Biocompatible nucleic acids for digital data storage

JP7912263B2Active Publication Date: 2026-08-28CENT NAT DE LA RECH SCI (C N R S) +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2022520144
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-10-01
Filing Date
2020-10-01
Publication Date
2026-08-28
Estimated Expiration
2040-10-01

Smart Images

  • Figure 0007912263000012
    Figure 0007912263000012
  • Figure 0007912263000013
    Figure 0007912263000013
  • Figure 0007912263000001
    Figure 0007912263000001
Patent Text Reader

Abstract

The present invention relates to a device for storing and / or editing digital data comprising at least one double-stranded replicative composite nucleic acid molecule. The composite nucleic acid molecule comprises both digital data-encoding nucleic acids and non-digital data-encoding nucleic acids. The non-digital data-encoding nucleic acids may enable indexing and / or provision of metadata for adjacent digital data-encoding nucleic acids. The composite nucleic acid molecules of the present invention may be pooled to form an array, which may constitute a DNA drive representing a physical support for storing digital data.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention relates to the storage of digital data in biomolecules. More specifically, digital data can be stored in double-stranded, reproducible complex nucleic acid molecules, which can then be easily recovered after sequencing. [Background technology]

[0002] The storage and archiving of digital data is a major issue in our modern society. Current digital media stored in data centers are fragile, bulky, and energy-consuming. While optical data, magnetic tape, hard drives, and flash memory have been developed, their lifespan, on average, does not exceed 20 years. This data must be periodically copied to new, reliable media, a process that must be carried out under controlled temperature and humidity conditions, incurring enormous energy costs and requiring vast amounts of raw materials. The amount of energy consumed by data centers reaches a threshold where, if the internet were equivalent to a country, it would be the sixth largest electricity consumer in the world. Annual consumption is 150 TWh, which corresponds to 4% of global energy consumption and approximately 40% more than the annual consumption of the UK. The carbon footprint of data centers is roughly equivalent to the carbon footprint of all commercial aviation worldwide. Despite these energy costs, carbon footprints, and the increasing need for these bulky spaces, data centers can only store about 30% of the data we produce, while our data production is growing exponentially. "Today, we can store about 30% of the information we produce, but in 10 or 12 years, we will only be able to store about 3%," (Dr. Karin Strauss, Microsoft Research). Considering all these factors, the data revolution, the big data market, and the development of artificial intelligence cannot proceed without finding innovative solutions to the problem of data storage.

[0003] International Patent Publication No. 2019079802 discloses a method for decoding a nucleotide sequence, wherein the nucleotide sequence encodes a value corresponding to a form of information, and the method includes the steps of: converting the form of information into a sequence of binary ASCII bits; converting the sequence of binary ASCII bits into a sequence of ternary ASCII bits; and converting the sequence of ternary ASCII bits into a corresponding oligonucleotide sequence.

[0004] Taejin Ahn et al. (Genomics and Informatics, 2018, Vol. 16(4):e30) disclosed the storage of digital information in long-read DNA (approximately 1,000 bp), where each bit 0 or 1 is encoded by a 16 bp nucleic acid unit constructed from a 6 bp noise sequence (random sequence) flanked at each end by a 4 bp signal sequence (TATT for bit 0 and ACCC for bit 1).

[0005] Existing methods for storing information in the form of nucleotide sequences (e.g., DNA or RNA molecules) have limitations and technical problems, including: (1) they are usually based on short single-stranded oligonucleotides (<200 nucleotides), thus limiting the density and amount of information stored; (2) they usually require in vitro chemosynthesis or enzymatic synthesis; (3) they are usually based on indicator construction systems constrained by physical media, i.e., short nucleotide sequences, thus limiting their effectiveness; and (4) they are usually incompatible with operations using living organisms.

[0006] The storage of digital data in cellular DNA has been discussed, for example, by Dagher et al. (Evolutionary Intelligence, 2019). The authors provide suggestions for conceiving nucleic acid molecules suitable for storage in cells and explicitly recommend protein-coding DNA (pcDNA) as a preferred environment for DNA coding because it is easy to implement, pcDNA is well understood via codons, and governs the genomes of viruses, prokaryotes, and yeast.

[0007] There remains a need for state-of-the-art technologies that can sustain the encoding of large amounts of data and, furthermore, be biocompatible—that is, means of storing digital data that can be copied, edited, written, and / or read using living organisms. [Overview of the project]

[0008] One aspect of the present invention is formula (I): 5'-([UP]-[DB]-[DO])x-3'(I) (In the formula, [DB] is approximately 8 nucleotides to approximately 10 6 This represents a nucleotide, preferably a digital data encoding nucleic acid having a length of about 500 nucleotides to about 5,000 nucleotides. [UP] and [DO] are each approximately 0 nucleotides to approximately 10 4 Represents a pair of non-digital data encoding nucleic acids having a length of approximately 10 to 200 nucleotides, x is approximately 1 to approximately 10 5 (represents) The present invention relates to an apparatus for storing and / or editing digital data, comprising at least one double-stranded, reproducible complex nucleic acid molecule containing nucleic acids.

[0009] In some embodiments, the complex nucleic acid molecule comprises approximately 500 nucleotides to approximately 10 11 Nucleotides, preferably about 10 3 Nucleotides ~ approximately 10 5has a nucleotide length. In certain embodiments, the nucleic acid of formula (I) has a C+G percentage of about 35% to about 65%. In some embodiments, the nucleic acid of formula (I) does not encode one or more RNAs, and preferably does not encode one or more mRNAs. In certain embodiments, the nucleic acid of formula (I) does not include one or more start codons, and / or includes one or more stop codons per about 200 nucleotides in all six reading frames. In some embodiments, the nucleic acid of formula (I) does not include one or more restriction sites for an enzyme selected from the group consisting of BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI, or an isoschizomer thereof. In certain embodiments, the nucleic acid of formula (I) does not include one or more repeats of at least four identical nucleotides. In some embodiments, each nucleotide of a [DB] nucleic acid encodes 1 or 2 bits of digital data. In certain embodiments, the [UP] and [DO] nucleic acids each include at least one barcode-encoding nucleic acid and / or at least one metadata-encoding nucleic acid.

[0010] In one aspect, a method for storing digital data comprises: a) assigning to said digital data at least one double-stranded digital data-encoding [DB] nucleic acid sequence (S DB ) and at least one pair of non-digital data-encoding [UP] and [DO] nucleic acid sequences (S UP ) and (S DO ); b) synthesizing at least one nucleic acid of formula (Ia) from each of sequence (S UP ), (S DB ), and (S DO ), respectively: 5’-([UP]-[DB]-[DO])-3’ (Ia) ; c) assembling one or more nucleic acids of formula (Ia) to provide a nucleic acid of formula (I): 5’-([UP]-[DB]-[DO])x-3’ (I) wherein x represents from about 1 to about 10 5 ) The steps include obtaining a double-stranded, reproducible complex nucleic acid molecule containing nucleic acids, d) 1 to approximately 10 of separate arrays 9 The steps include storing in a storage cell a pool containing a complex nucleic acid molecule and at least one pool containing the nucleic acid of formula (I) obtained in step c), and Includes.

[0011] In certain embodiments, this method e) The pool obtained in step d) is divided into one pool ~ approximately 10 6 The process further includes the step of constructing and grouping into at least one array containing a pool, preferably about 96 to about 384 pools.

[0012] In some embodiments, the complex nucleic acid molecule obtained in step c) is a plasmid, cosmid, prokaryotic chromosome, or eukaryotic chromosome.

[0013] In certain embodiments, this method c1) In vivo, amplify at least one complex nucleic acid molecule containing the nucleic acid of formula (I) obtained in step c), c2) A step to extract and purify the amplified complex nucleic acid molecule obtained in step c1) and It also includes.

[0014] In some embodiments, step c1) is carried out in vivo by an organism, preferably a microorganism.

[0015] Another aspect of the present invention is a method for recovering digital data stored by an apparatus and / or a method according to the present invention, a) Sequence at least one nucleic acid of formula (Ia) contained in a double-stranded replicating complex nucleic acid molecule containing the nucleic acid of formula (I), and obtain at least one nucleic acid sequence (S UP -S DB -S DO The steps to obtain ) and b) At least one nucleic acid sequence (S DB The steps to convert ) into digital data and Includes, Optionally, before step a), step a0) is performed, in which at least one nucleic acid of formula (Ia) is amplified. Regarding the method.

[0016] definition In this invention, the following terms have the following meanings.

[0017] The term "approximately" preceding a number encompasses a range of ±10% or less of that number. It should be understood that the value represented by the term "approximately" is also specific in itself and preferably disclosed.

[0018] "Digital data" refers to data that can be managed by a computerized machine. As used herein, the term "digital data" means data represented by a binary system. As used herein, "binary system" refers to a language consisting of bits "0" and "1". Non-exclusive examples of digital data may include program files, text files, music files, image files, video files, and combinations thereof.

[0019] "Storing" refers to the action of keeping an item in a specific location for further use or storage. More specifically, the expression "storing digital data" is intended to mean the action of securely keeping digital information for further use.

[0020] "Editing" refers to the action of assembling the item by cutting, pasting, and / or rearranging fragments of the item. Where used herein, "editing a nucleic acid molecule" is intended to refer to the modification of the nucleic acid molecule by inserting, deleting, or replacing one or more nucleotides in the sequence of the nucleic acid.

[0021] "Biocompatibility" refers to the ability to be manipulated by living organisms. As used herein, "biocompatible nucleic acid molecule" is intended to refer to a nucleic acid molecule that is compatible with / by replication and manipulation in living organisms, such as copying or editing.

[0022] "Replicability" refers to the ability to be replicated in vivo by a polymerase, such as DNA polymerase, i.e., to be replicated accurately within the margin of error of the biological replication mechanism. As used herein, "replicable nucleic acid molecule" is intended to refer to a nucleic acid molecule that can be copied at least once. In some embodiments, the nucleic acid molecules according to the present invention are selected from the group consisting of plasmids, cosmids, and chromosomes. In practice, a replicative nucleic acid molecule includes one or more origins of replication (also referred to as ORIs), which include one or more centromeres (of a chromosome).

[0023] "Composite" refers to an item made from separate parts or elements that are combined together. As used herein, "composite nucleic acid molecule" refers to a nucleic acid molecule derived from a fragment of nucleic acid that can be specifically designed in silico, synthesized in vitro or in vivo, and assembled and / or produced.

[0024] A “barcode” represents a patterned item containing information about an object that the barcode labels in order to uniquely identify that object from a set of multiple distinct objects. As used herein, “barcode-encoded nucleic acid” is intended to represent a non-digital data-encoded nucleic acid that enables labeling and / or indexing of adjacent digital data-encoded nucleic acids.

[0025] "Metadata" refers to basic information about the digital data being referenced, such as the author of the digital data, the date the digital data was created, the date the digital data was modified, the content of the data, and the size of the file.

[0026] The terms “nucleotide” and “nucleic acid base” are used interchangeably and are intended to represent the building blocks of nucleic acids in DNA or RNA molecules. As used herein, nucleotide represents adenine (A) or guanine (G), which are purines, or cytosine (C), thymine (T), or uracil (U), which are pyrimidines. In DNA nucleic acids, A represents dAMP deoxyribonucleotide, G represents dGMP deoxyribonucleotide, C represents dCMP deoxyribonucleotide, and T represents dTMP deoxyribonucleotide. In RNA nucleic acids, A represents AMP ribonucleotide, G represents GMP ribonucleotide, C represents CMP ribonucleotide, and U represents UMP ribonucleotide.

[0027] "Array" refers to a solid-phase support containing an assembly or set of nucleic acid molecules, preferably constructed in one or more pools.

[0028] "Amplifying" refers to the action of increasing the quantity of a target compound. Where used herein, the expression "amplifying a nucleic acid molecule" refers to increasing the copy number of the nucleic acid molecule used as a template. Unless otherwise specified, the terms "amplified," "replicated," and "doubled" are intended to be synonymous and are therefore interchangeable.

[0029] "To extract" refers to the action of extracting a target compound through physical and / or chemical processes. Where used herein, "to extract amplified nucleic acid molecules" is intended to refer to the removal of such nucleic acid molecules from an organism that has amplified them.

[0030] "To purify ~" refers to the action of obtaining a pure or substantially pure compound of interest from a mixture of compounds. Where used herein, the expression "to purify nucleic acid molecules" is intended to refer to the removal of impurities from a mixture containing the nucleic acid molecules in order to obtain a pure or substantially pure composition of the nucleic acid molecules.

[0031] Detailed explanation The inventors have shown that digital data, also known as computerized files, can be readily stored in double-stranded, reproducible complex nucleic acid molecules. The inventors have manipulated nucleic acid molecules (in the form of DNA molecules) that include both digital data-coding nucleic acids and non-digital data-coding nucleic acids. The non-digital data-coding nucleic acids are preferably used for assembly, replication, indexing of digital data, and / or metadata provision in living organisms. The replication properties of the complex nucleic acid molecules according to the present invention enable their easy manipulation, particularly their amplification in / by living organisms and / or their editing.

[0032] The present invention relates to formula (I): 5'-([UP]-[DB]-[DO])x-3'(I) (In the formula, [DB] is approximately 8 nucleotides to approximately 10 6 This represents a nucleotide, preferably a digital data encoding nucleic acid having a length of about 500 nucleotides to about 5,000 nucleotides. [UP] and [DO] are each approximately 0 nucleotides to approximately 10 4 Represents a pair of non-digital data encoding nucleic acids having a length of approximately 10 to 200 nucleotides, x is approximately 1 to approximately 10 5 (represents) The present invention relates to an apparatus for storing and / or editing digital data, comprising at least one double-stranded, reproducible complex nucleic acid molecule containing nucleic acids.

[0033] It should be understood that the complex nucleic acid molecules according to the present invention are biocompatible in the sense that they can be replicated and edited in / within / by living organisms.

[0034] A complex nucleic acid molecule containing the nucleic acid of formula (I) is given by formula (Ia): 5'-([UP]-[DB]-[DO])-3'(Ia) Please understand that it contains x nucleic acids.

[0035] In certain embodiments, the digital data consists of binary digital data. In fact, binary digital data is represented by a sequence of bits, where each bit is represented by either bit "0" or bit "1".

[0036] In some embodiments, the digital data may be selected from a group including program files, text files, table files, music files, image files, video files, and combinations thereof.

[0037] In certain embodiments, text files may be in the format .htm, .html, .rtf, .txt, .ccp, .py, or .xml. In some embodiments, video files may be in the format .avi, .mov, .mpeg, or .mpg. In certain embodiments, image files may be in the format .gif, .jpe, .jpeg, .jpg, or .png. In some embodiments, audio files may be in the format .mp3 or .ogg. In certain embodiments, files may be in the format .exe, .doc, .pdf, .ppt, .ps, .xls, or .zip.

[0038] It should be understood that the nucleic acid according to the present invention is a double-stranded nucleic acid molecule, that is, a double-stranded nucleic acid molecule containing two antiparallel complementary nucleic acid strands. In fact, one strand is oriented from 5' to 3', and the complementary strand is oriented from 3' to 5'.

[0039] As used herein, the “replication” property of a nucleic acid molecule according to the present invention refers to the ability to be replicated one or more times in vivo in a living organism, particularly by polymerase, and more specifically by DNA polymerase.

[0040] In practice, the replication properties of nucleic acid molecules can be evaluated by any standard method derived from or based on the latest technology. Exemplarily, replication properties can be evaluated by the increase in the copy number of the nucleic acid molecule in / by an organism, and / or the organism's ability to pass on the nucleic acid to its offspring.

[0041] In some embodiments, the organism is a microorganism, particularly bacteria, microalgae, archaea, fungi, phages, viruses, or yeast. In some embodiments, the organism is a prokaryote. Non-limiting examples of prokaryotes according to the present invention include bacteria, such as actinomycetes, Chlamydiales, cyanobacteria, Firmicutes, proteobacteria, spirochetes, and Thermotogales; and archaea, such as Euryarchaeota and Crematogaster. In certain embodiments, the organism is a eukaryote. Non-limiting examples of eukaryotes according to the present invention include protozoa, algae, plants, fungi, animals, and their respective cells.

[0042] To be replicated, the complex nucleic acid molecule according to the present invention has at least one origin of replication, i.e., a sequence of one or more nucleotides recognized by a replication initiation mechanism. Exemplary examples of origins of replication in archaea and bacteria include oriC. In fact, most bacteria may have a unique origin of replication, archaea may have one or more origins of replication, and eukaryotes may have multiple origins of replication, particularly in the form of centromeres. Within the scope of the present invention, the term "multiple origins of replication" refers to at least 2, 3, 4, 5, 10, 15, 20, 25, 50, 75, 100, 150, or 200 origins of replication per nucleic acid molecule.

[0043] In certain embodiments, the complex nucleic acid molecule consists of approximately 500 nucleotides to approximately 10 11 Nucleotides, preferably about 10 3 Nucleotides ~ approximately 10 5 It has the length of a nucleotide.

[0044] Within the scope of this invention, "500 nucleotides to about 10 11The term "nucleotide" refers to 500, 600, 700, 800, 900, 10 3 , 5×10 3 , 10 4 , 5×10 4 , 10 5 , 5×10 5 , 10 6 , 5×10 6 , 10 7 , 5×10 7 , 10 8 , 5×10 8 , 10 9 , 5×10 9 , 10 10 , 5×10 10 , and 10 11 It contains nucleotides.

[0045] Within the scope of the present invention, "about 10 3 Nucleotides ~ approximately 10 5 The expression "nucleotide" is 10 3 , 2.5×10 3 , 5×10 3 , 7.5×10 3 , 10 4 , 2.5×10 4 , 5×10 4 , 7.5×10 4 , and 10 5 It contains nucleotides.

[0046] It should be understood that the nucleic acid molecule according to the present invention is represented by a sequence of consecutive nucleotides.

[0047] In some embodiments, the nucleotides of the complex nucleic acid molecule according to the present invention are represented by nucleotides selected from the group consisting of deoxyribonucleotides, ribonucleotides, and their analogs, more preferably by deoxyribonucleotides. As used herein, deoxyribonucleotides encapsulate dATP, dCTP, dGTP, dTTP, dADP, dCDP, dGDP, dTDP, dAMP, dCMP, dGMP, and dTMP. As used herein, ribonucleotides encapsulate ATP, CTP, GTP, UTP, ADP, CDP, GDP, UDP, AMP, CMP, GMP, and UMP.

[0048] In certain embodiments, nucleotide analogs include 2-amino-ATP, 8-aza-ATP, 2'-fluoro-dATP, 2'-fluoro-dCTP, 2'-fluoro-dGTP, 2'-fluoro-dUTP, 5-iodo-CTP, 5-iodo-UTP, N6-methyl-ATP, 5-methyl-CTP, 2'-O-methyl-ATP, 2'-O-methyl-CTP, and 2'-O-methyl-GTP. , 2'-O-methyl-UTP, pseudo-UTP, ITP, 2'-O-methyl-ITP, promycin-TP, xanthosine-TP, 5-methyl-UTP, 4-thio-UTP, 2'-amino-dCTP, 2'-amino-dUTP, 2'-azide-dCTP, 2'-azide-dUTP, O6-methyl-GTP, 2-thio-UTP, Ara-CTP, Ara-UTP, 5,6-dihydro- UTP, 2-thio-CTP, 6-aza-CTP, 6-aza-UTP, N1-methyl-GTP, 2'-O-methyl-2-amino-ATP, 2'-O-methylpsoid-UTP, N1-methyl-ATP, 2'-O-methyl-5-methyl-UTP, 7-deaza-GTP, 2'-azide-dATP, 2'-amino-dATP, Ara-ATP, 8-azide-ATP, 5-bromo-CTP, 5-bromo-CTP Romo-UTP, 2'-fluoro-dTTP, 3'-O-methyl-ATP, 3'-O-methyl-CTP, 3'-O-methyl-GTP, 3'-O-methyl-UTP, 7-deazaATP, 5-AA-UTP, 2'-azide-dGTP, 2'-amino-dGTP, 5-AA-CTP, 8-oxo-GTP, pseudoiso-CTP, N4-methyl-CTP, N1-methylpsoid-UTP, 5,6-dihydro-5-methyl-UTP, N6-methyl-amino-ATP, 5-carboxy-CTP, 5-formyl-CTP, 5-hydroxymethyl-UTP, 5-hydroxymethyl-CTP, thieno-GTP, 5-hydroxy-CTP, 5-formyl-UTP, thieno-UTP, 2-amino-dATP, 5-bromo-dCTP, 5-bromo-dUTP, 7-deaza-dATP, 7-deaza-dGTP, dITP, 5-propynyl-dCTP, 5-propynyl-dUTP, 2'-dUTP, 5-fluoro-dUTP, 5-iodo-dCTP, 5-iodo-dUTP, N6-methyl- dATP, 5-methyl-dCTP, O6-methyl-dGTP, N2-methyl-dGTP, 8-oxo-dATP, 8-oxo-dGTP, 2-thio-dTTP, 2'-dPTP, 5-hydroxy-dCTP, 4-thio-dTTP, 2-thio-dCTP, 6-aza-dUTP, 6-thio-dGTP, 8-chloro-dATP, 5-AA-dCTP, 5-AA-dUTP, N4-methyl-dCTP, 2'-deoxyzebralin-TP, 5-hydroxymethyl-dUTP, 5-hydroxymethyl-dCTP, 5-propargylamino-dCTP, 5-propargylamino-dUTP, 5-carboxy-dCTP, 5-formyl-dCTP, 5-indolyl-AA-dUTP, 5-carboxy-dUTP, 5-formyl-dUTP, 3'-dATP, 3'-dGTP, 3'-dCTP, 5-methyl-3'-dUTP, 3'-dUTP, ddATP, ddGTP, ddUTP, ddTTP, ddCTP, 3'-azide-ddATP, 3'-azide-ddGTP, 3'-azide-ddTTP, 3'-amino-ddATP, 3'-amino-ddC TP, 3'-amino-ddGTP, 3'-amino-ddTTP, 3'-azido-ddCTP, 3'-azido-ddUTP, 5-bromo-ddUTP, ddITP, (1-thio)-dATP, (1-thio)-dCTP, (1-thio)-dGTP, (1-thio)-dTTP, (1-thio)-ATP, (1-thio)-CTP, (1-thio)-GTP, (1-thio)-UTP, (1-thio)-ddATP, (1-thio)-ddCTP, (1-thio)-ddGTP, (1-thio)-ddTTP, (1-thio)-3'-azid-ddTTP, (1-thio)-ddUTP, (1-vorano)-dATP, (1-vorano)-dCTP, (1-vorano)-dGTP, (1-vorano)-dTTP, ganciclovir-TP, and cidofovir-DP may be selected from an unrestricted group.

[0049] In some embodiments, the nucleic acid of formula (I) has a C+G percentage of approximately 35% to approximately 65%.

[0050] Within the scope of the present invention, the expression "approximately 35% to approximately 65%" encompasses 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, and 65%.

[0051] It should be understood that the complex nucleic acid molecules according to the present invention may be safe for organisms containing them, and furthermore, safe for individual consumers to manipulate. Therefore, the nucleic acid of formula (I) according to the present invention does not have to encode products that are predictably harmful to animals, plants, and the environment, although this is particularly true for individual consumers. Where used herein, the expression “not harmful” is intended to mean that the product does not promote disease or harm to individual consumers, animals, or plants, and furthermore, does not constitute a pollutant of the environment. Exemplary and non-limiting, the nucleic acid molecules according to the present invention do not have to encode toxins, pollutants, enzymes, toxins, antibiotics, etc.

[0052] In certain embodiments, the nucleic acid of formula (I) does not encode one or more RNAs, preferably one or more mRNAs, as predicted.

[0053] In some embodiments, the nucleic acid of formula (I) does not encode one or more RNAs, preferably one or more mRNAs.

[0054] Within the scope of the present invention, "RNA" is not limited to antisense RNA, guide RNA (gRNA), messenger RNA (mRNA), microRNA (miRNA), ribosomal RNA (rRNA), small hairpin RNA (shRNA), small interfering RNA (siRNA), nuclear small RNA (snRNA), nucleolar small RNA (snoRNA), and transfer RNA (tRNA).

[0055] In fact, the prediction that the nucleic acid of formula (I) does not encode one or more RNAs can be evaluated in silico by analyzing the sequence of the nucleic acid molecule for the presence of a signature sequence related to transcription initiation, such as a promoter sequence.

[0056] In some embodiments, the nucleic acid molecule of formula (I) does not contain one or more start codons and / or contains one or more stop codons per approximately 200 nucleotides in all six reading frames.

[0057] As used herein, “start codon” may refer to the codons ATG, AUG, GTG, GUG, CTG, or CUG.

[0058] In certain embodiments, the [DB] digital data encoded nucleic acid contains no start codons, while the [UP] and / or [DO] non-digital data encoded nucleic acid may contain one or more start codons, provided that the [DB] digital data encoded nucleic acid contains one or more stop codons per approximately 200 nucleotides in all six reading frames.

[0059] As used herein, “stop codon” may refer to the codons UAA, UAG, UGA, TAA, TAG, or TGA.

[0060] Within the scope of the present invention, "one or more stop codons per 200 nucleotides" includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, and 50 stop codons per 200 nucleotides.

[0061] In some embodiments, the nucleic acid of formula (I) does not contain one or more specific restriction sites. When used herein, “specific restriction site” refers to a restriction site in the sequence being determined.

[0062] In certain embodiments, the nucleic acid of formula (I) does not contain one or more restriction sites relating to an enzyme or its isoschisomer, selected from the group consisting of BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI.

[0063] As used herein, the term “restriction site” refers to a nucleotide sequence targeted by a restriction enzyme, i.e., a polypeptide in a nucleic acid molecule that has the property of cleaving the above sequence. In some embodiments, the nucleic acid of formula (I) does not contain any of the restriction sites listed below: BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI.

[0064] In some embodiments, the presence or absence of one or more restriction sites may depend on the organism having the complex nucleic acid molecule according to the present invention. In fact, a complex nucleic acid molecule according to the present invention that includes a bacterial restriction site may not be present in a bacterial organism. Exemplarily, a complex nucleic acid molecule according to the present invention that includes a restriction site recognized by an enzyme from one species may not be present in an organism from that species.

[0065] It should be understood that the nucleic acids of formula (I) according to the present invention are preferably synthesized and sequenced with high fidelity. It is known that the repetition of at least four identical nucleotides can hinder the high fidelity synthesis and / or sequencing of nucleic acid molecules because it tends to synthesize or sequence errors.

[0066] In certain embodiments, the nucleic acid of formula (I) does not contain one or more repeats of at least four identical nucleotides.

[0067] Within the scope of this invention, the expression "at least four identical nucleotides" includes 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 40, and 50 identical nucleotides. As used herein, "at least four identical nucleotides" refers to a set of nucleotides having the same properties, such as "AAAA", "CCCC", "GGGG", "TTTT", or "UUUU".

[0068] It should be understood that the double-stranded replication complex nucleic acid molecule according to the present invention includes both digital data encoding nucleic acids and non-digital data encoding nucleic acids.

[0069] In fact, digital data-encoded nucleic acids are represented as [DB] in "data blocks" and are intended to represent nucleic acids that contain only digital information.

[0070] Within the scope of the present invention, "about 8 nucleotides to about 10 6 The term "nucleotide" refers to 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 10 3 , 5×10 3 , 10 4 , 5×10 4 , 10 5 , 5×10 5 , and 10 6 It contains nucleotides.

[0071] Within the scope of the present invention, the expression "approximately 500 nucleotides to approximately 5000 nucleotides" includes 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,250, 3,500, 3,750, 4,000, 4,250, 4,500, 4,750, and 5,000 nucleotides.

[0072] In certain embodiments, each nucleotide of the [DB] nucleic acid encodes 1 or 2 bits of digital data.

[0073] In one embodiment, each nucleotide of the [DB] nucleic acid encodes 1 bit of digital data. Exemplarily, Table 1 below provides possible combinations.

[0074] [Table 1]

[0075] In one embodiment, each nucleotide of the [DB] nucleic acid encodes 2 bits of digital data. Exemplary, Table 2 below provides possible combinations.

[0076] [Table 2]

[0077] It should be understood that the double-stranded, reproducible complex nucleic acid molecule according to the present invention may include one or more digital data encoding nucleic acids in addition to one or more non-digital data encoding nucleic acids.

[0078] As used herein, the expression “non-digital data encoded nucleic acid” refers to a nucleic acid that does not contain any digital data information but may contain information about barcoding, indexing, metadata, security systems, and proofreading systems adjacent to digital data encoded [DB] nucleic acids.

[0079] In certain embodiments, [UP] and [DO] are each approximately 0 to 10 nucleotides. 4 Represents a pair of non-digital data-encoded nucleic acids having the length of a nucleotide.

[0080] Within the scope of the present invention, "about 0 nucleotides to about 10 4 The term "nucleotide" refers to 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 10 3 , 2.5×10 3 , 5×10 3 , 7.5×10 3 , and 10 4 It contains nucleotides.

[0081] In certain embodiments, [UP] and [DO] represent a pair of non-digital data-encoded nucleic acids, each having a length of approximately 10 to 200 nucleotides.

[0082] Within the scope of the present invention, the expression "about 10 to 200 nucleotides" includes 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200 nucleotides.

[0083] In some embodiments, the [UP] and [DO] nucleic acids each include at least one barcode-encoded nucleic acid and / or metadata-encoded nucleic acid.

[0084] As used herein, “barcode-encoded nucleic acid” is intended to represent a nucleic acid that enables the labeling of adjacent digital data-encoded [DB] nucleic acids. In practice, the labeling properties of barcode-encoded nucleic acids facilitate the data retrieval process.

[0085] In fact, barcodes may be obtained from available libraries or they may be created in silico.

[0086] In some embodiments, the composite nucleic acid molecule according to the present invention further comprises a non-digital data coding system block [SB] nucleic acid, wherein the [SB] nucleic acid is located upstream and / or downstream of the [DB] nucleic acid.

[0087] Where used herein, “non-digital data coding system block [SB] nucleic acid” is intended to represent a nucleic acid that enables the provision of indexing, metadata provision, security systems, and proofreading systems with respect to adjacent digital data coding [DB] nucleic acids.

[0088] In one embodiment, the nucleic acid [SB] is given by formula (IIa): 5'-[UP]-[SB]-[DB]-[DO]-3'(IIa) As illustrated by [DB], it is located upstream of nucleic acids.

[0089] In one other embodiment, the [SB] nucleic acid is given by formula (IIb): 5'-[UP]-[DB]-[SB]-[DO]-3'(IIb) As illustrated by [DB], it is located downstream of nucleic acids.

[0090] In another embodiment, the nucleic acid [SB] is given by formula (IIc): 5'-[UP]-[SB1]-[DB]-[SB2]-[DO]-3'(IIc) As illustrated by [DB], it is located both upstream and downstream of nucleic acids.

[0091] In the latter embodiment, the nucleic acids [SB1] and [SB2] are either identical or distinct.

[0092] In certain embodiments, [SB] is about 0 to about 10 5 This represents a nucleic acid having the length of a nucleotide.

[0093] Within the scope of the present invention, "about 0 nucleotides to about 10 5 The term "nucleotide" refers to 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 and 10 3 , 5×10 3 , 10 4 , 5×10 4 , and 10 5 It contains nucleotides.

[0094] Please understand that if [SB] nucleic acids exist, [UP] and [DO] nucleic acids simply represent barcode-encoded nucleic acids.

[0095] In certain embodiments, one or more nucleic acid molecules of formula (Ia) may constitute a sector (S). In some embodiments, up to about 10 5 The sectors (S) can be assembled into a double-stranded, reproducible complex nucleic acid molecule to form a track (T). In some embodiments, up to 10 9 Individual tracks (T) may be pooled to form a pool (P). In some embodiments, the pool (P) may be grouped to form an array (A). In some embodiments, the array (A) constitutes a DNA drive. As used herein, the expression “DNA drive” refers to a physical support on which digital data is stored.

[0096] [UP] and [DO] nucleic acids may enable the positioning of a sector within a track (T) or a pool of tracks (P), and / or enable the specific amplification of a given sector from a given pool (P), and / or enable the provision of a recognition site for editing a sector (S) in vitro or in vivo.

[0097] The apparatus according to the present invention may be characterized by its storage capacity expressed in octets (o), kilooctets (Ko), megaoctets (Mo), gigaoctets (Go), or teraoctets (To). In some embodiments, the properties of the apparatus according to the present invention range from about 1o (octets) to about 10 5 This is within the range of "To".

[0098] Within the scope of the present invention, "about 10 to about 10 5 The expression "To" can be used for 1o, 5o, 10o, 25o, 50o, 75o, 1Ko, 2Ko, 3Ko, 4Ko, 5Ko, 6Ko, 7Ko, 8Ko, 9Ko, 10Ko, 50Ko, 100Ko, 250Ko, 500Ko, 750Ko, 1Mo, 5Mo, 10Mo, 25Mo, 50Mo, 75Mo, 100Mo, 150Mo, 200Mo, 250Mo, 300Mo, 400Mo, 500Mo, 600Mo, 700Mo, 800Mo, 900Mo, 1Go, 2Go, 3Go, 4Go, 5Go, 10Go, 15Go, 20Go, 25Go, 50Go, 75Go, 100Go, 150Go, 200Go, 250Go, 300Go, 400Go, 500Go, 600Go, 700Go, 800Go, 900Go, 1To, 5To, 10To, 50To, 100To, 500To, 10 3 To, 5 x 10 3 To, 10 4 To, 5 x 10 4 To, and 10 5 It encompasses "To".

[0099] As exemplified in Figure 2, a sector (S) can be assembled into a track (T) corresponding to the double-stranded replicative composite nucleic acid molecule according to the present invention; the track (T) can be pooled into a pool (P), and the pool (P) can further be grouped into one array. One or more arrays (A) constitute a DNA drive.

[0100] The uses and methods according to the present invention can be performed in vivo, in vitro, or ex vivo.

[0101] One aspect of the present invention provides, for storing and / or editing and / or retrieving digital data, a compound of formula (I): 5'-([UP]-[DB]-[DO])x-3' (I) (wherein [UP] and [DO] each represent a pair of non-digital data-encoding nucleic acids having a length of from about 0 nucleotides to about 10 4 nucleotides, preferably from about 10 nucleotides to about 200 nucleotides, [DB] represents a digital data-encoding nucleic acid having a length of from about 8 nucleotides to about 10 6 nucleotides, preferably from about 500 nucleotides to about 5,000 nucleotides, x represents from about 1 to about 10 5 ) relates to the use of an apparatus comprising at least one double-stranded replicative composite nucleic acid molecule comprising the nucleic acid of.

[0102] Another aspect of the present invention is a method for storing digital data, comprising: a) assigning to said digital data at least one double-stranded digital data-encoding [DB] nucleic acid sequence (S DB ) and at least one pair of non-digital data-encoding [UP] and [DO] nucleic acid sequences (S UP ) and (S DO ), b) from each of (S UP ), (S DB ), and (S DO ), producing a compound of formula (Ia): 5'-([UP]-[DB]-[DO])-3'(Ia) A step of synthesizing at least one nucleic acid, c) Assemble one or more nucleic acids of formula (Ia) to form formula (I): 5'-([UP]-[DB]-[DO])x-3'(I) (In the formula, x is approximately 1 to approximately 10) 5 (represents) The steps include obtaining a double-stranded, reproducible complex nucleic acid molecule containing nucleic acids, d) For separate arrays, 1 to approximately 10 of equation (I) obtained in step c). 9 The steps include storing at least one pool containing a complex nucleic acid molecule in a storage cell and This includes methods.

[0103] In some embodiments, digital data may be compressed and / or encrypted. In fact, compression and / or encryption may be performed by any suitable algorithm. As used herein, the term “compression” is intended to describe the action of encoding information by using fewer bits than the original representation, for example, by eliminating redundancy. Non-exclusive examples of algorithms for performing digital data compression may be LZMA (Lempel Ziv Markow Algorithm) and LZMA2.

[0104] In fact, step a) assigning the above digital data to at least one double-stranded nucleic acid molecule that encodes both digital and non-digital data can be performed automatically by appropriate software. Exemplaryly, digital data, such as binary data, can be assigned to a specific nucleotide sequence.

[0105] Another subject of the present invention is computer software for carrying out uses and methods for storing digital data.

[0106] In one embodiment, the method of the present invention is carried out using a microprocessor that includes software configured to assign at least one double-stranded nucleic acid molecule to digital data. In some embodiments, the software is configured to achieve a C+G percentage of about 35% to about 65% with respect to the sequence of the complex nucleic acid molecule according to the present invention. In some embodiments, the software is configured to prevent the sequence of the complex nucleic acid molecule according to the present invention from encoding one or more RNAs, preferably one or more mRNAs. In some embodiments, the software is configured to prevent the sequence of the complex nucleic acid molecule according to the present invention from including one or more start codons, particularly in the [DB] nucleic acid. In some embodiments, the software is configured to achieve a sequence of the complex nucleic acid molecule according to the present invention that includes one or more stop codons per 200 nucleotides in all six reading frames. In some embodiments, the software is configured to prevent the sequence of the complex nucleic acid molecule according to the present invention from including one or more specific restriction sites. In some embodiments, the software is configured to prevent the sequence of the complex nucleic acid molecule according to the present invention from including one or more restriction sites, particularly BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI. In some embodiments, the software is configured to prevent the sequence of the complex nucleic acid molecule according to the present invention from containing one or more repeats of at least four identical nucleotides.

[0107] As shown in Figure 1, each bit "0" can be assigned to nucleotide A or nucleotide C, and each bit "1" can be assigned to nucleotide G or nucleotide T.

[0108] The 256-bit digital data of the following equation (III): 0100000110010010101000010000110000001101010001100011001000000000001111011101101000001111100101000111010011010110110100001100000001000001001111000010001010000011000101001001111111101000011101111001100001000110010100111110100010011111101111001100110111011000(III) is the 256-nucleotide sequence of the following formula (IV) (S DB ): 5'[CGCAACCGTCCGACTAGCTAAACGCAACGTCAACAAGTCTCGCAAGTAACGTCCGACCCAACCCAAGTTGAGTTAGGAGAACCCGTTTGACGATACCGGGCTCCTTCGAGTCTTATCAAAGTCCAACCCGCCCAAGAAGGTTCCAAGCAAGAGACAAAGGCCCGCTACGAATTGGTTTGAGACAAGGTAGTTGCCGGAACCTCAATTCCGATAAGTTGGCTCAAGACGGTTGGCTTTGACGGAAGTCGTTAGGAAC]3'(IV) (SEQ ID NO: 1) can be assigned to.

[0109] Accordingly, the pair of indicators [UP] and [DO] can be added to the 5' end and the 3' end, respectively.

[0110] For example, a 25-nucleotide indicator may have the sequence: (TATGAGGACGAATCTCCCGCTTATA; [UP]; SEQ ID NO: 2) and (GGTCTTGACAAACGTGTGCTTGTAC; [DO]; SEQ ID NO: 3).

[0111] Accordingly, the resulting composite nucleic acid molecule of general formula (I) can be represented by the nucleic acid molecule of the following formula (V): 5'[TATGAGGACGAATCTCCCGCTTATA]-[CGCAACCGTCCGACTAGCTAAACGCAACGTCAACAAGTCTCGCAAGTAACGTCCGACCCAACCCAAGTTGAGTTAGGAGAACCCGTTTGACGATACCGGGCTCCTTCGAGTCTTATCAAAGTCCAACCCGCCC AAGAAGGTTCCAAGCAAGAGACAAAGGCCCGCTACGAATTGGTTTGAGACAAGGTAGTTGCCGGAACCTCAATTCCGATAAGTTGGCTCAAGACGGTTGGCTTTGACGGAAGTCGTTAGGAAC]-[GGTCTTGACAAACGTGTGCTTGTAC]3'(V) (SEQ ID NO: 4).

[0112] In fact, step b) synthesizing at least one nucleic acid of formula (Ia) can be carried out by any suitable method known with the latest technology. Non-limiting examples of suitable methods include chemical synthesis and enzymatic synthesis. Exemplaryly, a chemical synthesis of nucleic acid molecules up to 200 nucleotides can be carried out. A nucleic acid molecule up to 200 nucleotides in length can be synthesized to a desired length, for example, up to about 10 6 It can be assembled to obtain nucleic acid molecules of nucleotides.

[0113] In fact, step c) of assembling one or more nucleic acids of formula (Ia) to obtain a double-stranded, reproducible complex nucleic acid molecule containing the nucleic acid of formula (I) may be performed with respect to the assembly of the nucleic acid molecule of formula (Ia).

[0114] In fact, step d) is 1 to approximately 10 9 The method includes the step of storing in a storage cell a pool containing 1 identical or distinct complex nucleic acid molecules of formula (I). As used herein, “identical complex nucleic acid molecules” refers to complex nucleic acid molecules having sequences with 100% identity. As used herein, “distinct complex nucleic acid molecules” refers to complex nucleic acid molecules having sequences with less than 100% identity.

[0115] The term "identity" or "identical," when used in reference to the relationship between two or more nucleic acid sequences, refers to the degree of relevance between sequences, determined by the number of matches between the chains of two or more nucleotides. "Identity" measures the percentage of identical matches between the smaller of two or more sequences, accompanied by gap alignment (if any), as presented by a specific mathematical model or computer program (i.e., an "algorithm"). The identity of related nucleic acid sequences can be readily calculated by known methods.

[0116] In fact, the percentage of nucleic acid identity is set as follows in the CLUSTAL W software (version 1.83) parameters: For slow / accurate alignment: (1) Gap start penalty: 15; (2) Gap extension penalty: 6.66; (3) Weight matrix: IUB; fast / approximate alignment: (4) K-tuple (word) size: 2; (5) Gap penalty: 5; (6) Number of top diagonals: 5; (7) Window size: 4; (8) Scoring method: PERCENT This can be determined using:

[0117] In some embodiments, step d) is a separate, approximately 1 to 10 of formula (I). 9 The method includes the step of storing at least one pool containing a complex nucleic acid molecule in a storage cell.

[0118] Within the scope of the present invention, "1 to about 10 9 The expression "a complex nucleic acid molecule" refers to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 10 3 , 5×10 3 , 10 4 , 5×10 4 , 10 5 , 5×10 5 , 10 6 , 5×10 6 , 10 7 , 5×107 , 10 8 , 5×10 8 , and 10 9 It contains multiple complex nucleic acid molecules.

[0119] Within the scope of this invention, the expression "at least one pool" means 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 10 3 , 5×10 3 , 10 4 , 5×10 4 , 10 5 , 5×10 5 , 10 6 It encompasses individual pools.

[0120] In fact, the storage cell may be any suitable receiver known in advanced technology for sustained storage of nucleic acid molecules. In some embodiments, the storage cell may be selected from the group including biological, glass-based, metal-based, silica-based, polymer-based, and paper-based receivers.

[0121] In certain embodiments, the organism may be a cell derived from bacteria, microalgae, archaea, fungi, or yeast. In some embodiments, the organism is a particle such as a phage or virus. In some embodiments, the organism is a prokaryote, selected from the group including bacteria, e.g., actinomycetes, Chlamydiales, cyanobacteria, firmicutes, proteobacteria, spirochetes, and thermotogales; and archaea, e.g., Creanarchaea, Euryarchaeota, Corarchaeota, Nanoarchaeota, and Thaumaranthiae. In certain embodiments, the organism is a cell, selected from the group including eukaryotic cells, particularly cells of protozoa, algae, plants, fungi, and animals.

[0122] In some embodiments, the animal or animal cell is not a human or a human cell, respectively.

[0123] In some embodiments, the storage of the complex nucleic acid molecules according to the present invention may be carried out in solution or in a dry state. In fact, the storage of the complex nucleic acid molecules according to the present invention in solution may be carried out in an alkaline solution, particularly a solution with a pH greater than 8. In fact, the dry nucleic acid molecules according to the present invention may be obtained, for example, by spray drying, spray freeze-drying, air drying, or freeze-drying. In some embodiments, the freeze-dried nucleic acid molecules according to the present invention may be encapsulated in an inert atmosphere. In one embodiment, the storage of the nucleic acid molecules according to the present invention may be carried out on paper, for example, on FTA® cards (Whatman®).

[0124] In certain embodiments, the complex nucleic acid molecules according to the present invention may be stored at a temperature of about -196°C to about +100°C. In some embodiments, storage may be carried out in liquid nitrogen (about -196°C). In some embodiments, storage may be carried out in a freezer, particularly at a temperature of about -80°C to about -20°C. In some embodiments, storage may be carried out at room temperature, particularly at a temperature of about +15°C to about +30°C.

[0125] Within the scope of the present invention, the expression "approximately -196°C to approximately +100°C" includes -196°C, -180°C, -170°C, -160°C, -150°C, -140°C, -130°C, -120°C, -110°C, -100°C, -90°C, -80°C, -70°C, -60°C, -50°C, -40°C, -30°C, -20°C, -10°C, -5°C, 0°C, +4°C, +5°C, +10°C, +15°C, +20°C, +25°C, +30°C, +35°C, +40°C, +45°C, +50°C, +55°C, +60°C, +65°C, +70°C, +75°C, +80°C, +85°C, +90°C, +95°C, and +100°C.

[0126] In some embodiments, this method e) The pool obtained in step d is divided into 1 pool ~ approximately 10 6 Steps to construct and group pools into at least one array containing approximately 96 or 384 pools. It also includes.

[0127] Within the scope of the present invention, "1 pool to about 10 6 The expression "pool of individual pools" refers to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 10 2 , 10 3 , 10 4 , 10 5 , and 10 6 It encompasses individual pools.

[0128] Within the scope of the present invention, the expression "about 96 or about 384 pools" encompasses 96, 102, 108, 114, 120, 126, 132, 138, 144, 150, 156, 162, 168, 174, 180, 186, 192, 198, 204, 210, 216, 222, 228, 234, 240, 246, 252, 258, 264, 270, 276, 282, 288, 294, 300, 306, 312, 318, 324, 330, 336, 342, 348, 354, 360, 366, 372, 378, and 384 pools.

[0129] In certain embodiments, the complex nucleic acid molecule obtained in step c) is a plasmid, cosmid, prokaryotic chromosome, or eukaryotic chromosome.

[0130] As used herein, the term "plasmid" refers to a small extragenomic DNA molecule, most commonly found as a round, double-stranded DNA molecule that can be used as a cloning vector in molecular biology to create / modify copies of DNA fragments up to 50 kb (i.e., 50,000 base pairs (bp)).

[0131] Within the scope of this invention, the expression "maximum approximately 50kb" means 0.1kb, 0.2kb, 0.3kb, 0.4kb, 0.5kb, 0.6kb, 0.7kb, 0.8kb, 0.9kb, 1kb, 1.1kb, 1.2kb, 1.3kb, 1.4kb, 1.5kb, 1.6kb, 1.7kb, 1. 8kb, 1.9kb, 2kb, 2.2kb, 2.4kb, 2.6kb, 2.8kb, 3kb, 3.2kb, 3.4kb, 3.6kb, 3.8k b, 4kb, 4.2kb, 4.4kb, 4.6kb, 4.8kb, 5kb, 5.2kb, 5.4kb, 5.6kb, 5.8kb, 6kb, 6.2 kb, 6.4kb, 6.8kb, 7kb, 7.5kb, 8kb, 8.5kb, 9kb, 9.5kb, 10kb, 11kb, 12kb, 13kb , 14kb, 15kb, 16kb, 17kb, 18kb, 19kb, 20kb, 21kb, 22kb, 23kb, 24kb, 25kb, 26kb It includes 27kb, 28kb, 29kb, 30kb, 31kb, 32kb, 33kb, 34kb, 35kb, 36kb, 37kb, 38kb, 39kb, 40kb, 41kb, 42kb, 43kb, 44kb, 45kb, 46kb, 47kb, 48kb, 49kb, and 50kb.

[0132] As used herein, the term “cosmid” refers to a hybrid plasmid containing a lambda phage-derived cos sequence that enables the packaging of the cosmid into a phage head and subsequent infection of bacterial cells. Cosmids are cyclized and can be replicated as plasmids. Often, cosmids represent DNA nucleic acid molecules in the size range of approximately 32kb–52kb.

[0133] Within the scope of the present invention, the expression "approximately 32kb to 52kb" encompasses 32kb, 33kb, 34kb, 35kb, 36kb, 37kb, 38kb, 39kb, 40kb, 41kb, 42kb, 43kb, 44kb, 45kb, 46kb, 47kb, 48kb, 49kb, 50kb, 51kb, and 52kb.

[0134] As used herein, “prokaryotic chromosome” refers to a nucleic acid molecule that can replicate in a prokaryote.

[0135] In some embodiments, the prokaryotic chromosome is a bacterial chromosome, preferably a bacterial artificial chromosome. As used herein, “bacterial artificial chromosome” or “BAC” refers to an extragenomic nucleic acid molecule based on a functional fertility plasmid that allows for further splitting of the DNA nucleic acid molecule of the extragenomic nucleic acid molecule after bacterial cell division. BACs are typically used as cloning vectors with DNA fragments ranging in size from about 50 kb to 350 kb.

[0136] Within the scope of this invention, the expression "approximately 50kb to 350kb" encompasses 50kb, 60kb, 70kb, 80kb, 90kb, 100kb, 110kb, 120kb, 130kb, 140kb, 150kb, 160kb, 170kb, 180kb, 190kb, 200kb, 210kb, 220kb, 230kb, 240kb, 250kb, 260kb, 270kb, 280kb, 290kb, 300kb, 310kb, 320kb, 330kb, 340kb, and 350kb.

[0137] As used herein, “eukaryotic chromosome” refers to a nucleic acid molecule that can replicate in a eukaryote.

[0138] In some embodiments, this method c1) In vivo, amplify at least one complex nucleic acid molecule containing the nucleic acid of formula (I) obtained in step c), c2) A step to extract and purify the amplified complex nucleic acid molecule obtained in step c1) and It also includes.

[0139] In some embodiments, step c1) is carried out in vivo by an organism, preferably a microorganism.

[0140] In some embodiments, when the storage and / or amplification of the complex nucleic acid molecule according to the present invention is carried out in a living organism, the complex nucleic acid molecule is introduced into the organism, preferably into at least one cell of the organism. In fact, these steps can be carried out because the complex nucleic acid molecule according to the present invention is biocompatible.

[0141] In fact, the introduction of nucleic acid molecules into prokaryotic or eukaryotic cells can be carried out by any appropriate method of cutting-edge origin.

[0142] Exemplary, the introduction of nucleic acid molecules into prokaryotic cells, particularly bacteria, can be carried out by transformation of competent bacteria or transduction using phages. As used herein, the term "competent" refers to such bacteria that have been treated to increase their ability to take up extracellular genomic nucleic acid molecules into the bacterial cytoplasm. Those skilled in the art are familiar with the techniques for preparing competent bacteria.

[0143] Exemplary examples include the introduction of nucleic acid molecules into eukaryotic cells by physical / chemical procedures, transformation, conjugation, transfection, or transduction using microorganisms, viral particles, and / or liposomes.

[0144] In fact, one would represent the manufacturer's instructions if a commercially available kit or substance is used, and / or the protocol described by Maniatis et al. (Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, 1982).

[0145] Furthermore, another aspect of the present invention is a method for retrieving digital data stored by an apparatus and / or a method according to the present invention, a) Sequence at least one nucleic acid of formula (Ia) contained in a double-stranded replicating complex nucleic acid molecule containing the nucleic acid of formula (I), and obtain at least one nucleic acid sequence (S UP -S DB -SDO The steps to obtain ) and b) At least one nucleic acid sequence (S DB The steps to convert ) into digital data and Includes, Optionally, before step a), step a0) is performed, in which at least one nucleic acid of formula (Ia) is amplified. Regarding the method.

[0146] In fact, step a) sequencing nucleic acid molecules can be performed by any suitable technique known to those skilled in the art. Non-limiting examples of suitable sequencing techniques include Sanger sequencing and next-generation sequencing (NGS), also known as high-throughput sequencing (HTS).

[0147] In fact, at least one nucleic acid sequence (S DB Step b) of converting ) into digital data can be performed automatically by appropriate software or in silico. The decryption step can be performed using the reverse method of the encryption step.

[0148] In fact, step a0), which amplifies a nucleic acid molecule containing a nucleic acid of formula (I) of any choice, can be performed in vivo in a living organism or in vitro by any suitable known technique derived from state-of-the-art technology. PCR is an example of a technique suitable for amplifying nucleic acid molecules. When performing PCR, (S DB ) consists of a 5'(SUP) sequence and a 3'(S DO The sequence can be amplified using a primer pair that suitably hybridizes with complementary sequences within the sequence. In fact, step a0) can be performed in vivo because the composite nucleic acid molecule according to the present invention is biocompatible.

[0149] Another subject of the present invention is computer software for carrying out uses and methods for recovering digital data.

[0150] In one embodiment, the method of the present invention involves at least one nucleic acid sequence (S DB This is carried out by a microprocessor that includes software configured to convert the data into digital data. [Brief explanation of the drawing]

[0151] [Figure 1] Figure 1 is a scheme illustrating a strategy for encoding a digital data file as a composite nucleic acid molecule according to the present invention. The upper panel shows the 256-bit length digital data to be encoded. The lower panel shows the corresponding digital data encoded nucleic acid based on the encoding (where bit "0" is encoded by a nucleotide of A or G, and bit "1" is encoded by a nucleotide of C or T) (see [DB] for sequence SEQ ID NO: 1). The [DB] nucleic acid is adjacent to the [UP] nucleic acid for sequence SEQ ID NO: 2 at its 5' end and adjacent to the [DO] nucleic acid for sequence SEQ ID NO: 3 at its 3' end. [Figure 2] Figure 2 is a scheme illustrating the construction of a DNA drive according to the present invention, with the following shown from top to bottom: (1) sectors (S) corresponding to the smallest units in which digital data is encoded; sectors (S) are made up of nucleic acids [UP], [DB], and [DO]; (2) sectors (S) can be assembled into tracks (T) corresponding to double-stranded replicable complex nucleic acid molecules containing multiple sectors; boxes represent double-stranded nucleic acid molecules containing one or more origins of replication. Tracks (T) can be pooled into pools (P) which can be assembled into a single array (A). Several arrays (A) constitute a DNA drive. [Modes for carrying out the invention]

[0152] Examples The present invention is further illustrated by the following examples.

[0153] Example 1 A DNA drive in one array (A) containing 96 pools of 10,000 tracks (T), each constructed from nine sectors (S) consisting of a pair of 25-nucleotide [UP] and [DO] nucleic acids flanked by a single 3,000-nucleotide [DB] nucleic acid, may contain equivalents of 3.24 Go digital data at an encoding density of 1 bit per nucleotide.

[0154] Example 2 A DNA drive consisting of 100 arrays (A) containing 384 pools of 10,000 tracks (T), each made up of nine sectors (S) consisting of a pair of 25-nucleotide [UP] and [DO] nucleic acids flanked by a single 3,000-nucleotide [DB] nucleic acid, may contain equivalents of 1.3 To of digital data at an encoding density of 1 bit per nucleotide.

[0155] Example 3 An example of a DNA drive containing the "Declaration of the Rights of Man and of the Citizen from 1789" The DNA drive was physically constructed to contain a single text file corresponding to the original French text of the Declaration of the Rights of Man and of the Citizen from 1789 ("La declaration des droits de l'homme et du citoyen de 1789") (source: Bibliotheque Nationale de France), which is fully reproduced below in this specification. “Declaration des Droits de l'Homme et du Citoyen de 1789 The Representatives of the French People, constituted as a National Assembly, considering that ignorance, neglect, or contempt for the rights of Man are the sole causes of public misfortunes and the corruption of Governments, have resolved to set forth, in a solemn Declaration, the natural, inalienable, and sacred rights of Man, so that this Declaration, constantly presented to all Members of the social body, may continually remind them of their rights and duties; so that the acts of the legislative power, and those of the executive power, being able at every moment to be compared with the purpose of all political institutions, may be more respected; so that the demands of citizens, henceforth based on simple and indisputable principles, may always lead to the maintenance of the Constitution and the happiness of all. Consequently, the National Assembly recognizes and declares, in the presence and under the auspices of the Supreme Being, the following rights of Man and of the Citizen. Article 1. Men are born and remain free and equal in rights. Social distinctions may be based only on common utility. Article 2. The aim of all political association is the preservation of the natural and imprescriptible rights of Man. These rights are liberty, property, security, and resistance to oppression. Article 3. The principle of all sovereignty resides essentially in the Nation. No body, no individual may exercise any authority which does not expressly emanate from it. Article 4. Liberty consists in being able to do anything that does not harm others: thus, the exercise of the natural rights of each man has no limits except those which ensure to the other members of society the enjoyment of these same rights. These limits can only be determined by law. Article 5. The Law only has the right to prohibit actions harmful to Society. Anything not prohibited by Law cannot be prevented, and no one can be compelled to do what it does not order. Article 6. The Law is the expression of the general will. All citizens have the right to participate personally, or through their representatives, in its formation. It must be the same for all, whether it protects or punishes. All citizens, being equal in its eyes, are equally eligible for all public dignities, offices, and employments, according to their capacity, and without any distinction other than that of their virtues and talents. Article 7. No man may be accused, arrested, or detained except in the cases determined by law, and according to the forms it has prescribed. Those who solicit, expedite, execute, or cause to be executed arbitrary orders must be punished; but every citizen summoned or seized by virtue of the law must obey immediately: resistance renders him guilty. Art. 8. The Law shall establish only penalties which are strictly and evidently necessary, and no one may be punished except by virtue of a Law established and promulgated prior to the offence, and legally applied. Article 9. Every man being presumed innocent until he has been declared guilty, if it is judged indispensable to arrest him, any rigor which is not necessary to secure his person must be severely repressed by law. Article 10. No one should be disturbed for their opinions, even religious ones, provided that their manifestation does not disturb the public order established by law. Article 11. The free communication of thoughts and opinions is one of the most precious rights of Man: every Citizen may therefore speak, write, print freely, subject to being held accountable for the abuse of this freedom in the cases determined by Law. Article 12. The guarantee of the rights of Man and of the Citizen requires a public force: this force is therefore instituted for the benefit of all, and not for the particular benefit of those to whom it is entrusted. Art. 13. For the maintenance of the public force, and for the expenses of administration, a common contribution is indispensable: it must be equally distributed among all citizens, according to their means. Article 14. All citizens have the right to ascertain, by themselves or by their representatives, the necessity of the public contribution, to consent to it freely, to follow its use, and to determine its amount, basis, collection and duration. Art. 15. La Societe a le droit de demander compte a tout Agent public de son administration. Art. 16. Toute Societe dans laquelle la garantie des Droits n'est pas assuree, ni la separation des Pouvoirs determinee, n'a point de Constitution. Art. 17. La propriete etant un droit inviolable et sacre, nul ne peut en etre prive, si ce n'est lorsque la necessite publique, legalement constatee, l'exige evidemment, et sous la condition d'une juste et prealable indemnite.”

[0156] This text file was encoded using the ISO 8859-1 standard material (commonly referred to as Latin-1), and its final size is 5,253 octets. This file was compressed using LZMA (Lempel-Ziv-Markov chain Algorithm). The compressed file (provided in binary hereafter) has a length of 2,293 octets.

[0157] This binary file was converted to nucleotides using the Church-Gao-Kosuri encoding scheme (Church et al.; 2012, Science, Volume 337, Issue 6102, pp1628), where A and C are represented by bit 0 and T and G by bit 1. For each bit (0 or 1), the corresponding nucleotide was randomly determined to be one of two possible nucleotides (0 for A or C, 1 for T or G). The resulting 18,344 nucleotide sequence was divided into six data blocks of 3,000 nucleotides each ([DB]) and one data block of 344 nucleotides. Next, each [DB] undergoes a random nucleotide modification cycle to enable sequence convergence toward a biocompatible sequence that conforms to the following DNA drive specifications: controlled percentage of G+C (35%–65%), no mRNA encoding, no start codons, at least one stop codon per 200 nucleotides in all six reading frames, no restriction sites for enzymes BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI, and no more than three identical nucleotide repeats.

[0158] The obtained nucleotide sequences are called data blocks [DB] ([DB-1] to [DB-7]) as shown in Table 3.

[0159] [Table 3] TIFF0007912263000004.tif243163TIFF0007912263000005.tif243165TIFF0007912263000006.tif243161 TIFF0007912263000007.tif242162TIFF0007912263000008.tif242160TIFF0007912263000009.tif228161

[0160] In fact, each sequence was scanned for prohibited nucleotide patterns (e.g., the presence of the BamHI restriction site "GGATCC"), and one randomly selected nucleotide within this pattern was replaced with its binary equivalent. After multiple iterative combinations, the sequences eventually converged to biocompatible sequences that conformed to the DNA drive specifications (see Table 3).

[0161] For each [DB], non-digital data encoding blocks [UP] and [DO] were added before and after the [DB]. The sequences of seven pairs of [UP] and [DO] blocks are provided in Tables 4 and 5, respectively.

[0162] [Table 4]

[0163] [Table 5]

[0164] The sectors were chemically synthesized and assembled to obtain the final sequence of formula I:5'-([UP]-[DB]-[DO])x-3'(x=7)(SEQ ID NO: 26). This 18,732-nucleotide sequence was inserted into a replication plasmid for manipulation of the E. coli DNA sequence.

[0165] This plasmid was replicated in E. coli, extracted, and sequenced using a DNA sequencer. The seven [DB] nucleotide sequences obtained experimentally were converted to binary files using the Church-Gao-Kosuri decoding scheme (A=C=0, G=T=1). The binary files were not compressed using the LZMA algorithm, and the text files were recovered with 100% accuracy.

[0166] Sequence ID 26 (Complete sequence of the DNA drive)

Claims

1. Equation (I): 5'-([UP]-[DB]-[DO])x-3'(I) (In the formula, [DB] is 8 nucleotides to approximately 10 6 It represents a digital data-encoded nucleic acid having the length of a nucleotide, [UP] and [DO] each consist of 1 nucleotide to approximately 10 4 Represents a pair of non-digital data-encoded nucleic acids having the length of a nucleotide, x is between 1 and approximately 10 5 (represents) A device for storing and / or editing digital data comprising a nucleic acid, wherein the nucleic acid of formula (I) does not contain one or more restriction sites relating to an enzyme or its isoschisomer selected from the group consisting of BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI, and comprising at least one double-stranded in vivo replicating complex nucleic acid molecule, The apparatus includes a storage cell in which the at least one double-stranded nucleic acid molecule is stored, and / or a microprocessor including software configured to assign digital data to the at least one double-stranded nucleic acid molecule.

2. The apparatus according to claim 1, wherein [DB] represents a digital data encoding nucleic acid having a length of approximately 500 nucleotides to approximately 5,000 nucleotides.

3. The apparatus according to claim 1 or 2, wherein [UP] and [DO] each represent a pair of non-digital data encoding nucleic acids having a length of about 10 to about 200 nucleotides.

4. The aforementioned complex nucleic acid molecule comprises approximately 500 nucleotides to approximately 10 11 The apparatus according to any one of claims 1 to 3, having the length of a nucleotide.

5. The aforementioned complex nucleic acid molecule is about 10 3 Nucleotides ~ approximately 10 5 The apparatus according to claim 4, having the length of a nucleotide.

6. The apparatus according to any one of claims 1 to 5, wherein the nucleic acid of formula (I) has a C+G percentage of about 35% to about 65%.

7. The apparatus according to any one of claims 1 to 6, wherein the nucleic acid of formula (I) does not encode one or more RNAs.

8. The apparatus according to claim 7, wherein the nucleic acid of formula (I) does not encode one or more mRNAs.

9. The apparatus according to any one of claims 1 to 8, wherein the nucleic acid of formula (I) does not contain one or more start codons and / or contains one or more stop codons per approximately 200 nucleotides in all six reading frames.

10. The apparatus according to any one of claims 1 to 9, wherein the nucleic acid of formula (I) does not contain one or more repeats of at least four identical nucleotides.

11. The apparatus according to any one of claims 1 to 10, wherein each nucleotide of the [DB] nucleic acid encodes 1 or 2 bits of digital data.

12. The apparatus according to any one of claims 1 to 11, wherein the [UP] and [DO] nucleic acids each comprise at least one barcode encoding nucleic acid and / or at least one metadata encoding nucleic acid.

13. A method for storing digital data, a) assigning to said digital data at least one double-stranded digital data-encoded [DB] nucleic acid sequence (S DB ) and at least one pair of non-digital data-encoded [UP] and [DO] nucleic acid sequences (S UP ) and (S DO ); b) Array (S UP ), (S DB ), and (S DO ), from each, equation (Ia): 5'-([UP]-[DB]-[DO])-3'(Ia) A step of synthesizing at least one nucleic acid, c) Assemble one or more nucleic acids of formula (Ia) to form formula (I): 5'-([UP]-[DB]-[DO])x-3'(I) (In the formula, x is between 1 and approximately 10) 5 (represents) A step to obtain a double-stranded in vivo replicating complex nucleic acid molecule containing the nucleic acid of formula (I), wherein the nucleic acid of formula (I) does not contain one or more restriction sites relating to an enzyme or its isoschisomer selected from the group consisting of BamHI, BsaI, BbsI, EcoRI, FokI, and I-SceI, d) 1 to approximately 10 separate sequences 9 The steps include storing in a storage cell at least one pool containing complex nucleic acid molecules and the nucleic acid of formula (I) obtained in step c), and Methods that include...

14. e) The pool obtained in step d) can be divided into one pool to approximately 10 6 The method according to claim 13, further comprising the step of constructing and grouping into at least one array including a pool of.

15. The method according to claim 14, wherein step e) comprises the step of constructing and grouping the pools obtained in step d) into at least one array containing one to 96 or 384 pools.

16. The method according to any one of claims 13 to 15, wherein the complex nucleic acid molecule obtained in step c) is a plasmid, a cosmid, a prokaryotic chromosome, or a eukaryotic chromosome.

17. c1) a step of amplifying in vivo at least one complex nucleic acid molecule containing the nucleic acid of formula (I) obtained in step c), c2) A step of extracting and purifying the amplified complex nucleic acid molecule obtained in step c1) The method according to any one of claims 13 to 16, further comprising:

18. The method according to claim 17, wherein step c1) is performed in vivo by a living organism.

19. The method according to claim 18, wherein step c1) is performed in vivo by a microorganism.

20. A method for recovering digital data stored by the apparatus described in any one of claims 1 to 12 and / or by the method described in any one of claims 13 to 19, a) Sequencing at least one nucleic acid of formula (Ia) contained in a double-stranded in vivo replicating complex nucleic acid molecule containing the nucleic acid of formula (I), thereby obtaining at least one nucleic acid sequence (S UP -S DB -S DO The steps to obtain ) b) At least one nucleic acid sequence (S DB The steps to convert ) into digital data and Methods that include...

21. The method according to claim 20, wherein step a0) is performed before step a) amplifying at least one nucleic acid of formula (Ia).

Citation Information

Patent Citations

  • Methods of encoding and high-throughput decoding of information stored in DNA

    WO2019079802A1