Antibody against PD-1 and method of use thereof

Abstract

To provide PD-1 antibody compositions usable for treating cancer and chronic viral infections, and methods of using the same.SOLUTION: The present invention provides an isolated multispecific antibody or an antigen-binding fragment thereof that binds to PD-1 protein and interleukin-12 (IL-12) receptor, comprising CDR1, CDR2, and CDR3 of VH and VL including specific amino acid sequences, and further comprising a constant region, a linker, and an IL-12 amino acid sequence having specific amino acid sequences.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] This application is an international application claiming priority to U.S. Provisional Patent Application No. 62 / 861,638 filed on 14 June 2019 and U.S. Provisional Patent Application No. 62 / 884,473 filed on 8 August 2019, each of which is incorporated herein by reference in its entirety.

[0002] All patents, patent applications, and publications cited herein are incorporated herein by reference in their entirety. To more fully describe the latest art known to those skilled in the art to the date of the invention described herein and claimed, the disclosures of these publications are incorporated herein by reference.

[0003] This patent disclosure includes materials that are protected by copyright. The copyright holder reserves all copyrights to the patent document or patent disclosure, except as they appear in the patent files or records of the United States Patent and Trademark Office, and does not object to facsimile reproduction of either the patent document or the patent disclosure.

[0004] Field of Invention The present invention relates to an antibody against PD-1 and a method for using the same. [Background technology]

[0005] Background of the Invention Programmed cell death-1 (PD-1) is a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B cells and is thought to play a role in their differentiation. A member of the CD28 family, PD-1 is upregulated in activated T cells, B cells, and monocytes. PD-1 has two identified ligands from the B7 family: PD-L1 (also known as programmed cell death-1 ligand 1, differentiation cluster 274 (CD274), or B7 homolog 1 (B7-H1)) and PD-L2. PD-L1 is a 40 kDa type I transmembrane protein. Binding of PD-L1 to PD-1 or B7.1 transmits an inhibitory signal that reduces the proliferation of CD8+ T cells in lymph nodes. In addition, PD-1 can also regulate the accumulation of exogenous antigen-specific T cells via apoptosis in lymph nodes, which is further mediated by the low regulation of the Bcl-2 gene. PD-L2 expression tends to be more restricted and is mainly found in activated antigen-presenting cells (APCs), while PD-L1 expression is widespread, including in hematopoietic cells (including activated T cells, B cells, monocytes, dendritic cells, and macrophages) and peripheral non-lymphoid tissues (including cardiac, skeletal, muscular, placental, lung, renal, and liver tissues). The widespread expression of PD-L1 indicates its important role in regulating peripheral immune tolerance via PD-1 / PD-L1. [Overview of the Initiative]

[0006] This invention provides a PD-1 antibody composition and a method for using the same.

[0007] One aspect of the present invention relates to an isolated multispecific antibody or its antigen-binding fragment that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor. In one embodiment, the isolated multispecific PD-1 antibody or its antigen-binding fragment comprises a heavy chain, a light chain, or a combination thereof. In some embodiments, the heavy chain includes CDR1, ISWNSGSI (SEQ ID NO: 19), IYPDDSDT (SEQ ID NO: 33), VYYNGNT (SEQ ID NO: 45), TNPYNGNT (SEQ ID NO: 57), or GDSVSSDNYF (SEQ ID NO: 43), GYTFNRFG (SEQ ID NO: 55), or This includes CDR2 containing ISYDGSNK (SEQ ID NO: 69), CDR3 containing ASDYGDKYYYYGMDV (SEQ ID NO: 21), AFWGASGAPVNGFDI (SEQ ID NO: 35), ATETPPTSYFNSGPFDS (SEQ ID NO: 47), ARVVAVNGMDV (SEQ ID NO: 59), ASQTVAGSDY (SEQ ID NO: 71), or ASDYGDKYSYYGMDV (SEQ ID NO: 79), or a combination thereof. In other embodiments, the light chain includes CDR1 containing SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73), (X9)-DN (SEQ ID NO: 8 10The CDR2 includes )-NN (SEQ ID NO: 84) or DDS (SEQ ID NO: 75), the CDR3 includes AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77), or a combination thereof. In other embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment further includes a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In some embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment includes a heavy chain and a light chain containing the CDRs described herein. In further embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment is fully humanized or humanized. In further embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment is monospecific, bispecific, or multispecific. In further embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment is a single-chain antibody. In other embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment is at least 1.0 × 10⁻¹⁶ -6It has a binding affinity of M. In other embodiments, the isolated multispecific PD-1 antibody or its antigen-binding fragment further comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. In some embodiments, the X1, X4, X5, or X8 amino acid residues of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment are nonpolar amino acid residues. In some embodiments, the X1, X4, X5, or X8 amino acid residues of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment are tyrosine (Y), phenylalanine (F), or alanine (A). In some embodiments, the X2, X3, X4, X6, X7, or X8 amino acid residues of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment are polar amino acid residues. In some embodiments, the X2, X3, X4, X6, X7, or X8 amino acid residues of the CDR from an isolated multispecific PD-1 antibody or its antigen-binding fragment are aspartic acid (D), threonine (T), serine (S), or tryptophan (W). In other embodiments, the X1 amino acid residue of the CDR from an isolated multispecific PD-1 antibody or its antigen-binding fragment is tyrosine (Y) or phenylalanine (F). In other embodiments, the X2 amino acid residue of the CDR from an isolated multispecific PD-1 antibody or its antigen-binding fragment is aspartic acid (D), threonine (T), or serine (S). In other embodiments, the X3 amino acid residue of the CDR from an isolated multispecific PD-1 antibody or its antigen-binding fragment is aspartic acid (D), threonine (T), or serine (S). In other embodiments, the X4 amino acid residue of the CDR from an isolated multispecific PD-1 antibody or its antigen-binding fragment is alanine (A) or tryptophan (W). In other embodiments, the X5 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is phenylalanine (F) or tyrosine (Y). In other embodiments, the X6 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is aspartic acid (D) or serine (S).In other embodiments, the X7 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is aspartic acid (D) or serine (S). In other embodiments, the X8 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is phenylalanine (F) or tyrosine (Y). In other embodiments, the X9 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is a polar hydrophilic amino acid residue. In other embodiments, the X9 amino acid residue of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is glutamic acid (E), asparagine (N), or aspartic acid (D). In other embodiments, the X of the CDR from the isolated multispecific PD-1 antibody or its antigen-binding fragment is... 10 The amino acid residue is a polar hydrophilic amino acid residue. In other embodiments, the X of the CDR from an isolated multispecific PD-1 antibody or its antigen-binding fragment. 10 The amino acid residue is either serine (S) or arginine (R).

[0008] One aspect of the present invention relates to an antibody composition comprising at least one antibody, wherein the at least one antibody comprises two heavy chains and two light chains. In some embodiments, the heavy chain CDR is between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 1, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 3, or between residues 27 and 38, residues 56 and 65, and residues 105 and 121 according to the IMGT numbering of SEQ ID NO: 5, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 7, or between residues 27 and 38, residues 56 and 65, and residues 105 and 114 according to the IMGT numbering of SEQ ID NO: 9, or The CDRs are identical to those of the reference germline located between residues 27 and 38, 56 and 65, and 105 and 119 according to IMGT numbering 12 (e.g., the HL-14 mutant described herein), or between residues 27 and 38, 56 and 65, and 105 and 119 according to IMGT numbering SEQ ID NO: 13 (e.g., the HLkin-1 mutant described herein), or between residues 27 and 38, 56 and 65, and 105 and 119 according to IMGT numbering SEQ ID NO: 15 (e.g., the mut-3 mutant described herein), provided that at least one of the heavy chain CDRs differs from its reference CDR by a single amino acid substitution.In some embodiments, the light chain CDR is between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 2, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 4, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 6, or between residues 27 and 38, residues 56 and 65 according to the IMGT numbering of SEQ ID NO: 8 , and between residues 105 and 114, or between residues 27 and 38, 56 and 65, and 105 and 115 according to the IMGT numbering of SEQ ID NO: 10, or between residues 27 and 38, 56 and 65, and 105 and 116 according to the IMGT numbering of SEQ ID NO: 11 (e.g., the HL-7 variant described herein), wherein at least one of the light chain CDRs differs from its reference CDR by a single amino acid substitution. In some embodiments, the antibody composition binds to an epitope containing an amino acid residue in the PD-1 plane generated by the FCC' chain, but does not contact the C'D loop of PD-1 containing a non-adjacent amino acid in SEQ ID NO: XX. In some embodiments, the antibody composition further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0009] One aspect of the present invention relates to an isolated antibody or fragment thereof that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor. In one embodiment, the isolated antibody or fragment thereof that binds to PD-1 and the interleukin-12 (IL-12) receptor includes VH CDR1 containing the amino acid sequence of SEQ ID NO: 17, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 26, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28. In one embodiment, an isolated antibody or fragment that binds to PD-1 and the interleukin-12 (IL-12) receptor includes VH CDR1 containing the amino acid sequence of SEQ ID NO: 31, VH CDR2 containing the amino acid sequence of SEQ ID NO: 33, VH CDR3 containing the amino acid sequence of SEQ ID NO: 35, VL CDR1 containing the amino acid sequence of SEQ ID NO: 37, VL CDR2 containing the amino acid sequence of SEQ ID NO: 39, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 41. In one embodiment, an isolated antibody or fragment that binds to PD-1 and the interleukin-12 (IL-12) receptor includes VH CDR1 containing the amino acid sequence of SEQ ID NO: 43, VH CDR2 containing the amino acid sequence of SEQ ID NO: 45, VH CDR3 containing the amino acid sequence of SEQ ID NO: 47, VL CDR1 containing the amino acid sequence of SEQ ID NO: 49, VL CDR2 containing the amino acid sequence of SEQ ID NO: 51, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 53. In one embodiment, the isolated antibody or fragments that bind to PD-1 and interleukin-12 (IL-12) receptors include VH CDR1 containing the amino acid sequence of SEQ ID NO: 55, VH CDR2 containing the amino acid sequence of SEQ ID NO: 57, VH CDR3 containing the amino acid sequence of SEQ ID NO: 59, VL CDR1 containing the amino acid sequence of SEQ ID NO: 61, VL CDR2 containing the amino acid sequence of SEQ ID NO: 63, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 65.In one embodiment, an isolated antibody or fragment that binds to PD-1 and the interleukin-12 (IL-12) receptor includes VH CDR1 containing the amino acid sequence of SEQ ID NO: 67, VH CDR2 containing the amino acid sequence of SEQ ID NO: 69, VH CDR3 containing the amino acid sequence of SEQ ID NO: 71, VL CDR1 containing the amino acid sequence of SEQ ID NO: 73, VL CDR2 containing the amino acid sequence of SEQ ID NO: 75, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 77. In one embodiment, an isolated antibody or fragment that binds to PD-1 and the interleukin-12 (IL-12) receptor includes VH CDR1 containing the amino acid sequence of SEQ ID NO: 17, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 80, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28 (e.g., the HL-7 variant described herein). In one embodiment, isolated antibodies or fragments that bind to PD-1 and interleukin-12 (IL-12) receptors include VH CDR1 containing the amino acid sequence of SEQ ID NO: 17, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 79, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 26, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28 (e.g., the HL-14 variant described herein). In one embodiment, isolated antibodies or fragments that bind to PD-1 and interleukin-12 (IL-12) receptors include VH CDR1 containing the amino acid sequence of SEQ ID NO: 78, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 26, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28 (e.g., the HLkin-1 variant described herein).In one embodiment, isolated antibodies or fragments that bind to PD-1 and interleukin-12 (IL-12) receptors include VH CDR1 containing the amino acid sequence of SEQ ID NO: 78, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 80, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28 (e.g., the HLkin-1HL-7 mut2 variant described herein). In one embodiment, an isolated antibody or fragment that binds to PD-1 and the interleukin-12 (IL-12) receptor comprises VH CDR1 containing the amino acid sequence of SEQ ID NO: 78, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 79, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 80, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28 (e.g., the HLkin-1 HL-7 HL-14 mut3 variant described herein). In one embodiment, an isolated antibody or fragment that binds to PD-1 and the interleukin-12 (IL-12) receptor described herein further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0010] One aspect of the present invention relates to an isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to the human programmed cell death 1 (PD-1) protein. In one embodiment, the isolated multispecific antibody or its antigen-binding fragment that binds to the human PD-1 protein includes a heavy chain variable region containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11. In one embodiment, the isolated multispecific antibody or its antigen-binding fragment includes an antibody that binds to the human PD-1 protein and also binds to the interleukin-12 (IL-12) receptor, and includes a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129.

[0011] In other embodiments, an isolated multispecific antibody or antigen-binding fragment that binds to the human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 1, the light chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In other embodiments, an isolated multispecific antibody or antigen-binding fragment that binds to the human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 5, the light chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 6, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.In other embodiments, an isolated multispecific antibody or antigen-binding fragment that binds to the human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 9, the light chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 10, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129. In other embodiments, an isolated multispecific antibody or antigen-binding fragment that binds to the human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 12, the light chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 2, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.In other embodiments, an isolated multispecific antibody or antigen-binding fragment that binds to the human PD-1 protein comprises a heavy chain, a light chain, or a combination thereof, wherein the heavy chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 13, the light chain comprises an amino acid sequence approximately 95% identical to SEQ ID NO: 11, and the antibody binds to an IL-12 receptor comprising a constant region, a linker, and an interleukin-12 (IL-12) amino acid sequence having at least 90% identity to SEQ ID NO: 129.

[0012] One aspect of the present invention relates to an isolated bispecific antibody comprising a first antibody fragment that binds to the human PD-1 protein and a second antigen-binding fragment having specificity for molecules on immune cells. In one embodiment, the isolated bispecific antibody comprises a fragment of a human antibody against the PD-1 protein described herein. In some embodiments, the molecules on immune cells include B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to the human PD-1 protein comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In other embodiments, the second antigen-binding fragment having specificity for molecules on immune cells comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the bispecific antibody contains an Fc fragment.

[0013] One aspect of the present invention relates to an isolated multispecific antibody comprising a first antibody fragment that binds to the human PD-1 protein and second and third antigen-binding fragments having specificity for molecules on immune cells. In one embodiment, the isolated multispecific antibody comprises a fragment of a human antibody against the PD-1 protein described herein. In some embodiments, the molecules on immune cells include B7H3, B7H4, CD27, CD28, CD40, CD40L, CD47, CD122, CTLA-4, GITR, GITRL, ICOS, ICOSL, LAG-3, LIGHT, OX-40, OX40L, PD-1, TIM3, 4-1BB, TIGIT, VISTA, HEVM, BTLA, or KIR. In some embodiments, the antibody fragment that binds to the human PD-1 protein comprises a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In other embodiments, the second and third antigen-binding fragments having specificity for molecules on immune cells include Fab fragments, single-chain variable fragments (scFv), or single-domain antibodies. In some embodiments, the multispecific antibody includes an Fc fragment. In some embodiments, the multispecific antibody further includes a fourth and / or fifth antigen-binding fragment having specificity for molecules on immune cells.

[0014] One aspect of the present invention relates to a nucleic acid encoding an isolated multispecific antibody or an antigen-binding fragment thereof that binds to the human programmed cell death 1 (PD-1) protein described herein. One aspect of the present invention relates to a nucleic acid encoding an isolated antibody or a fragment thereof that binds to the human PD-1 protein described herein. One aspect of the present invention relates to a nucleic acid encoding a bispecific antibody described herein. One aspect of the present invention relates to a nucleic acid encoding a multispecific antibody described herein. In some embodiments, the present invention relates to a vector comprising the nucleic acid described herein. In some embodiments, the present invention relates to a cell comprising the vector described herein.

[0015] One aspect of the present invention relates to a pharmaceutical composition comprising an antibody or fragment that binds to the human PD-1 protein described herein, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent may be a toxin, a radiolabeled substance, siRNA, a small molecule, or a cytokine.

[0016] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to the human PD-1 protein, a second antigen-binding fragment having specificity for a molecule on an immune cell as described herein, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent may be a toxin, a radiolabeled substance, an siRNA, a small molecule, or a cytokine.

[0017] One aspect of the present invention relates to a pharmaceutical composition comprising a bispecific antibody or fragment that binds to the human PD-1 protein, in addition to a second, third, fourth, or fifth antigen-binding fragment having specificity to a molecule on an immune cell as described herein, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition further comprises at least one additional therapeutic agent. For example, the therapeutic agent may be a toxin, a radiolabeled substance, siRNA, a small molecule, or a cytokine.

[0018] One aspect of the present invention relates to isolated cells comprising one or more polynucleotides encoding a PD-1 antibody or fragment as described herein. One aspect of the present invention relates to isolated cells comprising one or more polynucleotides encoding a bispecific antibody or fragment as described herein. One aspect of the present invention relates to isolated cells comprising one or more polynucleotides encoding a multispecific antibody or fragment as described herein.

[0019] One aspect of the present invention relates to a kit comprising a syringe, needle, or applicator and instructions for use for administering a pharmaceutical composition to a subject.

[0020] One aspect of the present invention relates to an engineered cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific to an antigen on the surface of a cancer cell, and the antigen comprises PD-1. Another aspect of the present invention also relates to an engineered cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific to a first antigen and a second antigen on the surface of a cancer cell, wherein the first antigen comprises CXCR4 and the second antigen comprises CLDN4, or the first antigen comprises CAIX and the second antigen comprises CD70, or the first antigen comprises MUC1 and the second antigen comprises Msln. In one embodiment, the extracellular ligand-binding domain comprises an antibody or a fragment thereof. In one embodiment, the antibody comprises VH and / or VL, or any combination thereof, as shown in Tables 1-11, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In one embodiment, the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. In one embodiment, the manipulated cells are T cells, NK cells, or NKT cells. In one embodiment, the T cells are CD4+, CD8+, CD3+ panT cells, or any combination thereof.

[0021] One aspect of the present invention relates to a method for treating a target cancer. In one embodiment, the method comprises administering a therapeutically effective amount of a composition comprising an antibody described herein to a subject in need of cancer treatment. In one embodiment, the method comprises administering a therapeutically effective amount of a pharmaceutical composition described herein to a subject in need of cancer treatment. In one embodiment, the method comprises administering a therapeutically effective amount of a CAR composition described herein to a subject in need of cancer treatment. In some embodiments, the cancer expresses PD-1. In other embodiments, the cancer includes non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, B-cell chronic lymphocytic leukemia (CLL), or renal cell carcinoma. In further embodiments, the method further comprises administering a chemotherapeutic agent to the subject.

[0022] [Invention 1001] An isolated multispecific antibody or its antigen-binding fragment that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor, CDR1 containing G-(X1)-TF-(X2X3)-Y-(X4) (SEQ ID NO: 81), G-(X5)-TF-(X6X7X8)-A (SEQ ID NO: 82), GDSVSSDNYF (SEQ ID NO: 43), or GYTFNRFG (SEQ ID NO: 55), CDR2 containing ISWNSGSI (sequence number 19), IYPDDSDT (sequence number 33), VYYNGNT (sequence number 45), TNPYNGNT (sequence number 57), or ISYDGSNK (sequence number 69), CDR3 containing ASDYGDKYYYYGMDV (SEQ ID NO: 21), AFWGASGAPVNGFDI (SEQ ID NO: 35), ATETPPTSYFNSGPFDS (SEQ ID NO: 47), ARVVAVNGMDV (SEQ ID NO: 59), ASQTVAGSDY (SEQ ID NO: 71), or ASDYGDKYSYYGMDV (SEQ ID NO: 79), or a combination of those CDRs heavy chain, CDR1 containing SSNIGSNT (SEQ ID NO: 24), SSNIGAGYV (SEQ ID NO: 37), SNNVGAHG (SEQ ID NO: 49), SGSIAAYY (SEQ ID NO: 61), or NIGSKS (SEQ ID NO: 73), (X9)-DN (Sequence ID 83), (X 10 )-NN (sequence number 84), or DDS (sequence number 75), CDR2, CDR3 containing AAWDGGLNGRGV (SEQ ID NO: 28), AAWDDSLNAPV (SEQ ID NO: 41), SSWDSSLSGYV (SEQ ID NO: 53), QSYDSSNLWV (SEQ ID NO: 65), or QVWHSVSDQGV (SEQ ID NO: 77), or a combination of those CDRs Light chains, or those combinations An isolated multispecific antibody or its antigen-binding fragment, comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129. [Invention 1002] The antibody according to the present invention 1001, which exhibits bispecificity. [Invention 1003] The antibody according to the present invention 1001, which is a single-chain antibody. [Invention 1004] At least 1.0 × 10 -6 The antibody of the present invention 1001 having binding affinity for M. [Invention 1005] The antibody or fragment of the present invention 1001, wherein the constant region comprises a heavy chain constant region, a light chain constant region, an Fc region, or a combination thereof. [Invention 1006] The antibody of the present invention 1001, wherein X1, X4, X5, or X8 is a nonpolar amino acid residue. [Invention 1007] The antibody of Invention 1006, wherein X1, X4, X5, or X8 is tyrosine (Y), phenylalanine (F), or alanine (A). [Invention 1008] The antibody of the present invention 1001, wherein X2, X3, X4, X6, X7, or X8 is a polar amino acid residue. [Invention 1009] The antibody of Invention 1008, wherein X2, X3, X4, X6, X7, or X8 is aspartic acid (D), threonine (T), serine (S), or tryptophan (W). [Invention 1010] The antibody of the present invention 1001, wherein X1 is phenylalanine (F) or tyrosine (Y). [Invention 1011] The antibody of the present invention 1001, wherein X2 is aspartic acid (D), threonine (T), and serine (S). [Invention 1012] The antibody of Invention 1001, wherein X3 is aspartic acid (D), threonine (T), and serine (S). [Invention 1013] The antibody of the present invention 1001, wherein X4 is alanine (A) or tryptophan (W). [Invention 1014] The antibody of the present invention 1001, wherein X5 is phenylalanine (F) or tyrosine (Y). [Invention 1015] The antibody of the present invention 1001, wherein X6 is aspartic acid (D) or serine (S). [Invention 1016] The antibody of Invention 1001, wherein X7 is aspartic acid (D) or serine (S). [Invention 1017] The antibody of the present invention 1001, wherein X8 is phenylalanine (F) or tyrosine (Y). [Invention 1018] The antibody of the present invention 1001, wherein X9 is a polar hydrophilic amino acid residue. [Invention 1019] The antibody of Invention 1018, wherein X9 is glutamic acid (E), asparagine (N), or aspartic acid (D). [Invention 1020] X 10 However, the antibody of the present invention 1001 is a polar hydrophilic amino acid residue. [Invention 1021] X 10 The antibody of the present invention 1020, wherein serine (S) or arginine (R). [Invention 1022] An antibody composition comprising at least one antibody, wherein the at least one antibody comprises two heavy chains and two light chains, The CDR of the heavy chain is between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 1, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 3, or between residues 27 and 38, residues 56 and 65, and residues 105 and 121 according to the IMGT numbering of SEQ ID NO: 5, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 7, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 9 It is identical to the reference germline CDR located between residues 65 and between residues 105 and 114, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 12, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 13, or between residues 27 and 38, residues 56 and 65, and residues 105 and 119 according to the IMGT numbering of SEQ ID NO: 15, provided that at least one of the heavy chain CDRs differs from its reference CDR by a single amino acid substitution, and The CDR of the light chain is between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 2, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 4, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 6, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 8 The CDRs are identical to those of the reference germline located between residues 6 and 65, and residues 105 and 114, or between residues 27 and 38, residues 56 and 65, and residues 105 and 115 according to the IMGT numbering of SEQ ID NO: 10, or between residues 27 and 38, residues 56 and 65, and residues 105 and 116 according to the IMGT numbering of SEQ ID NO: 11, provided that at least one of the CDRs of the light chain differs from its reference CDR by a single amino acid substitution. The antibody composition binds to an epitope containing an amino residue within the PD-1 plane generated by the FCC' chain, but does not come into contact with the C'D loop of PD-1 containing the non-adjacent amino acid in SEQ ID NO: XX, and The antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129. Antibody composition. [Invention 1023] An isolated, multispecific antibody or fragment thereof that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor, (a) VH CDR1 containing the amino acid sequence of SEQ ID NO: 17, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 26, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28, or (b) VH CDR1 containing the amino acid sequence of SEQ ID NO: 31, VH CDR2 containing the amino acid sequence of SEQ ID NO: 33, VH CDR3 containing the amino acid sequence of SEQ ID NO: 35, VL CDR1 containing the amino acid sequence of SEQ ID NO: 37, VL CDR2 containing the amino acid sequence of SEQ ID NO: 39, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 41, or (c) VH CDR1 containing the amino acid sequence of SEQ ID NO: 43, VH CDR2 containing the amino acid sequence of SEQ ID NO: 45, VH CDR3 containing the amino acid sequence of SEQ ID NO: 47, VL CDR1 containing the amino acid sequence of SEQ ID NO: 49, VL CDR2 containing the amino acid sequence of SEQ ID NO: 51, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 53, or (d) VH CDR1 containing the amino acid sequence of SEQ ID NO: 55, VH CDR2 containing the amino acid sequence of SEQ ID NO: 57, VH CDR3 containing the amino acid sequence of SEQ ID NO: 59, VL CDR1 containing the amino acid sequence of SEQ ID NO: 61, VL CDR2 containing the amino acid sequence of SEQ ID NO: 63, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 65, or (e) VH CDR1 containing the amino acid sequence of SEQ ID NO: 67, VH CDR2 containing the amino acid sequence of SEQ ID NO: 69, VH CDR3 containing the amino acid sequence of SEQ ID NO: 71, VL CDR1 containing the amino acid sequence of SEQ ID NO: 73, VL CDR2 containing the amino acid sequence of SEQ ID NO: 75, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 77, or (f) VH CDR1 containing the amino acid sequence of SEQ ID NO: 17, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 80, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28, or (g) VH CDR1 containing the amino acid sequence of SEQ ID NO: 17, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 79, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 26, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28, or (h) VH CDR1 containing the amino acid sequence of SEQ ID NO: 78, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 26, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28, or (i) VH CDR1 containing the amino acid sequence of SEQ ID NO: 78, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 21, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 80, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28, or (j) VH CDR1 containing the amino acid sequence of SEQ ID NO: 78, VH CDR2 containing the amino acid sequence of SEQ ID NO: 19, VH CDR3 containing the amino acid sequence of SEQ ID NO: 79, VL CDR1 containing the amino acid sequence of SEQ ID NO: 24, VL CDR2 containing the amino acid sequence of SEQ ID NO: 80, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 28 An isolated multispecific antibody or fragment thereof, comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129. [Invention 1024] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to a human PD-1 protein and comprises a heavy chain variable region containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 12, 13, and 15, and a light chain variable region containing an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129. [Invention 1025] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 1, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 2, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1026] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 3, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 4, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1027] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 5, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 6, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1028] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 7, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 8, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1029] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 9, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 10, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1030] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 1, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1031] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 12, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 2, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1032] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 13, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 2, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1033] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 13, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1034] An isolated multispecific antibody or its antigen-binding fragment, wherein the antibody binds to PD-1 and comprises a heavy chain, a light chain, or a combination thereof, the heavy chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 15, and the light chain comprising an amino acid sequence approximately 95% identical to SEQ ID NO: 11, and the antibody binds to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity to SEQ ID NO: 129. [Invention 1035] A nucleic acid encoding any of the antibodies described in invention 1001 to 1034. [Invention 1036] A pharmaceutical composition comprising an antibody or fragment thereof according to any of the present invention 1001 to 1034, and a pharmaceutically acceptable carrier or excipient. [Invention 1037] A pharmaceutical composition of the present invention 1036, further comprising at least one additional therapeutic agent. [Invention 1038] The pharmaceutical composition of the present invention 1037, wherein the therapeutic agent is a toxin, a radiolabeled substance, siRNA, a small molecule, or a cytokine. [Invention 1039] Isolated cells containing one or more polynucleotides encoding any antibody or fragment thereof according to invention 1001 to 1034. [Invention 1040] A vector comprising the nucleic acid of the present invention 1035. [Invention 1041] A cell containing the vector of the present invention 1040. [Invention 1042] A kit comprising at least one antibody composition of the present invention 1036, a syringe, needle or applicator for administering the at least one antibody to a subject, and instructions for use. [Invention 1043] Engineered cells comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific to an antigen on the surface of a cancer cell, and the antigen comprises PD-1. [Invention 1044] Engineered cells comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises extracellular ligand-binding domains specific to a first antigen and a second antigen on the surface of a cancer cell, wherein the first antigen comprises CXCR4 and the second antigen comprises CLDN4, or the first antigen comprises CAIX and the second antigen comprises CD70, or the first antigen comprises MUC1 and the second antigen comprises Msln. [Invention 1045] The manipulated cells of the present invention 1043 or 1044, wherein the extracellular ligand-binding domain contains an antibody or a fragment thereof. [Invention 1046] The manipulated cell of the present invention 1045, wherein the antibody comprises VH and / or VL, or any combination thereof, as shown in Tables 1-11, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129. [Invention 1047] The manipulated cell of the present invention 1045, wherein the antibody comprises CDR1, CDR2, and / or CDR3 of Table 12, or any combination thereof, and the antibody further comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO: 129. [Invention 1048] The manipulated cells of the present invention 1043 or 1044, wherein the manipulated cells include T cells, NK cells, or NKT cells. [Invention 1049] The manipulated cells of the present invention 1048, wherein the T cells are CD4+, CD8+, CD3+ panT cells, or any combination thereof. [Invention 1050] A method for treating cancer in a subject, comprising administering to a subject in need of such treatment a therapeutically effective amount of a composition comprising any antibody according to Invention 1001 to 1034, a pharmaceutical composition according to Invention 1036, or a CAR composition according to any CAR composition according to Invention 1043 to 1048. [Invention 1051] The method of the present invention 1050, wherein the aforementioned cancer expresses PD-1. [Invention 1052] The method of the present invention 1050, wherein the cancer includes non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, B-cell chronic lymphocytic leukemia (CLL), or renal cell carcinoma. [Invention 1053] The method of the present invention 1050, further comprising administering a chemotherapeutic agent to the subject. Other problems and advantages of the present invention will be readily apparent from the following description. [Brief explanation of the drawing]

[0023] A patent or application file must contain at least one color drawing. A copy of this patent or patent application publication containing the color drawing will be provided by the Patent Office after the application and payment of the required fees.

[0024] [Figure 1] An outline of the PMPL panning strategy for antibody discovery (for example, the PD-1 antibody of the present invention) is shown. [Figure 2-1] Figure 2 shows a schematic representation of the VH and VL sequences of the anti-PD-1 antibody P4-B3. [Figure 2-2] See the explanation in Figure 2-1. [Figure 3-1] Figure 3 illustrates the three-dimensional protein structure of human PD-1, highlighting the differences between human and cynomolgus monkey PD-1 in red. The corresponding amino acid sequences are shown below. A high degree of similarity is observed between human and cynomolgus monkey PD-1. The three-dimensional protein structure of PD-1 bound to nivolumab is also shown. [Figure 3-2] See the explanation in Figure 3-1. [Figure 4] This graph shows the binding curves of the P4-B3 minibody to human and cynomolgus monkey PD-1. [Figure 5] This shows graphs of octet-joint curves in various formats from page 4-B3. [Figure 6]The binding curve for a PD-L1 competitive assay using a PD-1 antibody is shown. [Figure 7] The binding curve for IgG ELISA is shown. [Figure 8-1] Figure 8 shows the FACS analysis plot of PD1 FACS performed using anti-PD1 IgG. [Figure 8-2] See the explanation in Figure 8-1. [Figure 9] This is a schematic diagram of the PD1-PDL1 bioassay. [Figure 10A] Figure 10 shows graphs of induction curves from commercially available PD1-PDL1 bioassays. (A) IgG1 wt monomer version of P4-B3 with pembro (pembrolizumab) and nivo (nivolumab). As shown, the P4-B3 anti-PD1 antibody shows approximately half the signal of pembro and nivo. [Figure 10B] Figure 10 shows graphs of the induction curves obtained from a commercially available PD1-PDL1 bioassay. (B) Comparison of hexamers based on the composition of IgG1 LALA. The hexamer composition shows a shift of approximately 2 to 3 times in the dose-response curve. [Figure 10C] Figure 10 shows graphs of the induction curves from a commercially available PD1-PDL1 bioassay. (C) Direct comparison of IgG4 constructs (monomer and hexamer) and nivo. A similar trend to that observed in 10A and 10B is observed here. The commercially available antibody is twice as potent as P4-B3, and the hexamer shifts approximately 2-3 times compared to the monomer. [Figure 11] This is a schematic diagram of human PD-1 using a ribbon diagram (see Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126). PD-1 is an antiparallel B sandwich. The antiparallel B sandwich is depicted. The front sheet of the PD-1 ribbon diagram contains G, F, C, and C', and the back sheet of the PD-1 ribbon diagram contains A, B, E, and D. PD-1 lacks cysteine ​​in its stem region, which hinders homodimerization of PD-1. [Figure 12-1]Figure 12 is a schematic diagram of the protein structure showing the interaction between PD-1 and its ligand, PDL-1 or PDL-2. See Cheng et al, Structure and Interactions of the Human Programmed Cell Death 1 Receptor, JBC 2013; Tan et al. (2016) Protein Cell DOI:10.1007 / s13238-016-0337-7, and Yan et al. (2008) PNAS, DPO:10.1073 / pnas.0804453105. [Figure 12-2] See the explanation in Figure 12-1. [Figure 13-1] Figure 13 shows ribbon diagrams of PD-1 binding to commercially available antibodies. (A) Nivo blocks PD-L1 by binding to the FG loop. (B) Pembro blocks PD-L1 by binding to the C and C' chains. See Fessas et al, Seminars in Oncology, 2017. [Figure 13-2] See the explanation in Figure 13-1. [Figure 14] This is a comparison of protein model overlays and amino acid sequences of human and mouse PD-1. Similarity of PD-1 between humans and mice: approximately 64%. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 15] This is a comparison of protein model overlays and amino acid sequences of human and mouse PD-1. Amino acid residue P110 (purple) causes a twist in the FG loop. In mouse PD1, this residue directs the BC loop towards the DE loop due to a hydrophobic interaction between Arg83 and Trp39. Amino acid residue P63 (blue) in human PD-1 causes the loop to detach from the C' chain, forming a highly flexible loop. While not constrained by theory, these two structural differences may explain the lack of cross-reactivity between Pembro and Nivo mouse PD-1. See Cheng, X et al., (2013). JBC doi.org / 10.1074 / jbc.M112.448126. [Figure 16] This graph shows the binding of P4-B3 to mouse PD-1. P4-B3 has a high affinity for mouse PD-1, setting it apart from Pembro and Nivo. [Figure 17] This is a schematic diagram of a staining strategy that can be used to differentially label a displayed yeast library before FACS screening. See Cherf and Cochran, 2015, Methods Mol Biol. [Figure 18] The plot of the FACS analysis is shown. Standard staining sorting is shown, with blue gates representing positive hits and green gates representing negatives. The blue gates are shifted upward along the x=y axis. Although not constrained by theory, the PD-1 antibody clone binds to PD-1 with higher affinity. [Figure 19] The plot shows the results of FACS analysis with dynamic staining. The blue gate indicates the cells collected, and red circles represent examples of targets. The collection gate was kept wide to obtain a large sample size. [Figure 20] This is a graph of the binding curve for the P4-B3 mutant. [Figure 21] This is a graph of the binding curve for the P4-B3 mutant. [Figure 22-1] Figure 22 shows a schematic diagram of the P4-B3 (anti-PD1) germline alignment and a diagram of the altered amino acid residues in the generated P4-B3 mutant. [Figure 22-2] See the explanation in Figure 22-1. [Figure 22-3] See the explanation in Figure 22-1. [Figure 23] The graphs show the octet binding curves of various P4-B3 mutants. SA sensors were coated with 2.5 ug / ml biotinylated PD-1. [Figure 24] The binding curves for PD-L1 competitive assays using PD-1 antibodies (various P4-B3 variants) are shown. [Figure 25] This is a schematic diagram of the amino acid residues that were altered in the generated P4-B3 mutant. [Figure 26-1] Figure 26 is a schematic diagram of germline alignment of anti-PD1 antibody clones. These candidates were identified via soluble protein panning (PD1-hFc). [Figure 26-2] See the explanation in Figure 26-1. [Figure 26-3] See the explanation in Figure 26-1. [Figure 26-4] See the explanation in Figure 26-1. [Figure 27] The graph shows the octet binding curve. Both PD1 and PDL1 have His tags. As is evident from sensor H4, the sensor was not saturated before the addition of PDL1. Further sequencing confirmed that PD1#5 is not an antibody. A4: R&D anti-PD1 (AF1086), B4: PD1 mini3, C4: PD1 mini4, D4: PD1 mini5, E4: PD1 mini7, F4: PD1 mini13, G4: TIG1 (control ab) + PDL1, H4: Ab-less + PD1 to check whether the sensor was saturated or not. [Figure 28] The octet binding curve graph is shown. As is evident from sensor H4, both PD1 and PDL1 have His tags. The sensor was not saturated before the addition of PDL1. PD1 and PDL1 were used at 2.5 ug / ml. Antibodies were used at 2 ug / ml. All samples were diluted with 1×PBST. A new PD-1 antibody was used in scFv-Fc format, and Nivo and Pembro are commercially available formulations. A6:Nivo, B6:Pembro, C6:PD1#3, D6:PD1#4, E6:PD1#5, F6:PD1#7, G6:PD1#13, H6:TIG1(-). [Figure 29] The octet-binding curve graph is shown. The SA sensor was loaded with 2.5 ug of expi293, which expresses soluble PD1-avi and was biotinylated using Avidity's biotinylation kit. PD1#3 showed a high off rate. [Figure 30-1] Figure 30 is a schematic diagram of the germline sequence of the anti-PD1 antibody clone P4-B7. [Figure 30-2] See the explanation in Figure 30-1. [Figure 31] The graphs show the minibody binding curves of P4-B7 to human and cynomolgus monkey PD-1. The curves were constructed in expi293 cells 48 hours after transfection. Expression levels were normalized using a commercially available antibody in the human variant, but not in the cynomolgus monkey variant. Normalization was not performed in the cynomolgus monkey variant because the commercially available antibody used has not been reported to bind to cynomolgus monkey PD#1. [Figure 32] The graph shows the binding curve of an IgG ELISA using P4-B7. P4-B7 shifts significantly to the right, indicating that the reaction kinetics were unsuitable for the progression of the reaction. In the figure above, the ELISA plate was coated with 1 ug / ml soluble PD1 at 37°C for 2 hours. The plate was then washed and blocked with 2% BSA / PBS at 37°C for 1 hour. The blocking solution was removed, and 3-fold serial dilutions of antibody, starting at 6 ug / ml, were added to each well (100 ul) of 2% milk-PBST. The plate was then incubated at room temperature with gentle shaking, washed 6 times with PBS-T, and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. The plate was incubated again at room temperature for 1 hour with gentle shaking, and then washed 6 times with PBS-T. TMB substrate was added, and the plate was incubated at 30°C for 10 minutes to accelerate the HRP reaction. The signal was then quenched with TMB stop solution and read at 450 nm. The data acquisition protocol in the figure below was the same as the protocol in the graph above, except that the plates were coated with serial 3-fold dilutions of the antigen starting at 6 ug / ml. Next, the antibody was added to all wells at a constant concentration of 1 ug / ml. [Figure 33] The graph shows the induction curve obtained from a commercially available PD1-PDL1 bioassay. [Figure 34]A schematic diagram of the Promega PD1-PDL1 bioassay (J1250) is shown. The Promega PD1-PDL1 bioassay (J1250) was performed using wild-type aPD-1scFv-Fc (P4-B3) and single and combo mutants generated from a random mutagenic yeast library. Nivolumab was used as a benchmark control. [Figure 35] The P4-B3 mutant Promega bioassay (scFv-Fc format bioassay) is shown. Nivo (black circle) reached approximately 6-fold induction, which is consistent with previous experiments. Single mutants HLkin-1 and HL-7, and combo mutants Mut+2 and Mut+3 show higher or equal levels of PD-1 / PD-L1 blocking compared to Nivo. This is also reflected in the EC50 values, with Mut+2 having an EC50 value approximately half that of Nivo. P4-B3 wild-type shows lower levels of blocking and has an EC50 value 1.75 times higher than Nivo. Point mutations identified by our random mutagenic yeast display library are thought to have a significant impact on binding and checkpoint blocking ability. All P4-B3 samples used in this assay are in scFv-Fc format. Only Nivo and F10 were used as complete IgG. [Figure 36] The octet binding curves for P4-B3 WT / mutant IgG are shown. SA sensors were coated with biotinylated PD-1 and immersed in various concentrations of anti-PD1 antibody. The first step after baseline shows antibody binding, and the second step shows dissociation. As is clear from this figure, the off-rate for P4-B3 WT is fast, while the off-rate for mutants and Pembro is much slower. [Figure 37] The binding curves for P4-B3 single-pair combo mutants using mouse PD-1 (mPD-1) in scFv-Fc format are shown. [Figure 38] Unless otherwise specified, the binding curves shown are those of the P4-B3 single-pair combo mutant with hPD1 in scFv-Fc format. [Figure 39]Excluding pembro / nivo / WT IgG1, this shows MFI of P4-B3 single-pair combo mutants using hPD1 in scFv-Fc format. [Figure 40-1] Figure 40 is a schematic diagram of the design of aPD1-scIL12 fusions such as HC F2A scIL12. [Figure 40-2] See the explanation in Figure 40-1. [Figure 41-1] Figure 41 is a schematic diagram of the design of aPD1-scIL12 fusions such as HC G4S scIL12. [Figure 41-2] See the explanation in Figure 41-1. [Figure 42-1] Figure 42 is a schematic diagram of the design of aPD1-scIL12 fusions such as LC F2A scIL12. [Figure 42-2] See the explanation in Figure 42-1. [Figure 43-1] Figure 43 is a schematic diagram of the design of aPD1-scIL12 fusion bodies such as LC G4S scIL12. [Figure 43-2] See the explanation in Figure 43-1. [Figure 44-1] Figure 44 is a schematic diagram of the cloning strategy for the aPD1-scIL12 fusion using Stuffer. [Figure 44-2] See the explanation in Figure 44-1. [Figure 44-3] See the explanation in Figure 44-1. [Figure 44-4] See the explanation in Figure 44-1. [Figure 44-5] See the explanation in Figure 44-1. [Figure 44-6] See the explanation in Figure 44-1. [Figure 44-7] See the explanation in Figure 44-1. [Figure 44-8] See the explanation in Figure 44-1. [Figure 44-9] See the explanation in Figure 44-1. [Figure 44-10] See the explanation in Figure 44-1. [Figure 44-11]See the explanation in Figure 44-1. [Figure 44-12] See the explanation in Figure 44-1. [Figure 45A] Figure 45 shows (A) a photographic image of a protein gel showing protein expression, and (B) a photographic image of a protein gel showing protein sample expression and purification. In Figure 45B, the sample was electrophoresed in Tris-acetate SDS running buffer on a NuPAGE Tris acetate 3-8% gel at 120V for 1 hour. The reduced sample was mixed with 10% BME. [Figure 45B] See the explanation in Figure 45A. [Figure 46-1] Figure 46 is a graph of the dynamic binding data for the aPD1-scIL12 fusion protein. Octet assays were performed to measure the binding affinity of P4-B3 WT versus Mut+2 and Mut+3 to PD-1. [Figure 46-2] See the explanation in Figure 46-1. [Figure 47] This graph shows the dynamic binding data of the aPD1-scIL12 fusion protein. Octet assays were performed to measure the binding affinity of P4-B3 mut+3 HC and LC scIL12 constructs to PD-1. [Figure 48] This is a schematic diagram of the IL-12 signaling cascade. [Figure 49] This is a graph of the IL-12 reporter assay. [Figure 50] This is a schematic diagram showing the plate layout for a CAR T cell killing assay. [Figure 51] This graph shows a comparison between the aPD1-IL12-HC fusion and aPD1 in a cell killing assay. The percentage of target cells killed = (T0-x) / T0 [Figure 52] This graph shows a comparison of the aPD1-IL12-HC fusion, aPD1, and IL-12 in a cell killing assay. The percentage of target cells killed = (T0-x) / T0 [Figure 53-1]Figure 53 shows the results of cytokine ELISA as a bar graph. * indicates p<0.05, ** indicates p<0.005, *** indicates p<0.0005, and **** indicates p<0.0001. [Figure 53-2] See the explanation in Figure 53-1. [Figure 54-1] Figure 54 shows the results of cytokine ELISA as a bar graph. * indicates p<0.05, ** indicates p<0.005, *** indicates p<0.0005, and **** indicates p<0.0001. [Figure 54-2] See the explanation in Figure 54-1. [Figure 55-1] Figure 55 shows the results of cytokine ELISA as a bar graph. * indicates p<0.05, ** indicates p<0.005, *** indicates p<0.0005, and **** indicates p<0.0001. [Figure 55-2] See the explanation in Figure 55-1. [Figure 56-1] Figure 56 is a schematic diagram of the scIL-12 fusion antibody and its mechanism of action. [Figure 56-2] See the explanation in Figure 56-1. [Figure 57] This is a schematic diagram of the amino acid residues that were altered in the generated P4-B3 mutant. [Figure 58] This is a schematic diagram of the mixed lymphocyte reaction (MLR) assay. CD4+ T cells express high levels of PD-1 when activated. DCs express high levels of PD-L1 to improve self-tolerance in the body. T cell activation via MHC mismatch is limited due to PD-1 / PD-L1 inhibition. Addition of an anti-PD-1 antibody removes this inhibitory signal and increases T cell activation (measured by cytokine release). [Figure 59-1] Figure 59 shows a graph of the MLR assay, indicating cytokine production, as indicated by the graph title. [Figure 59-2] See the explanation in Figure 59-1. [Figure 60-1] Figure 60 shows a graph of the MLR assay, indicating cytokine production, as indicated by the graph title. [Figure 60-2]See the explanation in Figure 60-1. [Figure 61-1] Figure 61 shows a statistical data table of the MLR assay between Pembro and P4B3mut+3 IgG4. [Figure 61-2] See the explanation in Figure 61-1. [Figure 62-1] Figure 62 shows a statistical data table of the MLR assay between Pembro and P4B3mut+3 IgG4. [Figure 62-2] See the explanation in Figure 62-1. [Figure 63-1] Figure 63 shows a statistical data table of the MLR assay between Pembro and P4B3mut+3 IgG4. [Figure 63-2] See the explanation in Figure 63-1. [Figure 64-1] Figure 64 shows a statistical data table of the MLR assay between Pembro and P4B3mut+3 IgG4. [Figure 64-2] See the explanation in Figure 64-1. [Figure 65-1] Figure 65 shows a graph of the MLR assay, indicating cytokine production, as indicated by the graph title. [Figure 65-2] See the explanation in Figure 65-1. [Figure 66-1] Figure 66 shows a graph of the MLR assay, indicating cytokine production, as indicated by the graph title. [Figure 66-2] See the explanation in Figure 66-1. [Figure 67] This is a schematic diagram of a structure including a steady-state region, a linker, and IL-12 (further including the p40 and p35 subunits of IL-12 separated by the MMP9 cleavage site (GPLGVRG)). [Figure 68] This is a schematic diagram of a construct containing a steady-state region-linker-IL12 (further including the p40 and p35 subunits of IL-12 separated by a mutated MMP9 cleavage site). [Figure 69] This is a schematic diagram of armored CAR-T cells. [Figure 70] This is a schematic diagram of cytokines that stimulate CART therapy. [Figure 71-1] Figure 71 is a schematic diagram of the fusion of P4B3mut+3-scIL12 LC with the extensional (G4S)5 linker. [Figure 71-2] See the explanation in Figure 71-1. [Modes for carrying out the invention]

[0025] Detailed description of the invention Abbreviations and definitions A detailed description of one or more embodiments is provided herein. However, it will be understood that the present invention can be embodied in a variety of forms. Accordingly, the specific details disclosed herein should not be construed as limitations, but rather as representative grounds for the claims and for teaching those skilled in the art to use the invention in any suitable way.

[0026] The singular forms “a,” “an,” and “the” include multiple references unless the context explicitly indicates otherwise. The use of the words “a” or “an” in the claims and / or specification with the term “includes” can mean “one,” but also coincide with the meanings of “one or more,” “at least one,” and “one or more.”

[0027] Whenever any of the phrases "for example," "etc.," or "including" are used herein, it is understood that they are always accompanied by the phrase "without limitation" unless otherwise explicitly stated. Similarly, "for example," "exemplary," etc., are understood to be non-limiting.

[0028] The term "substantially" allows for deviations from descriptive terms that do not negatively impact the intended purpose. Descriptive terms are understood to be modified by the term "substantially," even if the term is not explicitly listed.

[0029] Terms such as “comprising,” “including,” “having,” and “involving” (as well as “comprises,” “includes,” “has,” and “involves”) are used interchangeably and have the same meaning. Specifically, each term is defined in accordance with the general U.S. Patent Law definition of “comprising,” and is therefore interpreted as an open term meaning “at least the following,” and also as not excluding any additional features, limitations, aspects, etc. Thus, for example, “a process comprising steps a, b, and c” means that the process comprises at least steps a, b, and c. Whenever the terms “a” or “an” are used, they are understood to mean “one or more,” unless such an interpretation is meaningless in the context.

[0030] As used herein, the term “approximately” means roughly, roughly, about, or within that range. When the term “approximately” is used with a numerical range, it modifies that range by extending the upper and lower boundaries of the stated numerical value. Generally, the term “approximately” is used herein to qualify numerical values ​​that are above and below a stated value by a 20 percent above or below (higher or lower) variance.

[0031] PD-1 Programmed T cell death 1 (PD-1) is a transmembrane protein present on the surface of T cells that, when bound to programmed T cell death ligand 1 (PD-L1) on tumor cells, results in the suppression of T cell activity and a reduction in T cell-mediated cytotoxicity. Therefore, PD-1 and PD-L1 are immune down regulators or "off switches" for immune checkpoints. Examples of PD-1 inhibitors include, but are not limited to, nivolumab (Opdivo) (BMS-936558), pembrolizumab (Keytruda), pizilizumab, AMP-224, MEDI0680 (AMP-514), PDR001, MPDL3280A, MEDI4736, BMS-936559, and MSB0010718C.

[0032] The immune system must maintain a balance between an effective response to eliminate pathogens and the maintenance of resistance to prevent autoimmune diseases. T cells are central to maintaining this balance, and their proper regulation is primarily regulated by molecules of the B7-CD28 family. The interaction between members of the B7 family, which function as ligands, and members of the CD28 family, which function as receptors, provides important positive signals that initiate, enhance, and maintain T cell responses, as well as important negative signals that limit, terminate, and / or attenuate T cell responses as needed. PD-1 is a member of the CD28 family.

[0033] The binding between PD-L1 and PD-1 significantly influences the regulation of T cell responses. Specifically, the PD-L1 / PD-1 interaction inhibits T cell proliferation, as well as the production of effector cytokines that mediate T cell activity and immune responses, such as IL-2 and IFN-γ. This negative regulatory function is crucial for preventing T cell-mediated autoimmunity and immunopathology. However, the PD-1 / PD-L1 axis has also been shown to be involved in T cell depletion, thereby inhibiting T cell responses and adversely impacting the host. Long-term or chronic antigen stimulation of T cells can induce a negative immunological feedback mechanism, thereby inhibiting antigen-specific responses and potentially leading to immune evasion of pathogens. T cell depletion may also progress to the physical deletion of antigen-specific T cells themselves. PD-1 expression in T cells is upregulated in response to chronic antigen stimulation, and its binding to PD-L1 blocks effector function in both CD4+ (T helper cells) and CD8+ (cytotoxic T lymphocytes or CTLs) T cells, demonstrating a PD-1 / PD-L1 interaction in the induction of T cell depletion.

[0034] Recent studies have shown that some chronic viral infections and cancers have developed immune evasion tactics that specifically utilize the PD-1 / PD-L1 axis by causing T cell depletion via PD-1 / PD-L1. Many human tumor cells and tumor-associated antigen-presenting cells express high levels of PD-L1, suggesting that tumors induce T cell depletion to evade anti-tumor immune responses. For example, during chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, with reduced ability to produce cytokines and effector molecules, as well as reduced proliferative capacity. Studies have shown that PD-1 is highly expressed in HIV-specific CD8+ T cells of HIV-infected individuals, suggesting therapeutic potential in the treatment of HIV infection and AIDS patients by blocking the PD-1 / PD-L1 pathway. In summary, drugs that block the PD-1 / PD-L1 pathway offer novel therapeutic approaches for various cancers, HIV infection, and / or other diseases and conditions associated with T cell depletion. Therefore, there is an urgent need for drugs that can block or prevent the interaction between PD-1 and PD-L1.

[0035] Overexpression of PD-L1 has been detected in various cancers. For example, in breast cancer, PD-L1 overexpression is associated with a high-risk prognostic factor. In renal cell carcinoma, PD-L1 is upregulated, and increased PD-1 expression is also observed in tumor-infiltrating leukocytes. Anti-PD-L1 and anti-PD-1 antibodies have shown some clinical efficacy in Phase I trials for renal cell carcinoma. Therapeutic agents that can bind to PD-1 or PD-L1 may be useful in specifically targeting tumor cells. Drugs that can block PD-1 / PD-L1 interactions may be even more useful in treating cancers that evade anti-tumor T cell activity by inducing T cell depletion. The use of such drugs alone or in combination with other anti-cancer agents may allow for effective targeting of tumor cells that overexpress PD-L1, thereby enhancing anti-tumor T cell activity and thereby boosting the immune response against the targeted tumor cells.

[0036] PD-1 and PD-L1 can also be upregulated by T cells after chronic antigen stimulation, for example, by chronic infections. During chronic HIV infection, HIV-specific CD8+ T cells are functionally impaired, with reduced ability to produce cytokines and effector molecules, as well as reduced proliferative capacity. PD-1 is highly expressed in HIV-specific CD8+ T cells of HIV-infected individuals. Therefore, blocking this pathway may enhance the ability of HIV-specific T cells to proliferate and produce cytokines in response to stimulation by HIV peptides, thereby enhancing the immune response to HIV. Other chronic infections, such as chronic viral infections, bacterial infections, and parasitic infections, may also benefit from the use of PD-1 / PD-L1 blockers.

[0037] Aspects of the present invention provide isolated, multispecific antibodies having specificity for PD-1. As used herein with respect to nucleic acids such as cells, DNA, or RNA, the term “isolated” refers to a molecule isolated from other DNA or RNA present in a natural source of macromolecules. The term “isolated” may also refer to a nucleic acid or peptide that is substantially free from cellular material, viral material, or culture medium when produced by recombinant DNA technology, or from chemical precursors or other chemicals when chemically synthesized. For example, “isolated nucleic acid” may include nucleic acid fragments that do not exist naturally as fragments and would not be found in their natural state. “Isolated” may also refer to cells or polypeptides isolated from other cellular proteins or tissues. Isolated polypeptides can include both purified polypeptides and recombinant polypeptides. The isolated antibodies were identified through the use of a 27 billion human single-chain antibody (scFv) phage display library by using PD-1 as a library selection target. These antibodies represent a novel class of monoclonal antibodies against PD-1 that can compete with the binding of PD-L1, pembrolizumab, and nivolumab. Furthermore, the monoclonal PD-1 antibodies discussed herein cross-react with the PD-1 protein of cynomolgus monkeys (Macaca fascicularis). The monoclonal PD-1 antibodies discussed herein can also be used in the construction of multispecific antibodies or as payloads for CAR-T cells.

[0038] Ten unique recombinant monoclonal PD-1 antibodies are described herein. These include P4-B3, P4-B7, PD1#2, PD1#3, PD1#13, P4-B3-HLkin1, P4-B3-HL-7, P4-B3-HL-14, P4-B3 HLkin-1, HL-7 mut2, and P4-B3 HLkin-1 HL-7 HL-14 mut3. “Recombinant” in relation to polypeptides (such as antibodies) or polynucleotides refers to a form of polypeptide or polynucleotide that does not exist in nature, and non-limiting examples of such recombinant

[0039] In addition to exemplary wild-type IgG constant regions useful for combination with the VH and VL sequences provided herein (see Table 2), nucleic acid and amino acid sequences of monoclonal PD-1 antibodies are provided below. TIFF0007911826000001.tif18154

[0040] (Table 1A) Nucleic acid sequences of the variable regions of Ab(antibody)P4-B3 TIFF0007911826000002.tif77152

[0041] (Table 1B) Amino acid sequence of the variable region of Ab P4-B3 TIFF0007911826000003.tif44152

[0042] (Table 2A) Nucleic acid sequences of the constant region of Ab P4-B3 - wild-type IgG monomer TIFF0007911826000004.tif153152

[0043] (Table 2B) Amino acid sequence of the constant region of Ab P4-B3 - wild-type IgG monomer TIFF0007911826000005.tif86152

[0044] (Table 3A) Nucleic acid sequences of the variable region of Ab P4-B7 TIFF0007911826000006.tif77152

[0045] (Table 3B) Amino acid sequence of the variable region of Ab P4-B7 TIFF0007911826000007.tif44152

[0046] (Table 4A) Nucleic acid sequence of the variable region of PD1#2 TIFF0007911826000008.tif77152

[0047] (Table 4B) Amino acid sequence of the variable region of Ab PD1#2 TIFF0007911826000009.tif44152

[0048] (Table 5A) Nucleic acid sequence of the variable region of PD1#3 TIFF0007911826000010.tif77152

[0049] (Table 5B) Amino acid sequence of the variable region of Ab PD1#3 TIFF0007911826000011.tif43152

[0050] (Table 6A) Nucleic acid sequence of the variable region of Ab PD1#13 TIFF0007911826000012.tif73152

[0051] (Table 6B) Amino acid sequence of the variable region of Ab PD1#13 TIFF0007911826000013.tif39152

[0052] TIFF0007911826000014.tif11156

[0053] (Table 7A) Nucleic acid sequences of the variable region of Ab P4-B3-HLkin1 TIFF0007911826000015.tif77152

[0054] (Table 7B) Amino acid sequence of the variable region of Ab HLKin1 TIFF0007911826000016.tif43152

[0055] (Table 8A) Nucleic acid sequences of the variable region of Ab P4-B3-HL-7 TIFF0007911826000017.tif81152

[0056] (Table 8B) Amino acid sequence of the variable region of Ab HL-7 TIFF0007911826000018.tif43152

[0057] (Table 9A) Nucleic acid sequences of the variable region of Ab P4-B3-HL-14 TIFF0007911826000019.tif77152

[0058] (Table 9B) Amino acid sequence of the variable region of Ab HL-14 TIFF0007911826000020.tif48152

[0059] (Table 10A) Nucleic acid sequences of the variable region of Ab HLkin-1 HL-7 mut2 TIFF0007911826000021.tif77152

[0060] (Table 10B) Amino acid sequence of the variable region of Ab HLkin-1 HL-7 mut2 TIFF0007911826000022.tif44152

[0061] (Table 11A) Nucleic acid sequences of the variable regions of Ab HLkin-1 HL-7 HL-14 mut3 TIFF0007911826000023.tif77152

[0062] (Table 11B) Amino acid sequences of the variable regions of Ab HLkin-1 HL-7 HL-14 mut3 TIFF0007911826000024.tif43152

[0063] The amino acid sequences of the complementarity-determining regions of the heavy and light chains of the PD-1 antibody are shown in Tables 12A to 12B below.

[0064] (Table 12A) Complementarity-determining regions (CDRs) of the heavy chain (V H ) of the PD-1 antibody TIFF0007911826000025.tif114134

[0065] (Table 12B) Complementarity-determining regions (CDRs) of the light chain (V L ) of the PD-1 antibody TIFF0007911826000026.tif11413...

[0066] The amino acid sequences of the framework regions of the heavy and light chains of the PD-1 antibody are shown in Tables 13A to 13B below.

[0067] (Table 13A) Framework region (FR) of the heavy chain (V H ) of the PD-1 antibody TIFF0007911826000027.tif202155

[0068] (Table 13B) Framework region (FR) of the light chain (V L ) of the PD-1 antibody TIFF0007911826000028.tif202155

[0069] The PD-1 antibodies described herein bind to PD-1. In one embodiment, the PD-1 antibody has high affinity and high specificity for PD-1. Some embodiments also feature antibodies that have a certain percentage of identity or similarity to the amino acid or nucleotide sequence of the anti-PD-1 antibody described herein. For example, “homologousity” or “identity” or “similarity” refers to sequence similarity between two peptides or two nucleic acid molecules. Homologousity can be determined by comparing the positions of each sequence, which may be aligned for comparison purposes. If the positions of the sequences being compared are occupied by the same base or amino acid, the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. For example, an antibody may have 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher amino acid sequence identity when compared to a specific region or the full length of any one of the anti-PD-1 antibodies described herein. The sequence identity or similarity of the nucleic acids and proteins of the present invention can be determined by sequence comparison and / or alignment by methods known in the art, such as those described in Ausubel et al. eds. (2007) Current Protocols in Molecular Biology. For example, the sequence identity or similarity percentage of the nucleic acids and proteins of the present invention can be determined using a sequence comparison algorithm (i.e., BLAST or BLAST 2.0), manual alignment, or visual inspection.

[0070] As used herein, “polypeptide” can encompass a single “polypeptide” and multiple “polypeptides” and refers to a molecule composed of monomers (amino acids) linked in a linear chain by amide bonds (also known as peptide bonds). The term “polypeptide” refers to any one or more chains of two or more amino acids and does not refer to a specific length of the product. Thus, any other term used to refer to a peptide, dipeptide, tripeptide, oligopeptide, “protein,” “amino acid chain,” or a chain of two or more amino acids may refer herein to a “polypeptide,” and the term “polypeptide” may be used in place of or interchangeably with any of these terms. “Polypeptide” may also refer to post-expression modified products of a polypeptide, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting / blocking groups, proteolytic cleavage, or modification with amino acids that do not exist in nature. Polypeptides may originate from natural biological sources or be produced by recombinant technology and do not necessarily have to be translated from a specific nucleic acid sequence. They may be produced by any method, including chemical synthesis. With respect to amino acid sequences, those skilled in the art will readily recognize that individual substitutions, deletions, or additions to nucleic acids, peptides, polypeptides, or protein sequences that modify, add, delete, or substitute a single amino acid or a small percentage of amino acids in the encoded sequence are collectively referred to herein as “conservatively modified variants.” In some embodiments, the modification results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables that provide functionally similar amino acids are well known in the art. Such conservatively modified variants of anti-PD-1 antibodies disclosed herein may exhibit higher cross-reactivity to PD-1 compared to unmodified PD-1 antibodies.

[0071] For example, a "conservative amino acid substitution" is one in which an amino acid residue is substituted with an amino acid residue having a similar side chain. In this art, families of amino acid residues with similar side chains are defined as basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), non-charged side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, non-essential amino acid residues in immunoglobulin polypeptides are substituted with other amino acid residues derived from the same side chain family. In another embodiment, amino acid chains can be substituted with structurally similar chains that differ in the order and / or composition of their side chain family members.

[0072] antibody As used herein, “antibody” or “antigen-binding polypeptide” may refer to a polypeptide or polypeptide complex that specifically recognizes and binds to an antigen. An antibody may be a whole antibody, any antigen-binding fragment, or a single chain thereof. For example, an “antibody” may include any protein or peptide-containing molecule that contains at least a portion of an immunoglobulin molecule having biological activity to bind to an antigen. Non-limiting examples include the complementarity-determining region (CDR) of a heavy or light chain or its ligand-binding portion, the variable region of a heavy or light chain, the constant region of a heavy or light chain, the framework (FR) region, or any portion thereof, or at least a portion of a binding protein. As used herein, the term “antibody” may refer to an immunoglobulin molecule and an immunoglobulin (Ig) molecule, i.e., the immunoactive portion of a molecule containing an antigen-binding site that specifically binds to (immunely reacts with) an antigen. “Specifically binding” or “immunely reacting” means that the antibody reacts with one or more antigenicity-determining sites of a desired antigen and not with other polypeptides.

[0073] As used herein, the terms “antibody fragment” or “antigen-binding fragment” refer to F (ab’)2 F (ab)2 F ab ', F ab This refers to a portion of an antibody, such as Fv, scFv, etc. Regardless of its structure, an antibody fragment binds to the same antigen recognized by the complete antibody. The term "antibody fragment" can also encompass aptamers (such as Spiegelmer), minibodies, and diabodies. The term "antibody fragment" can also encompass any synthetic or genetically engineered protein that acts like an antibody by binding to a specific antigen and forming a complex. The antibodies, antigen-binding polypeptides, variants, or derivatives described herein include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized, or chimeric antibodies, single-chain antibodies, epitope-binding fragments such as Fab, Fab', F(ab')2, Fd, Fvs, single-chain Fv(scFv), single-chain antibodies, dAb (domain antibodies), minibodies, disulfide-binding Fv(sdFv), fragments containing any of the VL or VH domains, fragments generated by Fab expression libraries, and anti-idiotype (anti-Id) antibodies.

[0074] "Single-chain variable fragment" or "scFv" refers to the heavy chain (V) of immunoglobulins. H ) and light chain (V L This refers to a fusion protein of the variable region of ). A single-chain Fv ("scFv") polypeptide molecule is a covalently linked VH:VL heterodimer, which can be expressed from a gene fusion containing VH and VL coding genes linked by a peptide coding linker. (See Huston et al. (1988) Proc Nat Acad Sci USA 85(16):5879-5883). In some embodiments, the region is linked by a short linker peptide of 10 to about 25 amino acids. The linker can be rich in glycine for flexibility, and serine or threonine for solubility, in which case VH The N-terminus and V L The C-terminus can be linked to the other end, or vice versa. This protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of a linker. Numerous methods have been described for identifying the chemical structure to convert naturally aggregated but chemically separated light and heavy polypeptide chains from the antibody V region into scFv molecules that fold into a three-dimensional structure substantially similar to that of the antigen-binding site. See, for example, U.S. Patents 5,091,513, 5,892,019, 5,132,405, and 4,946,778, which incorporate their entirety by reference, respectively.

[0075] Very large naive human scFv libraries have been constructed and can be constructed to provide a large source of antibody genes rearranged for numerous target molecules. Smaller libraries can be constructed from individuals with infectious diseases to isolate disease-specific antibodies. (See Barbas et al., Proc. Natl. Acad. Sci. USA 89:9339-43 (1992), Zebedee et al, Proc. Natl. Acad. Sci. USA 89:3 175-79 (1992)).

[0076] Antibody molecules obtained from humans are classified into five classes of immunoglobulins: IgG, IgM, IgA, IgE, and IgD, which differ from one another in the properties of the heavy chains present in the molecules. Those skilled in the art will understand that the heavy chains are classified as gamma, mu, alpha, delta, or epsilon (γ, μ, α, δ, ε), and that there are several subclasses within these (e.g., γ1-γ4). Certain classes also have subclasses, such as IgG1, IgG2, IgG3, and IgG4, as well as others. Subclasses (isotypes) of immunoglobulins, such as IgG1, IgG2, IgG3, IgG4, and IgG5, are well-characterized and are known to provide functional specificity. In the case of IgG, a standard immunoglobulin molecule contains two identical light-chain polypeptides with a molecular weight of approximately 23,000 daltons and two identical heavy-chain polypeptides with a molecular weight of 53,000-70,000. The four chains are typically linked by disulfide bonds in a "Y" shape, with the light chains beginning at the mouth of the "Y" and surrounding the heavy chains that continue through the variable region. The immunoglobulin or antibody molecules described herein may be any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecules.

[0077] Light chains are classified as either kappa or lambda (κ, λ). Each heavy chain class can be bound to either a kappa or lambda light chain. Generally, light and heavy chains are covalently linked to each other, and when immunoglobulins are produced by hybridomas, B cells, or genetically engineered host cells, the "tails" of the two heavy chains are linked to each other by covalent disulfide bonds or non-covalent bonds. In heavy chains, the amino acid sequence extends from the N-terminus of the Y-branched ends to the C-terminus at the bottom of each chain.

[0078] Both the light and heavy chains are divided into structural and functional homology regions. The terms “constant” and “variable” are used in a functional sense. The variable domains (VL and VH) of both the light and heavy chain portions determine antigen recognition and specificity. Conversely, the constant domains (CL, as well as CH1, CH2, or CH3) of the light and heavy chains confer important biological characteristics such as secretion, transplacental mobility, Fc receptor binding, and complement binding. The term “antigen-binding site” or “binding region” can refer to the portion of the immunoglobulin molecule involved in antigen binding. Antigen-binding sites are formed by amino acid residues in the N-terminal variable ("V") regions of the heavy ("H") and light ("L") chains. Three highly distinct segments within the V regions of the heavy and light chains, called “hypervariable regions,” are inserted between more conserved adjacent segments known as “framework regions” or “FR.” Thus, the term “FR” refers to the naturally occurring amino acid sequences between and adjacent to the hypervariable regions of immunoglobulins. In antibody molecules, the three hypervariable regions of the light chain and the three hypervariable regions of the heavy chain are arranged relative to each other in three-dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of the antigen it binds to, and the three hypervariable regions of the heavy chain and the three hypervariable regions of the light chain are called "complementarity-determining regions" or "CDRs". The VH and VL regions, including the CDRs and framework (FR), of the PD-1 antibody are shown in Tables 1A to 15B.

[0079] The six CDRs present in each antigen-binding domain are short, non-adjacent sequences of amino acids that are specifically positioned to form the antigen-binding domain when the antibody takes its three-dimensional configuration in an aqueous environment. The remaining amino acids of the antigen-binding domain, the FR region, exhibit little intermolecular variation. The framework region primarily conforms to a β-sheet structure, with the CDRs linking together to form loops and, in some cases, forming part of the β-sheet structure. The framework region functions to form a scaffold for positioning the CDRs in the correct orientation through non-covalent interactions between the chains. The antigen-binding domain formed by the positioned CDRs provides a complementary surface to the epitope on the antigen in the immune response, promoting non-covalent binding of the antibody to the congeneral epitope. The amino acids containing the CDR and framework regions, respectively, can be readily identified by those skilled in the art for the heavy chain or light chain variable region, since they have been previously identified (see “Sequences of Proteins of Immunological Interest,” Kabat, E., et al., USD Department of Health and Human Services, (1983) and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987)).

[0080] Where there are two or more definitions for a term used and / or permitted in the art, the definitions used herein are intended to encompass all such meanings unless explicitly stated otherwise. A specific example is the use of the term “complementarity-determining region” (“CDR”) to describe non-adjacent antigen-binding sites found within the variable regions of both heavy-chain and light-chain polypeptides. This particular region is described by Kabat et al., USDept. of Health and Human Services, “Sequences of Proteins of Immunological Interest” (1983) and Chothia et al., J.Mol.Biol.196:901-917 (1987), which are incorporated herein by reference in their entirety. The definitions of CDR by Kabat and Chothia include overlaps or subsets of amino acid residues when compared to one another. Nevertheless, it is intended that applying either definition to refer to the CDR of an antibody or its variant is also within the scope of the terms defined and used herein. For comparison, the appropriate amino acid residues encompassing the CDR as defined by each of the above references are listed in the table below. The exact residue numbers containing a particular CDR vary depending on the CDR's sequence and size. Those skilled in the art can routinely determine which residues constitute a specific CDR simply by knowing the variable region amino acid sequence of the antibody. TIFF0007911826000029.tif48128

[0081] Kabat et al. defined a numbering system for variable domain sequences applicable to any antibody. Those skilled in the art can clearly assign this “Kabat numbering” system to any variable domain sequence, without relying on other experimental data of the sequence itself. As used herein, “Kabat numbering” refers to the numbering system described in Kabat et al., USDept. of Health and Human Services, “Sequence of Proteins of Immunological Interest” (1983).

[0082] In addition to the table above, the Kabat numbering system describes the CDR region as follows: CDR-H1 begins around amino acid 31 (i.e., about 9 residues after the first cysteine ​​residue), contains about 5-7 amino acids, and ends with the following tryptophan residue. CDR-H2 begins at the 15th residue after the end of CDR-H1, contains about 16-19 amino acids, and ends with the following arginine or lysine residue. CDR-H3 begins at about the 33rd amino acid residue after the end of CDR-H2, contains 3-25 amino acids, and ends with the sequence WGXG (where X is any amino acid). CDR-L1 begins around residue 24 (i.e., following the cysteine ​​residue), contains about 10-17 residues, and ends with the following tryptophan residue. CDR-L2 begins at about the 16th residue after the end of CDR-L1, contains about 7 residues. CDR-L3 begins approximately 33 residues after the end of CDR-L2 (i.e., following a cysteine ​​residue), contains approximately 7-11 residues, and ends with the sequence F or WGXG (where X is any amino acid).

[0083] As used herein, the term “epitope” may include any protein determinant that can specifically bind to an immunoglobulin, scFv, or T cell receptor. Variable regions allow antibodies to selectively recognize and specifically bind to epitopes on an antigen. For example, a combination of the VL and VH domains of an antibody, or a subset of complementarity-determining regions (CDRs), forms a variable region that defines a three-dimensional antigen-binding site. The quaternary structure of this antibody forms antigen-binding sites located at the ends of each arm of the Y. Epitope-determining elements typically consist of chemically active surface groups of molecules, such as amino acid or sugar side chains, and usually possess specific three-dimensional structural properties and specific charge properties. For example, antibodies can be produced against the N-terminal or C-terminal peptide of a polypeptide. More specifically, the antigen-binding site is defined by three CDRs on the VH and VL chains, respectively (i.e., CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3). In one embodiment, the antibody may be against PD-1 (Genbank accession number NP_005009; 288 amino acid residue length) containing the amino acid sequence of SEQ ID NO: XX. TIFF0007911826000030.tif18137

[0084] As used herein, the terms “immunological binding” and “immunological binding properties” may refer to a type of non-covalent interaction that occurs between an immunoglobulin molecule and an antigen to which the immunoglobulin is specific. The strength, or affinity, of an immunological binding interaction is determined by the dissociation constant (K) of the interaction. D It can be expressed as (K), and a smaller (K D ) represents greater affinity. The immunological binding properties of a selected polypeptide can be quantified using methods well known in the art. One such method involves measuring the rates of antigen-binding site / antigen complex formation and dissociation, whose rates depend on the concentration of the complex partner, the affinity of the interaction, and geometric parameters that equally affect the rates in both directions. Thus, both "on rate constants" (K) on) and "off-speed constant" (K off ) can be determined by calculating the concentration and the actual rates of association and dissociation. (See Nature 361:186-87 (1993)). K off / K on The ratio of these parameters cancels out all parameters unrelated to affinity, and the dissociation constant K D This is equivalent to (see Davies et al. (1990) Annual Rev Biochem 59:439-473 in general). The antibodies of the present invention have been measured by kinetic assays such as radioligand binding assays, or by similar assays known to those skilled in the art, such as BIAcore or Octet (BLI), and have an equilibrium binding constant (K D ) can specifically bind to the PD-1 epitope when its ratio is ≤1 μM, ≤10 μM, ≤10 nM, ≤10 pM, or ≤100 pM to about 1 pM. For example, in some embodiments, K D This is between approximately 1E-12M and 1E-11M. D In some embodiments, K D This is between approximately 1E-11M and 1E-10M. D In some embodiments, K D This is between approximately 1E-10M and 1E-9M. D In some embodiments, K D The K is approximately between 1E-9M and 1E-8M. D In some embodiments, K D This is between approximately 1E-8M and 1E-7M. D In some embodiments, K D This is between approximately 1E-7M and 1E-6M. D For example, in some embodiments, K D It is approximately 1E-12M, and in other embodiments, K D It is approximately 1E-11M. In some embodiments, K D It is approximately 1E-10M, and in other embodiments, K D In some embodiments, K D It is approximately 1E-8M, and in other embodiments, KD In some embodiments, K D It is approximately 1E-6M, and in other embodiments, K D It is approximately 1E-5M. In some embodiments, for example, K D It is approximately 3E-11M, and in other embodiments, K D It is approximately 3E-12M. In some embodiments, K D Its length is approximately 6E-11M. "Specifically binding" or "specific to" can refer to an antibody that binds to an epitope via its antigen-binding domain, and that the binding involves some complementarity between the antigen-binding domain and the epitope. For example, an antibody is said to "specifically bind" to an epitope if it binds to that epitope via its antigen-binding domain more easily than it would to bind to a random, unrelated epitope.

[0085] For example, PD-1 antibodies can be monovalent or bivalent and can be single-stranded or double-stranded. Functionally, the binding affinity of PD-1 antibodies is 10 -5 M~10 -12 It is within the range of M. For example, the binding affinity of the PD-1 antibody is 10 -6 M~10 -12 M, 10 -7 M~10 -12 M, 10 -8 M~10 -12 M, 10 -9 M~10 -12 M, 10 -5 M~10 -11 M, 10 -6 M~10 -11 M, 10 -7 M~10 -11 M, 10 -8 M~10 -11 M, 10 -9 M~10 -11 M, 10 -10 M~10 -11 M, 10 -5 M~10 -10 M, 10 -6 M~10 -10 M, 10 -7 M~10 -10 M, 10-8 M to 10 -10 M, 10 -9 M to 10 -10 M, 10 -5 M to 10 -9 M, 10 -6 M to 10 -9 M, 10 -7 M to 10 -9 M, 10 -8 M to 10 -9 M, 10 -5 M to 10 -8 M, 10 -6 M to 10 -8 M, 10 -7 M to 10 -8 M, 10 -5 M to 10 -7 M, 10 -6 M to 10 -7 M or 10 -5 M to 10 -6 It is M.

[0086] The PD-1 protein of the present invention, or derivatives, fragments, analogs, homologs or orthologs thereof, can be used as an immunogen in the production of antibodies that immunospecifically bind to these protein components, for example, amino acid residues including SEQ ID NO: X. The PD-1 protein, or derivatives, fragments, analogs, homologs or orthologs thereof, coupled to proteoliposomes can be used as an immunogen in the production of antibodies that immunospecifically bind to these protein components.

[0087] One skilled in the art will recognize that, without undue experimentation, it can be determined by confirming whether a human monoclonal antibody has the same specificity as the human monoclonal antibody of the present invention by whether the former prevents the binding of the latter to PD-1. If the human monoclonal antibody being tested shows a decrease in binding by the human monoclonal antibody of the present invention and competes with the human monoclonal antibody of the present invention, these two monoclonal antibodies are likely to bind to the same or closely related epitopes.

[0088] Another method for determining whether a human monoclonal antibody has the specificity of the human monoclonal antibody of the present invention is to pre-incubate the human monoclonal antibody of the present invention with a PD-1 protein that normally reacts with it, then add the human monoclonal antibody to be tested, and determine whether the human monoclonal antibody to be tested is inhibited in its ability to bind to PD-1. If the human monoclonal antibody to be tested is inhibited, it likely has the same or functionally equivalent epitope specificity as the monoclonal antibody of the present invention. Screening of the human monoclonal antibody of the present invention can also be carried out by utilizing PD-1 and determining whether the monoclonal antibody to be tested can neutralize PD-1.

[0089] Various procedures known within the art can be used to produce polyclonal or monoclonal antibodies directed against the proteins of the present invention, or against their derivatives, fragments, analogs, homologs, or orthologues. (See, for example, Antibodies: A Laboratory Manual, Harlow E, and Lane D, 1988, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, incorporated herein by reference).

[0090] Antibodies can be purified by well-known techniques such as affinity chromatography using protein A or protein G, which primarily provide the IgG fraction of immunoserum. Subsequently, or alternatively, immunospecific antibodies can be purified by immunoaffinity chromatography by immobilizing the specific antigen or epitope that is the target of the desired immunoglobulin onto a column. The purification of immunoglobulins is discussed, for example, by D. Wilkinson (The Scientist, published by The Scientist, Inc., Philadelphia PA, Vol. 14, No. 8 (April 17, 2000), pp. 25-28).

[0091] As used herein, the terms “monoclonal antibody,” “mAb,” “Mab,” or “monoclonal antibody composition” may refer to a group of antibody molecules containing only one species of antibody molecule, consisting of a distinctive light chain gene product and a distinctive heavy chain gene product. In particular, the complementarity-determining region (CDR) of a monoclonal antibody is identical across all molecules in the group. A MAb contains an antigen-binding site that can react immunologically with a specific epitope of an antigen, characterized by a specific binding affinity to it.

[0092] Monoclonal antibodies can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In hybridoma methods, mice, hamsters, or other suitable host animals are typically immunized with an immunizer to induce lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizer. Alternatively, lymphocytes can be immunized in vitro.

[0093] The immunotherapeutic agent may include protein antigens, their fragments, or fusion proteins. For example, peripheral blood lymphocytes may be used if human-derived cells are desired, or spleen cells or lymph node cells may be used if a non-human mammalian source is desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusion agent such as polyethylene glycol to form hybridoma cells (see Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103). The immortalized cell line may be transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. For example, rat or mouse myeloma cell lines may be used. The hybridoma cells can be cultured in a suitable medium containing one or more substances that inhibit the proliferation or survival of non-fusioned immortalized cells. For example, if parent cells lack the enzyme hypoxanthine guanine phosphoribosyltransferase (HGPRT or HPRT), the hybridoma culture medium typically contains hypoxanthine, aminopterin, and thymidine ("HAT medium"), and these substances prevent the growth of HGPRT-deficient cells.

[0094] Useful immortalized cell lines are those that efficiently fuse, maintain stable high levels of antibody expression by selected antibody-producing cells, and are sensitive to culture media such as HAT medium. Examples of immortalized cell lines include mouse myeloma lines available from the Salk Institute Cell Distribution Center (San Diego, California) and the American Type Culture Collection (Manassas, Virginia). Human myeloma and mouse-human heterozygous myeloma cell lines have also been described for the production of human monoclonal antibodies. (See Kozbor, J. Immunol, 133:3001 (1984), Brodeur et al, Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63).

[0095] Next, the culture medium in which hybridoma cells are cultured can be assayed for the presence of monoclonal antibodies against the antigen. For example, the binding specificity of monoclonal antibodies produced by hybridoma cells can be determined by immunoprecipitation or by in vitro binding assays such as radioimmunoassay (RIA) or enzyme-linked immunosolvent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of monoclonal antibodies can be determined, for example, by Scatchard analysis in Munson and Pollard, Anal. Biochem., 107:220 (1980). Furthermore, for therapeutic applications of monoclonal antibodies, it is important to identify antibodies that have high specificity and high binding affinity to the target antigen.

[0096] After the desired hybridoma cells are identified, clones can be subcloned using limiting dilution procedures and grown using standard methods (see Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986), pp. 59-103). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle Medium and RPMI-1640 Medium. Alternatively, hybridoma cells can be grown in vivo as ascites in mammals.

[0097] Monoclonal antibodies secreted by subclones can be isolated or purified from culture media or ascites fluid by conventional immunoglobulin purification procedures such as protein A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

[0098] Monoclonal antibodies can also be produced by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567 (which is incorporated herein by reference in its entirety). The DNA encoding the monoclonal antibodies of the present invention can be readily isolated and sequenced using conventional procedures (for example, by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of the mouse antibody). Hybridoma cells of the present invention serve as a source of such DNA. Once isolated, the DNA can be placed in an expression vector, which is then transfected into host cells such as monkey COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin proteins, to obtain the synthesis of monoclonal antibodies in recombinant host cells. DNA can also be modified, for example, by substituting the coding sequences of human heavy and light chain constant domains for homologous mouse sequences (see U.S. Patent No. 4,816,567, Morrison, Nature 368,812-13 (1994)) or by covalently bonding all or part of the coding sequence of a non-immunoglobulin polypeptide to the immunoglobulin coding sequence. Such non-immunoglobulin polypeptides can be used in place of the constant domain of the antibody of the present invention, or in place of the variable domain of one antigen-binding site of the antibody of the present invention, to produce a chimeric bivalent antibody.

[0099] Fully human antibodies are antibody molecules in which both the light and heavy chain sequences, including, for example, CDRs, originate from human genes. Such antibodies are referred to herein as “humanized antibodies” or “fully human antibodies.” “Humanized antibodies” can be antibodies derived from non-human species, but their light and heavy chain protein sequences have been modified to increase similarity to antibody variants produced in humans. Humanized antibodies are antibody molecules derived from non-human species antibodies that bind to a desired antigen, having one or more complementarity-determining regions (CDRs) from non-human species and a framework region derived from a human immunoglobulin molecule. Often, framework residues in the human framework region are substituted with corresponding residues from the CDR donor antibody, thereby altering, for example, antigen binding and improving it. These framework substitutions are identified by methods well known in the art, for example, by modeling the interaction between CDRs and framework residues to identify framework residues important for antigen binding, and by comparing sequences to identify abnormal framework residues at specific positions (see, for example, Queen et al., USPat. No. 5, 585, 089, and Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entirety). For example, non-human portions of an antibody (such as CDRs of the light and / or heavy chains) can bind to a target antigen. Humanized monoclonal antibodies are also sometimes referred to herein as “human monoclonal antibodies.”

[0100] Antibodies can be humanized using various techniques known in the art, such as CDR transplantation (EP239,400, PCT International Publication No. 91 / 09967, U.S. Patent Nos. 5,225,539, 5,530,101 and 5,585,089), veneering or resurfacing (EP592,106, EP519,596, Padlan, Molecular Immunology 28(4 / 5):489-498(1991); Studnicka et al., Protein Engineering 7(6):805-814(1994); Roguska et al., Proc. Natl. Sci. USA 91:969-973(1994)), and chain shuffling (U.S. Patent No. 5,565,332, which is incorporated in its entirety by reference). Humanization (also known as reshaping or CDR grafting) is a well-established technique, well known to those skilled in the art, for reducing the immunogenicity of monoclonal antibodies (mAbs) derived from a different source (usually rodents) and improving the activation of the human immune system (see, for example, Hou S, Li B, Wang L, Qian W, Zhang D, Hong X, Wang H, Guo Y (July 2008) "Humanization of an anti-CD34 monoclonal antibody by complementarity-determining region grafting based on computer-assisted molecular modeling" J Biochem. 144(1):115-20).

[0101] Human monoclonal antibodies, such as fully human and humanized antibodies, can be prepared using trioma technology, human B-cell hybridoma technology (see Kozbor, et al, 1983 Immunol Today 4:72), and EBV hybridoma technology that produces human monoclonal antibodies (see Cole, et al, 1985 In: MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp.77-96). Human monoclonal antibodies can be used and produced by using human hybridomas (see Cote, et al, 1983. Proc Natl Acad Sci USA 80:2026-2030) or by transforming human B cells with Epstein-Barr virus in vitro (Cole, et al., 1985 In:MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc., pp.77-96).

[0102] In addition, human antibodies can also be produced using other techniques, such as phage display libraries (see Hoogenboom and Winter, J.Mol.Biol, 227:381 (1991), Marks et al., J.Mol.Biol, 222:581 (1991)). Similarly, human antibodies can be produced by introducing human immunoglobulin loci into transgenic animals, such as mice in which the endogenous immunoglobulin gene is partially or completely inactivated. After the challenge, human antibody production is observed, which is very similar in all aspects to that seen in humans, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patents No. 5,545,807, 5,545,806, 5,569,825, 5,625,126, 5,633,425, and 5,661,016, as well as in Marks et al., Bio / Technology 10,779-783 (1992), Lonberg et al., Nature 368,856-859 (1994), Morrison, Nature 368,812-13 (1994), Fishwild et al., Nature Biotechnology 14,845-51 (1996), Neuberger, Nature Biotechnology 14,826 (1996), and Lonberg and Huszar, Intern. Rev. Immunol. 13. It is described in 65-93 (1995).

[0103] Human antibodies can also be produced using transgenic non-human animals that are modified to produce fully human antibodies rather than endogenous antibodies in response to antigenic challenge (see PCT International Publication 94 / 02602 and U.S. Patent No. 6,673,986). Endogenous genes encoding heavy and light chain immunoglobulin chains in the non-human host are neutralized, and active loci encoding human heavy and light chain immunoglobulins are inserted into the host genome. Human genes are incorporated, for example, using a yeast artificial chromosome containing the required human DNA segments. Animals providing all the desired modifications are then obtained as offspring by mating intermediate transgenic animals containing fewer modifications than the total number required. A preferred embodiment of such a non-human animal is the mouse, referred to as Xenomouse®, as disclosed in PCT International Publication 96 / 33735 and 96 / 34096. This animal produces B cells that secrete fully human immunoglobulin. Antibodies can be obtained, for example, as preparations of polyclonal antibodies, directly from animals after immunization with the immunogen of interest, or alternatively, from immortalized B cells derived from animals, such as hybridomas that produce monoclonal antibodies. In addition, genes encoding immunoglobulins with human variable regions can be recovered and expressed to directly obtain antibodies, or further modified to obtain antibody analogs, such as single-chain Fv(scFv) molecules. Thus, therapeutically useful IgG, IgA, IgM, and IgE antibodies can be produced using such techniques. For an overview of this technique for producing human antibodies, see Lonberg and Huszar Int. Rev. Immunol. 73:65-93 (1995).For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies, and protocols for producing such antibodies, see, for example, PCT International Publications 98 / 24893, 96 / 34096, 96 / 33735, U.S. Patents 5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318, and 5,939,598, which are incorporated herein by reference in their entirety. In addition, companies such as Creative BioLabs (Shirley, NY) can offer services to provide human antibodies against selected antigens using technologies similar to those described above.

[0104] An example of a method for producing a non-human host, exemplified by a mouse lacking expression of endogenous immunoglobulin heavy chains, is disclosed in U.S. Patent No. 5,939,598. This can be obtained by a method comprising: deleting a J-segment gene from at least one endogenous heavy chain locus in embryonic stem cells to prevent locus rearrangement and the formation of a transcript of the rearranged immunoglobulin heavy chain locus, wherein the deletion is carried out by a target-directed vector containing a gene encoding a selectable marker; and producing a transgenic mouse from embryonic stem cells, wherein its somatic and germ cells contain a gene encoding a selectable marker.

[0105] One method for producing an antibody of interest, such as a human antibody, is disclosed in U.S. Patent No. 5,916,771. This method involves introducing an expression vector containing a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, introducing an expression vector containing a nucleotide sequence encoding a light chain into another mammalian host cell, and fusing the two cells to form a hybrid cell. The hybrid cell expresses an antibody containing both a heavy chain and a light chain.

[0106] Further improvements to this procedure include methods for identifying clinically relevant epitopes on an immunogen level, and corresponding methods for selecting antibodies that bind immunospecifically to these relevant epitopes with high affinity, as disclosed in PCT International Publication No. 99 / 53049.

[0107] The antibody of interest can also be expressed by a vector containing a DNA segment encoding the single-chain antibody described above. For example, vectors include, but are not limited to, chemical conjugates containing a target-directed portion (e.g., a ligand for a cell surface receptor) and a nucleic acid-binding portion (e.g., polylysine), as described in International Publication No. 93 / 64701, viral vectors (e.g., DNA or RNA viral vectors), fusion proteins such as those described in PCT / US95 / 02140 (WO95 / 22618), i.e., fusion proteins containing a target-directed portion (e.g., an antibody specific to a target cell) and a nucleic acid-binding portion (e.g., protamine), plasmids, phages, and viral vectors. Vectors can be chromosomal, non-chromosomal, or synthetic. Retroviral vectors can also be used, such as Moloney's mouse leukemia virus. DNA viral vectors can also be used, including pox vectors such as orthopox or avipox vectors, herpesvirus vectors such as herpes simplex virus I (HSV) vectors (see Geller, AI et al, J. Neurochem, 64:487 (1995), Lim, F., et al, in DNA Cloning: Mammalian Systems, D. Glover, Ed. (Oxford Univ. Press, Oxford England) (1995), Geller, AI et al, Proc Natl. Acad. Sci.: USA 90:7603 (1993), Geller, AI, et al, Proc Natl. Acad. Sci USA 87:1149 (1990)), and adenovirus vectors (see LeGal LaSalle et al, Science, 259:988 (1993), Davidson, et al, Nat. Genet Examples include 3:219 (1993), Yang, et al, J. Virol. 69:2004 (1995), and adeno-associated virus vectors (see Kaplitt, MG. et al, Nat. Genet. 8:148 (1994)).

[0108] Poxvirus vectors introduce genes into the cytoplasm of cells. Avidoxvirus vectors result in short-term expression of nucleic acids. Adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus (HSV) vectors can be used to introduce nucleic acids into nerve cells. Adenovirus vectors result in shorter expression periods (about 2 months) than adeno-associated virus (about 4 months), and even shorter than HSV vectors. The specific vector selected will depend on the target cell and the condition being treated. Introduction can be by standard techniques, such as infection, transfection, transduction, or transformation. Examples of modes of gene introduction include, for example, naked DNA, CaP04 precipitation, DEAE dextran, electroporation, protoplast fusion, lipofection, cell microinjection, and viral vectors.

[0109] Vectors can be used to target virtually any desired target cell. For example, stereotactic injection can be used to guide a vector (e.g., adenovirus, HSV) to a desired location. In addition, particles can be delivered by intraventricular (icv) injection using minipump infusion systems such as the SynchroMed Infusion System. Methods based on bulk flow called convection have also proven effective in delivering large molecules to dilated areas of the brain and may be useful for delivering vectors to target cells. (See Bobo et al, Proc. Natl. Acad. Sci. USA 91:2076-2080 (1994), Morrison et al, Am. J. Physiol. 266:292-305 (1994)). Other methods that can be used include catheter, intravenous, parenteral, intraperitoneal, and subcutaneous injections, as well as oral or other known routes of administration.

[0110] These vectors can be used to express large quantities of antibodies that can be used in various ways. For example, to detect the presence of PD-1 in a sample. Antibodies can also be used to attempt to bind to and disrupt PD-1 activity.

[0111] The technique can be adapted to produce single-chain antibodies specific to the antigenic protein of the present invention (see, for example, U.S. Patent No. 4,946,778). In addition, the method is F ab Monoclonal F120 ab This can enable rapid and effective identification of fragments. Antibody fragments containing idiotypes for protein antigens can be produced by techniques known in the art, but are not limited to, (i) F produced by pepsin digestion of antibody molecules. (ab’)2 Fragment, (ii)F (ab’)2 F is produced by reducing the disulfide bridges of the fragments. ab (iii) F produced by treatment of the fragment, antibody molecule with papain and a reducing agent. ab Fragments, and (iv)F v Includes fragments.

[0112] Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies consist of two covalently bound antibodies. Such antibodies enable, for example, the targeting of immune system cells to undesirable cells (see U.S. Patent No. 4,676,980) and enable the treatment of HIV infection (see PCT International Publications 91 / 00360 and 92 / 20373). Antibodies are intended to be able to be prepared in vitro using known methods in the field of protein synthesis chemistry, such as those using crosslinking agents. For example, immunotoxins can be constructed using disulfide exchange reactions or by forming thioether bonds. Examples of suitable reagents for this purpose include iminothiolates and methyl-4-mercaptobutyrimidates, as well as those disclosed, for example, in U.S. Patent No. 4,676,980.

[0113] The antibodies of the present invention can be modified with respect to effector function, for example, to enhance the efficacy of the antibody in the treatment of cancer. For example, a cysteine ​​residue can be introduced into the Fc region, thereby enabling the formation of interchain disulfide bonds in this region. The homodimeric antibodies thus produced may have improved internalization ability and / or increased complement-mediated cytotoxicity and antibody-dependent cell-mediated cytotoxicity (ADCC). (See Caron et al, J. Exp Med., 176:1 191-195 (1992) and Shopes, J. Immunol., 148:2918-2922 (1992)). Alternatively, antibodies having a double Fc region, thereby possessing enhanced complement lysis and ADCC ability, can be manipulated. (See Stevenson et al, Anti-Cancer Drug Design, 3:219-230 (1989)).

[0114] In certain embodiments, the antibodies of the present invention may include Fc variants containing amino acid substitutions that modify the antigen-independent effector function of the antibody, particularly the circulating half-life of the antibody. Such antibodies, when compared to antibodies lacking these substitutions, exhibit either increased or decreased binding to FcRn, and therefore have increased or decreased serum half-lives, respectively. Fc variants with improved affinity for FcRn are expected to have a longer serum half-life, and such molecules have useful applications in methods of treating mammals where a longer half-life of the administered antibody is desirable, for example, to treat chronic diseases or disorders. In contrast, Fc variants with reduced FcRn binding affinity are expected to have a shorter half-life, and such molecules are also useful, for example, for administration to mammals where a shortened circulating time may be advantageous, such as for in vivo diagnostic imaging, or in situations where the starting antibody has toxic side effects if it remains in circulation for a long period of time. Fc variants with reduced FcRn binding affinity are less likely to cross the placenta and are therefore useful in the treatment of diseases or disorders in pregnant women. In addition, other applications where reduced FcRn binding affinity may be desirable include applications where localization to the brain, kidneys, and / or liver is desirable. In one embodiment, an Fc variant-containing antibody may exhibit reduced transport from the vascular system across the renal glomerular epithelium. In another embodiment, an Fc variant-containing antibody may exhibit reduced transport from the brain across the blood-brain barrier (BBB) ​​into the vascular space. In one embodiment, an antibody with modified FcRn binding contains an Fc domain having one or more amino acid substitutions within an "FcRn binding loop" of the Fc domain. The FcRn binding loop consists of amino acid residues 280-299 (according to EU numbering). Exemplary amino acid substitutions that modify FcRn binding activity are disclosed in PCT International Publication 05 / 047327, which is incorporated herein by reference. In certain exemplary embodiments, the antibody or fragment thereof of the present invention comprises an Fc domain having one or more of the following substitutions: V284E, H285E, N286D, K290E, and S304D (EU numbering).

[0115] In some embodiments, mutations are introduced into the constant region of an mAb so as to alter the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of the mAb. For example, the mutation is an LALA mutation in the CH2 domain. In one embodiment, the antibody (e.g., a human mAb, or a bispecific Ab) contains a mutation on one scFv unit of a heterodimeric mAb that reduces ADCC activity. In another embodiment, the mAb contains mutations on both strands of a heterodimeric mAb that completely eliminate ADCC activity. For example, a mutation introduced into one or both scFv units of an mAb is an LALA mutation in the CH2 domain. These mAbs with variable ADCC activity can be optimized so that the mAb exhibits maximum selective killing toward cells expressing one antigen recognized by the mAb, but minimum killing toward a second antigen recognized by the mAb.

[0116] In other embodiments, antibodies for use in the diagnostic and therapeutic methods described herein have a constant region, such as the heavy chain constant region of IgG1 or IgG4, which is modified to reduce or eliminate glycosylation. For example, the antibodies of the present invention may also include Fc variants that include amino acid substitutions that modify the glycosylation of the antibody. For example, in Fc variants, glycosylation (e.g., N-linked or O-linked glycosylation) can be reduced. In some embodiments, the Fc variant has reduced glycosylation of an N-linked glycan commonly found at amino acid position 297 (EU numbering). In another embodiment, the antibody has amino acid substitutions near or within a glycosylation motif, such as an N-linked glycosylation motif containing the amino acid sequence NXT or NXS. In a specific embodiment, the antibody includes an Fc variant having an amino acid substitution at amino acid position 228 or 299 (EU numbering). In a more specific embodiment, the antibody includes the IgG1 or IgG4 constant region containing S228P and T299A mutations (EU numbering).

[0117] Exemplary amino acid substitutions that reduce or alter glycosylation are disclosed in PCT International Publication No. 05 / 018572, incorporated herein by reference. In some embodiments, the antibody or fragment of the present invention is modified to eliminate glycosylation. Such an antibody or fragment may be referred to as an "agly" antibody or fragment (e.g., an "agly" antibody). Not bound by theory, an "agly" antibody or fragment may have an improved safety and stability profile in vivo. An exemplary agly antibody or fragment includes a deglycosylated Fc region of an IgG4 antibody that lacks Fc effector function, thereby eliminating the possibility of Fc-mediated toxicity to normal living tissues and cells expressing PD-1. In yet other embodiments, the antibody or fragment of the present invention includes a modified glycan. For example, the antibody may have a reduced number of fucose residues on the N-glycan at Asn297 in the Fc region, i.e., it is defucosylated. In another embodiment, the antibody may have a modified number of sialic acid residues on the N-glycan at Asn297 in the Fc region.

[0118] The present invention also relates to cytotoxic agents such as toxins (e.g., enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof), or immunoconjugates (the latter being radioconjugates) comprising antibodies conjugated to radioisotopes.

[0119] Enzymatically active toxins and fragments thereof that can be used include the A chain of diphtheria, non-binding active fragments of diphtheria toxin, the A chain of exotoxin A (derived from Pseudomonas aeruginosa), the A chain of ricin, the A chain of abrin, the A chain of modeccin, alpha-sarcin, Aleurites fordii protein, dianthin protein, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogelin, restrictocin, phenomycin, enomycin, and trichothecene. A variety of radionuclides are available for the production of radio-conjugated antibodies. Non-limiting examples include 212 Bi, 131 I, 131 In, 90 Y, and 186 Re.

[0120] Conjugates of antibodies and cytotoxic agents are made using a variety of bifunctional protein binders such as N-succinimidyl-3-(2-pyridyldithiol)propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutaraldehyde), bis-azide compounds (such as bis(p-azidobenzoyl)hexanediamine), bis-diazonium derivatives (bis-(p-diazoniumbenzoyl)-ethylenediamine), diisocyanates (such as tolylene 2,6-diisocyanate), and bis-active fluorine compounds (such as 1,5-difluoro-2,4-dinitrobenzene). For example, lysine immunotoxins can be prepared as described in Vitetta et al, Science 238:1098 (1987). Carbon-14 labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for the conjugation of radio nucleotides to antibodies. (See PCT International Publication No. 94 / 11026 and U.S. Patent No. 5,736,137).

[0121] One of ordinary skill in the art will recognize that a wide variety of possible moieties can be attached to the resulting antibody or other molecule of the invention. (See, for example, “Conjugate Vaccines”, Contributions to Microbiology and Immunology, J.M. Cruse and R.E. Lewis, Jr (eds), Carger Press, New York, (1989), the entire contents of which are incorporated herein by reference).

[0122] Binding can be achieved by any chemical reaction that will bind the two molecules, insofar as the antibody and the other part retain their respective activities. This binding can include many chemical mechanisms, such as covalent bonding, affinity bonding, intercalation, coordination bonding, and complex formation. In one embodiment, the binding is covalent. Covalent bonding can be achieved by direct condensation of existing side chains or by the incorporation of external crosslinking molecules. Many divalent or polyvalent binding agents are useful for binding protein molecules, such as the antibody of the present invention, to other molecules. For example, typical binding agents can include organic compounds such as thioesters, carbodiimides, succinimides, diisocyanates, glutaraldehyde, diazobenzene, and hexamethylenediamine. This list is not intended to cover all classes of binding agents known in the art, but rather to be an example of more general binding agents. (See Killen and Lindstrom, Jour.Immun.133:1335-2549 (1984), Jansen et al., Immunological Reviews 62:185-216 (1982), and Vitetta et al, Science 238:1098 (1987)). Non-limiting examples of linkers are described in the literature. (See, for example, Ramakrishnan, S. et al., Cancer Res.44:201-208 (1984) for the use of MBS (M-maleimidobenzoyl-N-hydroxysuccinimide ester).) See also U.S. Patent No. 5,030,719 for the use of halogenated acetylhydrazide derivatives conjugated to antibodies by oligopeptide linkers.Non-limiting examples of useful linkers that can be used with the antibodies of the present invention include: (i) EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride), (ii) SMPT (4-succinimidyloxycarbonyl-α-methyl-α-(2-pridyl-dithio)-toluene) (Pierce Chem. Co., Cat. (21558G)), (iii) SPDP (succinimidyl-6 [3-(2-pyridyldithio)propionamide]hexanoate) (Pierce Chem. Co., Cat. 21651G), (iv) sulfo-LC-SPDP (sulfosuccinimidyl-6 [3-(2-pyridyldithio)-propionamide]hexanoate) (Pierce (v)Sulfo-NHS(-hydroxysulfosuccinimide: Pierce Chem.Co., Cat.#24510) conjugated to (v)EDC.

[0123] The linkers described herein contain components with different attributes, resulting in conjugates with different physicochemical properties. For example, sulfo-NHS esters of alkyl carboxylates are more stable than sulfo-NHS esters of aromatic carboxylate salts. NHS-ester-containing linkers are less soluble than sulfo-NHS esters. Furthermore, linker SMPT can contain sterically hindered disulfide bonds to form conjugates with improved stability. Disulfide bonds are generally less stable than other bonds because they are cleaved in vitro, resulting in fewer available conjugates. In particular, sulfo-NHS can enhance the stability of carbodimide bonds. When carbodimide bonds (such as EDC) are used in combination with sulfo-NHS, they form esters that are more resistant to hydrolysis than carbodimide bond reactions alone.

[0124] The antibodies disclosed herein can also be formulated as immunoliposomes. Liposomes containing antibodies are prepared by methods known in the art, such as those described in Epstein et al, Proc. Natl. Acad. Sci. USA, 82:3688 (1985), Hwang et al, Proc. Natl. Acad. Sci. USA, 77:4030 (1980), and U.S. Patents No. 4,485,045 and No. 4,544,545. Liposomes with extended circulation time are disclosed in U.S. Patent No. 5,013,556.

[0125] Useful liposomes, not limited to those mentioned above, can be produced by reverse-phase evaporation using a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivativeized phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter of a defined pore size to produce liposomes having a desired diameter. The Fab' fragment of the antibody of the present invention can be conjugated to liposomes described in Martin et al, J. Biol. Chem., 257:286-288 (1982) via a disulfide exchange reaction.

[0126] bispecific antibody A bispecific antibody (bsAb) is an antibody containing two variable domains or scFv units, resulting in the antibody recognizing two different antigens. The present invention provides a bispecific antibody that recognizes PD-1 and a second antigen (e.g., a non-immune-depleted anti-PD1-scFv IL12 fusion protein). Examples of second antigens include tumor-associated antigens (e.g., LINGO1), cytokines (e.g., IL-12 (IL-12A (p35 subunit) protein sequence with NCBI reference number NP_000873.2, IL-12B (p40 subunit) protein sequence with NCBI reference number NP_002178.2, IL-18 (protein sequence with NCBI reference number NP_001553.1), IL-15 (protein sequence with NCBI reference number NP_000576.1), IL-7 (protein sequence with NCBI reference number NP_000871.1), IL-2 (protein sequence with NCBI reference number NP_000577.2), and IL-21 (protein sequence with NCBI reference number NP_068575.1)), cytokine synonym receptors (e.g., IL-12R)), and cell surface receptors. Non-limiting examples of the second antigen include CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. In one embodiment, the bispecific antibody comprises a PD-1 fusion protein. For example, the fusion protein comprises an antibody containing a variable domain or scFv unit and a ligand, thereby allowing the resulting antibody to recognize the antigen and bind to a ligand-specific receptor. In one embodiment, the fusion protein further comprises a constant region and / or a linker as described herein. For example, the fusion protein comprises an antibody that recognizes PD-1 and a ligand.Ligands include tumor-associated antigens (e.g., LINGO1, ErbB2 (HER2 / neu), oncoemulsifying antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, MN-CA). IX, RET1, RET2(AS), prostate-specific antigen (PSA), TAG-72, PAP, p53, Ras, prostain, PSMA, Survivin, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesoserin, β-catenin, TGF-βRII, BRCA1 / 2, SAP-1, HPV-E6, HPV-E7 (for further tumor-associated surface antigens, see also PCT / US2015 / 067225 and PCT / US2019 / 022272, which are incorporated in their entirety by reference)), cytokines (e.g., IL-12 (IL-12A (p35 subunit) protein sequence with NCBI reference number NP_000873.2, IL-12B (p40 subunit) protein sequence with NCBI reference number NP_002178.2), IL-1 These can be 8 (a sequence with NCBI reference number NP_001553.1), IL-15 (a protein sequence with NCBI reference number NP_000576.1), IL-7 (a protein sequence with NCBI reference number NP_000871.1), IL-2 (a protein sequence with NCBI reference number NP_000577.2), and IL-21 (a protein sequence with NCBI reference number NP_068575.1), CTLA-4, LAG-3, CD28, CD122, 4-1BB, TIM3, OX-40, OX40L, CD40, CD40L, LIGHT, ICOS, ICOSL, GITR, GITRL, TIGIT, CD27, VISTA, B7H3, B7H4, HEVM (or BTLA), CD47, and CD73. Bispecific antibodies in various formats are also provided herein. In some embodiments, the anti-PD1 fragment and the second antigen-specific fragment are independently selected from a Fab fragment, a single-chain variable fragment (scFv), or a single-domain antibody. In some embodiments, the bispecific antibody further comprises an Fc fragment.The bispecific antibodies of the present invention include a combination of the heavy and light chains of a PD-1 antibody, or scFv, as disclosed herein.

[0127] For example, the nucleic acid and amino acid sequences of a bispecific PD-1 antibody (e.g., a PD-1 IL-12 fusion) may be used in combination with the following exemplary constant regions useful in combination with the VH and VL sequences provided herein: P4-B3 scIL12 fusion (the variable and constant regions are the same as those of the base P4-B3 (as shown in Table 1 unless otherwise specified below), and in some embodiments, the variable regions of other PD-1 antibodies disclosed herein may be used to generate the exemplified IL12 fusions herein), CH3 / C L Show it in a regular font, TIFF0007911826000031.tif18153

[0128] (Table 14A) Nucleic acid sequences of Ab P4-B3 scIL12 HC F2A fusions TIFF0007911826000032.tif152152

[0129] (Table 14B) Nucleic acid sequences of Ab P4-B3 scIL12 HC F2A fusions TIFF0007911826000033.tif56152

[0130] (Table 15A) Nucleic acid sequences of Ab P4-B3 scIL12 HC G4S fusions TIFF0007911826000034.tif144152

[0131] (Table 15B) Amino acid sequence of Ab P4-B3 scIL12 HC G4S fusion TIFF0007911826000035.tif56152

[0132] (Table 16A) Nucleic acid sequences of Ab P4-B3 scIL12 LC F2A(-2) fusions TIFF0007911826000036.tif156152

[0133] (Table 16B) Amino acid sequence of Ab P4-B3 scIL12 LC F2A(-2) fusion TIFF0007911826000037.tif56152

[0134] (Table 17A) Nucleic acid sequences of Ab P4-B3 scIL12 LC G4S fusions TIFF0007911826000038.tif144152

[0135] (Table 17B) Amino acid sequence of Ab P4-B3 scIL12 LC (G4S)2 TIFF0007911826000039.tif56152

[0136] The bispecific antibodies of the present invention (e.g., non-immuno-depleted anti-PD1-scFv IL12 fusion protein) can be constructed using methods known in the art. In some embodiments, the bispecific antibody is a single polypeptide in which two scFv fragments are linked by a long linker polypeptide of sufficient length to allow intramolecular association between the two scFv units to form an antibody. In other embodiments, the bispecific antibody is two or more polypeptides linked by covalent or non-covalent bonds. In some embodiments, the amino acid linker (GGGGSGGGGS, "(G4S)2") shown in bold blue, used with the anti-PD1-scFv IL12 fusion construct, may be produced with a longer G4S linker to improve flexibility. For example, the linker can be "(G4S)3" (e.g., GGGGSGGGGSGGGGS), "(G4S)4" (e.g., GGGGSGGGGSGGGGSGGGGS), "(G4S)5" (e.g., GGGGSGGGGSGGGGSGGGGSGGGGS), "(G4S)6" (e.g., GGGGSGGGGSGGGGGSGGGGGSGGGGGSGGGGGS), "(G4S)7" (e.g., GGGGSGGGGSGGGGGSGGGGGSGGGGGSGGGGS), etc. For example, using the (G4S)5 linker can increase the flexibility of the IL-12 molecule and improve its expression. In some embodiments, the linker can also be (GS) n (GGS) n (GGGS) n (GGSG) n (GGSGG) n , or (GGGGS) n This may be the case, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Non-limiting examples of linkers known to those skilled in the art that can be used to construct the anti-PD-1-IL-12 fusions described herein can be found in U.S. Patent No. 9,708,412, U.S. Patent Application Publications 2018 / 0134789 and 2020 / 0148771, and PCT International Publication 2019 / 051122 (each of which is incorporated by reference in its entirety).

[0137] In another embodiment, bispecific antibodies are constructed using the "knob-into-hole" method (Ridgway et al, Protein Eng 7:617-621 (1996)). In this method, Ig heavy chains of two different variable domains are reduced to selectively cleave the heavy chain pairing while retaining the heavy-light chain pairing. Two heavy-light chain heterodimers that recognize two different antigens are mixed to facilitate heteroligation pairing mediated through the manipulated "knob-into-hole" of the CH3 domain.

[0138] In another embodiment, a bispecific antibody (e.g., a non-immune-depleted anti-PD1-scFv IL12 fusion protein) can be constructed through the exchange of heavy-light chain dimers from two or more different antibodies to produce a hybrid antibody in which the first heavy-light chain dimer recognizes PD-1 and the second heavy-light chain dimer recognizes a second antigen. The mechanism of heavy-light chain dimerization is analogous to the formation of human IgG4, which also functions as a bispecific molecule. Dimerization of IgG heavy chains is facilitated by intramolecular forces such as the pairing of the CH3 domain of each heavy chain with disulfide crosslinks. The presence of a specific amino acid (R409) in the CH3 domain has been shown to facilitate dimer exchange and the construction of the IgG4 molecule. Heavy chain pairing is also further stabilized by inter-heavy chain disulfide crosslinks in the hinge region of the antibody. Specifically, in IgG4, the hinge region contains the amino acid sequence Cys-Pro-Ser-Cys at amino acids 226-230 (compared to the stable IgG1 hinge region containing the sequence Cys-Pro-Pro-Cys). This difference in the serine sequence at position 229 is related to IgG4's tendency to form intrachain disulfides in the hinge region (Van der Neut Kolfschoten, M. et al, 2007, Science 317:1554-1557 and Labrijn, AF et al, 2011, Journal of Immunol 187:3238-3246).

[0139] Therefore, the bispecific antibodies of the present invention can be prepared through the introduction of the R409 residue in the CH3 domain and the Cys-Pro-Ser-Cys sequence in the hinge region of an antibody that recognizes PD-1 or a second antigen, resulting in the exchange of the heavy-light chain dimers and the production of an antibody molecule having one heavy-light chain dimer that recognizes PD-1 and a second heavy-light chain dimer that recognizes a second antigen, where the second antigen is any antigen disclosed herein. Known IgG4 molecules can also be modified as disclosed herein such that the heavy and light chains recognize PD-1 or a second antigen. The use of this method for constructing the bispecific antibodies of the present invention can be beneficial due to the inherent characteristics of IgG4 molecules, whose Fc regions are different from those of other IgG subtypes, in that their interaction with effector systems of the immune response, such as complement and Fc receptors expressed by certain leukocytes, is insufficient. Due to this particular property, these IgG4-based bispecific antibodies are attractive for therapeutic use where the antibody needs to bind to the target and functionally modify the target-related signaling pathway but does not induce effector activity.

[0140] The bispecific antibodies described herein (e.g., non-immune-depleting anti-PD1-scFvIL12 fusion proteins) can be engineered with a non-depleting heavy chain isotype, such as one of IgG1-LALA or stabilized IgG4 or other non-depleting variants. Without being bound by theory, anti-PD1-scFv IL12 fusion proteins containing the Fc region variants described herein (such as IgG1 LALA mutations or stabilized IgG4) can block PD1+ T cells without depleting them and simultaneously provide scIL12 for stimulating those T cells.

[0141] In some embodiments, mutations are introduced into the constant region of bsAb so as to alter the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of bsAb. For example, the mutation is an LALA mutation in the CH2 domain. In one embodiment, bsAb contains a mutation on one scFv unit of heterodimer bsAb that reduces ADCC activity. In another embodiment, bsAb contains mutations on both strands of heterodimer bsAb that completely eliminate ADCC activity. For example, a mutation introduced into one or both scFv units of bsAb is an LALA mutation in the CH2 domain. These bsAbs with variable ADCC activity can be optimized so that bsAb exhibits maximum selective killing toward cells expressing one antigen recognized by bsAb, but minimum killing toward a second antigen recognized by bsAb.

[0142] The bispecific antibodies disclosed herein can be effectively used to treat chronic infections, diseases, or medical conditions, such as cancer.

[0143] Use of antibodies against PD-1 The antibodies of the present invention, which specifically bind to the PD-1 protein or a fragment thereof, can be administered for the treatment of PD-1-related diseases or disorders. “PD-1-related diseases or disorders” include conditions and / or symptoms associated with a disease characterized by elevated levels of PD-1 and / or activation of PD-1-mediated cellular signaling pathways. Exemplary PD-1-related diseases or disorders include, but are not limited to, diseases in which T cells are suppressed, such as cancer and infectious diseases. In some embodiments, infectious diseases are caused by microorganisms such as DNA viruses, RNA viruses, or reverse transcription viruses. Non-exclusive examples of viruses include adenoviruses, coxsackieviruses, Epstein-Barr viruses, hepatitis A virus, hepatitis B virus, hepatitis C virus, herpes simplex virus type 1, herpes simplex virus type 2, cytomegalovirus, human herpesvirus type 8, HIV, influenza virus, measles virus, mumps virus, human papillomavirus, parainfluenza virus, poliovirus, rabievirus, respiratory syncytial virus, rubella virus, and varicellazoster virus. In some embodiments, the infection is caused by microorganisms such as Gram-positive bacteria, Gram-negative bacteria, protozoa, or fungi.

[0144] Non-specific examples of bacteria that cause disease include Bacillus anthracis, Bacillus cereus, Bartonella henselae, Bartonella quintana, Bordetella pertussis, Borrelia burgdorferi, Borrelia garinii, Borrelia afzelii, Borrelia recurrentis, Brucella abortus, Brucella canis, Brucella melitensis, Brucella suis, and Campylobacter jejuni. Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium tetani, Corynebacterium diphtheria, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Francisella tularensis, Haemophilus influenzae influenza, Helicobacter pylori, Legionella pneumophila, Leptospira interlogansLeptospira interrogans, Leptospira santarosai, Leptospira weilii, Leptospira noguchii, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Mycobacterium ulcerans, Mycoplasma pneumoniae, Neisseria gonorrhoeae, Neisseria meningitides, Pseudomonas aeruginosa, Rickettsia rickettsia, Salmonella typhi, Salmonella typhi typhimurium), Shigella sonnei, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholera, Yersinia pestis, Yersinia enterocolitica Examples include Yersinia enterocolitica and Yersinia pseudotuberculosis.

[0145] Non-specific examples of protozoa that cause disease include Plasmodium falciparum (malaria), Toxoplasma gondii (toxoplasmosis), species of Leishmania (leishmaniasis), Trypanosoma brucei (African sleeping sickness), Trypanosoma cruzi (Chagas disease), and Giardia intestinalis (giardiasis).

[0146] Non-exclusive examples of fungi that cause disease include Candida albicans, Aspergillus fumigatus, Aspergillus flavus, Cryptococcus neoformans, Cryptococcus gattii, Histoplasma capsulatum, Pneumocystis carinii, and Stachybotrys chartarum.

[0147] Antibodies of the present invention, such as bispecific, polyclonal, monoclonal, humanized, and fully human antibodies, can be used as therapeutic agents. Such agents are generally thought to be used to treat or prevent cancer in a subject, to improve vaccine efficiency, or to enhance the innate immune response. Antibody preparations, for example, those having high specificity and high affinity for their target antigen, are administered to a subject and are generally thought to produce effects due to binding to the target. By administering antibodies, the activity of the PD-1 protein can be neutralized, inhibited, or interfered with.

[0148] The antibody of the present invention, which specifically binds to the PD-1 protein or a fragment thereof, can be administered in the form of a pharmaceutical composition for the treatment of cancer. Principles and precautions related to the preparation of therapeutic pharmaceutical compositions containing the antibody, as well as guidance on component selection, are provided, for example, in Remington: The Science And Practice Of Pharmacy 20th ed. (Alfonso R. Gennaro, et al, editors) Mack Pub. Co., Easton, Pa., 2000, Drug Absorption Enhancement: Concepts, Possibilities, Limitations, And Trends, Harwood Academic Publishers, Langhorne, Pa., 1994, and Peptide And Protein Drug Delivery (Advances In Parenteral Sciences, Vol. 4), 1991, M. Dekker, New York.

[0149] The specific dosage and treatment plan for a particular patient depends on various factors, including the specific antibody used, its variant or derivative, the patient's age, weight, general health status, sex, and diet, as well as the timing of administration, excretion frequency, concomitant drug use, and the severity of the specific disease being treated. The determination of such factors by healthcare professionals is within the scope of the skills of those skilled in the art. The dosage is also considered to depend on the individual patient being treated, the route of administration, the type of formulation, the properties of the compound used, the severity of the disease, and the desired effect. The dosage used can be determined by pharmacokinetic principles well known in the art.

[0150] The therapeutically effective dose of the antibody of the present invention can be the amount necessary to achieve the therapeutic objective. As described above, this can be the binding interaction between the antibody and its target antigen, which in certain cases interferes with the function of the target. The amount to be administered further depends on the binding affinity of the antibody to its specific antigen and on the rate at which the administered antibody is depleted from the free volume of the other subject to which it is administered. The dose of the antigen-binding polypeptide described herein administered to a subject (e.g., a patient) is typically 0.1 mg / kg to 100 mg / kg patient body weight, 0.1 mg / kg to 20 mg / kg patient body weight, or 1 mg / kg to 10 mg / kg patient body weight. Human antibodies have a longer half-life in the human body than antibodies from other species due to the immune response to exogenous polypeptides. Therefore, it is often possible to administer human antibodies in lower doses and at lower frequencies. Furthermore, the dose and frequency of administration of the antibodies of this disclosure can be reduced by enhancing antibody uptake and penetration into tissues (e.g., the brain) through modifications such as lipidization. The general range for therapeutically effective administration of the antibody or antibody fragment of the present invention may, as a non-limiting example, be about 0.1 mg / kg body weight to about 50 mg / kg body weight. The general frequency of administration may be, for example, in the range of twice a day to once a week.

[0151] When antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based on the variable region sequence of the antibody, a peptide molecule that retains the ability to bind to the target protein sequence can be designed. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. (See, for example, Marasco et al, Proc. Natl. Acad. Sci. USA, 90:7889-7893 (1993)). The formulation may also contain two or more active compounds necessary for the specific indication to be treated, for example, those having complementary activity that does not adversely affect each other. Alternatively or additionally, the composition may include agents that enhance its function, such as cytotoxic agents, cytokines (e.g., IL-15), chemotherapeutic agents, or growth inhibitors. Such molecules are appropriately present in combination in amounts effective for the intended purpose.

[0152] The active ingredient can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or interfacial polymerization, such as hydroxymethylcellulose or gelatin microcapsules and poly-(methyl methacrylate) microcapsules, in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or in macroemulsions, respectively.

[0153] Preparations used for in vivo administration must be sterile. This can be easily achieved by filtration through a sterile filtration membrane.

[0154] Sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing antibodies, which are in the form of molded articles, e.g., films or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate) or poly(vinyl alcohol)), polylactide (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT (trademark) (injectable microspheres consisting of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyrate. Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid allow for molecular release over more than 100 days, while certain hydrogels release proteins over shorter periods.

[0155] The antibody according to the present invention can be used as a drug for detecting the presence of PD-1 (or its protein fragments) in a sample. For example, the antibody may contain a detectable label. The antibody may be polyclonal or monoclonal. A intact antibody or its fragment (e.g., F ab , scFv, or F (ab)2) can be used. With respect to probes or antibodies, the term “labeled” can include direct labeling of the probe or antibody by binding (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include the detection of a primary antibody using a fluorescently labeled secondary antibody, and the end labeling of a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term “biological sample” can include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within the subject. Therefore, the use of the term “biological sample” can include blood, and fractions or components of blood, including serum, plasma, or lymph. That is, the detection methods of the present invention can be used to detect analytes mRNA, proteins, or genomic DNA in biological samples in vitro and in vivo. For example, in vitro techniques for the detection of analytes mRNA include Northern hybridization and in situ hybridization. In vitro techniques for detecting analyte proteins include enzyme-linked immunosorbent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. In vitro techniques for detecting analyte genomic DNA include Southern hybridization.

[0156] Procedures for performing immunoassays are described, for example, in “ELISA: Theory and Practice: Methods in Molecular Biology”, Vol. 42, JRCrowther (Ed.), Human Press, Totowa, NJ, 1995; “Immunoassay”, E. Diamandis and T. Christophorus, Academic Press, Inc., San Diego, CA, 1996; and “Practice and Theory of Enzyme Immunoassays”, P. Tijssen, Elsevier Science Publishers, Amsterdam, 1985. Furthermore, in vivo techniques for detecting analyte proteins involve introducing labeled anti-analyte protein antibodies into the target. For example, the antibody may be labeled with a radiomarker whose presence and location in the target can be detected by standard imaging techniques.

[0157] Antibodies against the PD-1 protein (or fragments thereof) can be used in methods known in the art related to the localization and / or quantification of the PD-1 protein (e.g., use in measuring levels of PD-1 protein in suitable physiological samples, use in diagnostic methods, use in protein imaging). In certain embodiments, antibodies specific to the PD-1 protein, or its derivatives, fragments, analogs, or homologs, containing an antigen-binding domain derived from the antibody, are used as pharmaceutically active compounds (hereinafter referred to as "therapeutic agents").

[0158] The PD-1 polypeptide can be isolated using the PD-1 protein-specific antibody of the present invention by standard techniques such as immunoaffinity assay, chromatography, or immunoprecipitation. Antibodies against the PD-1 protein (or fragments thereof) can be used diagnostically, for example, to monitor protein levels in tissues as part of a clinical trial procedure, or to determine the effectiveness of a given treatment regimen.

[0159] Detection can be facilitated by binding (i.e., physically linking) antibodies to detectable substances. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Suitable enzyme examples include horseradish peroxidase, alkaline phosphatase, β-galactosidase, or acetylcholinesterase; suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dancylcloride, or phycoerythrin; luminescent materials include luminol; bioluminescent materials include luciferase, luciferin, and aequorin; suitable radioactive materials include 125 I, 131 I, 35 S, 32 P or 3 H can be mentioned.

[0160] The antibodies or drugs of the present invention (also referred to herein as “active compounds”), as well as their derivatives, fragments, analogs, and homologs, can be incorporated into pharmaceutically appropriate compositions. Such compositions typically comprise the antibody or drug and a pharmaceutically acceptable carrier. As used herein, a “pharmaceutically acceptable carrier” can include any solvent, dispersion medium, coating, antimicrobial and antifungal agent, isotonic agent, and absorption retarder, etc., suitable for pharmaceutically appropriate administration. Suitable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference text in the art, incorporated herein by reference. Preferred examples of such carriers or diluents include, but are not limited to, water, physiological saline, Ringer’s solution, dextrose solution, and 5% human serum albumin. Non-aqueous vehicles such as liposomes and fixative oils may also be used. The use of such media and drugs for pharmaceutically active substances is well known in the art. Unless any conventional media or drug is incompatible with the active compound, its use in a composition is intended. Auxiliary active compounds can also be incorporated into the composition.

[0161] The pharmaceutical compositions of the present invention are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral administration, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may contain the following components: sterile diluents such as water for injection, saline solution, fixative oil, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antimicrobial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates; and agents for adjusting tonicity such as sodium chloride or dextrose. pH can be adjusted with an acid or base such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be sealed in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.

[0162] Pharmaceutical compositions suitable for injectable use may include sterile aqueous solutions (if water-soluble) or dispersions, and sterile powders for the immediate preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL® (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). In embodiments, the composition is sterile and fluid enough to allow easy passage through an injection needle. It may be stable under manufacturing and storage conditions and can be preserved against microbial contamination such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Adequate fluidity can be maintained, for example, by the use of coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, and thimerosal. Often, isotonic agents, such as sugars, polyhydric alcohols like mannitol and sorbitol, and sodium chloride, can be included in the composition. Sustained absorption of the injectable composition can be achieved by including absorption-delaying agents in the composition, such as aluminum monostearate and gelatin.

[0163] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent having, as needed, one or a combination of the components listed above, followed by filtration sterilization. For example, a dispersion can be prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion solvent and other necessary components listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation method is vacuum drying and lyophilization, which yield powders of the active component and any additional desired components from the previously sterile filtered solution.

[0164] Oral compositions include an inert diluent or an edible carrier. They can be encapsulated in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of tablets, lozenges, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, in which case the compound in the fluid carrier is applied orally, swirled in the mouth, and either spat out or swallowed. Pharmaceutically compatible binders and / or adjuvant materials may be included as part of the composition. Tablets, pills, capsules, lozenges, etc., may contain any of the following ingredients or compounds of similar properties: binders such as microcrystalline cellulose, tragacanth gum, or gelatin; excipients such as starch or lactose; disintegrants such as alginic acid, Primogel, or corn starch; lubricants such as magnesium stearate or sterol; flow enhancers such as colloidal silicon dioxide; sweeteners such as sucrose or saccharin; or flavorings such as peppermint, methyl salicylate, or orange flavor.

[0165] For administration by inhalation, the compound is delivered in the form of an aerosol spray from a pressurized container or dispenser containing a suitable propellant, such as a gas like carbon dioxide, or a nebulizer.

[0166] Systemic administration may also be by mucosal or percutaneous means. For mucosal or percutaneous administration, a penetrating agent suitable for the barrier to penetration is used in the formulation. Such penetrating agents are generally known in the art and include, for example, for mucosal administration, cleansing agents, bile salts, and fusidic acid derivatives. Mucosal administration can be achieved through the use of nasal sprays or suppositories. For percutaneous administration, the active compound is formulated into ointments, plasters, gels, or creams that are generally known in the art.

[0167] The compounds can also be prepared in the form of suppositories (e.g., those having a conventional suppository base such as cocoa butter and other glycerides) or retained enemas for rectal delivery.

[0168] In one embodiment, the active compound is prepared on a carrier that will protect the compound from rapid elimination from the body, such as a controlled-release formulation, which includes implants and microencapsulation delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are apparent to those skilled in the art. The materials are also commercially available from Alza Corporation and Nova Pharmaceuticals, Inc. Liposome suspensions (containing liposomes targeting cells infected with monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0169] For ease of administration and uniformity of dosage, oral or parenteral compositions can be formulated in dose unit forms. As used herein, dose unit forms refer to physically distinct units suitable as a single dose for the subject being treated, each unit containing a predetermined amount of the active compound calculated to produce the desired therapeutic effect in conjunction with the required pharmaceutical carrier. The specifications of the dose unit forms of the present invention are determined and directly depend on the specific characteristics of the active compound, the particular therapeutic effect to be achieved, and the limitations inherent in the techniques for formulating such active compounds for the treatment of an individual.

[0170] Pharmaceutical compositions may be included in containers, packs, or dispensers along with administration instructions.

[0171] Treatment method As used herein, the terms “to treat” or “treatment” refer to both therapeutic actions and preventive or protective measures aimed at preventing or slowing (mitigating) undesirable physiological changes or impairments, such as the progression of cancer. Beneficial or desirable clinical outcomes include, but are not limited to, relief of symptoms, reduction of disease severity, stable (i.e., non-worsening) state of disease, delay or stabilization of disease progression, improvement or relief of the condition, and remission (partial or total), whether detectable or not. “Treatment” means extending survival time compared to the survival rate expected without treatment. Those who require treatment include those who already have a disease or impairment, as well as those who are susceptible to a disease or impairment, or who need to prevent a disease or impairment.

[0172] The present invention provides both prophylactic and therapeutic methods for treating subjects at risk (or susceptible) of cancer or other cell proliferation-related diseases or disorders. Such diseases or disorders include, but are not limited to, diseases or disorders associated with the abnormal expression of PD-1. For example, the method is used to treat, prevent, or alleviate the signs of cancer. In one embodiment, the method is used to treat, prevent, or alleviate the signs of solid tumors. Non-limiting examples of cancers that can be treated with the compositions described herein include lung cancer, ovarian cancer, prostate cancer, colon cancer, cervical cancer, brain cancer, skin cancer, liver cancer, pancreatic cancer, or stomach cancer. In addition, the methods of the present invention can be used to treat hematological cancers such as leukemia and lymphoma. Alternatively, the methods can be used to treat, prevent, or alleviate the symptoms of metastatic cancer. For example, cancers that can be treated, prevented, or alleviated include B-cell chronic lymphocytic leukemia (CLL), non-small cell lung cancer, melanoma, ovarian cancer, lymphoma, or renal cell carcinoma. Cancers that can be treated, prevented, or have their symptoms mitigated include solid tumors and WBCs in filtrate with high mutational burdens. Cancers that can be treated, prevented, or have their symptoms mitigated include cancers with regulated PD-1 / PD-L1 axis signaling, such as (but not limited to) breast cancer, lung cancer (e.g., non-small cell lung cancer or lung adenocarcinoma), gastric cancer, colorectal cancer, bladder cancer, pancreatic cancer, prostate cancer, esophageal squamous cell carcinoma, nasopharyngeal cancer, and liquid tumors with active PD1 / PD-L1 axis (diffuse large B-cell lymphoma (DLBCL) and B-cell chronic lymphocytic leukemia (B-CLL)) (see, for example, Han et al., PD-1 / PD-L1 pathway: current researches in cancer, Am J Cancer Res 2020;10(3):727-742).

[0173] Accordingly, in one embodiment, the present invention provides a method for preventing, treating, or alleviating symptomatic cancer or cell proliferation disorder or impairment in a patient by administering the patient a monoclonal antibody, scFv antibody, or bispecific antibody of the present invention. For example, an anti-PD-1 antibody can be administered in a therapeutically effective dose.

[0174] Individuals at risk of cancer or cell proliferation-related disorders or impairments may include patients with a family history of cancer or those exposed to drugs known or suspected to cause cancer. Preventive medication may be administered before the onset of cancerous signs, either to prevent the disease or, alternatively, to delay its progression.

[0175] In another embodiment, tumor cell growth is inhibited by contacting cells with the anti-PD-1 antibody of the present invention. The cells can be any cells that express PD-1.

[0176] The present invention further provides both prophylactic and therapeutic methods for treating subjects at risk (or susceptible) to chronic or acute viral, bacterial, or parasitic infections. The present invention also provides therapeutic methods for both prophylactic and therapeutic methods for treating subjects at risk of developing T-cell depletion-related diseases, disorders, or symptoms. The present invention also provides therapeutic methods for both prophylactic and therapeutic methods for treating subjects at risk of developing T-cell depletion-related diseases, disorders, or symptoms. Such diseases or disorders include, but are not limited to, HIV, AIDS, and chronic or acute bacterial, viral, or parasitic infections. Other such chronic infections include, for example, those caused by hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus 1 (HSV-1), H. pylori, or Toxoplasma gondii. Other acute infections include, for example, those caused by microorganisms such as Gram-positive bacteria, Gram-negative bacteria, protozoa, or fungi as described herein.

[0177] Methods for increasing or enhancing an immune response to an antigen are also included in the present invention. The immune response is increased or enhanced by administering to a subject a monoclonal antibody, scFv antibody, or bispecific antibody of the present invention. The immune response is enhanced, for example, by enhancing antigen-specific T effector function. The antigen is a virus (e.g., HIV), a bacterium, a parasite, or a tumor antigen. The immune response is a spontaneous immune response. A spontaneous immune response means an immune response that is a result of an infection. The infection is a chronic infection. An increase or enhancement of the immune response to an antigen can be measured by many methods known in the art. For example, the immune response can be measured by measuring any one of the following: T cell activity, T cell proliferation, T cell activation, effector cytokine production, and T cell transcription profile. Alternatively, the immune response is a response induced by vaccination.

[0178] Therefore, in another embodiment, the present invention provides a method for increasing vaccine efficiency by administering the monoclonal antibody or scFv antibody and vaccine of the present invention to a subject. The antibody and vaccine are administered sequentially or simultaneously. The vaccine is an oncological vaccine, a bacterial vaccine, or a viral vaccine.

[0179] Combination method The compositions of the present invention described herein can be administered in combination with chemotherapeutic agents. Chemotherapy agents that may be administered with the compositions of this disclosure include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin), antiestrogens (e.g., tamoxifen), antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, phloxuridine, interferon alpha-2b, glutamic acid, pricamycin, mercaptopurine, and 6-thioguanine), cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cisplatin, Examples include vincristine sulfate and other steroids, hormones (e.g., medroxyprogesterone, estramustine sodium phosphate, ethinylestradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianicene, and testotrachtone), nitrogen mustard derivatives (e.g., mephalen, colambucil, mechloretamine (nitrogen mustard), and thiotepa), steroids and combinations (e.g., betamethasone sodium phosphate), and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).

[0180] In additional embodiments, the compositions of the present invention described herein may be administered in combination with cytokines. Cytokines that may be administered together with the compositions include, but are not limited to, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-13, IL-15, anti-CD40, CD40L, and TNF-α.

[0181] In additional embodiments, the compositions described herein may be administered in combination with other therapeutic or prophylactic regimens, such as radiotherapy.

[0182] In some embodiments, the compositions described herein can be administered in combination with other immunotherapeutic agents. Non-limiting examples of immunotherapeutic agents include simtuzumab, abagovomab, adecatumumab, afutuzumab, alemtuzumab, altumomab, amatuximab, anatumomab, arcitumomab, bavituximab, and bectumomab. b) bevacizumab, bivatuzumab, blinatumomab, brentuximab, cantuzumab, catumaxomab, cetuximab, citatuzumab, cixutumumab, clivatuzumab, conatumumab, daratumumab daratumumab, drozitumab, duligotumab, dusigitumab, detumomab, dacetuzumab, dalotuzumab, eclomeximab, elotuzumab, ensituximab, ertumaxomab, etaraci zumab), farletuzumab, ficlatuzumab, figitumumab, flanvotumab, futuximab, ganitumab, gemtuzumab, girentuximab, glembatumumab, ibritumomab, igovomab,imgatuzumab, indatuximab, inotuzumab, intetumumab, ipilimumab, iratumumab, labetuzumab, lexatumumab, lintuzumab, lorvotuzumab, lucatumumab, mapatumumab, matsuzumab (matuzumab), milatuzumab, minretumomab, mitumomab, moxetumomab, narnatumab, naptumomab, necitumumab, nimotuzumab, nofetumomab, ocaratuzumab, ofatumumab, olaratumab b) Onartuzumab, oporuzumab, oregobomab, panitumumab, parsatuzumab, patritumab, pemtumomab, pertuzumab, pintumomab, pritumumab, racotumomab, radretumab, rilotumumab lotumumab, rituximab, robatumumab, satumomab, sibrotuzumab, siltuximab, solitomab, tacatuzumab, taplitumomab, tenatumomab, teprotumumab, tigatuzumab, tositumomab,Examples include trastuzumab, tucotuzumab, ublituximab, veltuzumab, vorsetuzumab, votumumab, zalutumumab, CC49, and 3F8.

[0183] The present invention provides a method for treating a patient's cancer by administering two antibodies that bind to the same epitope of the PD-1 protein, or alternatively, to two different epitopes of the PD-1 protein. Alternatively, cancer can be treated by administering a first antibody that binds to PD-1 and a second antibody that binds to a protein other than PD-1. In other embodiments, cancer can be treated by administering a bispecific antibody that binds to both PD-1 and a protein other than PD-1. Examples of other proteins other than PD-1 include, but are not limited to, IL-12, IL-12R, IL-2, IL-2R, IL-15, IL-15R, IL-7, IL-7R, IL-21, or IL-21R. For example, the other protein other than PD-1 may be a tumor-associated antigen, or it may be a cytokine.

[0184] In some embodiments, the present invention provides administering an anti-PD-1 antibody alone or in combination with additional antibodies that recognize another protein other than PD-1, along with cells capable of achieving or enhancing an immune response. For example, these cells may be peripheral blood mononuclear cells (PBMCs), or any cell type found in PBMCs, such as cytotoxic T cells, macrophages, and natural killer (NK) cells.

[0185] In addition, the present invention provides the administration of an antibody that binds to the PD-1 protein and other therapeutic agents, including antineoplastic agents such as small molecules, growth factors, cytokines, or biomolecules such as peptides, peptide mimes, peptoids, polynucleotides, lipid-derived mediators, small bioamines, hormones, neuropeptides, and proteases. Small molecules include, but are not limited to, inorganic and small organic molecules. Suitable growth factors or cytokines include IL-2, GM-CSF, IL-12, and TNF-α. Small molecule libraries are known in the art. (See Lam, Anticancer Drug Des., 12:145, 1997.)

[0186] Chimeric antigen receptor (CAR) T cell therapy Cell therapies, such as chimeric antigen receptor (CAR) T-cell therapy, are also provided herein. CAR T-cell therapy redirects a patient's T cells to kill tumor cells, for example, by exogenous expression of CARs on T cells. CARs can be transmembrane fusion proteins that link the antigen-recognition domain of an antibody to the intracellular signaling domains of T cell receptors and co-receptors. For example, suitable cells capable of secreting (or, alternatively, engineered to express the anti-PD-1 antibody described herein that is secreted) can be used. The secreted anti-PD-1 "payload" can be, for example, a minibody, ScFv, IgG molecule, bispecific fusion molecule, and other antibody fragments described herein.

[0187] Solid tumors present unique challenges for CAR-T therapy. Several barriers to the efficacy of CAR-T in solid tumors include heterogeneous antigen expression, insufficient tissue homing, activation, persistence, and an immunosuppressive tumor microenvironment. Unlike hematological malignancies, tumor-associated target proteins are overexpressed in both tumor and healthy tissue, resulting in on-target / off-tumor T cell killing in healthy tissue. Furthermore, immunosuppression in the tumor microenvironment (TME) limits the activation of CAR-T cells that kill tumors. Following such contact or manipulation, cells can be introduced into cancer patients requiring treatment. Cancer patients may have any of the types of cancer disclosed herein. Cells (e.g., T cells) may be, but are not limited to, tumor-infiltrating T lymphocytes, CD4+ T cells, CD8+ T cells, or combinations thereof.

[0188] Examples of CARs and CAR factories useful in embodiments of the present invention include, for example, those disclosed in PCT / US2015 / 067225 and PCT / US2019 / 022272, each of which is incorporated herein by reference in whole. For example, CAR-T cells can be generated according to methods known in the art using lentiviral systems (via transduction), retroviral systems (via transfection (electroporation)), and transposon systems (via PiggyBac). Useful promoters for payloads that can be used to generate CAR-T cells include, for example, constitutive promoters (promoters are the same as in the case of CAR-T, such as EF1a, then IRES or 2A), inducible promoters (promoters are different from the CAR-T promoters, such as NFAT, IL-2 prom), and genetically engineered promoters (such as cytokine PD-1 locus "knock-in" and / or promoters under the control of an endogenous promoter). In one embodiment, the PD-1 antibody or PD-1 fusion protein discussed herein can be used in the construction of a multispecific antibody or as a payload for CAR-T cells. For example, in one embodiment, the anti-PD-1 antibody or PD-1 fusion protein discussed herein can be used for targeting of CARS (i.e., as a target-directing moiety). In one embodiment, the anti-PD-1 antibody or PD-1 fusion protein discussed herein can be used as a payload secreted by CAR-T cells. In another embodiment, the anti-PD-1 antibody or PD-1 fusion protein discussed herein can be used as a target-directing moiety, and different PD-1 antibodies targeting different epitopes can be used as payloads. In yet another embodiment, the payload can be an immunomodulatory antibody payload. In some embodiments, the PD-1 antibody or PD-1 fusion protein described herein for use in a CAR-T composition is not a high-affinity PD-1 antibody (e.g., so that the antibody does not strongly bind to its PD-1 target).For example, the PD-1 antibody or PD-1 fusion protein described herein can be used as a payload secreted by CAR-T cells in the form of two target-directed moieties (e.g., tumor-associated surface antigens) selected for a specific cancer (i.e., MSLN and MUC1 in the case of ovarian cancer). Non-limiting examples of tumor-associated surface antigens include ErbB2 (HER2 / neu), oncoemulsifying antigen (CEA), epithelial cell adhesion molecule (EpCAM), epidermal growth factor receptor (EGFR), MUC1, MSLN, CD19, CD20, CD30, CD40, CD22, RAGE-1, and MN-CA. Examples include IX, RET1, RET2(AS), prostate-specific antigen (PSA), TAG-72, PAP, p53, Ras, prostain, PSMA, survivor, 9D7, prostate cancer tumor antigen-1 (PCTA-1), GAGE, MAGE, mesoserin, β-catenin, TGF-βRII, BRCA1 / 2, SAP-1, HPV-E6, and HPV-E7 (see also PCT / US2015 / 067225 and PCT / US2019 / 022272, which incorporate all further tumor-associated surface antigens by reference). Exemplary armored CAR-T cells are listed in the table below. TIFF0007911826000040.tif132154

[0189] In one embodiment, a bispecific (or bitarget) CAR-T is provided. In another embodiment, the CAR-T is an engineered cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises extracellular ligand-binding domains specific to a first antigen and a second antigen on the surface of a cancer cell, wherein the first antigen comprises CXCR4 and the second antigen comprises CLDN4, or the first antigen comprises CAIX and the second antigen comprises CD70, or the first antigen comprises MUC1 and the second antigen comprises Msln. For example, an anti-PD-1 antibody or PD-1 fusion protein as described herein (such as the anti-PD1-scIL12 fusion as described herein) can be used as a payload for the CAR-T described herein. In one embodiment, a CXCR4 / CLDN4 bitargeted CAR-T having an anti-PD1-scIL12 fusion payload can be used for breast cancer. In one embodiment, a CAIX / CD70 dual-targeted CAR-T with an anti-PD1-scIL12 fusion payload can be used for clear cell renal cell carcinoma (ccRCC). In another embodiment, a MUC1 / Msln dual-targeted CAR-T with an anti-PD1-scIL12 fusion payload can be used for ovarian cancer.

[0190] Diagnostic assay Anti-PD-1 antibodies can be used, for example, as part of a clinical trial procedure to determine the effectiveness of a given therapeutic and / or prophylactic regimen, or diagnostically to monitor the development or progression of cancer.

[0191] In some embodiments, for diagnostic purposes, the anti-PD-1 antibody of the present invention is linked to a detectable portion to provide a method for detecting cancer cells in subjects who are at risk of cancer or who have cancer.

[0192] The detectable portion can be conjugated directly to the antibody or fragment, or indirectly, for example, by using a fluorescent secondary antibody. Direct conjugation can be achieved, for example, by standard chemical binding of a fluorophore to the antibody or antibody fragment, or through genetic engineering. Chimeras, or fusion proteins containing an antibody or antibody fragment conjugated to a fluorescent or bioluminescent protein, can be constructed. For example, Casadei et al (Proc Natl Acad Sci US A.1990 Mar;87(6):2047-51) describe a method for constructing a vector construct capable of expressing an aequorin and antibody fusion protein gene in mammalian cells.

[0193] As used herein, the term “labeled” with respect to a probe or antibody may include direct labeling of the probe or antibody by binding (i.e., physically linking) a detectable substance to the probe or antibody, and indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include the detection of a primary antibody using a fluorescently labeled secondary antibody, and the terminal labeling of a DNA probe with biotin so that it can be detected with fluorescently labeled streptavidin. The term “biological sample” is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and biological fluids present within a subject. That is, by using the detection methods of the present invention, cells expressing PD-1 can be detected in vitro and in vivo in a biological sample. For example, in vitro techniques for the detection of PD-1 include enzyme-linked immunosolvent assay (ELISA), Western blotting, immunoprecipitation, and immunofluorescence. Furthermore, an in vivo technique for the detection of PD-1 is the introduction of a labeled anti-PD-1 antibody into the subject. For example, antibodies can be labeled with radioactive markers whose presence and location in a target can be detected by standard imaging techniques.

[0194] In the case of a “targeted” conjugate, i.e., a conjugate containing a target-directed moiety—a molecule or feature designed to localize the conjugate within a subject or animal at a specific site(s)—localization can refer to a state where an equilibrium is essentially achieved between the bound “localized” entities and the unbound “free” entities within the subject. The rate at which such equilibrium is achieved depends on the route of administration. For example, a conjugate administered by intravenous injection may achieve localization within minutes of injection. On the other hand, a conjugate administered orally may take several hours to achieve localization. Alternatively, localization can simply refer to the location of the entities within the subject or animal over a selected period after administration. Another example is when localization is achieved when the moiety becomes distributed after administration.

[0195] It is understood that a reasonable estimate of the time required to achieve localization can be made by those skilled in the art. Furthermore, the state of localization as a function of time can be tracked by imaging a detectable portion (e.g., a light-emitting conjugate) according to the method of the present invention, such as with a photodetector device. The “photodetector device” used should be capable of imaging faint light from within a mammal over a reasonable time and should have sufficient sensitivity to construct an image using the signal from such a device.

[0196] If it is possible to use an extremely bright photogenerating portion and / or detect a photogenerating fusion protein localized near the surface of the object or animal being imaged, then "night vision" goggles or standard high-sensitivity video cameras such as Silicon Intensified Tube (SIT) cameras (e.g., from Hammamatsu Photonic Systems, Bridgewater, NJ) can be used. However, more typically, a more sensitive photodetection method is required.

[0197] At extremely low light levels, the photon flux per unit area becomes so low that the imaged scene no longer appears continuous. Instead, it is represented by individual photons distinct from one another, both in time and space. When viewed on a monitor, such an image appears as a series of shimmering points of light, each representing a single detected photon. By accumulating these detected photons over time in a digital image processor, an image can be acquired and constructed. In contrast to conventional cameras where an intensity value is assigned to the signal at each image point, the amplitude of the signal is irrelevant in photon counting imaging. The goal is simply to detect the presence of a signal (photon) and count the occurrence of the signal relative to its location over time.

[0198] At least two types of photodetector devices, described below, can detect individual photons and generate signals that can be analyzed by an image processor. Noise-reducing photodetector devices achieve sensitivity not by amplifying the photon signal, but by reducing the background noise of the photon detector. Noise is reduced primarily by cooling the detector array. Devices include charge-coupled device (CCD) cameras called "back-thinning" cooled CCD cameras. In more sensitive instruments, cooling is achieved using liquid nitrogen, for example, to raise the temperature of the CCD array to about -120°C. "Back-thinning" refers to an ultra-thin backplate that reduces the path length that photons travel until detected, thereby increasing quantum efficiency. A particularly sensitive back-thinning cryogenic CCD camera is the Series 200 camera, "TECH 512," available from Photometries, Ltd. (Tucson, Arizona).

[0199] A “photon amplification device” amplifies photons before they strike the detection screen. This class includes CCD cameras equipped with enhancement tubes, such as microchannel enhancement tubes. Microchannel enhancement tubes typically contain a metal array of channels perpendicular to and extending parallel to the camera’s detection screen. The microchannel array is placed between the sample, object, or animal being imaged and the camera. Most photons entering the array’s channels contact the sides of the channels before exiting. A voltage applied across the array results in the emission of many electrons from each photon collision. Electrons from such collisions exit their channels of origin in a “shotgun” pattern and are detected by the camera.

[0200] By arranging enhanced microchannel arrays in series, even higher sensitivity can be achieved, resulting in electrons generated in the first stage subsequently yielding an amplified signal in the second stage. However, this increase in sensitivity is achieved at the expense of spatial resolution, which decreases with each additional stage of amplification. An exemplary microchannel enhancement tube-based single-photon detection device is the C2400 series, available from Hamamatsu.

[0201] An image processor processes signals generated by a photodetector device that counts photons to construct an image that can be displayed on a monitor or printed on a video printer. Such image processors are typically sold as part of a system that includes the high-sensitivity photon counting camera mentioned above, and are therefore available from the same source. Image processors are usually connected to personal computers such as IBM-compatible PCs or Apple Macintosh (Apple Computer, Cupertino, Calif), which may or may not be included as part of a purchased imaging system. Once the images are in the form of digital files, they can be manipulated and printed by various image processing programs ("ADOBE PHOTOSHOP", Adobe Systems, Mt.View, Calif, etc.).

[0202] In one embodiment, the biological sample contains protein molecules from the subject of test. One exemplary biological sample is a peripheral blood leukocyte sample isolated from the subject by conventional means.

[0203] The present invention also encompasses kits for detecting the presence of PD-1 or PD-1-expressing cells in a biological sample. For example, a kit may include a labeled compound or agent (e.g., anti-PD-1 scFv or monoclonal antibody) capable of detecting cancer or tumor cells in a biological sample, means for determining the amount of PD-1 in the sample, and means for comparing the amount of PD-1 in the sample to a standard. In some embodiments, the standard is a non-cancer cell or its cell extract. The compound or agent can be packaged in a suitable container. The kit may further include instructions for detecting cancer in a sample using the kit.

[0204] Other Embodiments Although the present invention has been described in detail, the foregoing description is intended to illustrate, and not to limit, the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

[0205] The present invention will be further described by the following embodiments, but these will not limit the scope of the invention as described in the claims. [Examples]

[0206] Examples are provided below to facilitate a more complete understanding of the present invention. The following examples illustrate exemplary modes of constructing and carrying out the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, and similar results can be obtained using alternative methods; therefore, these examples are for illustrative purposes only.

[0207] Example 1 - PMPL Panning The PD-1 antibodies of the present invention (e.g., P4-B3 and P4-B7) were discovered via PMPL panning. Briefly, PD-1 was expressed by genetically fusing it to a C-terminal C9 tag (TETSQVAPA). Transient transfection of Expi293 cells was performed, followed by lysis. The lysate was clarified, and the PD-1 protein was captured using magnetic beads conjugated with 1D4 (anti-C9 tag). The beads were then dialyzed in a lipid solution to form a lipid bilayer around the beads, simulating a cell membrane and enhancing protein stability. These beads were then used for panning.

[0208] Example 2 - Mini-body coupling curve Minibody binding curves were created using transfected cells (see Figure 4). P4-B3 minibody binding curves were constructed using cells transfected with human or cynomolgus monkey PD1. Human variants were transfected twice, while negative controls and cynomolgus monkeys were transfected once. Curves were constructed using Expi293 cells 48 hours after transfection. Human variant curves were normalized based on expression levels using commercially available antibody staining, but cynomolgus monkey variants were not. Normalization was omitted for cynomolgus monkey variants because the commercially available antibody used has not been reported to bind to cynomolgus monkey PD-1.

[0209] Octet binding curves of different antibody formats in Example 3-P4-B3 The streptavidin sensor was loaded with 3 ug / ml biotinylated PD-1. A maximum concentration of 50 nM was set for all P4-B3 formats, and 3 / 4 serial dilutions were performed. Kinetic calculations were performed using Octet Red software and are shown in Figure 5. According to the EMEA evaluation report (EMEA / H / C / 003820 / 0000), the reported KD of Pembro was 2.9E-11M, which is comparable to results obtained from experiments for Pembro.

[0210] Example 4 - PD-L1 competitive assay SA sensors were loaded with 3 ug / ml PD-1 and incubated with various concentrations (50-0 nM) of Pembro (IgG) or P4-B3 (IgG or mini-bodies), followed by 5 ug / ml PD-L1. In Figure 6, the red curve represents the maximum amount of PD-L1 bound to the PD-1 functionalized sensor without antibody loading. As shown in Figure 6, the P4-B3 antibody is slightly shifted by the addition of PD-L1, but appears to block a significant portion of PD-L1 binding. The curve does not include the antibody loading step, but instead shows the PD-L1 binding step. The original antibody binding step is shown in detail in Figure 5.

[0211] Example 5 - IgG ELISA ELISA plates were coated with 1 ug / ml soluble PD1 at 37°C for 2 hours. The plates were then washed and blocked with 2% BSA / PBS at 37°C for 1 hour. The blocking solution was removed, and 3-fold serial dilutions of antibody, starting at 6 ug / ml, were added to each well (100 ul) of 2% milk-PBST. The plates were then incubated at room temperature with gentle shaking, washed 6 times with PBS-T, and secondary anti-human Fc-HRP (1:150k, Bethyl) was added. The plates were incubated again at room temperature for 1 hour with gentle shaking, and then washed 6 times with PBS-T. TMB substrate was added, and the plates were incubated at 30°C for 10 minutes to accelerate the HRP reaction. The signal was then quenched with TMB stop solution and read at 450 nm. See the graph in the upper part of Figure 7.

[0212] The same protocol described herein was applied to the lower graph in Figure 7, except that the plates were coated with 3-fold serial dilutions of the antigen starting at 6 ug / ml. Next, the antibody was added to all wells at a constant concentration of 1 ug / ml.

[0213] Example 6 - PD1 FACS using anti-PD1 IgG T cells were cultured for 48 hours in complete DMEM (293FT medium) with or without 5 ug / ml PHA. Pembrolizumab and P4-B3 antibody were detected using Biolegend's anti-human IgG Fc APC (catalog number 409306). As shown in Figure 8, the P4-B3 PD-1 antibody showed a similar binding pattern to pembrolizumab and the control anti-PD1 antibody.

[0214] Example 7 - PD1-PDL1 Bioassay The Promega PD1-PDL1 bioassay (J1250) was performed using the PD-1 antibody (P4-B3) of the present invention, as well as commercially available antibodies pembrolizumab and nivolumab (Figure 9).

[0215] The constructs tested were as follows: (a) IgG1: WT monomer, (b) LALA: monomer, hexamer, and mutant 3, (c) sIgG4: monomer and hexamer, control: mAb11 LALA monomer.

[0216] All samples, except for mAb11, were tested three times.

[0217] Lead factor: RLU stimulation / RLU non-stimulation (no Ab) (Figure 10).

[0218] Example 8 - Anti-PD-1 cross-reactivity Many anti-PD-1 antibodies do not cross-react with mouse and human PD-1 (Pembro and Nivo are not cross-reactive). See Fessas, Petros et al. “A molecular and preclinical comparison of the PD-1-targeted T-cell checkpoint inhibitors nivolumab and pembrolizumab” Seminars in oncology vol.44,2(2017):136-140. See also Tan JBL, Chen C, Chen K, “Preclinical Characterization of GLS-010(AB122): A Fully Human Clinical-Stage anti-PD-1 Antibody.” Poster, Arcus Biosciences, and Burova, Elena et al. “Characterization of the Anti-PD-1 Antibody REGN2810 and Its Antitumor Activity in HumanPD-1Knock-In Mice” Large Molecule Therapeutics, 2017. Furthermore, see Li, Dong et al. “Epitope mapping reveals the binding mechanism of a functional antibody cross-reactive to both human and murine programmed death 1” mAbs vol.9,4(2017):628-637.

[0219] The antibody of the present invention (e.g., P4-B3) is cross-reactive.

[0220] Expi293 cells transiently transfected with 3E5 were suspended in 100 μl of MACS buffer and added to each well. Next, 50 μl of each antibody dilution was mixed with the cells, and the plate was incubated at 4°C for 30 minutes. After incubation, the plate was washed twice with MACS buffer and incubated with 1 μl / well of anti-human Fc-APC (Biolegend #409306). The plate was incubated at 4°C for 25 minutes and washed three times before sample analysis.

[0221] As shown in Figure 16, P4-B3 exhibits moderate affinity for mouse PD-1, setting it apart from Pembro and Nivo.

[0222] Example 9 - Affinity Maturation Yeast library generation First, P4-B3 scFv is cut and pasted from the pFarber vector (phage display) to the pCTCON2 vector (yeast display). Next, a library is prepared according to two methods practiced in the art: (1) bacterial cleavage / ligation and transformation of yeast with untreated plasmid, and (2) homologous recombination in yeast with linearized vector + PCR fragments. The cleavage / ligation method (method (1) as described herein) results in a very small library size, low efficiency of ligation / bacterial transformation, and very low efficiency of transformation into yeast. However, homologous recombination (method (2) as described herein) yields approximately 10 6 ~10 7 A library of individual mutants was obtained.

[0223] Error-prone mutation introduction The Agilent GeneMorph II Random Mutagenesis Kit was used. The kit is designed to vary the mutagenesis rate based on the original template DNA. TIFF0007911826000041.tif41128

[0224] External primer (overlaps with the pCTCON2 vector by approximately 50-60 bp): (a) pCTCON2-HR-Fwd: GAGGAGGCTCTGGTGGAGGCGGTAGCGGAGGCGGAGGGTCGGCTAGCTGGGCCCAGCCGG (b) pCTCON2-HR-Rev: ACACTGTTGTTATCAGATCTCGAGCTATTACAAGTCCTCTTCAGAAAATAAGCTTTTGTTC

[0225] Internal primer (overlapped with heavy or light chain fragment by 45 bp): (a) G4S-Fwd: GGTGGCGGCGGTTCCGGAGGTGGTGGTTCTGGCGGTGGTGGCAGC (b) G4S-Rev: GCTGCCACCACCGCCAGAACCACCACCTCCGGAACCGCCGCCACC

[0226] Error-prone mutation induction strategy (a) PCR the entire scFv fragment using an external primer. This strategy allows for mutations in the linker region (which is undesirable). (b) PCR the heavy and light chains using the external primer and G4S primer separately, and use the G4S linker as the third overlapping point for three-piece homologous recombination. This strategy protects the linker from mutations, but requires three-piece homologous recombination and may be less efficient than the two-piece method.

[0227] Both methods were used with varying amounts of template DNA. The template for whole-scFv PCR was the pCTCON4 vector from which P4-B3 was cloned (approximately 1 / 10 of the template was the target sequence). The templates for separate heavy-chain / light-chain PCRs were the P4-B3 PCR fragments (approximately 1 / 2 of the template was the target sequence).

[0228] Templates used: For whole scFv PCR: 4ug, 2ug, 1ug, 0.5ug; for separate PCR of heavy / light chains: 450ng, 50ng (two reactions each).

[0229] *To increase DNA yield, PCR was performed for 33 cycles.

[0230] Library generation The protocol described in Benatuil et al, “An improved yeast transformation method for the generation of very large human antibody libraries,” Protein Eng Des Sel. 2010 Apr;23(4):155-9 was followed.

[0231] General protocol: EBY100 yeast cells were inoculated into 100 ml of YPD medium at OD600 = 0.3 and grown at 30C for approximately 5-6 hours until OD600 = 1.6. Cells were harvested by centrifugation, washed twice with 50 ml of chilled ddH2O, and once with 50 ml of chilled electroporation buffer (1 M sorbitol / 1 mM CaCl2). Next, the cells were conditioned by shaking in 20 ml of 0.1 M LiAc / 10 mM DTT at 30C for 30 minutes. Cells were harvested and washed with 50 ml of chilled electroporation buffer. After pelleting, the cells were resuspended in a final volume of 1 ml, which is suitable for two transformations.

[0232] Total scFv PCR yielded 4.8 ug of insert, which was mixed with 4 ug of linearized vector (NcoI / BamHI).

[0233] H / L chain PCR yielded 4.1 ug of HC and 3.5 ug of LC, which were then reduced to 3 ug of linearized vector (NcoI / BamHI).

[0234] The vector and the target fragment were mixed, precipitated with EtOH, and reduced in volume (less than 50 μl). Using Biorad, 400 μl of electrocompetent yeast cells were transformed at 2.5 kV, 25 μF. Cells were harvested in 1:1 YPD:1 M sorbitol, spun down for 1 hour, washed with SDCAA, and resuspended in 250 ml SDCAA for each transformation.

[0235] Potency: (a) entire scFv library: approximately 5.2E6 members, (b) individual H / L chains: approximately 5.8E6 members.

[0236] After two passages, colonies were plated out and subjected to sequencing (96 colonies per library). At least one mutation was found in 56 / 96 (58.33%) of the total scFv library. At least one mutation was found in 42 / 96 (43.75%) of the separate H / L chain libraries.

[0237] Effective library size: (a) Total scFv library: approximately 2.9E6 members, (b) Separate H / L chain: approximately 2.1E6 members.

[0238] Library sorting strategy Two staining methods were used: (1) standard staining to explore improved binding (shifted to the upper right quadrant during FACS analysis), and (2) a dynamic strategy to look for improved off-velocity.

[0239] In dynamic staining, the library is stained with labeled antigen at 10 times the concentration of Kd, washed, and then incubated with unlabeled antigen at 100 times the concentration of Kd in increased volume. Incubating a large volume of sample prevents dissociated antigens from rebinding with yeast. Furthermore, adding a high concentration of unlabeled antigen causes the deactivated labeled antigens to be replaced by the unlabeled antigens.

[0240] In the case of dynamic staining, the staining time depends on the time constant (τ). τ=(k on [Ag]0+k off )-1

[0241] In the formula, kon = on rate (M^-1s^-1), koff = off rate (s^-1), and [Ag]0 = initial antigen concentration (M).

[0242] Octet measurements show that for P4-B3 scfv, kon=6.85E4, koff=6.45E-5, and Kd=9.4E10.

[0243] Equilibrium bonding at 3τ is 95%, and at 5τ, it is 99%.

[0244] The staining protocol was carried out according to Cherf and Cochran, “Applications of Yeast Surface Display for Protein Engineering,” Methods Mol Biol. 2015;1319:155-75.

[0245] In short, high-affinity protein variants were isolated from a yeast display library by FACS. Following transformation and induction of surface expression of yeast cells by the gene library, two main strategies were used to differentially label the displayed library before screening: 1) In the equilibrium binding strategy, the library was labeled with the expected K in the highest-affinity variant. D Incubate at a ligand concentration 5 to 10 times higher than the value, resulting in near saturation in tightly binding mutants and partial labeling in mutants with weak equilibrium affinity. 2) In the dynamic binding strategy, incubate the library with the ligand as described in the equilibrium binding strategy, but remove the unbound ligand by washing, then incubate the library in 100 times excess of the unlabeled ligand, or incubate in a sufficiently excess volume of buffer to prevent rebinding of the dissociated ligand.

[0246] In this second incubation step, rebinding of dissociated labeled ligands is prevented by an excess of unlabeled ligand or a large excess incubation volume. Thus, proteins are distinguished based on their dissociation rate constant (koff), with the variant having the slowest koff retaining the largest proportion of pre-bound labeled ligand. Addition of fluorescently labeled anti-epitope tag antibodies allows for normalization of yeast surface expression levels by binding, enabling isolation of the most affinity variants by FACS. The pool of selected yeast clones can be grown by culture for analysis or subsequent sorting rounds, or DNA from these clones can be isolated and used for mutagenesis and further transformation of new batches of yeast for targeted protein evolution. Components of the yeast display platform, such as Aga1p, Aga2p, HA, and c-myc epitope tags, as well as the detection antibodies shown in Figure 17, are omitted for clarity.

[0247] Library sorting The libraries were sorted using a Sony 800, and approximately 1000 clones were recovered from each sample. Samples were sorted for clones with increased and decreased binding (mapping key residues). Selected cells were plated, and only a few dozen grew; all were sequenced. Separate libraries of H / L chains were focused using standard and dynamic staining. TIFF0007911826000042.tif72128

[0248] Selected cells were seeded onto SDCAA plates and incubated at 30°C for 3 days. Colonies were then picked, grown in fresh SDCAA medium, sequenced, and key mutations were identified. Specific clones from sequencing were then inoculated into fresh SGCAA (induced by galactose), and after 36 hours, the samples were stained to create binding curves.

[0249] EBY100 yeast cultures were induced at 30°C for 1.5 days. 1E6 cells were spun down and added to wells containing antigens diluted in varying amounts with PBS. Plates were incubated at room temperature for 2 hours with shaking. Plates were washed with PBS and 0.1 ug / ml streptavidin-APC (Biolegend) was added to each well. Plates were incubated at room temperature for 25 minutes with shaking, then washed and read using a FACS caliber.

[0250] Clones 2, 7, 10, and 14 were derived from a randomly mutant library of P4-B3 (anti-PD1) and sorted by high binding (shifted upward with respect to the y=x axis). HL clones were generated separately by error-prone methods for the H and L chains and then rejoined by homologous recombination via the linker sequence. HL Dynamic 1 was derived from a dynamic staining approach in which the library was incubated with 10 × Kd labeled antigen, then incubated for an extended period with 10 times the volume of the original stain and 100 times the excess unlabeled antigen. P4-B3wt was not positive at this stage, but several clones were present in the popped-up library (see Figure 20). The experiment was repeated at appropriate concentrations, and only clones whose curves shifted to the left were used (see Figure 21).

[0251] Other clones that have been identified but not characterized TIFF0007911826000043.tif71136

[0252] scFv positivity indicates clones that show increased binding, primarily due to low binding affinity to cMyc but high binding affinity to PD-1 (no upward shift on the x=y axis).

[0253] scFv-negative clones are those that show reduced binding compared to wild-type clones (WT).

[0254] In addition to cloning HLkin1, HL-7, and HL-14 into minibody vectors, we created double (Mut+2:HLkin1+HL-7) and triple (Mut+3:HLkin1+HL-7+HL-14) combination mutants to check whether additive effects were observed (see Figures 23 and 24).

[0255] For example, K D The measurement results were as follows: PD1#3 Approximately 1E-10M P4-B3 WT approx. 1E-9M Mut+2 (HLkin1 + HL-7) approx. 3E-11M Mut+3(HLkin1+HL-7+HL-14) Approx. 3E-12M HLkin-1 approx. 6E-11M

[0256] The inventors also cloned anti-PD-1 single-chain IL12 fusions (bispecific antibodies). Four constructs were created: (1) light chain fusion, (2) light chain F2A fusion, (3) heavy chain fusion, and (4) heavy chain F2A fusion. The fusions are linked by a flexible linker, and the F2A has a self-cleaving peptide variant, allowing anti-PD-1 and scIL12 to advance in different directions as needed.

[0257] Example 10 - PD1 bioassay using IgG The Promega PD1-PDL1 bioassay (J1250) was performed using the PD-1 antibody of the present invention (e.g., P4-B3 and the variants described herein) as well as the commercially available antibodies pembrolizumab and nivolumab (Figure 33).

[0258] Nivo (green triangle) achieved approximately 5-6 times induction, which is consistent with previous experiments. In the scFv-Fc experiment, Mut+2, Mut+3, HLkin-1, and HL-7 all showed higher induction compared to Nivo. When converted to IgG, the combo mutant (Mut+2 / Mut+3) maintained better performance than Nivo and functioned at a level comparable to Pembro, while the single mutant (HLkin-1 / HL-7) showed slightly lower activity. The original P4-B3 IgG significantly underperformed the IgG of all antibodies. Clone scFv-6 is a double mutant derived from a yeast library and has mutations in both light chains. As understood, it is an improvement over P4-B3 WT but significantly inferior to commercially available and other mutant antibodies.

[0259] Example 11 - Construct design and kill assay aPD1-scIL12 fusion design The goal is to generate a single-chain IL12 fusion with scIL12 fused to P4-B3 Mut±3 IgG1, either with the IgG1 heavy or light chain. Either a (G4S)2 linker is used to maintain the linkage of scIL12 to IgG, or a self-cleaving F2A peptide is used to allow separation of the two molecules. All experiments are performed with the G4S linker fused to IL12. The F2A method is also employed. Due to the length of IL12 and considering the efficiency and cost of gene synthesis, the construct was initially cloned using a stuffer sequence, and the correct restriction enzyme sites were added. The following protocol follows the descriptions in Jiang et al., (1999) Infect Immun. Jun;67(6):2996-3001, Lode et al., (1999) Proc Natl Acad Sci US A. Jul 20;96(15):8591-6, Peng et al (1999) J Immunol. Jul 1;163(1):250-8, and Yu et al. (2012) PLoS One.7(11):e50438.doi:10.1371 / journal.pone.0050438.Epub 2012 Nov 28.

[0260] Cloning strategies using stuffers Figure 44 shows the cloning steps used to produce the aPD1-scIL12 fusion, starting with P4-B3 Mut+3 and ending with the G4S-scIL12 HC fusion (heavy chain fusions can be produced in this manner for any antibody construct, and for kappa LC antibodies, the restriction enzyme cloning sites need to be modified, but the overall strategy is the same). The same procedure is followed when creating the HC F2A version, except that the F2A stuffer synthetic fragment is used (the F2A stuffer fragment can be cleaved with NheI / BamHI, and then scIL12 can be inserted with XbaI / BamHI). In some embodiments, heavy chain fusions can be produced using the exact same restriction sites for any IgG vector, but the light chain restriction enzyme sites and light chain constant region used with the stuffer are specific to the λ light chain. To add the fusion to a κ light chain, the restriction enzyme sites must be changed and the light chain constant region changed to κ to match the κ vector instead of the λ vector.

[0261] When fabricating the light chain, the same steps outlined in Figure 44 can be followed, but instead of NheI / BamHI for inserting the stuffer, the AvrII and EcoRI sites can be used. Then, scIL12 can be inserted at XbaI / EcoRI.

[0262] Protein expression For example, see Figure 45.

[0263] Kinetic binding assay of aPD1-scIL12 fusion protein An octet assay was performed to measure the binding affinity of P4-B3 WT versus Mut+2 and Mut+3 to PD-1 (Figure 46). PD-1 was loaded at 2 μl / ml into the streptavidin sensor in column AG, and negative control H5 biotin was loaded at 2 μl / ml into column H. The antibodies were diluted with 2-fold serial dilutions. Compared to WT, improved off-rates (flatter slopes) were observed in Mut+2 and +3. The low curve in Pembro is an artifact of the octet sensor.

[0264] Octet assays were performed to measure the binding affinity of P4-B3 mut+3 HC and LC scIL12 constructs to PD-1. PD-1 was loaded at 2 μl / ml into a streptavidin sensor in column AG, and negative control H5 biotin was loaded at 2 μl / ml into column H. The fusion proteins were diluted with 2-fold serial dilutions. The HC fusion is shown in the left graph of Figure 47, and the LC fusion is shown in the right graph of Figure 47. The anti-PD1 IL12 fusion showed a similar binding curve to P4-B3 Mut+3 in Figure 46, and the addition of the IL12 fusion did not impair the improved off-rate.

[0265] Evaluation of the biological activity of the aPD1-scIL12 fusion protein using an IL12 cytokine reporter assay. IL12, which binds to the native heterodimer IL12R, leads to signaling via TyK2, JAK2, and STAT4, increasing IFNγ production. Invivogen engineered the IL12 pathway to link STAT4 production to an inducible SEAP reporter gene, which was then stably transduced into 293T cells (Figure 48). When the supernatant of IL12-induced 293T-IL12 cells was mixed with Quanti-Blue reagent, the solution turned blue in the presence of SEAP, allowing for quantification by measuring the absorbance at 620–655 nm. Invivogen Cat #: hkb-il12.

[0266] The function of IL12 fusions was tested using Invivogen's HEK-Blue IL12 reporter assay. Biolegend's carrier-free IL12 was used as a positive control. This experiment shows that the scIL12 and aPD1-LC-IL12 fusions prepared by the inventors exhibit higher levels of activity compared to Biolegend IL12. The aPD1-HC-IL12 fusion shows a 2-fold leftward shift compared to the LC fusion and scIL12.

[0267] The negative controls used were P4-B3 Mut+3 IgG1, pembroluzimab, CD70-mFc, and wells containing only culture medium. All wells were considered negative.

[0268] Evaluation of the biological activity of the aPD1-scIL12 fusion protein using a CART killing assay. A Celigo-based killing assay was set up to test the effect of IL12 fusions on T cell killing activity. In this experiment, anti-CAIX CARs were used against CAIX+BFP cells in both 4-1BB format and CD28-mat. The A716-41BB CAR was used as a negative control because it does not target CAIX. BioIL12 was recombinant IL12 purchased from Biolegend.

[0269] Constructs tested: aPD1P4-B3 Mut+3 with HC or LC scIL12 fusion, aPD1P4-B3 Mut+3 alone, and scIL12 alone. Pembrolizumab + bioIL12 was also tested to replicate separate doses of aPD1 and IL12. This experiment was designed to test the effect of IL12 on CAR using only culture medium. The plate layout for the killing assay is shown in Figure 50.

[0270] Killing activity was measured by counting the change in BFP cell count on days 0, 1, and 2 via a Celigo image cytometer. At the end of day 2, the supernatant was collected for cytokine ELISA (IL2, TNFα, IFNγ). For cytokine ELISA, the supernatant was diluted at 1:5 (TNFα), 1:40 (IL2), or 1:50 (IFNγ). TNFα and IL2 ELISAs were obtained from BioLegend, and IFNγ from Invitrogen.

[0271] Viral transduction efficiency: Three types of CAR T cells were generated using different lentiviral vectors. The CARs were generated with the aim of providing T cells already designed to kill for use in a kill assay. Both G36-41BB and G36-CD28 target CAIX+ tumor cells, while A716-41BB targets BCMA. This provides both target-specific killing and control, as CAIX+ tumor cells are used in the kill assay and A716-41BB is unable to kill CAIX+ cells. The G36-CD28 CAR shows a more potent and rapid response than G36-41BB, which is not constrained by theory, but this is expected to be observed in the kill assay as well. G36-41BB → Donor O: 58.4% G36-CD28 → Donor O: 45.5% A716-41BB → Donor O: 32.6%

[0272] Bulk T cells were added to each well, and the transduction efficiency was normalized. The T cells were not sorted before use. Transduction efficiency was measured 3 days after transduction by GFP expression.

[0273] T cells were isolated from one donor (named Donor O) and incubated overnight with TransAct. The following day, these cells were transduced at an MOI of 20 by spinoculation and DEAE. One day after transduction, the T cells were washed and resuspended in fresh medium containing IL-21 for further treatment.

[0274] A CAR T cell killing assay was performed (Figure 50 shows the plate setup). CAIX+ cells were added to each well. All three CARs and untransduced cells were added to the plate individually or in combination with various antibodies, and the differences in their effects were observed. LC and HC fusions were added to the corresponding wells, as well as anti-PD1, Pembro, IL-12, and a combination of Pembro and bioIL12. Upon plate reading, a large clustering and death of tumor cells was observed.

[0275] Even with an E:T ratio of 1.25:1, G36 CARs exhibit significant killing activity (Figure 41). In both G36-41BB and CD28 CAR T cells, the addition of the aPD1-HS scIL12 fusion increased killing activity compared to aPD1 alone. A shift was also observed in A716 killing (non-specific killing) with the addition of the scIL12 fusion compared to aPD1 alone (Figure 51).

[0276] When the killing curves for G36-41BB only and G36-41BB + scIL12 only are added, all the lines "converge" at the top of the killing curve (Figure 52).

[0277] Cytokine ELISA Cytokine levels are expressed as OD450 measurements. aPD1 refers to the IgG1 WT mono-format P4-B3 Mut+3 antibody (which can be fused to scIL12). Pembro refers to pembrolizumab.

[0278] A716-41BB was processed similarly to all G36-41BB CARS and used as a control. For G36-CD28, untransduced T cells were used as a control and were not treated with cytokines or antibodies. Cytokine ELISA compared untreated CARs (medium only) with the treatment option.

[0279] The IL12 construct has a significant effect on G36-41BB T cells at each E:T ratio. At E:T ratios of 2.5:1 and 1.25:1, it has a moderate effect on G36-CD28 T cells (except for CD28 at a 1:1.25 ratio) (Figure 43). When G36-41BB is used alone or in combination with anti-PD1, only small amounts of IL-2 are produced, but when IL12 is added, IL-2 secretion increases significantly, and this is further enhanced by treatment with aPD1-HCscIL12 or aPD1-LCscIL12 (Figure 53).

[0280] The scIL12 fusion pair yields similar effects on both 41BB and CD28 constructs. In this IFNγ assay, scIL12 induces increased IFNγ secretion compared to CART cells alone. aPD1 itself also has various effects on IFNγ secretion, with slight inhibitory effects observed in some samples. Addition of either aPD1-IL12 fusion increases IFNγ production in both 41BB and CD28-based CARs compared to CAR alone, aPD1 alone, or scIL12 alone (Figure 54). The aPD1 HC IL12 fusion is generally superior to aPD1 LC IL12, but under most conditions, both aPD1 scIL12 fusions are superior to CART alone (Figure 54).

[0281] The scIL12 fusion did not significantly affect TNFα production induced by the G36-41BB construct, but a marked increase in TNFα production was observed with the G36-CD28 construct. In this experiment, the HC fusion had a greater impact on TNFα production compared to IL12 alone or the LC fusion. However, all IL-12 samples appear to have exceeded the baseline TNFα production induced by G36-CD28 cells.

[0282] Example 12 - Mixed Lymphocyte Response (MLR) Protocol CD14+ monocytes were isolated using Miltenyi CD14+ microbeads. Cells were cultured in Miltenyi Mo-DC medium (pre-prepared medium containing GM-CSF + IL4). After culturing the cells for 5 days, TNF-α (1000 U / ml), IL-1β (5 ng / ml), IL-6 (10 ng / ml), and prostaglandin E2 (PGE2) (1 μM) were added, and the cells were cultured for 2 days to mature the DCs. T cells were isolated on the day of the MLR experiment (using the CD4+ negative selection kit StemCell). 100,000 T cells and 10,000 MoDC cells were used per well for the MLR. Antibodies were added at various concentrations, and the culture medium was incubated for 5 days.

[0283] The supernatant was saved for ELISA screening (e.g., IL2 and IFNγ). For FACS analysis, cells were stained with CD4-FITC, PD1-PE, LAG3-BV421, and TIM3-APC Cy7.

[0284] MLR Pembro vs. P4-B3mut+3 IgG4. Two T cell donors and two DC donors were used. The graph titles in Figures 59 and 60 show the measured cytokines, T cell donors, and DC donors. IL2 T2 DCV live corresponds to IL2 assay, T cell donor 2, and DC donor V.

[0285] The sIgG4 format P4-B3mut+3 antibody was tested against commercially available formulations of pembrolizumab and F10-sIgG4 (negative control). As shown in Figures 59 and 60, the addition of either P4-B3mut+3 or pembrolizumab significantly increased cytokine production compared to F10.

[0286] MLR PD-1 / IL12 fusion. One T cell donor and two DC donors were used. The graph titles in Figures 65 and 66 show the measured cytokines, T cell donors, scIL12 constructs, and DC donors. The T2 DCV HC IL2 data correspond to the IL2 assay, T cell donor 2, DC donor V, and scIL12 HC fusion pair.

[0287] P4-B3mut+3 antibodies in LALA format, with scIL12 fused to either the heavy or light chain, or without fusion, were tested against F10 in a similar format. As shown in Figures 59 and 60, the addition of either P4-B3mut+3 increased cytokine production compared to F10. The addition of the scIL12 fusion significantly increased IFN-γ but not IL2. The effects were similar for heavy and light chain fusions. The PD-1 / IL12 fusions described herein activate T cells and increase IFNγ expression, but do not increase IL2 expression.

[0288] Example 13 - Masked IL-12 structure Two “masked” PD-1 / IL12 constructs are shown in Figures 67 and 68. Figure 67 shows the intact MMP9 cleavage site for the protease MMP9 between the P35 and P40 subunits of IL-12. The other construct in Figure 68 shows the mutated protease cleavage site between the P35 and P40 subunits of IL-12.

[0289] Proteases are proteins that, in some cases, cleave proteins in a sequence-specific manner. Examples of proteases include, but are not limited to, serine proteases, cysteine ​​proteases, aspartate proteases, threonine proteases, glutamate proteases, metalloproteases, asparagine peptide lyases, serum proteases, cathepsins, cathepsin B, cathepsin C, cathepsin D, cathepsin E, cathepsin K, cathepsin L, kallikrein, hK1, hK10, hK15, plasmin, collagenase, type IV collagenase, stromericin, factor Xa, chymotrypsin-like proteases, trypsin-like proteases, elastase-like proteases, subtilisin-like proteases, actinidine, bromelan, calpain, caspases, caspase-3, and Mi Examples include rl-CP, papain, HIV-1 protease, HSV protease, CMV protease, chymosin, renin, pepsin, matryptase, regmine, plasmmepsin, nepenthesin, metalloexopeptidase, metalloendopeptidase, matrix metalloproteinase (MMP), MMP1, MMP2, MMP3, MMP8, MMP9, MMP13, MMP11, MMP14, urokinase plasminogen activator (uPA), enterokinase, prostate-specific antigen (PSA, hK3), interleukin-1β-converting enzyme, thrombin, FAP (FAP-α), dipeptidyl peptidase, and dipeptidyl peptidase IV (DPPIV / CD26). A “protease cleavage site” can refer to an amino acid sequence that can be cleaved by a protease, such as a matrix metalloproteinase (MMP) or furin. Non-limiting examples of linkers and protease cleavage sites known to those skilled in the art that can be used to construct the anti-PD-1-IL-12 fusions described herein are described in U.S. Patent No. 9,708,412, U.S. Patent Application Publications 2018 / 0134789 and 2020 / 0148771, and PCT International Publication 2019 / 051122 (each of which is incorporated in whole by reference). In some embodiments, the protease cleavage site is recognized by a protease disclosed in Table X herein.

[0290] (Table X) Protease and protease cleavage sites TIFF0007911826000044.tif220150TIFF0007911826000045.tif229150

[0291] For example, the anti-PD-1-IL-12 fusion described herein includes at least one protease cleavage site comprising an amino acid sequence cleaved by at least one protease. In some embodiments, the anti-PD-1-IL-12 fusion described herein includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more protease cleavage sites that are cleaved by at least one protease. Non-limiting examples of such cleavage sites include (GPLGIAGQ) or (AVRWLLTA) that can be cleaved by metalloproteinases, and (RRRRRR) that can be cleaved by furin. In therapeutic applications, the protease cleavage site can be cleaved by target cells, such as cancer cells or infected cells, or by proteases produced by pathogens. In some embodiments described herein, the linker may include a protease cleavage site. Such linkers, including protease cleavage sites, are, in certain embodiments, sensitive to proteases (such as MMPs, furins, and cathepsin B) present in specific tissues or intracellular compartments. Examples of such protease-cleavable linker sequences include, but are not limited to, (PLGLWA)n, (RVLAEA)n(EDVVCCSMSY)n, and (GGIEGRGS)n, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, which are recognized by MMP-1, as well as (GFLG)n, where n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, which are recognized by furin. In some embodiments, a linker containing a protease cleavage site plays a role in masking / demasking (e.g., activation) of the IL-12 target domain binding protein. In some embodiments, the binding protein may be other cytokines described herein, etc.In some embodiments, the inducible target-binding protein becomes ≤100kD, ≤75kD, ≤50kD, ≤25kD, ≤20kD, ≤15kD, ≤10kD, or ≤5kD upon activation by protease cleavage. Prior to cleavage and activation, the target-binding protein is, in certain embodiments, ≤100kD, ≤75kD, ≤50kD, ≤25kD, ≤20kD, ≤15kD, ≤10kD, or ≤5kD.

[0292] The protease cleavage sites described herein are polypeptides having sequences that are recognized and cleaved in a sequence-specific manner. The anti-PD-1-IL-12 fusions described herein may include protease cleavage sites that are sequence-specifically recognized by a matrix metalloproteinase (MMP), for example, MMP9. In some embodiments, the protease cleavage site recognized by MMP9 includes a polypeptide having the amino acid sequence PR(S / T)(L / I)(S / T). In some embodiments, the protease cleavage site recognized by MMP9 includes a polypeptide having the amino acid sequence LEATA. In some embodiments, the protease cleavage site is sequence-specifically recognized by MMP11. In some embodiments, the protease cleavage site recognized by MMP11 includes a polypeptide having the amino acid sequence GGAANLVRGG.

[0293] For example, the MMP9 / mutation site forms a pseudo-linker of 7 amino acids compared to the 15 amino acids originally present in the G4S repeat linker. Although not bound by theory, shortening the linker prevents IL-12 from folding into a dimer, and therefore its activity is significantly reduced. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 6 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 5 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 4 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 3 amino acids. In one embodiment, the MMP9 / mutation site forms a pseudo-linker of 2 amino acids. In some embodiments, pseudolinker sites can be formed according to techniques routinely used by those skilled in the art, resulting in pseudolinkers of 14, 13, 12, 11, 10, 9, or 8 amino acids in length (see Eckhard et al. (2016) Matrix Biology, 49:37-60, which incorporates the whole by reference). For example, upon reaching the tumor site, a localized protease can cleave the linker, releasing the P35 subunit to form a heterodimer. While not constrained by theory, the 7aa linker is short enough to inhibit folding, and once the second monomer is released, the subunit is properly assembled.

[0294] In some embodiments, MMP9 is selected because the cleavage sequence and recombinant protease are readily available to those skilled in the art. In other embodiments, the cutting site can be optimized / selected to suit various cancer indications (for example, incorporating the whole by reference for each: Al-Alem L, Curry TE Jr. Ovarian cancer: involvement of the matrix metalloproteinases. Reproduction. 2015;150(2):R55-R64; Wang, S., Jia, J., Liu, D. et al. Matrix Metalloproteinase Expressions Play Important role in Prediction of Ovarian Cancer Outcome. Sci Rep 9,11677(2019); Ren F, Tang R, Zhang X, et al. Overexpression of MMP Family Members Functions as Prognostic Biomarker for Breast Cancer Patients: A Systematic Review and Meta-Analysis. PLoS One. 2015;10(8):e0135544). For example, if ovarian cancer overexpresses MMP2 but not MMP9, it is thought that the linker / cleavage sequence is modified accordingly.

[0295] equivalent Those skilled in the art will recognize or be able to identify numerous equivalents to the specific substances and procedures described herein without using anything beyond routine experiments. Such equivalents are considered to fall within the scope of the present invention and are covered by the appended claims.

[0296] Sequence information SEQUENCE LISTING <110> DANA-FARBER CANCER INSTITUTE, INC. <120> ANTIBODIES AGAINST PD-1 AND METHODS OF USE THEREOF <150> US 62 / 884,473 <151> 2019-08-08 <150> US 62 / 861,638 <151> 2019-06-14 <160> 225 <170> PatentIn version 3.5 <210> 1 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 1 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 2 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Phe Asn Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Ala Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Gly Gly Leu 85 90 95 Asn Gly Arg Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 3 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 3 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Asp Ser Gly Tyr Thr Phe Thr Thr Tyr 20 25 30 Trp Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu Glu Leu Met 35 40 45 Gly Ile Ile Tyr Pro Asp Asp Ser Asp Thr Thr Tyr Ser Pro Ser Phe 50 55 60 Gln Gly His Val Thr Ile Ser Ala Asp Lys Ser Ile Asn Thr Ala Tyr 65 70 75 80 Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Phe Trp Gly Ala Ser Gly Ala Pro Val Asn Gly Phe Asp Ile Trp 100 105 110 Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 4 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 4 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly 20 25 30 Tyr Val Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu 35 40 45 Leu Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu 65 70 75 80 Gln Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser 85 90 95 Leu Asn Ala Pro Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Leu 100 105 110 <210> 5 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 5 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Arg Pro Ser Ala 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Asp Ser Val Ser Ser Asp 20 25 30 Asn Tyr Phe Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Pro Leu Glu 35 40 45 Trp Ile Gly Tyr Val Tyr Tyr Asn Gly Asn Thr Asn Tyr Asn Pro Ser 50 55 60 Phe Asn Ser Arg Val Thr Met Ser Leu Asp Thr Ser Lys Asn Gln Phe 65 70 75 80 Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp Thr Ala Phe Tyr Tyr 85 90 95 Cys Ala Thr Glu Thr Pro Pro Thr Ser Tyr Phe Asn Ser Gly Pro Phe 100 105 110 Asp Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 115 120 125 <210> 6 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 6 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Ser Ser Asn Asn Val Gly Ala His 20 25 30 Gly Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu 35 40 45 Ala Tyr Arg Asn Asn Asn Arg Pro Ser Gly Ile Ser Glu Arg Phe Ser 50 55 60 Ala Ser Arg Ser Gly Asn Thr Ala Ser Leu Thr Ile Ile Gly Leu Gln 65 70 75 80 Pro Glu Asp Glu Gly Asp Tyr Tyr Cys Ser Ser Trp Asp Ser Ser Leu 85 90 95 Ser Gly Tyr Val Phe Gly Pro Gly Thr Lys Val Thr Val Leu 100 105 110 <210> 7 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 7 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Asn Arg Phe 20 25 30 Gly Leu Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met 35 40 45 Gly Trp Thr Asn Pro Tyr Asn Gly Asn Thr Arg Tyr Ala Gln Lys Phe 50 55 60 Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr 65 70 75 80 Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Met Tyr Phe Cys 85 90 95 Ala Arg Val Val Ala Val Asn Gly Met Asp Val Trp Gly Gln Gly Thr 100 105 110 Thr Val Thr Val Ser Ser 115 <210> 8 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 8 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn Ser Gly Ser Ile Ala Ala Tyr 20 25 30 Tyr Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val 35 40 45 Ile Tyr Glu Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Gly Ser Ile Asp Ser Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly 65 70 75 80 Leu Lys Thr Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser 85 90 95 Ser Asn Leu Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 9 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 9 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Ser Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Gln Thr Val Ala Gly Ser Asp Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 10 <211> 108 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 10 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Pro Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn Asn Ile Gly Ser Lys Ser Val 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val Tyr 35 40 45 Asp Asp Ser Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser 50 55 60 Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly 65 70 75 80 Asp Glu Ala Asp Tyr Tyr Cys Gln Val Trp His Ser Val Ser Asp Gln 85 90 95 Gly Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 100 105 <210> 11 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 11 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn 20 25 30 Thr Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu 35 40 45 Ile Phe Asp Asp Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser 50 55 60 Ala Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln 65 70 75 80 Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Gly Gly Leu 85 90 95 Asn Gly Arg Gly Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 100 105 110 <210> 12 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 12 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 13 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 13 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Phe 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 14 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 14 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 1 5 10 <210> 15 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 15 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Phe 20 25 30 Ala Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Trp Asn Ser Gly Ser Ile Gly Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val Trp 100 105 110 Gly Lys Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 16 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 16 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 17 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 17 Gly Phe Thr Phe Asp Asp Tyr Ala 1 5 <210> 18 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 18 Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser 1 5 10 15 Gly <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 19 Ile Ser Trp Asn Ser Gly Ser Ile 1 5 <210> 20 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 20 Gly Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Val Ser Arg Asp Asn 1 5 10 15 Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 21 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 21 Ala Ser Asp Tyr Gly Asp Lys Tyr Tyr Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 22 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 22 Trp Gly Lys Gly Thr Thr Val Thr Val Ser Ser 1 5 10 <210> 23 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 23 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 1 5 10 <210> 24 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 24 Ser Ser Asn Ile Gly Ser Asn Thr 1 5 <210> 25 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 25 Gln Pro Gly Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Ser Gly Ser 20 25 <210> 26 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 26 Asn Asp Asn 1 <210> 27 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 27 Val Asn Trp Tyr Gln Gln Phe Pro Gly Lys Ala Pro Lys Leu Leu Ile 1 5 10 15 Phe <210> 28 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 28 Ala Ala Trp Asp Gly Gly Leu Asn Gly Arg Gly Val 1 5 10 <210> 29 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 29 Phe Gly Gly Gly Thr Lys Leu Thr Val Leu 1 5 10 <210> 30 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 30 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu 1 5 10 15 Ser Leu Lys Ile Ser Cys Lys Asp Ser 20 25 <210> 31 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 31 Gly Tyr Thr Phe Thr Thr Tyr Trp 1 5 <210> 32 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 32 Ile Gly Trp Val Arg Gln Leu Pro Gly Lys Gly Leu Glu Leu Met Gly 1 5 10 15 Ile <210> 33 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 33 Ile Tyr Pro Asp Asp Ser Asp Thr 1 5 <210> 34 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 34 Thr Tyr Ser Pro Ser Phe Gln Gly His Val Thr Ile Ser Ala Asp Lys 1 5 10 15 Ser Ile Asn Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp 20 25 30 Thr Ala Met Tyr Tyr Cys 35 <210> 35 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 35 Ala Phe Trp Gly Ala Ser Gly Ala Pro Val Asn Gly Phe Asp Ile 1 5 10 15 <210> 36 <211> 35 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 36 Leu Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Phe Gly Gly Gly Thr Lys Leu 20 25 30 Thr Val Leu 35 <210> 37 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 37 Ser Ser Asn Ile Gly Ala Gly Tyr Val 1 5 <210> 38 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 38 Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 39 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 39 Ser Asn Asn 1 <210> 40 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 40 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly 1 5 10 15 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 41 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 41 Ala Ala Trp Asp Asp Ser Leu Asn Ala Pro Val 1 5 10 <210> 42 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 42 Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Arg Pro Ser Ala 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser 20 25 <210> 43 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 43 Gly Asp Ser Val Ser Ser Asp Asn Tyr Phe 1 5 10 <210> 44 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 44 Trp Ser Trp Ile Arg Gln Pro Pro Gly Lys Pro Leu Glu Trp Ile Gly 1 5 10 15 Tyr <210> 45 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 45 Val Tyr Tyr Asn Gly Asn Thr 1 5 <210> 46 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 46 Asn Tyr Asn Pro Ser Phe Asn Ser Arg Val Thr Met Ser Leu Asp Thr 1 5 10 15 Ser Lys Asn Gln Phe Ser Leu Lys Leu Arg Ser Val Thr Ala Ala Asp 20 25 30 Thr Ala Phe Tyr Tyr Cys 35 <210> 47 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 47 Ala Thr Glu Thr Pro Pro Thr Ser Tyr Phe Asn Ser Gly Pro Phe Asp 1 5 10 15 Ser <210> 48 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 48 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Ser Lys Gly Leu Arg Gln 1 5 10 15 Thr Ala Thr Leu Thr Cys Thr Gly Ser 20 25 <210> 49 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 49 Ser Asn Asn Val Gly Ala His Gly 1 5 <210> 50 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 50 Ala Ala Trp Leu Gln Gln His Gln Gly His Pro Pro Lys Leu Leu Ala 1 5 10 15 Tyr <210> 51 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 51 Arg Asn Asn 1 <210> 52 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 52 Asn Arg Pro Ser Gly Ile Ser Glu Arg Phe Ser Ala Ser Arg Ser Gly 1 5 10 15 Asn Thr Ala Ser Leu Thr Ile Ile Gly Leu Gln Pro Glu Asp Glu Gly 20 25 30 Asp Tyr Tyr Cys 35 <210> 53 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 53 Ser Ser Trp Asp Ser Ser Leu Ser Gly Tyr Val 1 5 10 <210> 54 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 54 Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser 1 5 10 15 Ser Val Lys Val Ser Cys Lys Thr Ser 20 25 <210> 55 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 55 Gly Tyr Thr Phe Asn Arg Phe Gly 1 5 <210> 56 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 56 Leu Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly 1 5 10 15 Trp <210> 57 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 57 Thr Asn Pro Tyr Asn Gly Asn Thr 1 5 <210> 58 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 58 Arg Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met Thr Thr Asp Thr 1 5 10 15 Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser Leu Arg Ser Asp Asp 20 25 30 Thr Ala Met Tyr Phe Cys 35 <210> 59 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 59 Ala Arg Val Val Ala Val Asn Gly Met Asp Val 1 5 10 <210> 60 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 60 Asn Phe Met Leu Thr Gln Pro His Ser Val Ser Glu Ser Pro Gly Lys 1 5 10 15 Thr Val Thr Ile Ser Cys Thr Arg Asn 20 25 <210> 61 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 61 Ser Gly Ser Ile Ala Ala Tyr Tyr 1 5 <210> 62 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 62 Val Gln Trp Tyr Gln Gln Arg Pro Gly Ser Ser Pro Thr Thr Val Ile 1 5 10 15 Tyr <210> 63 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 63 Glu Asp Asn 1 <210> 64 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 64 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Ile Asp Ser 1 5 10 15 Ser Ser Asn Ser Ala Ser Leu Thr Ile Ser Gly Leu Lys Thr Glu Asp 20 25 30 Glu Ala Asp Tyr Tyr Cys 35 <210> 65 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 65 Gln Ser Tyr Asp Ser Ser Asn Leu Trp Val 1 5 10 <210> 66 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 66 Glu Val Gln Leu Val Gln Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser 20 25 <210> 67 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 67 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 68 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 68 Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala 1 5 10 15 Val <210> 69 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 69 Ile Ser Tyr Asp Gly Ser Asn Lys 1 5 <210> 70 <211> 38 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 70 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 71 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 71 Ala Ser Gln Thr Val Ala Gly Ser Asp Tyr 1 5 10 <210> 72 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 72 Gln Pro Gly Leu Thr Gln Pro Pro Ser Val Pro Val Ala Pro Gly Gln 1 5 10 15 Thr Ala Arg Ile Thr Cys Gly Gly Asn 20 25 <210> 73 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 73 Asn Ile Gly Ser Lys Ser 1 5 <210> 74 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 74 Val His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Val 1 5 10 15 Tyr <210> 75 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 75 Asp Asp Ser 1 <210> 76 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 76 Asp Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser Asn Ser Gly 1 5 10 15 Asn Thr Ala Thr Leu Thr Ile Ser Arg Val Glu Ala Gly Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 77 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 77 Gln Val Trp His Ser Val Ser Asp Gln Gly Val 1 5 10 <210> 78 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 78 Gly Phe Thr Phe Asp Asp Phe Ala 1 5 <210> 79 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 79 Ala Ser Asp Tyr Gly Asp Lys Tyr Ser Tyr Tyr Gly Met Asp Val 1 5 10 15 <210> 80 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 80 Asp Asp Asn 1 <210> 81 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (2)..(2) <223> Any amino acid <220> <221> MOD_RES <222> (5)..(6) <223> Any amino acid <220> <221> MOD_RES <222> (8)..(8) <223> Any amino acid <400> 81 Gly Xaa Thr Phe Xaa Xaa Tyr Xaa 1 5 <210> 82 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (2)..(2) <223> Any amino acid <220> <221> MOD_RES <222> (5)..(7) <223> Any amino acid <400> 82 Gly Xaa Thr Phe Xaa Xaa Xaa Ala 1 5 <210> 83 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (1)..(1) <223> Any amino acid <400> 83 Xaa Asp Asn 1 <210> 84 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MOD_RES <222> (1)..(1) <223> Any amino acid <400> 84 Xaa Asn Asn 1 <210> 85 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 85 Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser Ala Ser Lys Ser Gly 1 5 10 15 Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Gln Ser Glu Asp Glu Ala 20 25 30 Asp Tyr Tyr Cys 35 <210> 86 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 86 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt gatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 87 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 87 Gly Gly Gly Gly Ser 1 5 <210> 88 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 88 Gly Pro Leu Gly Val Arg Gly 1 5 <210> 89 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 89 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser Gly Gly Gly Gly Ser 20 25 <210> 90 <211> 288 <212> PRT <213> Homo sapiens <400> 90 Met Gln Ile Pro Gln Ala Pro Trp Pro Val Val Trp Ala Val Leu Gln 1 5 10 15 Leu Gly Trp Arg Pro Gly Trp Phe Leu Asp Ser Pro Asp Arg Pro Trp 20 25 30 Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu Gly Asp 35 40 45 Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser Phe Val 50 55 60 Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys Leu Ala 65 70 75 80 Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Cys Arg Phe Arg 85 90 95 Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val Val Arg 100 105 110 Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile Ser Leu 115 120 125 Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu Arg Val 130 135 140 Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro Ser Pro 145 150 155 160 Arg Pro Ala Gly Gln Phe Gln Thr Leu Val Val Gly Val Val Gly Gly 165 170 175 Leu Leu Gly Ser Leu Val Leu Leu Val Trp Val Leu Ala Val Ile Cys 180 185 190 Ser Arg Ala Ala Arg Gly Thr Ile Gly Ala Arg Arg Thr Gly Gln Pro 195 200 205 Leu Lys Glu Asp Pro Ser Ala Val Pro Val Phe Ser Val Asp Tyr Gly 210 215 220 Glu Leu Asp Phe Gln Trp Arg Glu Lys Thr Pro Glu Pro Pro Val Pro 225 230 235 240 Cys Val Pro Glu Gln Thr Glu Tyr Ala Thr Ile Val Phe Pro Ser Gly 245 250 255 Met Gly Thr Ser Ser Pro Ala Arg Arg Gly Ser Ala Asp Gly Pro Arg 260 265 270 Ser Ala Gln Pro Leu Arg Pro Glu Asp Gly His Cys Ser Trp Pro Leu 275 280 285 <210> 91 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 91 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 <210> 92 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 92 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 93 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 93 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser 20 <210> 94 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 94 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 95 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 95 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 96 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 96 caggtgcagc tggtgcagtc tggagcagag gtgaagaagc ccggggagtc tctgaagatc 60 tcctgtaagg attctggata cacctttacc acctactgga tcggctgggt gcgccagctg 120 cccgggaaag gcctggagtt gatggggatc atctatcctg atgactctga taccacatac 180 agcccgtcct tccaaggcca tgtcaccatc tcagccgaca agtccatcaa caccgcctac 240 ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gttttggggt 300 gcgagtggag cgccagtgaa tggttttgat atctggggcc aaggcaccct ggtcaccgtc 360 tcctca 366 <210> 97 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 97 ctgcctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcctgcactg ggagcagctc caacatcggg gcaggttatg ttgtacactg gtaccagcag 120 ctcccaggaa cggcccccaa actcctcatc tatagtaata atcagcggcc ctcaggggtc 180 cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc 240 cagtctgagg atgaggctga ttattactgt gcagcatggg atgacagcct gaatgctccg 300 gtgttcggcg gagggaccaa gctgaccgtc cta 333 <210> 98 <211> 375 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 98 caggtacagc tgcagcagtc aggcccagga ctggtgaggc cttcggcgac cctgtccctc 60 acctgcactg tctctggtga ctccgtcagc agtgataatt acttctggag ttggattcgg 120 cagcccccag ggaagccact ggagtggatt ggctatgtct attacaatgg gaacaccaac 180 tacaacccct ccttcaacag tcgagtcacc atgtcacttg acacgtccaa gaaccagttc 240 tccttgaagc tgaggtctgt gaccgccgcg gacacggcct tttattactg tgcgacagag 300 acgcccccaa ccagctattt taatagtgga ccctttgact cctggggcca gggcaccctg 360 gtcaccgtct cctcg 375 <210> 99 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 99 cagcctgggc tgactcagcc accctcggtg tccaagggct tgagacagac cgccacactc 60 acctgcactg ggagcagcaa caatgtaggc gcccacggag cagcttggct gcagcagcac 120 cagggccacc ctcccaaact ccttgcctac aggaataaca accggccctc agggatctca 180 gagagattct ctgcatccag gtcaggaaac acagcctccc tgaccattat tggactccag 240 cctgaggacg agggtgacta ttactgctca tcatgggaca gcagcctcag tggttatgtc 300 ttcggacctg ggaccaaagt caccgtccta 330 <210> 100 <211> 354 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 100 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc agtgaaggtc 60 tcctgcaaga cttctggcta cacctttaac aggtttggtc tcacctgggt gcgacaggcc 120 cctggacaag ggcttgagtg gatgggatgg accaaccctt acaatggtaa cacaaggtat 180 gcacagaagt tccagggcag agtcaccatg accacagaca catccacgag cacagcctac 240 atggagctga ggagcctgag atctgacgac acggccatgt atttctgtgc gagagtcgta 300 gccgtaaacg gtatggacgt ctggggccaa gggaccacgg tcaccgtctc ctca 354 <210> 101 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 101 aattttatgc tgactcagcc ccactctgtg tcggagtctc cggggaagac ggttaccatc 60 tcctgcaccc gcaacagtgg cagcattgcc gcctactatg tgcagtggta ccagcagcgc 120 ccgggcagtt cccccaccac tgtgatctat gaagataacc aaagaccctc tggggtccct 180 gatcggttct ctggctccat cgacagctcc tccaactctg cctccctcac catctctgga 240 ctgaagactg aggacgaggc tgactactac tgtcagtctt atgatagcag caatctttgg 300 gtgttcggcg gagggaccaa gctgaccgtc cta 333 <210> 102 <211> 351 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 102 gaggtgcagc tggtgcagtc tgggggaggc gtggtccagc ctgggaggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctatgcta tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtggcagtt atatcatatg atggaagcaa taaatactac 180 gcagactccg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agctgaggac acggctgtgt attactgtgc gagccaaaca 300 gtggctggaa gtgactactg gggccagggc accctggtca ccgtctcctc a 351 <210> 103 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 103 cagcctgggc tgactcagcc accctcggtg ccagtggccc caggacagac ggccaggatt 60 acctgtgggg gaaacaacat tggaagtaaa agtgtgcact ggtaccagca gaagccaggc 120 caggcccctg tgctggtcgt ctatgatgat agcgaccggc cctcagggat ccctgagcga 180 ttctctggct ccaactctgg gaacacggcc accctgacca tcagcagggt cgaagccggg 240 gatgaggccg actattactg tcaggtgtgg catagtgtta gtgatcaagg ggtcttcgga 300 actgggacca aagtcaccgt ccta 324 <210> 104 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 104 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattttgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 105 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 105 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 106 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 106 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actactacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 107 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 107 cagcctgggc tgactcagcc accctcagcg tctgggaccc cagggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt gatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 108 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 108 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattatgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actcctacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 109 <211> 333 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 109 cagcctgggc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcttgttctg gaagcagctc caacatcgga agtaatactg tcaactggta tcagcaattc 120 cccggaaagg cccccaaact cctcatcttt aatgataatc agcggccctc aggggtccct 180 gaccgcttct ctgcttccaa gtctggcacc tcagcctccc tggccattag tggcctccag 240 tctgaggatg aggctgacta ttactgtgcg gcatgggatg gcggtctgaa tggtcgaggg 300 gtgttcggcg gagggaccaa actgaccgtc cta 333 <210> 110 <211> 366 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 110 caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggcaggtc cctgagactc 60 tcctgtgcag cctctggatt cacctttgat gattttgcca tgcactgggt ccggcaagct 120 ccagggaagg gcctggagtg ggtctcaggt attagttgga atagtggtag cataggctat 180 gcggactctg tgaagggccg attcaccgtc tccagagaca acgccaagaa ctcactgtat 240 ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagtgactac 300 ggtgacaaat actcctacta cggtatggac gtctggggca aagggaccac ggtcaccgtc 360 tcctca 366 <210> 111 <211> 97 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 111 Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys 1 5 10 15 Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr 65 70 75 80 Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95 Lys <210> 112 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 112 Ala Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 1 5 10 15 <210> 113 <211> 110 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 113 Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 1 5 10 15 Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 20 25 30 Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr 35 40 45 Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 50 55 60 Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 65 70 75 80 Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 85 90 95 Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys 100 105 110 <210> 114 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 114 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 1 5 10 15 Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 20 25 30 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 100 105 <210> 115 <211> 106 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 115 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 1 5 10 15 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 20 25 30 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Gly Ser Pro 35 40 45 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 50 55 60 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 65 70 75 80 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 85 90 95 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 100 105 <210> 116 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 116 accaagggcc catcggtctt ccccctggca ccctcctcca agagcacctc tgggggcaca 60 gcggccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 120 tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 180 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 240 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agaaa 285 <210> 117 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 117 gcagagccca aatcttgtga caaaactcac acatgcccac cgtgccca 48 <210> 118 <211> 330 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 118 gcacctgaac tcctgggggg accgtcagtc ttcctcttcc ccccaaaacc caaggacacc 60 ctcatgatct cccggacccc tgaggtcaca tgcgtggtgg tggacgtgag ccacgaagac 120 cctgaggtca agttcaactg gtacgtggac ggcgtggagg tgcataatgc caagacaaag 180 ccgcgggagg agcagtacaa cagcacgtac cgtgtggtca gcgtcctcac cgtcctgcac 240 caggactggc tgaatggcaa ggagtacaag tgcaaggtct ccaacaaagc cctcccagcc 300 cccatcgaga aaaccatctc caaagccaaa 330 <210> 119 <211> 324 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 119 gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 60 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 120 tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 180 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 240 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 300 ctctccctgt ctccgggtaa atga 324 <210> 120 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 120 ggtcagccca aggctgcccc ctcggtcact ctgttcccgc cctcctctga ggagcttcaa 60 gccaacaagg ccacactggt gtgtctcata agtgacttct acccgggagc cgtgacagtg 120 gcctggaagg cagatggcag cccctcaag gcgggagtgg agaccaccac accctccaaa 180 caaagcaca acagtacgc ggccagcagc tatctgagcc tgacgcctga gcagtggaag 240 tcccacagaa gctacagctg ccaggtcacg catgaaggga gcaccgtgga gaagacagtg 300 gccctacag aatgttcatg a 321 <210> 121 <211> 682 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 121 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 1 5 10 15 Glu Thr Lys Asn Gln Will Be Thr Cys Thr Lys Gly Phe 20 25 30 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Arg Ala Lys Arg Ser 100 105 110 Gly Ser Gly Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu 115 120 125 Ser Asn Pro Gly Pro Ser Arg Met Cys His Gln Gln Leu Val Ile Ser 130 135 140 Trp Phe Ser Leu Val Phe Leu Ala Ser Pro Leu Val Ala Ile Trp Glu 145 150 155 160 Leu Lys Lys Asp Val Tyr Val Val Glu Leu Asp Trp Tyr Pro Asp Ala 165 170 175 Pro Gly Glu Met Val Val Leu Thr Cys Asp Thr Pro Glu Glu Asp Gly 180 185 190 Ile Thr Trp Thr Leu Asp Gln Ser Ser Glu Val Leu Gly Ser Gly Lys 195 200 205 Thr Leu Thr Ile Gln Val Lys Glu Phe Gly Asp Ala Gly Gln Tyr Thr 210 215 220 Cys His Lys Gly Gly Glu Val Leu Ser His Ser Leu Leu Leu Leu His 225 230 235 240 Lys Lys Glu Asp Gly Ile Trp Ser Thr Asp Ile Leu Lys Asp Gln Lys 245 250 255 Glu Pro Lys Asn Lys Thr Phe Leu Arg Cys Glu Ala Lys Asn Tyr Ser 260 265 270 Gly Arg Phe Thr Cys Trp Trp Leu Thr Thr Ile Ser Thr Asp Leu Thr 275 280 285 Phe Ser Val Lys Ser Ser Arg Gly Ser Ser Asp Pro Gln Gly Val Thr 290 295 300 Cys Gly Ala Ala Thr Leu Ser Ala Glu Arg Val Arg Gly Asp Asn Lys 305 310 315 320 Glu Tyr Glu Tyr Ser Val Glu Cys Gln Glu Asp Ser Ala Cys Pro Ala 325 330 335 Ala Glu Glu Ser Leu Pro Ile Glu Val Met Val Asp Ala Val His Lys 340 345 350 Leu Lys Tyr Glu Asn Tyr Thr Ser Ser Phe Phe Ile Arg Asp Ile Ile 355 360 365 Lys Pro Asp Pro Pro Lys Asn Leu Gln Leu Lys Pro Leu Lys Asn Ser 370 375 380 Arg Gln Val Glu Val Ser Trp Glu Tyr Pro Asp Thr Trp Ser Thr Pro 385 390 395 400 His Ser Tyr Phe Ser Leu Thr Phe Cys Val Gln Val Gln Gly Lys Ser 405 410 415 Lys Arg Glu Lys Lys Asp Arg Val Phe Thr Asp Lys Thr Ser Ala Thr 420 425 430 Val Ile Cys Arg Lys Asn Ala Ser Ile Ser Val Arg Ala Gln Asp Arg 435 440 445 Tyr Tyr Ser Ser Ser Trp Ser Glu Trp Ala Ser Val Pro Cys Ser Gly 450 455 460 Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Arg Asn 465 470 475 480 Leu Pro Val Ala Thr Pro Asp Pro Gly Met Phe Pro Cys Leu His His 485 490 495 Ser Gln Asn Leu Leu Arg Ala Val Ser Asn Met Leu Gln Lys Ala Arg 500 505 510 Gln Thr Leu Glu Phe Tyr Pro Cys Thr Ser Glu Glu Ile Asp His Glu 515 520 525 Asp Ile Thr Lys Asp Lys Thr Ser Thr Val Glu Ala Cys Leu Pro Leu 530 535 540 Glu Leu Thr Lys Asn Glu Ser Cys Leu Asn Ser Arg Glu Thr Ser Phe 545 550 555 560 Ile Thr Asn Gly Ser Cys Leu Ala Ser Arg Lys Thr Ser Phe Met Met 565 570 575 Ala Leu Cys Leu Ser Ser Ile Tyr Glu Asp Leu Lys Met Tyr Gln Val 580 585 590 Glu Phe Lys Thr Met Asn Ala Lys Leu Leu Met Asp Pro Lys Arg Gln 595 600 605 Ile Phe Leu Asp Gln Asn Met Leu Ala Val Ile Asp Glu Leu Met Gln 610 615 620 Ala Leu Asn Phe Asn Ser Glu Thr Val Pro Gln Lys Ser Ser Leu Glu 625 630 635 640 Glu Pro Asp Phe Tyr Lys Thr Lys Ile Lys Leu Cys Ile Leu Leu His 645 650 655 Ala Phe Arg Ile Arg Ala Val Thr Ile Asp Arg Val Met Ser Tyr Leu 660 665 670 Asn Ala Ser His His His His His His His 675 680 <210> 122 <211> 2046 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 122 gggcagcccc gagaaccaca ggtgtacacc ctgcccccat cccgggatga gctgaccaag 60 aaccaggtca gcctgacctg cctggtcaaa ggcttctatc ccagcgacat cgccgtggag 120 tgggagagca atgggcagcc ggagaacaac tacaagacca cgcctcccgt gctggactcc 180 gacggctcct tcttcctcta cagcaagctc accgtggaca agagcaggtg gcagcagggg 240 aacgtcttct catgctccgt gatgcatgag gctctgcaca accactacac gcagaagagc 300 ctctccctgt ctccgggtaa acgcgctaag cggtcaggtt caggcttgaa tttcgacctc 360 ctcaaactgg ccggggatgt cgagagcaat ccgggaccat ctagaatgtg ccatcagcag 420 ctggtgatta gctggtttag cctggtgttt ctggcgagcc cgctggtggc gatttgggaa 480 ctgaaaaaag atgtgtatgt ggtggaactg gattggtatc ctgatgcgcc gggcgaaatg 540 gtggtgctga cctgcgatac cccggaagaa gatggcatta cctggaccct ggatcagagc 600 agcgaagtgc tgggcagcgg caaaaccctg accattcagg tgaaagaatt tggcgatgcg 660 ggccagtata cctgtcataa aggaggcgaa gtcctgagtc atagcctgct gctgctgcat 720 aaaaaagaag atggcatttg gagcaccgat attctgaaag atcagaaaga accgaaaaac aaaacctttc tgcgctgcga agcgaaaaac tatagtgga gatttacctg ctggtggctg accaccatta gcaccgatct gacctttagc gtgaaaagca gccgcggcag cagcgatccg cagggcgtga cctgcggcgc ggcgaccctg agcgcggaga cgataacaaa gaatatgaat atagcgtgga atgccaggaa gatagcgcgt gcccggcggc ggaagaaagc ctgccgattg aagtgatggt ggatgcggtg cataaactga aatatgaaaa ctataccagc agctttttta ttcgcgatat tattaacct gaccctccga aaaacctgca gctgaaacccg ctgaaaaaca gccgccaggt ggaagtgagc tgggaatacc cagatacctg gagcaccccg catagctatt ttagcctgac cttttgcgtg caggtgcagg gcaaaagcaa acgcgaaaaa aaagatcgcg tgtttaccga taaaaccagc gcgaccgtga tttgccgcaa aaacgcgagc attagcgtgc gcgcgcagga tcgctattat agcagcagct ggagcgaatg ggcgagcgtg 1380 ccgtgcagcg gcggaggtgg aagtggaggt ggaggatcag gtggaggtgg aagccgcaac 1440 ctgccggtgg cgaccccaga tccaggcatg tttccgtgcc tgcatcatag ccagaacctg 1500 ctgcgcgcgg tgagcaacat gctgcagaaa gcgcgccaga ccctggaatt ttatccgtgc 1560 accagcgaag aaattgatca tgaagatatt accaaagata aaaccagcac cgtggaagcg 1620 tgcctgccgc tggaactgac caaaaacgaa agctgcctga acagccgcga aaccagcttt 1680 attaccaacg gcagctgcct ggcgagccgc aaaaccagct ttatgatggc gctgtgcctg 1740 agcagcattt atgaagatct gaaaatgtat caggtggaat ttaaaaccat gaacgcgaaa 1800 ctgctgatgg accctaaacg ccagattttt ctggatcaga acatgctggc ggtgattgat 1860 gaactgatgc aggcgctgaa ctttaacagc gaaaccgtgc cgcagaaaag cagcctggaa 1920 gaaccggatt tttataaaac caaaattaaa ctgtgcattc tgctgcatgc gtttcgcatt 1980 cgcgctgtga ccatcgatcg cgtgatgagc tatctgaacg cgagccatca ccaccatcat 2040 caccat 2046 <210> 123 <211> 643 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 123 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp 1 5 10 15 Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 20 25 30 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys Gly Gly G...

Claims

1. An isolated multispecific antibody or antigen-binding fragment that binds to the human programmed cell death 1 (PD-1) protein and the interleukin-12 (IL-12) receptor, comprising VH CDR1 containing the amino acid sequence of SEQ ID NO: 31, VH CDR2 containing the amino acid sequence of SEQ ID NO: 33, VH CDR3 containing the amino acid sequence of SEQ ID NO: 35, VL CDR1 containing the amino acid sequence of SEQ ID NO: 37, VL CDR2 containing the amino acid sequence of SEQ ID NO: 39, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 41, and An isolated multispecific antibody or its antigen-binding fragment further comprising a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO:

129.

2. An isolated multispecific antibody or antigen-binding fragment thereof, wherein the antibody is bound to PD-1 and comprises a heavy chain and a light chain, the heavy chain comprising VH CDR1 containing the amino acid sequence of SEQ ID NO: 31, VH CDR2 containing the amino acid sequence of SEQ ID NO: 33, and VH CDR3 containing the amino acid sequence of SEQ ID NO: 35, and comprising an amino acid sequence identical to or more than SEQ ID NO: 3, and the light chain comprising VL CDR1 containing the amino acid sequence of SEQ ID NO: 37, VL CDR2 containing the amino acid sequence of SEQ ID NO: 39, and VL CDR3 containing the amino acid sequence of SEQ ID NO: 41, and comprising an amino acid sequence identical to or more than SEQ ID NO: 4, and the antibody is bound to an interleukin-12 (IL-12) receptor and comprises a constant region, a linker, and an IL-12 amino acid sequence having at least 90% identity with SEQ ID NO:

129.

3. A nucleic acid encoding the antibody according to claim 1 or 2.

4. A pharmaceutical composition comprising an antibody or antigen-binding fragment according to claim 1 or 2, and a pharmaceutically acceptable carrier or excipient.

5. An isolated cell comprising one or more polynucleotides encoding the antibody or its antigen-binding fragment according to claim 1 or 2.

6. A vector comprising the nucleic acid described in claim 3.

7. A cell comprising the vector according to claim 6.

8. A kit for use in a method of treating cancer in a subject, comprising the pharmaceutical composition according to claim 4, a syringe, needle or applicator for administering the at least one antibody to a subject, and instructions for use.

9. A modified cell comprising a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an extracellular ligand-binding domain specific to an antigen on the surface of a cancer cell, the antigen comprises PD-1, and the extracellular ligand-binding domain comprises the antibody or antigen-binding fragment thereof as described in claim 1 or 2.

10. The manipulated cells according to claim 9, wherein the manipulated cells include T cells, NK cells, or NKT cells.

11. The pharmaceutical composition according to claim 4, further comprising at least one additional therapeutic agent.

12. The pharmaceutical composition according to claim 11, wherein the therapeutic agent is a toxin, a radiolabeled substance, siRNA, a small molecule, or a cytokine.

13. The manipulated cell according to claim 10, wherein the T cell is a CD4+, CD8+, CD3+ panT cell, or any combination thereof.

Images