ds T ds T ds T ds m C ds T ds m C eo T eo m C es A es m C e (SEQ ID NO: 10), wherein A is an adenine nucleic acid base, m C is the 5-methylcytosine nucleic acid base, G is a guanine nucleic acid base, T is the thymine nucleic acid base, e is the 2'-MOE sugar moiety, d is the 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate nucleoside bond, The above oligomeric compound wherein o is a phosphodiester nucleoside interbonding bond.
5. A group of modified oligonucleotides according to claim 1, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotides are stereorandom.
6. A pharmaceutical composition comprising the modified oligonucleotide described in claim 1 and a pharmaceutically acceptable diluent.
7. The pharmaceutical composition according to claim 6, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
8. The pharmaceutical composition according to claim 7, wherein the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
9. A group of modified oligonucleotides according to claim 3, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotides are stereorandom.
10. A pharmaceutical composition comprising the modified oligonucleotide described in claim 3 and a pharmaceutically acceptable diluent.
11. The pharmaceutical composition according to claim 10, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
12. The pharmaceutical composition according to claim 11, wherein the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
13. A group of oligomeric compounds according to claim 4, wherein all of the phosphorothioate nucleoside bonds of the modified oligonucleotide are stereorandom.
14. A pharmaceutical composition comprising the oligomer compound described in claim 4 and a pharmaceutically acceptable diluent.
15. The pharmaceutical composition according to claim 14, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
16. The pharmaceutical composition according to claim 15, wherein the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
17. A pharmaceutical composition comprising a group of modified oligonucleotides as described in claim 5, and a pharmaceutically acceptable diluent.
18. The pharmaceutical composition according to claim 17, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
19. A pharmaceutical composition comprising a group of modified oligonucleotides as described in claim 9, and a pharmaceutically acceptable diluent.
20. The pharmaceutical composition according to claim 19, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
21. A pharmaceutical composition comprising a group of oligomeric compounds according to claim 13, and a pharmaceutically acceptable diluent.
22. The pharmaceutical composition according to claim 21, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate-buffered saline, or sterile water.
23. A pharmaceutical composition for treating a disease related to type I interferon signaling, wherein the composition is the pharmaceutical composition according to any one of claims 6 to 8, 10 to 12, and 14 to 22, and the treatment comprises administering a therapeutically effective amount of the pharmaceutical composition to a subject having a disease related to type I interferon signaling.
24. The pharmaceutical composition according to claim 23, wherein the disease associated with type I interferon signaling is Aicardi-Goutieres syndrome, stroke, neuropsychiatric systemic lupus erythematosus, neuroinflammation after traumatic brain injury, neuroautoimmune disorder, Alzheimer's disease, postoperative delirium and cognitive decline, cranial radiation-induced cognitive decline, viral infection-induced cognitive decline, neuromyelitis optica, or telangiectatic ataxia.
25. The pharmaceutical composition according to claim 24, wherein the disease is related to an increase in the level of interferon alpha.
26. The pharmaceutical composition according to claim 24, wherein administration of the pharmaceutical composition reduces seizures, dystonia, convulsions, white matter abnormalities, T cell infiltration, B cell infiltration, striatal necrosis, cerebral atrophy, basal ganglion calcification, or cerebellar myelopathy in a subject, improves feeding, motor development, language development, or social skills development in a subject, or reduces interferon alpha or lymphocyte increase in the cerebrospinal fluid of a subject.
27. The pharmaceutical composition according to claim 23, wherein the subject is a human.
Citation Information
Patent Citations
Compounds and Methods for Reducing Tau Expression
US20200199589A1
A genotyping tool for improving the prognostic and clinical management of ms patients
WO2010103292A2
Nucleic acid molecules for reduction of PAPD5 or PAPD7 mRNA for treating hepatitis b infection
WO2017216390A1
Modified compounds and uses thereof
WO2019157531A1