Chimeric antigen receptors that target EGFR

Abstract

Provided are chimeric antigen receptors (CARs) that target EGFR, CAR-T cells containing the CARs, and methods for preparing and using the same.

Description

[Technical Field]

[0001] This invention relates to the field of biomedicine. Specifically, it relates to EGFR-targeting chimeric antigen receptors (CARs), CAR-T cells containing such CARs, and methods for preparing and using the same. [Background technology]

[0002] The human epidermal growth factor receptor (also known as HER-1 or Erb-B1, and referred to herein as "EGFR") is a 170 kDa transmembrane receptor encoded by the c-erbB oncogene, exhibiting intrinsic tyrosine kinase activity. EGFR regulates a variety of cellular processes through tyrosine kinase-mediated signaling pathways, including, but not limited to, the activation of signaling pathways that control cell proliferation, differentiation, cell survival, apoptosis, angiogenesis, mitosis, and metastasis.

[0003] Studies have shown that increased EGFR gene copy number and overexpression may promote the malignant transformation of normal cells and the metastasis of malignant tumors, indicating that the EGFR signaling network plays a crucial role in tumor formation and development. EGFR overexpression has already been reported in studies of many human malignancies, including lung cancer, pancreatic cancer, colorectal cancer, gastric cancer, and breast cancer. In addition, clinical studies have shown that EGFR overexpression is associated with poor patient prognosis. EGFR is already a specific target for antitumor therapy.

[0004] Several drugs targeting EGFR have been approved for the clinical treatment of human malignancies. These drugs are mainly classified into two categories: the first category consists of monoclonal antibody drugs that block the extracellular functional domain of EGFR, such as cetuximab, panitumumab, and nimotuzumab; the second category consists of small molecule tyrosine kinase inhibitors that target the intracellular domain of EGFR, such as gefitinib, erlotinib, and afatinib. While the safety and clinical efficacy of these drugs have already been demonstrated, their antitumor effects are often not as effective as expected, and problems such as the time-dependent decline in blood concentrations of monoclonal antibody-targeted drugs, low target response rates, and EGFR mutations have been observed. [Overview of the project] [Problems that the invention aims to solve]

[0005] Therefore, there is still a need for new drugs and therapies to treat EGFR-related malignancies in this field. [Means for solving the problem]

[0006] Summary of the Invention In one embodiment, the present invention provides an EGFR-targeting chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain that specifically targets EGFR, wherein the extracellular antigen-binding domain comprises a heavy chain variable region (VH) and a light chain variable region (VL), where, i) The VH includes VH-CDR1 shown in SEQ ID NO: 1, VH-CDR2 shown in SEQ ID NO: 2, and VH-CDR3 shown in SEQ ID NO: 3, and the VL includes VL-CDR1 shown in SEQ ID NO: 4, VL-CDR2 shown in SEQ ID NO: 5, and VL-CDR3 shown in SEQ ID NO: 6; ii) The VH includes VH-CDR1 shown in SEQ ID NO: 10, VH-CDR2 shown in SEQ ID NO: 11, and VH-CDR3 shown in SEQ ID NO: 12, and the VL includes VL-CDR1 shown in SEQ ID NO: 13, VL-CDR2 shown in SEQ ID NO: 14, and VL-CDR3 shown in SEQ ID NO: 16; iii) The VH includes VH-CDR1 shown in SEQ ID NO: 19, VH-CDR2 shown in SEQ ID NO: 20, and VH-CDR3 shown in SEQ ID NO: 21, and the VL includes VL-CDR1 shown in SEQ ID NO: 22, VL-CDR2 shown in SEQ ID NO: 23, and VL-CDR3 shown in SEQ ID NO: 24; iv) The VH includes VH-CDR1 shown in SEQ ID NO: 28, VH-CDR2 shown in SEQ ID NO: 29, and VH-CDR3 shown in SEQ ID NO: 30, and the VL includes VL-CDR1 shown in SEQ ID NO: 31, VL-CDR2 shown in SEQ ID NO: 32, and VL-CDR3 shown in SEQ ID NO: 33; v) The VH includes VH-CDR1 shown in SEQ ID NO: 37, VH-CDR2 shown in SEQ ID NO: 38, and VH-CDR3 shown in SEQ ID NO: 39, and the VL includes VL-CDR1 shown in SEQ ID NO: 40, VL-CDR2 shown in SEQ ID NO: 41, and VL-CDR3 shown in SEQ ID NO: 42; or vi) The VH includes VH-CDR1 shown in SEQ ID NO: 46, VH-CDR2 shown in SEQ ID NO: 47, and VH-CDR3 shown in SEQ ID NO: 48, and the VL includes VL-CDR1 shown in SEQ ID NO: 49, VL-CDR2 shown in SEQ ID NO: 50, and VL-CDR3 shown in SEQ ID NO: 51.

[0007] In some embodiments, i) The VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 8; ii) The VH comprises the amino acid sequence shown in SEQ ID NO: 16, and the VL comprises the amino acid sequence shown in SEQ ID NO: 17; iii) the VH contains the amino acid sequence shown in SEQ ID NO: 25 and the VL contains the amino acid sequence shown in SEQ ID NO: 26; iv) the VH contains the amino acid sequence shown in SEQ ID NO: 34 and the VL contains the amino acid sequence shown in SEQ ID NO: 35; v) the VH contains the amino acid sequence shown in SEQ ID NO: 43 and the VL contains the amino acid sequence shown in SEQ ID NO: 44; or vi) the VH contains the amino acid sequence shown in SEQ ID NO: 52 and the VL contains the amino acid sequence shown in SEQ ID NO: 53.

[0008] In some embodiments, the extracellular antigen-binding domain comprises a single-chain Fv fragment (scFv).

[0009] In some embodiments, the scFv contains an amino acid sequence selected from SEQ ID NOs: 9, 18, 27, 36, 45, and 54.

[0010] In some embodiments, the CAR further comprises a CD8α signal peptide at the N-terminus, for example, the CD8α signal peptide contains the amino acid sequence of SEQ ID NO: "55".

[0011] In some embodiments, the CAR further comprises a transmembrane domain such as the CD8α transmembrane domain, for example, the CD8α transmembrane domain contains the amino acid sequence of SEQ ID NO: 57.

[0012] In some embodiments, the CAR further comprises a hinge region located between the extracellular antigen-binding domain and the transmembrane domain, for example, the hinge region is the CD8α hinge region, for example, the CD8α hinge region contains the amino acid sequence of SEQ ID NO: 56.

[0013] In some embodiments, the CAR further comprises a signaling domain such as the CD3ζ signaling domain, for example, the CD3ζ signaling domain contains the amino acid sequence shown in SEQ ID NO: 59.

[0014] In some embodiments, the CAR further comprises one or more co-stimulatory domains such as a 4-1BB co-stimulatory domain. For example, the 4-1BB co-stimulatory domain comprises the amino acid sequence of SEQ ID NO: 58.

[0015] In some embodiments, the CAR comprises an amino acid sequence selected from SEQ ID NOs: 60-65.

[0016] In one aspect, the present invention provides a therapeutic T cell comprising the CAR of the present invention.

[0017] In some embodiments, TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) in the therapeutic T cells are knocked down or knocked out.

[0018] In some embodiments, the therapeutic T cells can specifically lyse tumor cells expressing EGFR in vitro at an effector-target ratio of about 0.2:1 to about 0.00625:1, for example, about 0.2:1, about 0.1:1, about 0.05:1, about 0.025:1, about 0.0125:1, and about 0.00625:1.

[0019] In one aspect, the present invention provides the use of the therapeutic T cells of the present invention in the preparation of a drug for treating EGFR-related cancer.

[0020] In one aspect, the present invention provides a pharmaceutical composition for treating EGFR-related cancer in a subject, comprising a therapeutically effective amount of the therapeutic T cells of the present invention and a pharmaceutically acceptable carrier.

[0021] In one aspect, the present invention provides a method for treating EGFR-related cancer, comprising administering to a subject in need thereof a therapeutically effective amount of the therapeutic T cells of the present invention or the pharmaceutical composition of the present invention.

[0022] In some embodiments, the method further includes administering radiotherapy and / or chemotherapy and / or another tumor-targeting drug and / or immunotherapy to the subject.

[0023] In some embodiments of each aspect of the present invention, the EGFR-related cancer is selected from esophageal cancer, gastric cancer, colon cancer, rectal cancer, colorectal cancer, pancreatic cancer, lung cancer (including non-small cell lung cancer NSCLC), breast cancer, cervical cancer, uterine cancer, endometrial cancer, ovarian cancer, bladder cancer, head and neck cancer (including head and neck squamous cell carcinoma SCCHN), osteosarcoma, prostate cancer, neuroblastoma, nephroma, glioma, glioblastoma, and skin cancer (including epithelial carcinoma).

[0024] In one embodiment, the present invention provides a polynucleotide comprising a nucleotide sequence encoding the CAR of the present invention. In some embodiments, the polynucleotide comprises a nucleotide sequence selected from SEQ ID NOs. 66 to 71.

[0025] In one embodiment, the present invention provides an expression construct comprising a regulatory sequence and a polynucleotide of the present invention operably linked thereto.

[0026] In one embodiment, the present invention provides a method for preparing therapeutic T cells, the method comprising the following steps: a) A step of providing isolated T cells; and b) A step of introducing the polynucleotide or expression construct of the present invention into the T cells, thereby causing the T cells to express the CAR of the present invention. Includes.

[0027] In some embodiments, the method is x) A step of knocking down or knocking out TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) in the T cells. It also includes. [Brief explanation of the drawing]

[0028] [Figure 1]Figure 1 is a schematic diagram of the target gene sequence of the lentiviral vector for anti-EGFR CAR. [Figure 2] Figure 2 shows the detection of the positivity rates of six types of anti-EGFR CAR-T cells. [Figure 3] Figure 3 shows that six types of humanized anti-EGFR CAR-T cells were co-cultured in vitro with CRL-5826 cells for an extended period, and the luciferase content of CRL-5826 cells was measured to quantify the tumor-killing value (N=4, SEM). [Figure 4] Figure 4 shows a comparison of the in vitro function of six types of humanized anti-EGFR CAR-T cells: in vitro stress test experiment of six types of humanized anti-EGFR CAR-T cells. CAR-T cells were collected from the sterilization sample well every other day, and new tumor target cells were added in an E:T=2:1 ratio, and the sterilization rate was detected (target cells: CRL-5826, E:T=2:1, 50% CAR-T positivity rate, N=4, SEM). [Figure 5] Figure 5 shows a comparison of the in vivo function of six types of humanized anti-EGFR CAR-T cells: A) Experimental process for NPG mice. Tumor cell inoculation: 2 × 10⁶ / mouse, CAR-T cell injection dose: 1 × 10⁷ / mouse, 50% CAR-positive, iv: tail vein injection, 5 NPG mice in each group. B) Changes in tumor volume in mice (N=5, SEM). [Figure 6] Figure 6 shows a comparison of the in vitro function of humanized hu806 CAR-T cells and mouse-derived m806 CAR-T cells. CAR-T cells were co-cultured in vitro with CRL-5826 cells for an extended period, and the luciferase content of CRL-5826 cells was detected to quantify the tumor-killing value (N=4, SEM). [Figure 7] Figure 7 shows hu806 CAR-T cells in which TGF-β receptor II has been knocked out. A) The knockout efficiency of hu806-TKO CAR-T cells was detected by the TIDE method. B) The positivity rates of hu806 CAR-T and hu806-TKO CAR-T cells were detected by flow cytometry. [Figure 8-1]Figure 8 shows the detection of the killing function of hu806 CAR-T cells with TGF-β receptor II knocked out. A) Detection of long-term killing of CRL-5826 cells in vitro. Final TGF-β concentration: 5 ng / μl, (N=4, SEM). B. Detection of 4th and 5th killing of hu806 CAR-T and hu806-TKO CAR-T cells. Final concentration of additional TGF-β: 5 ng / μl. (N=4, SEM). C) Cell proliferation statistics of hu806 and hu806-TKO CAR-T cells in stress test experiments. [Figure 8-2] This is a continuation of Figure 8-1. [Figure 9] Figure 9 shows in vivo experiments with mice. A) Injection of various doses of CAR-T cells into the tail vein of NPG mice resulted in changes in tumor size, and tumor size continued to change after reinjection. Five mice were injected with CAR-T cells in each group, and the positive rate was 50%. B) Human CD3 content in the peripheral blood of mice in each experimental group and the PBS group was detected by flow cytometry. [Figure 10-1] Figure 10 shows the analysis of various subtypes of huCD3 in mice. A) Tumor size changed after CAR-T cells (1 × 10⁷ cells / mouse, 50% CAR positive) were injected into the tail vein of NPG mice. CAR-T cells were prepared using #4 donor peripheral blood with strong in vivo amplification ability. Each group consisted of 5 mice. B) Human CD3 content in the peripheral blood of mice in each experimental group and the PBS group was detected by flow cytometry. C) The proportion of T cell subtypes in the peripheral blood of mice was detected by flow cytometry. D) The proportion of huCD4 and huCD8 relative to huCD3 in the peripheral blood of mice was detected by flow cytometry. Peripheral blood was collected from two groups of mice for analysis on days 21, 28, 36, and 42. [Figure 10-2] This is a continuation of Figure 10-1. [Figure 11-1]Figure 11 shows in vivo therapeutic dose experiments of Hu806-TKO CAR-T cells in tumor-bearing NPG mice. A) Various doses of CAR-T cells (2×10⁶ CAR+ cells / mouse, 1×10⁶ CAR+ cells / mouse, 0.5×10⁶ CAR+ cells / mouse, and 0.25×10⁶ CAR+ cells / mouse, respectively) were injected into the tail vein of NPG mice, and tumor size changed. After the tumor completely disappeared, reinoculation altered the tumor size. Each group consisted of 5 mice. B) Human CD3 content in the peripheral blood of mice in each experimental group and the control group was detected by flow cytometry. [Figure 11-2] This is a continuation of Figure 11-1. [Figure 12] Figure 12 shows the detection of off-target safety of Hu806 CAR-T cells. A) Flow cytometry detection of lung squamous cell carcinoma cell line CRL-5826, human dermal fibroblasts "fibroblasts", and leukemia cell line K562. Staining antibodies: anti-EGFR antibody-PE and 806 antibody-PE. B) Detection of in vitro killing function of Hu806 CAR-T cells against three types of cells. A detection method using real-time unlabeled cell analysis technology (N=2, SEM) was employed. [Figure 13-1] Figure 13 shows the correspondence between the amino acid and nucleotide sequences of m806 scFv and CAR. [Figure 13-2] This is a continuation of Figure 13-1. [Figure 13-3] This is a continuation of Figure 13-2. [Modes for carrying out the invention]

[0029] Detailed description of the invention Unless otherwise indicated or defined, all terms used have their ordinary meanings in the art, and their meanings can be understood by those skilled in the art. References can be made to standard manuals such as Sambrook et al., "Molecular Cloning: A Laboratory Manual"; Lewin, "Genes VIII"; and Roitt et al., "Immunology" (8th edition), as well as to the general existing art referenced herein; in addition, unless otherwise specified, all methods, processes, techniques, and operations not specifically detailed can and have been performed in known ways that can be understood by those skilled in the art. References can also be made to standard manuals, the general existing art mentioned above, and other references cited therein.

[0030] As used herein, the term "and / or" should be considered to encompass all combinations of items linked by this term, each of which is already listed separately herein. For example, "A and / or B" includes "A", "A and B", and "B". For example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0031] Where the term “comprises / comprising” is used herein to describe a protein or nucleic acid sequence, that protein or nucleic acid may consist of that sequence, or may have additional amino acids or nucleotides at one or both ends of that protein, but still possess the activity described in the present invention. In addition, those skilled in the art will be aware that methionine encoded by the N-terminal start codon of a peptide may be retained in some practical situations (such as when expressed in a particular expression system), but this does not substantially affect the function of the peptide. Therefore, when describing a particular amino acid sequence in the specification and claims of this application, it may not include the N-terminal methionine encoded by the start codon, but it may also include sequences that contain methionine. Correspondingly, the nucleotide sequence encoded therein may also include the start codon, and vice versa.

[0032] In a first embodiment, the present invention provides an EGFR-targeting chimeric antigen receptor (CAR) comprising an extracellular antigen-binding domain that specifically targets EGFR, wherein the extracellular antigen-binding domain comprises a heavy chain variable region (VH) and a light chain variable region (VL), where, i) The VH includes VH-CDR1 shown in SEQ ID NO: 1, VH-CDR2 shown in SEQ ID NO: 2, and VH-CDR3 shown in SEQ ID NO: 3, and the VL includes VL-CDR1 shown in SEQ ID NO: 4, VL-CDR2 shown in SEQ ID NO: 5, and VL-CDR3 shown in SEQ ID NO: 6; ii) The VH includes VH-CDR1 shown in SEQ ID NO: 10, VH-CDR2 shown in SEQ ID NO: 11, and VH-CDR3 shown in SEQ ID NO: 12, and the VL includes VL-CDR1 shown in SEQ ID NO: 13, VL-CDR2 shown in SEQ ID NO: 14, and VL-CDR3 shown in SEQ ID NO: 16; iii) The VH includes VH-CDR1 shown in SEQ ID NO: 19, VH-CDR2 shown in SEQ ID NO: 20, and VH-CDR3 shown in SEQ ID NO: 21, and the VL includes VL-CDR1 shown in SEQ ID NO: 22, VL-CDR2 shown in SEQ ID NO: 23, and VL-CDR3 shown in SEQ ID NO: 24; iv) The VH includes VH-CDR1 shown in SEQ ID NO: 28, VH-CDR2 shown in SEQ ID NO: 29, and VH-CDR3 shown in SEQ ID NO: 30, and the VL includes VL-CDR1 shown in SEQ ID NO: 31, VL-CDR2 shown in SEQ ID NO: 32, and VL-CDR3 shown in SEQ ID NO: 33; v) The VH includes VH-CDR1 shown in SEQ ID NO: 37, VH-CDR2 shown in SEQ ID NO: 38, and VH-CDR3 shown in SEQ ID NO: 39, and the VL includes VL-CDR1 shown in SEQ ID NO: 40, VL-CDR2 shown in SEQ ID NO: 41, and VL-CDR3 shown in SEQ ID NO: 42; or vi) The VH includes VH-CDR1 shown in SEQ ID NO: 46, VH-CDR2 shown in SEQ ID NO: 47, and VH-CDR3 shown in SEQ ID NO: 48, and the VL includes VL-CDR1 shown in SEQ ID NO: 49, VL-CDR2 shown in SEQ ID NO: 50, and VL-CDR3 shown in SEQ ID NO: 51.

[0033] In some embodiments, the extracellular antigen-binding domain comprises VH and VL, where, i) The VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 8; ii) The VH comprises the amino acid sequence shown in SEQ ID NO: 16, and the VL comprises the amino acid sequence shown in SEQ ID NO: 17; iii) The VH comprises the amino acid sequence shown in SEQ ID NO: 25, and the VL comprises the amino acid sequence shown in SEQ ID NO: 26; iv) The VH comprises the amino acid sequence shown in SEQ ID NO: 34, and the VL comprises the amino acid sequence shown in SEQ ID NO: 35; v) The VH comprises the amino acid sequence shown in SEQ ID NO: 43, and the VL comprises the amino acid sequence shown in SEQ ID NO: 44; or vi) The VH comprises the amino acid sequence shown in SEQ ID NO: 52, and the VL comprises the amino acid sequence shown in SEQ ID NO: 53.

[0034] In some embodiments, the extracellular antigen-binding domain includes a single-stranded Fv fragment (scFv).

[0035] In some embodiments, the VH and VL are linked by a linker. In some embodiments, the linker is a flexible peptide linker. In some embodiments, the linker includes the amino acid sequence shown in SEQ ID NO: 72.

[0036] In some embodiments, the scFv includes an amino acid sequence selected from SEQ ID NOs: 9, 18, 27, 36, 45, and 54.

[0037] In some embodiments, the CAR further comprises a CD8α signal peptide at its N-terminus. In some embodiments, the CD8α signal peptide comprises the amino acid sequence of SEQ ID NO: 55.

[0038] In some embodiments, the CAR further comprises a transmembrane domain such as a CD8α transmembrane domain or a CD28 transmembrane domain. In some embodiments, the CAR comprises a CD8α transmembrane region. In some embodiments, the CD8α transmembrane region comprises the amino acid sequence of SEQ ID NO: 57.

[0039] In some embodiments, the CAR further includes a hinge region located between the extracellular antigen-binding domain and the transmembrane domain, for example, the hinge region being a CD8α hinge region. In some embodiments, the CD8α hinge region includes the amino acid sequence of SEQ ID NO: 56.

[0040] In some embodiments, the CAR further includes a signaling domain, such as a signaling domain that can be used for T cell activation, and a signaling domain selected from TCRζ, FcRγ, FcRβ, FcRε, CD3γ, CD3δ, CD3ε, CD3ζ, CD5, CD22, CD79a, CD79b, and CD66d. In some preferred embodiments, the CAR includes a CD3ζ signaling domain, for example, the CD3ζ signaling domain includes the amino acid sequence shown in Sequence ID No. 59.

[0041] In some embodiments, the CAR further comprises one or more co-stimulatory domains, such as a co-stimulatory domain selected from CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, and 4-1BBL. In some embodiments, the CAR further comprises a 4-1BB co-stimulatory domain. In some embodiments, the 4-1BB co-stimulatory domain comprises the amino acid sequence of SEQ ID NO: 58.

[0042] In some implementations, the CAR comprises an extracellular antigen-binding domain, a CD8α hinge region, a CD8α transmembrane region, a 4-1BB costimulatory domain, and an EGFR-targeting CD3ζ signaling domain, and optionally a CD8α signal peptide at its N-terminus.

[0043] In some specific embodiments, the CAR comprises an amino acid sequence selected from SEQ ID NOs. 60-65.

[0044] In another embodiment, the present invention provides a polynucleotide comprising a nucleotide sequence encoding the CAR of the present invention. In some embodiments, the polynucleotide comprises a nucleotide sequence selected from SEQ ID NOs. 66 to 71.

[0045] In another embodiment, the present invention provides an expression construct comprising a polynucleotide of the present invention operably linked to a regulatory sequence.

[0046] The “expression construct” of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or a translatable RNA (such as mRNA). In some preferred embodiments, the expression construct is a viral vector, such as a lentiviral vector.

[0047] The terms “regulatory sequence” and “regulatory element” may be used interchangeably to refer to nucleotide sequences located upstream (5' non-coding sequence), midway, or downstream (3' non-coding sequence) of a coding sequence that affect the transcription, RNA processing, or stability or translation of the coding sequence in question. A regulatory element refers to a nucleotide sequence that can control the transcription, RNA processing, or stability or translation of the nucleotide sequence involved. Regulatory sequences may include, but are not limited to, promoters, translational leader sequences, introns, enhancers, and polyadenylation recognition sequences.

[0048] As used herein, the term “operatably linked” refers to a linkage between a regulatory element (such as a promoter sequence and a transcription termination sequence, but not limited to these) and a nucleic acid sequence (such as a coding sequence or open reading frame), so that the transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. Techniques for operatably linking regulatory element regions to nucleic acid molecules are known in the art.

[0049] In another embodiment, the present invention provides therapeutic T cells comprising the CAR of the present invention. In some embodiments, the CAR is expressed on the surface of the T cell membrane.

[0050] In some embodiments, the TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) on the therapeutic T cells are knocked down or knocked out.

[0051] As used herein, "TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) knocked down or knocked out in therapeutic T cells" means that, compared to control T cells, the expression of TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) in the therapeutic T cells of the present invention is downregulated or absent, or the activity of TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) is reduced or inactivated (antagonized, etc.). As used herein, knockdown or knockout may be at the genomic, transcriptional, translational, or posttranslational level.

[0052] In some embodiments of each aspect of the present invention, the therapeutic T cells are derived from the subject's own cells. As used herein, “self” means that the cells, cell lines, or cell population used to treat the subject are derived from the subject. In some embodiments, the therapeutic T cells are derived from allogeneic cells, for example, from a donor subject whose human leukocyte antigen (HLA) matches that of the subject to be treated. Cells from the donor subject can be converted to non-allogeneic reactive cells using a standard scheme and replicated as needed to produce cells applicable to one or more subjects.

[0053] In some embodiments, the T cells are derived from a healthy subject. In some embodiments, the T cells are derived from a subject with cancer.

[0054] The T cells described in the context of the present invention may be derived from inflammatory T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, and / or helper T lymphocytes. In some embodiments, the T cells described in the context of the present invention are CD4 + T lymphocytes and / or CD8 + It may originate from T lymphocytes.

[0055] In the context of the present invention, T cells can be obtained from many non-limiting sources by various non-limiting methods, including peripheral blood monocytes, bone marrow, lymph node tissue, umbilical cord blood, thymic tissue, ascites, pleural fluid, splenic tissue, and tumors. In the context of the present invention, T cells may also be part of a mixed population of cells exhibiting different phenotypic features.

[0056] The therapeutic T cells of the present invention can specifically lyse EGFR-expressing tumor cells in vitro. For example, by co-culturing the therapeutic T cells of the present invention with EGFR-expressing tumor cells in vitro, the EGFR-expressing tumor cells can be effectively and specifically lysed at effector-target ratios of approximately 0.2:1 to approximately 0.00625:1, for example, approximately 0.2:1, approximately 0.1:1, approximately 0.05:1, approximately 0.025:1, approximately 0.0125:1, and approximately 0.00625:1 (therapeutic T cells:EGFR-expressing tumor cells). For example, after co-culturing for 1, 2, 3, 4, 5, 6, or 7 days, at least approximately 10%, at least approximately 20%, at least approximately 30%, at least approximately 40%, at least approximately 50%, at least approximately 60%, at least approximately 70%, at least approximately 80%, and even at least approximately 90% or more of the EGFR-expressing tumor cells are lysed.

[0057] As used in the context of this application, “Subject” means an organism that is suffering from or susceptible to a disease that can be treated by the cells, pharmaceutical compositions, or methods of the present invention (e.g., cancer, such as EGFR-related cancer). Examples, not limited to, include humans, cattle, rats, mice, cats, dogs, monkeys, goats, sheep, and other non-mammals. In preferred embodiments, the subject is human.

[0058] In another embodiment, the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of the therapeutic T cells of the present invention and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is used to treat EGFR-related cancer in a subject.

[0059] As used herein, “pharmaceutically acceptable carriers” include all physiologically compatible solvents, dispersions, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption retarders. Preferably, carriers are suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion).

[0060] In another embodiment, the present invention provides the use of therapeutic T cells in the preparation of drugs for treating EGFR-related cancers.

[0061] In another embodiment of the present invention, a method for treating EGFR-related cancer is further provided, comprising administering a therapeutically effective amount of the therapeutic T cells or the pharmaceutical composition of the present invention to a subject requiring such treatment.

[0062] In some implementations, the method further includes administering radiotherapy and / or chemotherapy and / or another tumor-targeting drug (such as a monoclonal antibody or small molecule compound that targets another antigen) and / or immunotherapy (such as an immune checkpoint inhibitor) to the subject.

[0063] As used herein, “therapeutically effective amount,” “therapeutic effective dose,” or “effective amount” means the amount of substance, compound, material, or cells that is at least sufficient to produce a therapeutic effect after administration to a subject. Thus, it is the amount necessary to prevent, cure, improve, block, or partially block a disease or its symptoms. As used herein, treatment also includes preventing the recurrence of a disease (such as cancer).

[0064] For example, an "effective amount" of the cells or pharmaceutical composition of the present invention preferably leads to a reduction in the severity of disease symptoms, an increase in the frequency and asymptomatic period of the disease, or prevention of injury or disability caused by the pain of the disease. For example, in the treatment of tumors, an "effective amount" of the cells or pharmaceutical composition of the present invention preferably inhibits tumor cell proliferation or tumor growth by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, more preferably at least about 80%, and more preferably at least about 90% compared to an untreated subject. The ability to inhibit tumor growth can be evaluated in animal model systems that predict therapeutic effects on human tumors. Alternatively, it can be evaluated by examining the ability to inhibit tumor cell proliferation, and this inhibition can be determined in vitro by experiments well known to those skilled in the art.

[0065] In practical applications, the dose level of cells in the pharmaceutical composition of the present invention can be modified to obtain the amount and mode of administration of the active ingredient composition that is non-toxic to patients and effectively achieves the desired therapeutic response for a specific target. The dose level can be selected according to various pharmacokinetic factors, including the activity of the specific composition of the present invention used, the route of administration, the timing of administration, the excretion rate of the specific compound used, the duration of treatment, other drugs, compounds and / or materials used in combination with the specific composition used, the age, sex, weight, condition, overall health status and medical history of the person being treated, and similar factors well known in the medical field.

[0066] As used herein, a therapeutically effective amount of therapeutic T cells refers to an amount of therapeutic T cells that can reduce the amount of tumor cells after use, for example, an amount that can reduce the amount of tumor cells by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, and at least about 90%, or an amount that can achieve a complete remission of cancer. In some embodiments of each aspect of the present invention, the effective amount of therapeutic T cells is about 10 4 ~about 10 9 cells, for example, about 10 4 , about 10 5 , about 10 6 , about 10 7 , about 10 8 , or about 10 9 cells. In some embodiments, the dosage of the therapeutic T cells is determined according to the weight of the subject, for example, about 10 4 cells / kg body weight to about 10 9 cells / kg body weight, for example, about 10 4 , about 10 5 , about 10 6 , about 10 7 , about 10 8 , or about 10 9 cells / kg body weight.

[0067] From the research results of the present inventors, it has been shown that the therapeutic T cells of the present invention in which the TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) are knocked down or knocked out can achieve a better therapeutic effect with a lower dosage as compared with control T cells (in which the TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) are not knocked down or knocked out). For example, the therapeutic T cells having the TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) of the present invention can achieve a better antitumor effect at a lower effector-target ratio and / or for a longer period than control T cells. This is particularly beneficial for reducing the preparation time and cost, and the side effects caused by high-dose administration can also be reduced.

[0068] For example, the dosage of therapeutic T cells having a TGFβ receptor (such as TGFBRIII) according to the present invention is approximately 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 30 times, 40 times, 50 times, 80 times, 100 times, 150 times, 160 times, and 200 times or more lower than the dosage of control T cells in which the TGFβ receptor (such as TGFBRII) is not knocked down or knocked out.

[0069] The administration of cells or compositions according to the present invention can be carried out in any convenient form, including injection, infusion, implantation, or transplantation. The administration of cells or compositions described herein can be carried out intravenously, lymphatically, intradermally, intratumorally, intramedullarily, intramuscularly, or intraperitoneally. In a particular execution scheme, the cells or compositions of the present invention are preferably administered by intravenous injection.

[0070] In some embodiments of each aspect of the present invention, the EGFR-related cancer is a cancer in which tumor cells express EGFR, including, but not limited to, esophageal cancer, gastric cancer, colon cancer, rectal cancer, colorectal cancer, pancreatic cancer, lung cancer (including non-small cell lung cancer NSCLC), breast cancer, cervical cancer, uterine cancer, endometrial cancer, ovarian cancer, bladder cancer, head and neck cancer (including head and neck squamous cell carcinoma SCCHN), osteosarcoma, prostate cancer, neuroblastoma, nephroma, glioma, glioblastoma, and skin cancer (including epithelial carcinoma).

[0071] In another embodiment, the present invention provides a method for preparing therapeutic T cells, the method comprising the following steps: a) A step of providing isolated T cells; and b) A step of introducing the polynucleotide or expression construct of the present invention into the T cells, thereby causing the T cells to express the CAR of the present invention. Includes.

[0072] The step of providing isolated T cells can be carried out by methods known in the art for isolating T cells. For example, T cells can be isolated from the peripheral blood of a subject using a commercially available kit. Suitable kits include, but are not limited to, the EasySep human T cell Enrichment kit (Stemcell Technologies). As described above, the isolated T cells do not necessarily have to be homogeneous and may be a mixed population of different cells, preferably T cells are abundant in the population.

[0073] In some embodiments, the method is x) A step of knocking down or knocking out the expression of TGFβ receptors (such as TGFBRI, TGFBRII, and TGFBRIII) in the T cells. It also includes.

[0074] In some embodiments, step x) is performed before step b). In some embodiments, step x) is performed after step b).

[0075] Several methods for knocking down or knocking out protein expression in cells are known in the art. In some embodiments, the expression of the TGFβ receptor (e.g., TGFBRII) in T cells is knocked down or knocked out by introducing antisense RNA, antagomir, siRNA, and shRNA. In other embodiments, the expression of the TGFβ receptor (e.g., TGFBRII) in T cells is knocked down or knocked out by gene editing methods, for example, by introducing meganucleases, zinc finger nucleases, TALENs (transcription activator-like effector nucleases), or CRISPR systems. In a preferred embodiment of the method of the present invention, a CRISPR system is used to knock down or knock out the expression of the TGFβ receptor (e.g., TGFBRII) in T cells. In some implementations, the nuclease used by the CRISPR system (CRISPR nuclease) may be selected from, for example, Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Cas9, Csn2, Cas4, Cpf1, C2c1, C2c3, or C2c2 proteins, or functional variants of these nucleases.

[0076] The polynucleotides, expression constructs and / or proteins may be introduced into the cells by any suitable method, including electroporation; transfection using calcium chloride, rubidium chloride, calcium phosphate, DEAE-glucan or other substances; particle bombardment; liposome transfection; and infection (for example, the expression construct is a virus).

[0077] The T cells of the present invention can be activated and amplified before or after any modification step. These T cells can be amplified in vitro or in vivo.

[0078] Therefore, in some embodiments, the method is y) A step of amplifying the T cells. It also includes.

[0079] In some embodiments, step y) is performed before and / or after step b). In some embodiments, step y) is performed before and / or after step x).

[0080] Typically, the T cells of the present invention can be amplified by, for example, contacting the T cells with a reagent that stimulates a co-stimulatory molecule on the surface of the CD3 TCR complex to generate a T cell activation signal. For example, chemical substances such as the calcium ionophore A23187, phorbol 12-myristate 13-acetate (PMA), or mitotic lectins such as phytohemaglutinin (PHA) can be used to generate the T cell activation signal. In some embodiments, the T cells can be activated in vitro by, for example, contacting them with an anti-CD3 antibody or its antigen-binding fragment immobilized on their surface, or with an anti-CD2 antibody, or by contacting a calcium ionophore with a protein kinase C activator (e.g., bryostatin). For example, under conditions suitable for stimulating T cell proliferation, the T cells can be contacted with anti-CD3 antibodies and anti-CD28 antibodies. Conditions applicable to T cell culture include suitable media that may contain factors necessary for proliferation and vitality (such as minimal essential medium or RPMI medium 1640, or X-vivo 5, (Lonza)), where necessary factors include serum (such as fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-2, IL-15, TGFβ and TNF, or additives known to those skilled in the art for cell proliferation. Other additives used for cell proliferation include, but are not limited to, surfactants, human plasma protein powders, and reducing agents (e.g., N-acetylcysteine ​​and 2-mercaptoacetic acid). The culture medium may contain RPMI 1640, A1M-V, DMEM, MEM, a-MEM, F-12, X-Vivo 1 and X-Vivo 20, Optimizer, amino acids, sodium pyruvate and vitamins, serum-free or moderately supplemented serum (or plasma) or a set of established hormones, and / or a certain amount of cytokines sufficient to promote T cell growth and amplification. T cells can be maintained under conditions necessary to support proliferation, such as a suitable temperature (e.g., 37°C) and environment (e.g., air + 5% CO2).

[0081] In another embodiment, the present invention further provides a kit for preparing therapeutic T cells of the present invention. The kit of the present invention comprises the polynucleotides of the present invention, expression constructs of the present invention, and / or tools for knocking down or knocking out the expression of the TGFβ receptor (such as TGFBRII), e.g., antisense RNA, antagomir, siRNA, shRNA, meganuclease, zinc finger nuclease, TALEN (transcription activator like effector nuclease), or CRISPR system or nucleic acids or vectors encoding it. The kit may further include reagents for isolating, culturing, and / or amplifying the T cells, preparations for introducing the polynucleotides or proteins into the cells, and the like. [Examples]

[0082] The present invention will be further described below with reference to examples, but the present invention is not limited to the scope of the examples described.

[0083] Experimental materials and methods 1. CD3 + Isolation, stimulation, and amplification of T cells Fresh umbilical cord blood from healthy donors was obtained from the Beijing Umbilical Cord Blood Bank with informed consent. Mononuclear cells were isolated using human lymphocyte isolate (Tianjin Haoyang Bio-Products Technology Co., Ltd.). T cells were isolated using the EasySep human T cell Enrichment kit (Stemcell Technologies), and the isolated T cells were activated in a 1:1 ratio by adding anti-CD3 / CD28 Dynabeads (Thermo Fisher Scientific) according to the instructions for use. The culture medium for the T cells was X-VIVO15 medium (Lonza) supplemented with 5% (v / v) heat-inactivated fetal bovine serum (GIBCO) and 400 IU / mL recombinant human IL-2 (Sino-biological Inc.).

[0084] 2. Preparation of anti-EGFR CAR-T cells Seven anti-EGFR ScFv gene fragments were synthesized (Hua Da Qinglan Biotechnology Co., Ltd.), and the ScFv fragments were cloned into pRRLSIN lentiviral vectors using two enzymatic digestion sites, Bam HI and Mlu I. Three plasmid-based vector plasmids, pMD2.G and psPAX2, were co-transfected into 293T cells using Lipo3000 (Thermo Fisher Scientific). Lentiviral culture supernatants were collected at 48 and 72 hours and concentrated using a concentration column (Millipore, Amicon Ultra-15 centrifugation filter, Ultracel-100K). Human primary CD3 + T cells were stimulated with magnetic beads for 24 hours, followed by lentiviral infection. During infection, CD3 + T cell density 2 x 10 6 The solution was adjusted to / ml. Co-transfection reagent Polybrene (Sigma) was added simultaneously according to the MOI=1 ratio, and the final concentration of Polybrene was 10 μg / ml. After 48 hours of infection, the CAR-T cell positivity rate was detected by flow cytometry.

[0085] 3. Flow cytometry detection Approximately 1~10×10 5Cells were collected and stained according to the antibody company's recommended dosage. CytoFLEX (Beckman Coulter Inc.) was used for on-machine detection. The following antibodies were used: goat anti-human IgG(H+L) flow cytometry antibody Alexa Fluor 647 (109-606-003, Jackson), mouse anti-human CD3 flow cytometry monoclonal antibody Brilliant Violet. 421 (300434, BioLegend), mouse anti-human EGFR monoclonal antibody PE (352903, BioLegend), 806 recombinant monoclonal antibody (synthesized by Genscript), mouse anti-human CD4 flow cytometry monoclonal antibody PE (300508, BioLegend), mouse anti-human CD8α flow cytometry monoclonal antibody APC (301014, BioLegend), mouse anti-human CD45RO flow cytometry monoclonal antibody PE (304205, BioLegend), and mouse anti-human CCR7 flow cytometry monoclonal antibody APC (353213, BioLegend).

[0086] 4. Detection of electroporation and editing efficiency of CAR-T cells Three days after T cell activation, Dynabeads were removed with a magnet. Prior to electroporation, RNP complexes were prepared and incubated with 6 μg of Cas9 protein (Shenzhen Feipeng Biotechnology Co., Ltd.) and 6 μg of sgRNA (target sequence: CCTGAGCAGCCCCCGACCCA) transcribed and prepared in vitro for 20 minutes at room temperature. Electroporation was performed using 20 μl of P3 primary cell 4D-NucleofectorX kit electroporation solution (V4XP-3024, Lonza), resulting in 1 × 10⁶ cells. 6100 CAR-T cells were resuspended and incubated RNP was added. A 4D-Nucleofector System N(Lonza) electroporator was used for electroporation under EO-115 electroporation conditions. After electroporation, the cell mixture was extracted and transferred to preheated T cell medium. After 48 hours, the electroporation efficiency was detected. Sanger sequencing (sequencing primers: TGFbR2-TIDE-F:5'-cacatctggcccgcacatct-3'; and TGFbR2-TIDE-R:5'-ggaaactttcctcgtttccgc-3') was performed on the PCR products of the surveyor assay (primers: TGFbR2-TIDE-F:5'-cacatctggcccgcacatct-3'; and TGFbR2-GT-R:5'-gggtggctcagaaagagctg-3'). The sequencing results were analyzed using the website http: / / tide.nki.nl.

[0087] 5. CAR-T cell in vitro killing experiment (luciferase detection method) Construction of CRL-5826-Luci cells: Wild-type CRL-5826 cells were infected with a lentivirus expressing luciferase and puromycin resistance screening genes, and then screened with puromycin for 2 weeks to obtain CRL-5826-Luci cells that stably express luciferase. Killing experiment: Target cells CRL-5826-Luci were killed using 1640 complete medium at a cell density of 1 × 10⁶ 6The cells were resuspended to a concentration of / ml. Target cell suspensions were inoculated into 96-well plates at a rate of 100 μl per well. Different numbers of effector CAR-T cells were added according to different effector-target ratios, and four replicates were performed for each ratio. The final volume of each well was 200 μl. These were placed in an incubator, removed at different time points, and the lysis efficiency was detected. At detection, 10 μl of Steady-glo fluorescein substrate (Promega) was added to each well and allowed to react for 5 minutes. Fluorescence values ​​were detected using a PerinElmer VICTOR X3 microplate reader. The lysis efficiency of effector cells against target cells was calculated based on the fluorescence value of each well: Specific lysis (%) = (1 - RUL effector cells + target cells / RUL target cells) × 100 (RUL: relative light units).

[0088] 6.CAR-T cell in vitro killing experiment (RTCA detection method) The in vitro lysing function of effector CAR-T cells against target cells was detected using a real-time label-free cell function analyzer. Fibroblasts, CRL-5826 cells, and K562 cells were seeded on E-Plate16 (ACEA), and 2500 cells were added to each well, with two replicates. After 24 hours, effector CAR-T cells were added according to different effector-target ratios (0.2:1, 0.05:1, 0.0125:1, and 0:1). Cell index (CI) values ​​were continuously observed for 4 days. The lysing efficiency of effector cells against target cells was calculated based on the CI value of each well: Specific lysis (%) = (1 - CI effector cells + target cells / CI target cells) × 100.

[0089] 7. Multi-round antigen stimulation (stress test) experiment 2 x 10 5Nine CAR-T cells were co-cultured with CRL-5826 tumor cells in an effector-target ratio of 1:1. After 2 days, all tumor cells were lysed, and after counting the CAR-T cells, new tumor cells were added. Similarly, new tumor cells were added every other day, maintaining an effector-target ratio of 1:1 until a significant difference in CAR-T cell killing efficiency was observed between the different groups. The TGF-β1 concentration in the supplemented groups was maintained at 5 ng / ml.

[0090] 8. Detection of CAR-T cell function in tumor-bearing mouse models The experimental mice were 6-week-old NPG female mice (purchased from Weitongda Company). CRL-5826 cells were resuspended in DPBS, and the cell density was 2 × 10⁶. 7 The values ​​were / ml. 100 μl of cell suspension was collected from each, 100 μl of Matrigel was added, and the mixture was subcutaneously injected into mice. Each mouse received approximately 2 × 10⁶ cells. 6 After injecting individual CRL-5826 cells, the tumor volume was approximately 300 mm³ after 4 weeks. 3 The tumor-bearing mice were randomly grouped according to tumor size, with 5 mice assigned to each experimental group. CAR-T cells were injected once into the tail vein at different doses (CAR). + (This is approximately 50%). Tumor volume, human CD3 content in peripheral blood, and percentage of T cell subtypes were measured weekly. Re-inoculation of tumor mass: Mice in the PBS group were euthanized, the tumor mass was removed, and 200-300 mm was removed. 3 The tumor was divided into chunks and each was inoculated subcutaneously on the opposite side of the mouse from which the tumor had been completely removed. Four new NPG mice were selected and subcutaneously inoculated with the divided tumor chunks as re-inoculation controls.

[0091] Example 1: Synthesis and vector construction of anti-EGFR ScFv sequences Six humanized anti-EGFR ScFv sequences and one mouse-derived anti-EGFR ScFv were identified from existing patents and the National Center for Biotechnology Information (NCBI) (hu806 (US009493568B2), E2 (US20150030599A1), Pan (US20150152184A1), Nec (WO2005 / 090407A1), Nimo (US6506883B2), 301 (GeneBank JQ306330.1), and m806 (WO02092771A2)). After gene synthesis, these seven ScFv sequences were inserted into the lentiviral vector pRRLSIN plasmid along with the CAR framework gene (Figure 1).

[0092] Example 2: Preparation of anti-EGFR CAR-T cells Seven different CAR structures containing different ScFvs, as described in Example 1, were introduced into human primary T cells using lentiviruses. After infecting the human primary T cells with the same viral titer, the positivity rate of CAR-T cells was detected 5 days post-infection (Figure 2). The results show that even under the same lentiviral titer conditions, there are still relatively large differences and clusters in the positivity rates of different CAR-T cells.

[0093] Example 3: Comparison of the killing function of anti-EGFR CAR-T cells in vitro and in vivo. To compare the killing function of anti-EGFR CAR-T cells from different scFv sources, CRL-5826 cells were subjected to in vitro low-effector-target ratio long-term killing experiments and tumor antigen continuous stimulation killing stress tests (Figures 3 and 4). The results showed that hu806 and Nimo CAR-T cells had more potent in vitro tumor-killing function compared to the other four scFv CAR-T cells. In addition, the stress test results showed that the tumor-removal effect of hu806 CAR-T cells was superior to that of Nimo CAR-T cells. Next, in vivo tumor-bearing and therapeutic experiments were conducted in NPG mice (Figure 5A). Tumors were formed subcutaneously with CRL-5826 cells, and after 5 weeks, six types of anti-EGFR CAR-T cells were injected into the tail vein at the same dose. Subsequently, changes in tumor volume were observed weekly (Figure 5B). The results showed that hu806 CAR-T cells had the optimal in vivo tumor-removal effect.

[0094] Example 4: Comparison of in vitro killing function of humanized hu806 CAR-T cells and mouse-derived m806 CAR-T cells. The anti-EGFR monoclonal antibody 806 ScFv was originally derived from mouse IgG2b (m806), and its FR region sequence was humanized to become humanized 806 (hu806). In this application, the in vitro function of CAR-T cells derived from humanized and mouse 806 ScFv was compared. The experimental results showed that hu806 CAR-T cells have a more potent in vitro antitumor function (Figure 6).

[0095] The amino acid and nucleotide sequences of mouse IgG2b(m806)CAR are shown in Sequence IDs 81 and 82, respectively, and each part of mouse IgG2b(m806)CAR corresponds to Table 1 below.

[0096] [Table 1]

[0097] Example 5: Antitumor activity can be enhanced in hu806 CAR-T cells after TGF-β receptor II is knocked out. The antitumor function of hu806 CAR-T cells with TGF-β receptor knockout was compared with that of cells without knockout. Human primary T cells were infected with lentivirus, and after 48 hours, Cas9 RNP targeting TGFbR2 was electroporated. Two days later, genomic DNA was extracted from the knockout cells, and the knockout efficiency (Figure 7A) and positive rate (Figure 7B) of CAR-T cells were detected by TIDE. After 7 days of in vitro culture, the in vitro tumor-killing conditions of hu806 CAR-T cells and hu806-TKO CAR-T cells in the presence of TGF-β were observed.

[0098] The results showed that TGF-β inhibits the in vitro antitumor function of hu806 CAR-T cells, and that knockout of TGF-β receptor II may reverse the inhibitory effect of TGF-β on CAR-T cell function (Figure 8A). Furthermore, stress test results showed that after multiple rounds of continuous stimulation with tumor antigens, hu806-TKO cells had more antitumor advantages compared to hu806 CAR-T cells (Figure 8B). In addition, hu806-TKO CAR-T cells with knocked-out TGF-β receptor II had more proliferative advantages than hu806 CAR-T cells (Figure 8C).

[0099] Example 6: In vivo experiments with NPG mice demonstrate that hu806-TKO CAR-T has superior therapeutic efficacy. Hu806 CAR-T cells and 806-TKO CAR-T cells were injected at different doses, and changes in tumor volume were observed in tumor-bearing NPG mice (Figure 9A). In vivo results from animal studies showed that higher injection doses were associated with faster tumor removal. In addition, under the same dose conditions, the therapeutic effect of hu806-TKO CAR-T cells was significantly superior to that of hu806 CAR-T cells (Figure 9A). Tumor reinoculation was performed on mice in the hu806-TKO group whose tumors had been completely removed. After 3-4 weeks, the mice in the experimental group again showed the ability to remove tumors. Analysis of the percentage of human CD3 in the peripheral blood of the mice revealed that the percentage of hCD3 in the hu806-TKO group was significantly higher than in the hu806 group (Figure 8B), and this was positively correlated with the tumor removal effect.

[0100] Example 7: Percentage of T cell subtypes in peripheral blood of tumor-bearing NPG mice using hu806-TKO CAR-T cells To observe the amplification of CAR-T cells injected into animals and the changes in subtype ratios, hu806 cells and hu806-TKO cells were prepared by using CD3 T cells from a #4 donor with good in vivo amplification. Two types of CAR-T cells and a PBS control were injected into the tail vein, with an injection dose of 5e6 CAR +The mice were subjected to weekly blood sampling to observe T cell subtypes. The results again showed that the knockout group had a better tumor-removing effect (Figure 10A). The percentage of hCD3 in the peripheral blood of the mice initially increased and then decreased. Even in the later stages of treatment, the hu806-TKO group still maintained a higher percentage of hCD3 compared to the hu806 group (Figure 10B). Further analysis of human CD3 subtypes in the peripheral blood of the mice showed that the TKO group had a higher percentage of memory state T cells, particularly a higher percentage of central memory T cells, which was advantageous (Figure 10C). According to published literature, the percentage of central memory T cells is positively correlated with prognosis and efficacy. Results from CD4 and CD8 staining showed that in the early stages of treatment, the percentage of CD8 T cells was higher in the TKO group. Over time, CD4 T cells became the dominant cell subgroup (Figure 10D).

[0101] Example 8: Exploration of therapeutic doses of hu806-TKO CAR-T cells To provide a baseline for injectable therapeutic doses in clinical trials, dose-grouping experiments were conducted on tumor-bearing NPG mice. Different infusion doses were prescribed based on equivalent dose conversion between mice and humans (Table 2). Results from in vivo grouping therapy in animals showed that all four dose groups of hu806-TKO effectively removed CDX model tumors, and the dose was related to the rate of tumor removal (Figure 11A). After tumor removal, tumor reinoculation experiments were conducted with two therapeutic dose groups, and an effective reduction in the volume of reinoculated tumors was observed in both groups (Figure 11A). hCD3 content in mouse peripheral blood was related to the infusion dose, and hCD3 content initially increased with treatment time, then decreased (Figure 11B).

[0102] [Table 2]

[0103] Example 9: In vivo safety of hu806 CAR-T cells The main risk of CAR-T cell therapy lies in off-target effects. To detect off-target effects of anti-EGFR hu806 ScFv and clarify its in vivo safety, lung squamous cell carcinoma cells and human primary fibroblasts were stained using a recombinant hu806 antibody. Flow cytometry results showed that both CRL-5826 and fibroblasts expressed EGFR, while fibroblasts expressed only small amounts of hu806 antigen. Blood-derived leukemia cells K562 did not express EGFR (Figure 12A). Accordingly, in vitro toxicity detection against these three cell types showed that hu806 CAR-T cells had strong toxic activity against EGFR-positive 806 antigen-positive CRL-5826 cells, while killing EGFR-positive 806 antigen-negative fibroblasts and EGFR-negative K562 cells with little effect (Figure 12B). This suggests that injecting hu806 cells into the body as a drug carries a low risk of off-target side effects. The present invention encompasses the following embodiments. [1] A chimeric antigen receptor (CAR) targeting EGFR, comprising an extracellular antigen-binding domain that specifically targets EGFR, wherein the extracellular antigen-binding domain comprises a heavy chain variable region (VH) and a light chain variable region (VL), where, i) The VH includes VH-CDR1 shown in SEQ ID NO: 1, VH-CDR2 shown in SEQ ID NO: 2, and VH-CDR3 shown in SEQ ID NO: 3, and the VL includes VL-CDR1 shown in SEQ ID NO: 4, VL-CDR2 shown in SEQ ID NO: 5, and VL-CDR3 shown in SEQ ID NO: 6; ii) The VH includes VH-CDR1 shown in SEQ ID NO: 10, VH-CDR2 shown in SEQ ID NO: 11, and VH-CDR3 shown in SEQ ID NO: 12, and the VL includes VL-CDR1 shown in SEQ ID NO: 13, VL-CDR2 shown in SEQ ID NO: 14, and VL-CDR3 shown in SEQ ID NO: 16; iii) The VH includes VH-CDR1 shown in SEQ ID NO: 19, VH-CDR2 shown in SEQ ID NO: 20, and VH-CDR3 shown in SEQ ID NO: 21, and the VL includes VL-CDR1 shown in SEQ ID NO: 22, VL-CDR2 shown in SEQ ID NO: 23, and VL-CDR3 shown in SEQ ID NO: 24; iv) The VH includes VH-CDR1 shown in SEQ ID NO: 28, VH-CDR2 shown in SEQ ID NO: 29, and VH-CDR3 shown in SEQ ID NO: 30, and the VL includes VL-CDR1 shown in SEQ ID NO: 31, VL-CDR2 shown in SEQ ID NO: 32, and VL-CDR3 shown in SEQ ID NO: 33; v) The VH includes VH-CDR1 shown in SEQ ID NO: 37, VH-CDR2 shown in SEQ ID NO: 38, and VH-CDR3 shown in SEQ ID NO: 39, and the VL includes VL-CDR1 shown in SEQ ID NO: 40, VL-CDR2 shown in SEQ ID NO: 41, and VL-CDR3 shown in SEQ ID NO: 42; or vi) The VH includes VH-CDR1 shown in SEQ ID NO: 46, VH-CDR2 shown in SEQ ID NO: 47, and VH-CDR3 shown in SEQ ID NO: 48, and the VL includes VL-CDR1 shown in SEQ ID NO: 49, VL-CDR2 shown in SEQ ID NO: 50, and VL-CDR3 shown in SEQ ID NO: 51. CAR. [2]i) The VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO: 8; ii) The VH comprises the amino acid sequence shown in SEQ ID NO: 16, and the VL comprises the amino acid sequence shown in SEQ ID NO: 17; iii) The VH comprises the amino acid sequence shown in SEQ ID NO: 25, and the VL comprises the amino acid sequence shown in SEQ ID NO: 26; iv) The VH comprises the amino acid sequence shown in SEQ ID NO: 34, and the VL comprises the amino acid sequence shown in SEQ ID NO: 35; v) The VH comprises the amino acid sequence shown in SEQ ID NO: 43, and the VL comprises the amino acid sequence shown in SEQ ID NO: 44; or vi) A EGFR-targeting CAR according to [1], wherein VH comprises the amino acid sequence shown in SEQ ID NO: 52, and VL comprises the amino acid sequence shown in SEQ ID NO: 53. [3] A CAR that targets EGFR as described in [1] or [2], wherein the extracellular antigen-binding domain comprises a single-stranded Fv fragment (scFv). [4] The scFv comprises an amino acid sequence selected from SEQ ID NOs. 9, 18, 27, 36, 45, and 54, and is an EGFR-targeting CAR as described in [3]. [5] A EGFR-targeting CAR according to any one of [1] to [4], further comprising a CD8α signal peptide at its N-terminus, wherein the CD8α signal peptide comprises, for example, the amino acid sequence of SEQ ID NO: 55. [6] A CAR that further comprises a transmembrane domain such as a CD8α transmembrane domain, for example, the CD8α transmembrane domain comprising the amino acid sequence of SEQ ID NO: 57, according to any one of [1] to [5]. [7] A EGFR-targeting CAR according to any one of [1] to [6], further comprising a hinge region located between the extracellular antigen-binding domain and the transmembrane domain, for example, the hinge region being a CD8α hinge region, for example, the CD8α hinge region comprising the amino acid sequence of SEQ ID NO: 56. [8] A CAR that further comprises a signaling domain such as a CD3ζ signaling domain, for example, the CD3ζ signaling domain comprising the amino acid sequence shown in SEQ ID NO: 59, and which targets EGFR as described in any of [1] to [7]. [9] A CAR that targets EGFR as described in any of [1] to [8], further comprising one or more co-stimulatory domains, such as a 4-1BB co-stimulatory domain, wherein the 4-1BB co-stimulatory domain comprises, for example, the amino acid sequence of SEQ ID NO: 58.

[10] A CAR that targets EGFR as described in any of [1] to [9], comprising an amino acid sequence selected from SEQ ID NOs. 60 to 65. Therapeutic T cells containing CAR as described in any of

[11] [1] to

[10] .

[12] Therapeutic T cells as described in

[11] , wherein the TGFβ receptor in the therapeutic T cells is knocked down or knocked out.

[13] Therapeutic T cells as described in

[11] or

[12] , which can specifically lyse tumor cells expressing EGFR in vitro in effector-target ratios of approximately 0.2:1 to approximately 0.00625:1, for example, approximately 0.2:1, approximately 0.1:1, approximately 0.05:1, approximately 0.025:1, approximately 0.0125:1, and approximately 0.00625:1.

[14] Use of therapeutic T cells as described in any of

[11] to

[13] in the preparation of drugs for the treatment of EGFR-related cancers.

[15] A pharmaceutical composition for treating EGFR-related cancer in a subject, comprising a therapeutically effective amount of therapeutic T cells according to any of

[11] to

[13] and a pharmaceutically acceptable carrier.

[16] A method for treating EGFR-related cancer, comprising administering a therapeutically effective amount of therapeutic T cells according to any of

[11] to

[13] or a pharmaceutical composition according to

[15] to a subject in need.

[17] The method according to

[16] , further comprising administering radiotherapy and / or chemotherapy and / or another tumor-targeting drug and / or immunotherapy to the subject.

[18] The EGFR-related cancer is selected from esophageal cancer, gastric cancer, colon cancer, rectal cancer, colorectal cancer, pancreatic cancer, lung cancer (including non-small cell lung cancer NSCLC), breast cancer, cervical cancer, uterine cancer, endometrial cancer, ovarian cancer, bladder cancer, head and neck cancer (including head and neck squamous cell carcinoma SCCHN), osteosarcoma, prostate cancer, neuroblastoma, nephroma, glioma, glioblastoma, and skin cancer (including epithelial carcinoma), [the use described in 14, the pharmaceutical composition described in 15, or any of the methods described in

[16] to

[17] . A polynucleotide containing a nucleotide sequence encoding a CAR as described in any of

[19] [1] to

[10] .

[20] A polynucleotide as described in

[19] , comprising a nucleotide sequence selected from sequence numbers 66-71.

[21] Expression constructs comprising a polynucleotide described in

[19] or

[20] operably linked to a regulatory sequence. A method for preparing therapeutic T cells as described in any of

[22]

[11] ~

[13] , comprising the following steps: a) A step of providing isolated T cells; and b) A step of introducing the polynucleotide described in

[19] or

[20] or the expression construct described in

[21] into the T cells, thereby causing the T cells to express the CAR described in any of [1] to

[10] . including, method.

[23] x) A step of knocking down or knocking out the TGFβ receptor in the T cells. The method described in

[22] , further including the method described in

[22] .

[24] y) Step of amplifying the T cells The method described in

[22] , further including the method described in

[22] . A kit for preparing therapeutic T cells as described in any of

[25]

[11] ~

[13] .

[0104] Sequence Listing: TIFF0007912005000003.tif50168TIFF0007912005000004.tif255166TIFF00079120050 00005.tif255166TIFF0007912005000006.tif255166TIFF0007912005000007.tif255166 TIFF0007912005000008.tif255166TIFF0007912005000009.tif255166TIFF0007912005 000010.tif253168TIFF0007912005000011.tif255168TIFF0007912005000012.tif75168

Claims

1. A chimeric antigen receptor (CAR) targeting EGFR, comprising an extracellular antigen-binding domain that specifically targets EGFR, wherein the extracellular antigen-binding domain comprises a heavy chain variable region (VH) and a light chain variable region (VL), where, i) The VH includes VH-CDR1 shown in SEQ ID NO: 1, VH-CDR2 shown in SEQ ID NO: 2, and VH-CDR3 shown in SEQ ID NO: 3, and the VL includes VL-CDR1 shown in SEQ ID NO: 4, VL-CDR2 shown in SEQ ID NO: 5, and VL-CDR3 shown in SEQ ID NO:

6. CAR.

2. i) The VH comprises the amino acid sequence shown in SEQ ID NO: 7, and the VL comprises the amino acid sequence shown in SEQ ID NO:

8. A CAR that targets the EGFR as described in claim 1.

3. An EGFR-targeting CAR according to claim 1 or 2, wherein the extracellular antigen-binding domain comprises a single-stranded Fv fragment (scFv).

4. The EGFR-targeting CAR according to claim 3, wherein the scFv comprises the amino acid sequence shown in Sequence ID No.

9.

5. A CAR targeting EGFR according to any one of claims 1 to 4, further comprising a CD8α signal peptide at its N-terminus, wherein the CD8α signal peptide comprises the amino acid sequence of SEQ ID NO:

55.

6. A CAR that targets an EGFR according to any one of claims 1 to 5, further comprising a CD8α transmembrane domain, wherein the CD8α transmembrane domain comprises the amino acid sequence of SEQ ID NO:

57.

7. A CAR targeting an EGFR according to any one of claims 1 to 6, further comprising a hinge region located between the extracellular antigen-binding domain and the transmembrane domain, wherein the hinge region is a CD8α hinge region and the CD8α hinge region comprises the amino acid sequence of SEQ ID NO:

56.

8. A CAR that targets an EGFR according to any one of claims 1 to 7, further comprising a CD3ζ signaling domain, wherein the CD3ζ signaling domain comprises the amino acid sequence shown in SEQ ID NO:

59.

9. A CAR targeting an EGFR according to any one of claims 1 to 8, further comprising a 4-1BB co-stimulatory domain, wherein the 4-1BB co-stimulatory domain comprises the amino acid sequence of SEQ ID NO:

58.

10. A CAR that targets an EGFR according to any one of claims 1 to 9, comprising the amino acid sequence shown in Sequence ID No.

60.

11. Therapeutic T cells comprising the CAR described in any one of claims 1 to 10.

12. The therapeutic T cells according to claim 11, wherein the TGFβ receptor in the therapeutic T cells is knocked down or knocked out.

13. The therapeutic T cells according to claim 11 or 12, which can specifically lyse tumor cells expressing EGFR in vitro at an effector-target ratio of 0.2:1 to 0.00625:

1.

14. Use of therapeutic T cells according to any one of claims 11 to 13 in the preparation of a drug for treating EGFR-associated cancer.

15. The use according to claim 14, wherein the EGFR-related cancer is selected from esophageal cancer, gastric cancer, colon cancer, rectal cancer, colorectal cancer, pancreatic cancer, lung cancer (including non-small cell lung cancer NSCLC), breast cancer, cervical cancer, uterine cancer, endometrial cancer, ovarian cancer, bladder cancer, head and neck cancer (including head and neck squamous cell carcinoma SCCHN), osteosarcoma, prostate cancer, neuroblastoma, nephroma, glioma, glioblastoma, and skin cancer (including epithelial carcinoma).

16. A pharmaceutical composition for treating EGFR-related cancer in a subject, comprising a therapeutically effective amount of therapeutic T cells according to any one of claims 11 to 13, and a pharmaceutically acceptable carrier.

17. The pharmaceutical composition according to claim 16, wherein the EGFR-related cancer is selected from esophageal cancer, gastric cancer, colon cancer, rectal cancer, colorectal cancer, pancreatic cancer, lung cancer (including non-small cell lung cancer NSCLC), breast cancer, cervical cancer, uterine cancer, endometrial cancer, ovarian cancer, bladder cancer, head and neck cancer (including head and neck squamous cell carcinoma SCCHN), osteosarcoma, prostate cancer, neuroblastoma, nephroma, glioma, glioblastoma, and skin cancer (including epithelial carcinoma).

18. A polynucleotide comprising a nucleotide sequence encoding a CAR according to any one of claims 1 to 10.

19. The polynucleotide according to claim 18, comprising a nucleotide sequence selected from sequence numbers 66 to 71.

20. An expression construct comprising a polynucleotide according to claim 18 or 19, operably linked to a regulatory sequence.

21. A method for preparing therapeutic T cells according to any one of claims 11 to 13, comprising the following steps: a) the step of providing isolated T cells; and b) The step of introducing the polynucleotide according to claim 18 or 19 or the expression construct according to claim 20 into the T cells, thereby causing the T cells to express the CAR according to any one of claims 1 to 10. including, method.

22. x) The step of knocking down or knocking out the TGFβ receptor in the T cells. The method according to claim 21, further comprising:

23. y) A step of amplifying the T cells. The method according to claim 21, further comprising:

24. A humanized CAR as described in claim 1.

Images