Polypeptides having 4-aminobenzoic acid hydroxylation activity and their utilization
Patent Information
- Application Number
- JP2022117492
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-07-22
- Publication Date
- 2026-09-01
- Estimated Expiration
- 2042-07-22
AI Technical Summary
【0012】 本発明の4-アミノ安息香酸水酸化活性を有するポリペプチドは顕著に優れた4-アミノ安息香酸水酸化活性を有することから、これを用いることにより、4-アミノ安息香酸類から効率よく4-アミノ-3-ヒドロキシ安息香酸類を製造することができる。
Smart Images

Figure 0007913908000001 
Figure 0007913908000002 
Figure 0007913908000003
Abstract
Description
[Technical Field]
[0001] This invention relates to a polypeptide having 4-aminobenzoic acid hydroxylation activity and its use. [Background technology]
[0002] Polybenzoxazole (PBO) is known as an engineering plastic with excellent heat resistance and mechanical strength, and is used in fiber materials and insulating films for semiconductor devices, etc. (Non-patent document 1).
[0003] The benzoxazole skeleton is formed by the condensation of an o-aminophenol skeleton with a carboxylic acid. Therefore, 4-amino-3-hydroxybenzoic acid (4,3-AHBA) compounds, which have these functional groups in their molecules, are expected to be useful as PBO monomers. In fact, the synthesis and property evaluation of polybenzoxazoles using 4,3-AHBA have been investigated (Non-Patent Literature 2).
[0004] In recent years, methods for producing compounds using microbial fermentation with renewable resources as raw materials have attracted attention as a means of reducing the burden on the global environment. For example, studies are being conducted on the microbial production and polymerization of 3-amino-4-hydroxybenzoic acid (3,4-AHBA), which has a structure similar to 4,3-AHBA (Patent Document 1).
[0005] Regarding the production of 4,3-AHBA, methods such as chemical reduction of nitroaromatic compounds have been known (Patent Document 2). As a strategy to enable fermentation production of 4,3-AHBA by microorganisms, hydroxylation of the 3-position of 4-aminobenzoic acid (4-ABA), which can be biosynthesized within microorganisms, is conceivable. However, regarding such a reaction, only some 4-hydroxybenzoic acid hydroxylases have been reported to have slight activity (Non-Patent Documents 3, 4).
[0006] Under these circumstances, the applicant has discovered a specific 4-hydroxybenzoic acid hydroxylase (HFM122) having 4-aminobenzoic acid hydroxyl activity, and a variant of the enzyme having high 4-aminobenzoic acid hydroxyl activity, and has already filed patent applications (Patent Documents 3-7). [Prior art documents] [Patent Documents]
[0007] [Patent Document 1] Patent No. 5445453 [Patent Document 2] Patent No. 3821350 [Patent Document 3] Japanese Patent Publication No. 2020-39330 [Patent Document 4] Japanese Patent Publication No. 2021-73914 [Patent Document 5] Japanese Patent Publication No. 2021-101626 [Patent Document 6] Japanese Patent Publication No. 2021-101627 [Patent Document 7] Japanese Patent Publication No. 2022-47939 [Non-patent literature]
[0008] [Non-Patent Document 1] Hiroki Murase, SENI GAKKAISHI (Textiles and Industry), Vol. 66, No. 6 (2010) [Non-Patent Document 2] Lon J. Mathias et al., Macromolecules, Vol.18, No.4, pp.616-622 (1985) [Non-Patent Document 3] Barrie Entsch et al., The Journal of Biological Chemistry, Vol.262, No.13, pp.6060-6068 (1987) [Non-Patent Document 4] Domenico L. Gatti et al., Biochemistry, Vol.35, No.2, pp.567-578 (1996) SUMMARY OF THE INVENTION PROBLEM TO BE SOLVED BY THE INVENTION
[0009] The present invention relates to providing a polypeptide having excellent 4-aminobenzoic acid hydroxylation activity and a method of use thereof. MEANS FOR SOLVING THE PROBLEM
[0010] The present inventors discovered that a mutant of 4-hydroxybenzoate hydroxylase having a specific amino acid sequence has remarkably excellent 4-aminobenzoic acid hydroxylation activity, and is useful for producing 4-amino-3-hydroxybenzoic acids.
[0011] That is, the present invention relates to the following 1) to 7). 1) A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein in the amino acid sequence represented by SEQ ID NO: 2, the amino acid residues at positions 47 and 106, positions 47 and 201, positions 47 and 222, positions 47 and 294, positions 106 and 201, or positions 106 and 294 are the amino acids described below; or in an amino acid sequence having at least 90% identity with the amino acid sequence represented by SEQ ID NO: 2, the amino acid residues at positions corresponding to positions 47 and 106, positions 47 and 201, positions 47 and 222, positions 47 and 294, positions 106 and 201, or positions 106 and 294 of the amino acid sequence represented by SEQ ID NO: 2 are the amino acids described below. (a) Position 47 or a position corresponding thereto: leucine (b) Position 106 or a position corresponding thereto: alanine (c) Position 201 or a position corresponding thereto: phenylalanine (d) Position 222 or a position corresponding thereto: phenylalanine (e) Position 294 or a position corresponding thereto: serine 2) A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, comprising substituting an amino acid residue at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids, or substituting an amino acid residue at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine 3) A method for improving 4-aminobenzoic acid hydroxylation activity, comprising substituting amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids, or substituting amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine 4) A polynucleotide that codes for the polypeptide of 1). 5) A vector or DNA fragment containing the polynucleotides described in 4). 6) Transformed cells containing the vector or DNA fragment of 5). A method for producing 4-amino-3-hydroxybenzoic acid compounds, comprising the step of culturing transformed cells according to 7)6). [Effects of the Invention]
[0012] The polypeptide having 4-aminobenzoic acid hydroxylation activity of the present invention exhibits remarkably excellent 4-aminobenzoic acid hydroxylation activity, and by using it, 4-amino-3-hydroxybenzoic acid compounds can be efficiently produced from 4-aminobenzoic acid compounds. [Modes for carrying out the invention]
[0013] In this specification, the identity of amino acid sequences or nucleotide sequences is calculated using the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, it is calculated by performing the homology analysis (Search homology) using the genetic information processing software GENETYX Ver.12 with a Unit size to compare (ktup) of 2.
[0014] In this specification, the "corresponding position" on an amino acid sequence or nucleotide sequence can be determined by aligning the target sequence with a reference sequence (for example, the amino acid sequence shown in Sequence ID No. 2) to give the greatest homology. Alignment of an amino acid sequence or nucleotide sequence can be performed using known algorithms, and the procedures are known to those skilled in the art. For example, alignment can be performed using the Clustal W multiple alignment program (Thompson, J. Det. al., 1994, Nucleic Acids Res. 22:4673-4680) with default settings. Alternatively, revised versions of Clustal W, such as Clustal W2 or Clustal Omega, can be used. Clustal W, Clustal W2, and Clustal omega can be accessed, for example, from the Clustal website operated by University College Dublin [www.clustal.org], the European Bioinformatics Institute (EBI [www.ebi.ac.uk / index.html]), and the DNA Databank of Japan (DDBJ [www.ddbj.nig.ac.jp / searches-j.html]) operated by the National Institute of Genetics. The position of the target sequence aligned to any position in the reference sequence by the above alignment is considered to be the "corresponding position" to that arbitrary position.
[0015] Those skilled in the art can further fine-tune the amino acid sequence alignment obtained above to optimize it. Such an optimal alignment is preferably determined by considering the similarity of the amino acid sequences and the frequency of inserted gaps. Here, similarity of amino acid sequences refers to the ratio (%) of the number of positions where identical or similar amino acid residues exist in both sequences when two amino acid sequences are aligned, relative to the total number of amino acid residues. Similar amino acid residues refer to amino acid residues among the 20 amino acids that make up a protein that have similar properties in terms of polarity and charge, resulting in so-called conservative substitutions. Groups consisting of such similar amino acid residues are well known to those skilled in the art, and examples include, but are not limited to, arginine and lysine or glutamine; glutamic acid and aspartic acid or glutamine; serine and threonine or alanine; glutamine and asparagine or arginine; leucine and isoleucine, etc.
[0016] In this specification, "amino acid residue" means the 20 amino acid residues that make up proteins: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine (Cys or C), glutamine (Gln or Q), glutamic acid (Glu or E), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V).
[0017] In this specification, "operable linkage" between a regulatory region such as a promoter and a gene means that the gene and the regulatory region are linked in such a way that the gene can be expressed under the control of the regulatory region. Procedures for "operable linkage" between a gene and a regulatory region are well known to those skilled in the art.
[0018] In this specification, "upstream" and "downstream" with respect to a gene refer to the upstream and downstream regions in the transcription direction of the gene. For example, "a gene located downstream of a promoter" means that the gene is located on the 3' side of the promoter in the DNA sense strand, and "upstream of a gene" means the 5' region of the gene in the DNA sense strand.
[0019] In this specification, the term "inherent" used with respect to the function, properties, or traits of a cell is used to indicate that the function, property, or trait is inherently present in the cell. In contrast, the term "external" is used to indicate a function, property, or trait that is not inherently present in the cell but has been introduced from outside. For example, an "external" gene or polynucleotide is a gene or polynucleotide that has been introduced into a cell from outside. An external gene or polynucleotide may originate from the same species of organism as the cell into which it was introduced, or from a different species of organism (i.e., a different gene or polynucleotide).
[0020] <Polypeptides possessing 4-aminobenzoic acid hydroxylation activity> The polypeptide having 4-aminobenzoic acid hydroxylation activity (referred to as "the polypeptide of the present invention") is a polypeptide in which, in the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are the following amino acids, or in an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine Such polypeptides are mutant polypeptides having 4-aminobenzoic acid hydroxylation activity, wherein in a standard polypeptide, i.e., a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are substituted with the amino acids (a) to (e) above, or in a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are substituted with the amino acids (a) to (e) above.
[0021] The polypeptides of the present invention are preferably polypeptides in which the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity thereto is leucine at position 47 or a corresponding position of the amino acid sequence shown in SEQ ID NO: 2 and alanine at position 106 or a corresponding position; polypeptides in which the amino acid residue at position 106 or a corresponding position is alanine and phenylalanine at position 201 or a corresponding position; and polypeptides in which the amino acid residue at position 106 or a corresponding position is alanine and serine at position 294 or a corresponding position.
[0022] In the present invention, "4-aminobenzoic acid hydroxylation activity" means the activity that catalyzes the hydroxylation of 4-aminobenzoic acids, preferably the activity that catalyzes the hydroxylation at the 3-position of 4-aminobenzoic acids. The 4-aminobenzoic acid hydroxylation activity can be determined by culturing microorganisms that produce the polypeptide of the present invention and measuring the amount of 4-amino-3-hydroxybenzoic acid produced by HPLC or the like, as shown in the examples described later.
[0023] The polypeptide of the present invention can be produced by substituting the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 with the amino acids listed below, or by substituting the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in the amino acid sequence shown in Sequence ID No. 2 with the amino acids listed below. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine Here, a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 or an amino acid sequence having at least 90% identity thereto, and having 4-aminobenzoic acid hydroxylation activity, is the "parent" polypeptide of the polypeptide of the present invention. The "parent" polypeptide refers to a reference polypeptide that becomes the polypeptide of the present invention when a predetermined mutation is made in its amino acid residues.
[0024] In the present invention, HFM122, a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 (NCBI Reference Sequence: WP_010920262.1), is known as 4-hydroxybenzoic acid-3-monooxygenase (EC1.14.13.2). 4-hydroxybenzoic acid-3-monooxygenase is an enzyme that has catalytic activity to promote either or both of the reaction in which the 3-position of 4-hydroxybenzoic acid is hydroxylated to produce protocatechuic acid, and the reverse reaction, and is a type of enzyme that catalyzes the hydroxylation of 4-hydroxybenzoic acids (4-hydroxybenzoic acid hydroxylase). The applicant has found that such HFM122 has 4-aminobenzoic acid hydroxylation activity (see Patent Document 3 above), and has also found that polypeptides in which any of the amino acid residues at positions 47, 106, 201, 222, or 294 of HFM122 are substituted with a specific amino acid have high 4-aminobenzoic acid hydroxylation activity (see Patent Documents 4-7 above).
[0025] Polypeptides having 4-aminobenzoic acid hydroxylation activity and consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2 include polypeptides having 4-aminobenzoic acid hydroxylation activity and consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 2, specifically, 90% or more, preferably 95% or more, more preferably 96% or more, even more preferably 97% or more, even more preferably 98% or more, and even more preferably 99% or more identity with the amino acid sequence shown in SEQ ID NO: 2.
[0026] The parent polypeptide is preferably one having a valine residue at position 47 or a corresponding position in the amino acid sequence shown in SEQ ID NO: 2, preferably one having a methionine residue at position 106 or a corresponding position, preferably one having a tyrosine residue at position 201 or a corresponding position, preferably one having a tyrosine residue at position 222 or a corresponding position, preferably one having a threonine residue at position 294 or a corresponding position, preferably one having a valine residue at position 47 or a corresponding position and a methionine residue at position 106 or a corresponding position, preferably one having a valine residue at position 47 or a corresponding position and a tyrosine residue at position 201 or a corresponding position, preferably one having a valine residue at position 47 or a corresponding position and a threonine residue at position 294 or a corresponding position, preferably one having a valine residue at position 47 or a corresponding position and a threonine residue at position 106 or a corresponding position, preferably one having a valine residue at position 47 or a corresponding position and a tyrosine residue at position 201 or a corresponding position, preferably one having a valine residue at position 47 or a corresponding position and a threonine residue at position 222 or a corresponding position More preferably, the compound has a tyrosine residue at the corresponding position, a valine residue at position 47 or a corresponding position and a threonine residue at position 294 or a corresponding position, a methionine residue at position 106 or a corresponding position and a tyrosine residue at position 201 or a corresponding position, or a methionine residue at position 106 or a corresponding position and a threonine residue at position 294 or a corresponding position. Even more preferably, the compound has a valine residue at position 47 or a corresponding position, a methionine residue at position 106 or a corresponding position, a tyrosine residue at position 201 or a corresponding position, a tyrosine residue at position 222 or a corresponding position, and a threonine residue at position 294 or a corresponding position.The polypeptide of the present invention is obtained by substituting valine at position 47 or a corresponding position with leucine and methionine at position 106 or a corresponding position with alanine, substituting valine at position 47 or a corresponding position with leucine and tyrosine at position 201 or a corresponding position with phenylalanine, substituting valine at position 47 or a corresponding position with leucine and tyrosine at position 222 or a corresponding position with phenylalanine, substituting valine at position 47 or a corresponding position with leucine and threonine at position 294 or a corresponding position with serine, substituting methionine at position 106 or a corresponding position with alanine and position 201 or More preferably, the tyrosine at the corresponding position is replaced with phenylalanine, the methionine at position 106 or the corresponding position is replaced with alanine and the threonine at position 294 or the corresponding position is replaced with serine, and even more preferably, the valine at position 47 or the corresponding position is replaced with leucine and the methionine at position 106 or the corresponding position is replaced with alanine, the methionine at position 106 or the corresponding position is replaced with alanine and the tyrosine at position 201 or the corresponding position is replaced with phenylalanine, and the methionine at position 106 or the corresponding position is replaced with alanine and the threonine at position 294 or the corresponding position is replaced with serine.
[0027] <Polynucleotides encoding the polypeptide of the present invention> In the present invention, various mutagenesis techniques known in the art can be used as means for mutating the amino acid residues of the parent polypeptide. For example, in a polynucleotide encoding the amino acid sequence of the parent polypeptide (hereinafter also referred to as the parent gene), the nucleotide sequence encoding the amino acid residue to be mutated can be changed to the nucleotide sequence encoding the mutated amino acid residue to obtain a polynucleotide encoding the polypeptide of the present invention.
[0028] The introduction of a desired mutation into a parent gene can, in principle, be carried out using various site-directed mutagenesis methods well known to those skilled in the art. Site-directed mutagenesis methods can be carried out using any method, such as inverse PCR or annealing. Commercially available site-directed mutagenesis kits (for example, Agilent Technologies' QuikChange II Site-Directed Mutagenesis Kit or QuikChange Multi Site-Directed Mutagenesis Kit) can also be used.
[0029] Site-directed mutagenesis into a parent gene can most commonly be performed using a mutation primer containing the nucleotide mutation to be introduced. This mutation primer should be designed to anneal to a region in the parent gene containing the nucleotide sequence encoding the amino acid residue to be mutated, and to include a nucleotide sequence (codon) that encodes the mutated amino acid residue in place of the original nucleotide sequence (codon). Those skilled in the art can appropriately identify and select the nucleotide sequences (codons) encoding the pre-mutation and post-mutation amino acid residues based on standard textbooks. Alternatively, site-directed mutagenesis can also be performed using a method in which two complementary primers containing the nucleotide mutation to be introduced are used separately to amplify the upstream and downstream sides of the mutation site, and the resulting DNA fragments are then ligated together using SOE (splicing by overlap extension)-PCR (Gene, 1989, 77(1): p61-68).
[0030] The template DNA containing the parent gene can be prepared by extracting genomic DNA from a microorganism that produces the aforementioned 4-hydroxybenzoic acid hydroxylase using conventional methods, or by extracting RNA and synthesizing cDNA by reverse transcription. Alternatively, the corresponding nucleotide sequence may be chemically synthesized based on the amino acid sequence of the parent polypeptide and used as template DNA. Sequence ID 1 shows the DNA sequence containing the base sequence encoding HFM122, which has 4-aminobenzoic acid hydroxyl activity as previously described.
[0031] Mutation primers can be prepared by well-known oligonucleotide synthesis methods such as the phosphoramidite method (Nucleic Acids R4esearch, 1989, 17:7059-7071). Such primer synthesis can also be carried out using commercially available oligonucleotide synthesizers (e.g., ABI). By using a primer set containing these mutation primers and introducing site-directed mutagenesis as described above with the parental gene as template DNA, a polynucleotide encoding the polypeptide of the present invention having the desired mutation can be obtained.
[0032] The polynucleotide encoding the polypeptide of the present invention may include single-stranded or double-stranded DNA, cDNA, RNA, or other artificial nucleic acids. The DNA, cDNA, and RNA may be chemically synthesized. The polynucleotide may also include a nucleotide sequence of the untranslated region (UTR) in addition to the open reading frame (ORF). Furthermore, the polynucleotide may be codon-optimized to suit the species of transformant for producing the mutant polypeptide of the present invention. Information on codons used by various organisms is available from the Codon Usage Database ([www.kazusa.or.jp / codon / ]).
[0033] <Vector or DNA fragment> The polynucleotide encoding the polypeptide of the present invention obtained can be incorporated into a vector. The vector containing the polynucleotide is an expression vector. Preferably, the vector is an expression vector that can introduce the polynucleotide encoding the polypeptide of the present invention into a host microorganism and express the polynucleotide within the host microorganism. Preferably, the vector includes the polynucleotide encoding the polypeptide of the present invention and a regulatory region operably linked thereto. The vector may be an extrachromosomal vector capable of autonomous growth and replication, such as a plasmid, or it may be a vector incorporated into a chromosome.
[0034] Specific examples of vectors include, for example, pBluescript II SK(-) (Agilent Technologies), pUC18 / 19, pUC118 / 119 and other pUC vectors (Takara Bio), pET vectors (Merck), pGEX vectors (Merck), pCold vectors (Takara Bio), pHY300PLK (Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2):93-103), pBR322 (Takara Bio), pMW218 / 219 (Nippon Gene), pRI909 / 910 and other pRI vectors (Takara Bio), pBI vectors (Clontech), IN3 vectors (Implanta Innovations), pPTR1 / 2 (Takara Bio), pDJB2 (DJBallance et al.) al., Gene, 36, 321-331, 1985), pAB4-1 (van Hartingsveldt W et al., Mol Gen Genet, 206, 71-75, 1987), pLeu4 (MIGRoncero et al., Gene, 84, 335-343, 1989), pPyr225 (CDSkory et al., Mol Genet Genomics, 268, 397-406, 2002), pFG1 (Gruber, F. et al., Curr Genet, 18, 447-451, 1990), and the like.
[0035] Furthermore, the polynucleotide encoding the polypeptide of the present invention may be constructed as a DNA fragment containing it. Examples of such DNA fragments include PCR-amplified DNA fragments and restriction enzyme-cleared DNA fragments. Preferably, the DNA fragment may be an expression cassette comprising the polynucleotide encoding the polypeptide of the present invention and a regulatory region operably linked thereto.
[0036] The regulatory region contained in the above-mentioned vector or DNA fragment is a sequence for expressing the polynucleotide encoding the polypeptide of the present invention in the host cell into which the vector or DNA fragment has been introduced. Examples include expression regulatory regions such as promoters and terminators, and replication initiation sites. The type of regulatory region can be appropriately selected depending on the type of host microorganism into which the vector or DNA fragment is introduced. If necessary, the vector or DNA fragment may further contain selection markers such as antibiotic resistance genes and amino acid synthesis-related genes (for example, resistance genes for drugs such as ampicillin, neomycin, kanamycin, and chloramphenicol). The above vector or DNA fragment may contain a polynucleotide sequence encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acids. Examples of polypeptides necessary for the biosynthesis of 4-aminobenzoic acids include 4-amino-4-deoxychorismate synthase (pabAB) and 4-amino-4-deoxychorismate lyase (pabC).
[0037] The polynucleotide encoding the polypeptide of the present invention can be linked to the regulatory region and the marker gene sequence by methods such as the SOE-PCR method and seamless cloning method described above. The procedure for introducing the gene sequence into the vector is well known in the field. The type of regulatory region, such as the promoter region, terminator, and secretion signal region, is not particularly limited, and a commonly used promoter or secretion signal sequence can be appropriately selected and used depending on the host to which the gene is introduced.
[0038] Suitable examples of the regulatory region include, but are not limited to, strongly regulatory regions that can enhance expression compared to the wild type, such as known high-expression promoters such as the T7 promoter, lac promoter, tac promoter, trp promoter, gap promoter, and tuf promoter.
[0039] <Transformed cells> Transformed cells of the present invention can be obtained by introducing a vector containing a polynucleotide encoding the polypeptide of the present invention into a host, or by introducing a DNA fragment containing a polynucleotide encoding the polypeptide of the present invention into the host genome. Such transformed cells are cells into which a polynucleotide encoding the polypeptide of the present invention has been introduced to enable expression, and can be said to be cells in which the expression of said polynucleotide is enhanced, and consequently, cells in which the expression of the polypeptide of the present invention is enhanced.
[0040] Any host cell may be used, such as fungi, yeasts, actinomycetes, Escherichia coli, or Bacillus subtilis, but Escherichia coli and actinomycetes are preferred. Examples of actinomycetes include Corynebacterium, Mycobacterium, Rhodococcus, Streptomyces, and Propionibacterium, with Corynebacterium being preferred, and Corynebacterium glutamicum being even more preferred. In particular, microorganisms capable of supplying 4-aminobenzoic acid compounds, which serve as substrates for the biosynthesis of 4-amino-3-hydroxybenzoic acid compounds, are preferred, and microorganisms with enhanced 4-aminobenzoic acid compound supply capabilities are more preferred. Methods for enhancing the 4-aminobenzoic acid compound supply capabilities of microorganisms include, for example, introducing a vector containing a polynucleotide encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acid compounds and a regulatory region operably linked thereto into the microorganism, or replacing the regulatory region of an endogenous polynucleotide encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acid compounds, which is inherently present in the microorganism, with a strongly expressing promoter.
[0041] Methods for introducing vectors or DNA fragments into a host include, for example, electroporation, transformation, transfection, conjugation, protoplast, particle gun, and Agrobacterium.
[0042] Furthermore, the method for introducing polynucleotides into the host genome is not particularly limited, but one example is the double crossover method using a DNA fragment containing the polynucleotide. The DNA fragment may be introduced downstream of the promoter sequence of a gene that is highly expressed in the host cell as described above, or a fragment may be prepared by activating the linkage between the DNA fragment and the regulatory region described above, and this linked fragment may be introduced into the host genome. Moreover, the DNA fragment may be pre-linked to a marker (such as a drug resistance gene or a nutrient complement gene) for selecting cells into which the polynucleotide of the present invention has been appropriately introduced.
[0043] Transformed cells into which the target vector or DNA fragment has been introduced can be selected using a selection marker. For example, if the selection marker is an antibiotic resistance gene, transformed cells into which the target vector or DNA fragment has been introduced can be selected by culturing them in a medium containing the antibiotic. Alternatively, if the selection marker is an amino acid synthesis-related gene, transformed cells into which the target vector or DNA fragment has been introduced can be selected after introducing the gene into a host microorganism that requires the amino acid, using the presence or absence of the amino acid requirement as an indicator. Alternatively, the introduction of the target vector or DNA fragment can be confirmed by examining the DNA sequence of the transformed cells by PCR or other methods.
[0044] The transformed cells thus obtained, when cultured in an appropriate medium, express the polynucleotide introduced into the cells, thereby producing the polypeptide of the present invention. In other words, the transformed cells can become polypeptide-producing bacteria having 4-aminobenzoic acid hydroxylation activity. As shown in the examples described later, when the transformed cells of the present invention are cultured, the productivity of 4-amino-3-hydroxybenzoic acid is significantly improved compared to when transformed cells producing the parent polypeptide are used. The polypeptide of the present invention consists of an amino acid sequence in which two specific amino acid residues in the amino acid sequence of the parent polypeptide are predetermined amino acids. When the transformed cells of the present invention are cultured, the productivity of 4-amino-3-hydroxybenzoic acid is significantly improved compared to when transformed cells producing a polypeptide consisting of an amino acid sequence in which only one of the two specific amino acid residues in the amino acid sequence of the parent polypeptide is a predetermined amino acid, and the rate of improvement is even higher than the rate of improvement in production capacity expected from the latter polypeptide. In other words, in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2, a mutation in which the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are replaced with the following amino acids, or in a polypeptide consisting of an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 2 and possessing 4-aminobenzoic acid hydroxylation activity, a mutation in which the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are replaced with the following amino acids is useful for synergistically improving 4-aminobenzoic acid hydroxylation activity, and consequently for synergistically improving the productivity of 4-amino-3-hydroxybenzoic acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine Furthermore, the transformed cells of the present invention are polypeptide-producing bacteria with significantly improved 4-aminobenzoic acid hydroxylation activity, and are useful strains for producing 4-amino-3-hydroxybenzoic acids.
[0045] <Production of 4-amino-3-hydroxybenzoic acid compounds> The present invention provides a method for producing 4-amino-3-hydroxybenzoic acid compounds, which includes a step of culturing the transformed cells of the present invention, and 4-amino-3-hydroxybenzoic acid compounds can be obtained by recovering them from the culture medium. In the present invention, 4-amino-3-hydroxybenzoic acid compounds specifically refer to the following general formula (1):
[0046] [ka]
[0047] (wherein, R 1 represents a hydrogen atom, a hydroxy group (-OH), a methoxy group (-OCH3), an amino group (-NH2), a fluorine atom (-F), a chlorine atom (-Cl), a bromine atom (-Br), an iodine atom (-I), a carboxy group (-COOH), a methyl group (-CH3) , or or an ethyl group (-CH2CH3), and R 2 represents a hydrogen atom 、 a hydroxy group (-OH), a methoxy group (-OCH3), an amino group (-NH2), a fluorine atom (-F), a chlorine atom (-Cl), a bromine atom (-Br), an iodine atom (-I), a carboxy group (-COOH), a methyl group (-CH3) 、 or an ethyl group (-CH2CH3), X 1 and X 2 are each a hydrogen atom or a hydroxy group, and at least one of them is a hydroxy group.) includes 4-amino-3-hydroxybenzoic acid derivatives represented by
[0048] R 1 As the functional group represented by , a hydrogen atom, a hydroxy group (-OH), a methoxy group (-OCH3), a fluorine atom (-F) or a methyl group (-CH3) is preferred. R 2 As the functional group represented by , a hydrogen atom, a hydroxy group (-OH), a methoxy group (-OCH3), a fluorine atom (-F) or a methyl group (-CH3) is preferred. R 1 and R 2 are more preferably both hydrogen atoms. In addition, X 1 and X 2 may both be hydroxy groups, but it is preferred that either X 1 or X 2 is a hydroxy group.
[0049] If necessary, 4-aminobenzoic acids, which serve as substrates for biosynthesis of 4-amino-3-hydroxybenzoic acids, may be present in the medium. Here, 4-aminobenzoic acids are defined by the following general formula (2):
[0050] [ka]
[0051] [In the formula, R 1 and R 2 This indicates the same thing as above. Examples include 4-aminobenzoic acid derivatives represented by [formula].
[0052] The culture medium for transforming cells may be either a natural or synthetic medium, as long as it contains a carbon source, a nitrogen source, inorganic salts, etc., and is capable of efficiently culturing the transforming cells of the present invention. As a carbon source, for example, sugars such as glucose, polyols such as glycerin, alcohols such as ethanol, or organic acids such as pyruvic acid, succinic acid, or citric acid can be used. As a nitrogen source, for example, peptone, meat extract, yeast extract, casein hydrolysate, soybean meal alkali extract, alkylamines such as methylamine, or ammonia or its salts can be used. In addition, phosphates, carbonates, sulfates, salts such as magnesium, calcium, potassium, iron, manganese, and zinc, specific amino acids, specific vitamins, and antifoaming agents may be used as needed.
[0053] Culturing can usually be carried out at 10°C to 40°C for 6 to 96 hours, preferably 24 to 96 hours, and more preferably 48 to 96 hours, with stirring or shaking as needed. Antibiotics such as ampicillin or kanamycin may also be added to the culture medium during cultivation as needed.
[0054] The method for recovering and purifying 4-amino-3-hydroxybenzoic acid from cultures is not particularly limited. That is, it can be carried out by combining well-known methods such as ion exchange resin methods, precipitation methods, crystallization methods, recrystallization methods, concentration methods, and others. For example, after removing the bacterial cells by centrifugation or the like, ionic substances can be removed using cation and anion exchange resins, and then concentrated to obtain 4-amino-3-hydroxybenzoic acid. The 4-amino-3-hydroxybenzoic acid accumulated in the culture may be used as is without isolation.
[0055] The present invention also includes, as exemplary embodiments, the following substances, manufacturing methods, uses, methods, etc. However, the present invention is not limited to these embodiments. <1> A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein, in the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are the following amino acids, or in an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine <2> A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein, in the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are substituted with the following amino acids, or in an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are substituted with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine <3> The amino acid residue substitutions are: substitution of valine at position 47 or equivalent with leucine and substitution of methionine at position 106 or equivalent with alanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 222 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of threonine at position 294 or equivalent with serine; substitution of methionine at position 106 or equivalent with alanine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of methionine at position 106 or equivalent with alanine and substitution of threonine at position 294 or equivalent with serine. <2> polypeptide. <4> A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, comprising: substituting an amino acid residue at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 2 with the following amino acids; or substituting an amino acid residue at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in SEQ ID NO: 2 with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine <5> The amino acid residue substitutions are: substitution of valine at position 47 or equivalent with leucine and substitution of methionine at position 106 or equivalent with alanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 222 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of threonine at position 294 or equivalent with serine; substitution of methionine at position 106 or equivalent with alanine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of methionine at position 106 or equivalent with alanine and substitution of threonine at position 294 or equivalent with serine. <4> The method. <6> A method for improving 4-aminobenzoic acid hydroxylation activity, comprising substituting amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids, or substituting amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine <7> The amino acid residue substitutions are: substitution of valine at position 47 or equivalent with leucine and substitution of methionine at position 106 or equivalent with alanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 222 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of threonine at position 294 or equivalent with serine; substitution of methionine at position 106 or equivalent with alanine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of methionine at position 106 or equivalent with alanine and substitution of threonine at position 294 or equivalent with serine. <6> The method. <8> When producing 4-amino-3-hydroxybenzoic acids using a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 or an amino acid sequence having at least 90% identity thereto, and having 4-aminobenzoic acid hydroxylation activity, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are replaced with the following amino acids. A method for improving the productivity of 4-amino-3-hydroxybenzoic acids, comprising substituting amino acid residues at positions corresponding to the following amino acids in a polypeptide having an amino acid sequence that is at least 90% identical to the amino acid sequence shown in Sequence ID No. 2 and having 4-aminobenzoic acid hydroxylation activity, wherein the amino acid residues are at the following positions: 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylenine (d) Position 222 or equivalent: Phenylenine (e) Position 294 or equivalent: Serine <9> The amino acid residue substitutions are: substitution of valine at position 47 or equivalent with leucine and substitution of methionine at position 106 or equivalent with alanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of tyrosine at position 222 or equivalent with phenylalanine; substitution of valine at position 47 or equivalent with leucine and substitution of threonine at position 294 or equivalent with serine; substitution of methionine at position 106 or equivalent with alanine and substitution of tyrosine at position 201 or equivalent with phenylalanine; substitution of methionine at position 106 or equivalent with alanine and substitution of threonine at position 294 or equivalent with serine. <8> The method. <10> <1> ~ <3> A polynucleotide encoding a polypeptide as described in any of the following. <11> <10> A vector or DNA fragment containing polynucleotides. <12> <11> Transformed cells containing a vector or DNA fragment. <13> It is either Escherichia coli or a bacterium of the genus Corynebacterium. <12> The transformed cells described. <14> Microorganisms capable of supplying 4-aminobenzoic acids, <12> or <13> Transformed cells. <15> The supply capacity of 4-aminobenzoic acids has improved. <12> or <13> Transformed cells. <16> This is a microorganism into which a vector containing a polynucleotide encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acids and a regulatory region operably linked thereto has been introduced. <15> Transformed cells. <17> This microorganism has a regulatory region of an endogenous polynucleotide encoding a polypeptide necessary for the biosynthesis of 4-aminobenzoic acids replaced with a strongly expressed promoter. <15> Transformed cells. <18> <12> ~ <17> A method for producing 4-amino-3-hydroxybenzoic acid compounds, comprising the step of culturing any of the transformed cells. <19> It is cultured in a medium containing sugars as a carbon source. <18> The method. <20> The process includes a step of recovering 4-amino-3-hydroxybenzoic acid compounds from the culture medium. <18> or <19> The method. <21> The culture is carried out in the presence of 4-aminobenzoic acids. <18> ~ <20> One of the following methods. <22> 4-amino-3-hydroxybenzoic acids are given by the following general formula (1):
[0056] [ka]
[0057] [In the formula, R 1 These are hydrogen atoms, hydroxyl groups, methoxy groups, amino groups, fluorine atoms, chlorine atoms, bromine atoms, iodine atoms, carboxyl groups, methyl groups, or It shows an ethyl group, R 2 is a hydrogen atom 、 X represents a hydroxyl group, methoxy group, amino group, fluorine atom, chlorine atom, bromine atom, iodine atom, carboxyl group, methyl group, or ethyl group. 1 and X 2 [This is either a hydrogen atom or a hydroxyl group, and at least one of them represents a hydroxyl group.] It is a 4-amino-3-hydroxybenzoic acid derivative represented by <18> ~ <21> One of the following methods. <23> 4-aminobenzoic acids are given by the following general formula (2):
[0058] [ka]
[0059] [In the formula, R 1 These are hydrogen atoms, hydroxyl groups, methoxy groups, amino groups, fluorine atoms, chlorine atoms, bromine atoms, iodine atoms, carboxyl groups, methyl groups, or It shows an ethyl group, R 2 is a hydrogen atom 、This represents a hydroxyl group, methoxy group, amino group, fluorine atom, chlorine atom, bromine atom, iodine atom, carboxyl group, methyl group, or ethyl group. It is a 4-aminobenzoic acid derivative represented by <21> or <22> The method. [Examples]
[0060] The present invention will be described in more detail below based on test examples, but the present invention is not limited thereto.
[0061] Test Example 1: Production of 4-amino-3-hydroxybenzoic acid (1) Construction of plasmids containing genes encoding HFM122 or HFM122 variants In the following test examples, PCR was performed using KOD One PCR Master Mix (Toyobo). After treating the PCR product with DpnI (Takara Bio), the DNA fragments were purified using NucleoSpin Gel and PCR Clean-up (Takara Bio). In-Fusion HD Cloning Kit (Takara Bio) was used to ligate the DNA fragments. ECOS Competent E. coli JM109 strain (Nippon Gene) was transformed using the ligated DNA fragments, and the cell suspension was spread onto LBKm agar medium (Difco LB Broth Lennox 20 g / L, kanamycin sulfate 50 μg / mL, agar 1.5%) and left to stand overnight at 37°C. The resulting colonies were inoculated into 750 μL of TBKm liquid medium (Difco Terrific Broth 47.6 g / L, kanamycin sulfate 50 μg / mL) and cultured overnight at 37°C. Plasmids were prepared from the obtained bacterial cells using NucleoSpin Plasmid EasyPure (Takara Bio). The DNA sequences of the obtained plasmids were analyzed using the Sanger assay (Eurofins Genomics).
[0062] (a) Production of plasmid pKCG1 DNA fragments were amplified by PCR using plasmid pHM1519 (Agric. Biol. Chem., 48, 2901-2903, (1984)), extracted from Corynebacterium glutamicum strain ATCC13058, as a template, with primers pHM1519-Fw (SEQ ID NO: 3, CGTCGCTGATCGCCCTCGCGAC) and pHM1519-Rv (SEQ ID NO: 4, TTGGGAGCAGTCCTTGTGCGCTTACGAG). Additionally, DNA fragments were amplified by PCR using plasmid pHSG299 (Takara Bio) as a template, with primers pHSG299-Fw (SEQ ID NO: 5, AAGGACTGCTCCCAATACGGTTATCCACAGAATCA) and pHSG299-Rv (SEQ ID NO: 6, GGGCGATCAGCGACGACTGGCCGTCGTTTTACAAC). Plasmid pKCG1 was obtained by ligating these PCR products.
[0063] (b) Preparation of plasmid pKCG1_PtufT1 Using plasmid pKCG1 as a template, a vector DNA fragment was amplified by PCR using primers pHM1519-Fw (SEQ ID NO: 3) and pKCG1vec-Rv (SEQ ID NO: 7, GGATCTAAACGATCTACTGGCCGTCGTTTTACAAC). Subsequently, using the genome of Corynebacterium glutamicum strain ATCC13032 as a template, a DNA fragment containing the promoter of the tuf gene (cg0587) (hereinafter referred to as the tuf promoter) was amplified by PCR using primers Ptuf-Fw (SEQ ID NO: 8, AGATCGTTTAGATCCGAAGGAAAACGTCGAAAAGC) and Ptuf-Rv (SEQ ID NO: 9, TGTATGTCCTCCTGGACTTCGTGGTGGCTAC). Furthermore, a DNA fragment containing a terminator sequence (SEQ ID NO: 10, GGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTT) was synthesized artificially and amplified by PCR using primers T1-Fw (SEQ ID NO: 11, CCAGGAGGACATACAGGTAGTGTGGGGTCTCCCCA) and T1-Rv (SEQ ID NO: 12, GGGCGATCAGCGACGAAATCCGCTCCCGGCGGATT). Plasmid pKCG1_PtufT1 was obtained by ligating these PCR products.
[0064] (c) Preparation of plasmid pKCG1_PtufT1_HFM122 Using plasmid pKCG1_PtufT1 as a template, a vector DNA fragment was amplified by PCR using primers pKCG1_PtufT1vec-Fw (SEQ ID NO: 13, GGTAGTGTGGGGTCTCCCCATGC) and pKCG1_PtufT1vec-Rv (SEQ ID NO: 14, TGTATGTCCTCCTGGACTTCGTGGTGGCTAC). Subsequently, a gene encoding polypeptide HFM122, which has 4-aminobenzoic acid hydroxylation activity (SEQ ID NO: 1), was synthesized by artificial gene synthesis. Using this as a template, an insert DNA fragment was synthesized by PCR using primers HFM122-Fw (SEQ ID NO: 15, CCAGGAGGACATACAATGCGCACTCAGGTGGCTAT) and HFM122-Rv (SEQ ID NO: 16, AGACCCCACACTACCTTATACGAGTGGCAGTCCTA). By ligating these PCR products, plasmid pKCG1_PtufT1_HFM122 was obtained. In the constructed plasmid, the gene encoding wild-type HFM122 is ligated under the control of the tuf promoter.
[0065] (d) Construction of a plasmid containing the gene encoding the mutant enzyme Plasmid pKCG1_PtufT1_HFM122_V47L was constructed using plasmid pKCG1_PtufT1_HFM122 as a template and complementary primers HFM122 V47L F (SEQ ID NO: 17, GCTGGTCTCCTGGAACGTATCACGGTG) and HFM122 V47L R (SEQ ID NO: 18, TTCCAGGAGACCAGCCCGAACTCGGCC) by PCR. Similarly, plasmids containing the genes encoding each enzyme variant were obtained by PCR using the primers shown in "Primers" in Table 1, instead of the primers HFM122 V47L F and HFM122 V47L R.
[0066] [Table 1]
[0067] (2) Creation of host cells with enhanced ability to synthesize 4-aminobenzoic acid (a) Construction of a plasmid in which the tuf promoter is introduced into the cg1829(aroC) promoter region. The 5' upstream region of the cg1829 gene (SEQ ID NO: 27) was amplified using two types of DNA primers (SEQ ID NOs: 28 and 29), and the 5' region of the cg1829 gene ORF (SEQ ID NO: 30) was amplified using two types of DNA primers (SEQ ID NOs: 31 and 32) to obtain DNA fragments. Furthermore, a DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified using the genome of strain ATCC13032 as a template, using two types of DNA primers (SEQ ID NOs: 34 and 35) to obtain DNA fragments. Additionally, pHKPsacB1 was used as a template and amplified using two types of DNA primers (SEQ ID NOs: 36 and 37), and the resulting PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and the plasmid pHKPsacB_Ptuf-aroC was constructed by ligation using the In-Fusion HD Cloning Kit (Takara Bio).
[0068] (b) Creation of a strain in which the tuf promoter is introduced into the cg1829(aroC) promoter region. Using an electroporation transformation method, the plasmid pHKPsacB_Ptuf-aroC described above was introduced into strain KC315 (Japanese Patent Application No. 2021-201877), and strain KC367sr was obtained by selecting for kanamycin resistance. Analysis of strain KC367sr using PCR with primers SEQ ID NOs. 28 and 38 (Sapphire Amp (Takara Bio)) yielded the expected results, confirming that strain KC367sr is a once-cross-recombinant homologous recombinant into which the plasmid pHKPsacB_Ptuf-aroC has been introduced. The KC367sr strain was cultured for 24 hours in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride), and a portion of the culture solution was streaked onto LB agar containing 20% sucrose to obtain the KC367 strain. PCR using primers SEQ ID NOs. 38 and 39 (Sapphire Amp (Takara Bio)) confirmed that the KC367 strain is a double-crossover homologous recombinant with the tuf promoter introduced into the cg1829 (aroC) promoter region, as expected.
[0069] (c) Construction of a plasmid in which the TUF promoter was introduced into the cg1774(tkt) promoter region. The 5' upstream region of the cg1774 gene (SEQ ID NO: 40) was amplified using two types of DNA primers (SEQ ID NOs: 41 and 42), and the 5' region of the cg1774 gene ORF (nucleotide number 43) was amplified using two types of DNA primers (SEQ ID NOs: 44 and 45) to obtain DNA fragments. In addition, a DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified using the genome of strain ATCC13032 as a template with two types of DNA primers (SEQ ID NOs: 34 and 35) to obtain DNA fragments. Furthermore, pHKPsacB1 was used as a template and amplified with two types of DNA primers (SEQ ID NOs: 36 and 37), and the resulting PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and the plasmid pHKPsacB_Ptuf-tkt was constructed by ligation using the In-Fusion HD Cloning Kit (Takara Bio).
[0070] (d) Creation of a strain in which the TUF promoter is introduced into the cg1774(tkt) promoter region. Using electroporation-based transformation, the plasmid pHKPsacB_Ptuf-tkt described above was introduced into the KC367 strain, and the KC376sr strain was obtained by selecting for kanamycin resistance. Analysis of the KC376sr strain using PCR with primers SEQ ID NOs. 41 and 46 (Sapphire Amp (Takara Bio)) yielded the expected results, confirming that the KC376sr strain is a one-time cross-recombinant homologous recombinant in which the plasmid pHKPsacB_Ptuf-tkt was introduced into the promoter region of cg1774. The KC376sr strain was cultured for 24 hours in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride), and a portion of the culture solution was streaked onto LB agar containing 20% sucrose to obtain the KC376 strain. PCR using primers SEQ ID NOs. 46 and 47 (Sapphire Amp (Takara Bio)) confirmed that the KC376 strain is a double-crossover homologous recombinant with the tuf promoter introduced into the cg1774(tkt) promoter region, as expected.
[0071] (e) Construction of a plasmid in which the tuf promoter is introduced into the cg0644(ppsA) promoter region. The 5' upstream region of the cg0644 gene (SEQ ID NO: 48) was amplified using two types of DNA primers (SEQ ID NOs: 49 and 50), and the 5' region of the cg0644 gene ORF (nucleotide number 51) was amplified using two types of DNA primers (SEQ ID NOs: 52 and 53) to obtain DNA fragments. In addition, a DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified using the genome of strain ATCC13032 as a template with two types of DNA primers (SEQ ID NOs: 34 and 35) to obtain DNA fragments. Furthermore, pHKPsacB1 was used as a template and amplified with two types of DNA primers (SEQ ID NOs: 36 and 37), and the resulting PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the four obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and plasmid pHKPsacB_Ptuf-ppsA was constructed by ligation using In-Fusion HD Cloning Kit (Takara Bio).
[0072] (f) Creation of a strain in which the tuf promoter is introduced into the promoter region of cg0644(ppsA) Using electroporation for transformation, the plasmid pHKPsacB_Ptuf-ppsA described above was introduced into the KC376 strain, and the KC408sr strain was obtained by selecting for kanamycin resistance. Analysis of the KC408sr strain using PCR with primers SEQ ID NOs. 49 and 54 (Sapphire Amp (Takara Bio)) yielded the expected results, confirming that the KC408sr strain is a once-cross-recombinant homologous recombinant into which the plasmid pHKPsacB_Ptuf-ppsA has been introduced. The KC408 strain was cultured for 24 hours in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride), and a portion of the culture medium was streaked onto LB agar containing 20% sucrose to obtain the KC408 strain. PCR using primers SEQ ID NOs. 54 and 55 (Sapphire Amp (Takara Bio)) confirmed that the KC408 strain is a double-crossover homologous recombinant with the tuf promoter introduced into the cg0644 (ppsA) promoter region, as expected.
[0073] (g) Plasmid construction for deletion of the cg0502(qsuB) gene region The 5' upstream region (SEQ ID NO: 56) of the cg0502 gene region was amplified using two types of DNA primers (SEQ ID NOs: 57 and 58), and the 3' downstream region (nucleotide number 59) of the cg0502 gene region was amplified using two types of DNA primers (SEQ ID NOs: 60 and 61) to obtain DNA fragments. Furthermore, pHKPsacB1 was used as a template and amplified using two types of DNA primers (SEQ ID NOs: 36 and 37). The resulting PCR products were treated with DpnI (Takara Bio). Each DNA fragment was purified from the three obtained PCR products using NucleoSpin Gel and PCR Clean-up (Takara Bio), and the plasmid pHKPsacB_ΔqsuB was constructed by ligation using the In-Fusion HD Cloning Kit (Takara Bio).
[0074] Creation of a strain lacking the (h)cg0502(qsuB) gene region. The plasmid pHKPsacB_ΔqsuB described above was introduced into the KC408 strain using electroporation, and the KC525sr strain was obtained by selecting for kanamycin resistance. Analysis of the KC525sr strain using PCR with primers SEQ ID NOs. 57 and 62 (Sapphire Amp (Takara Bio)) yielded the expected results, confirming that the KC525sr strain is a once-cross-recombinant homologous recombinant into which the plasmid pHKPsacB_ΔqsuB has been introduced. The KC525sr strain was cultured for 24 hours in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride), and a portion of the culture solution was streaked onto LB agar containing 20% sucrose to obtain the KC418 strain. PCR using primers SEQ ID NOs. 62 and 63 (Sapphire Amp (Takara Bio)) confirmed that the KC525 strain was, as expected, a double-crossover homologous recombinant with a deletion in the cg(qsuB) gene region.
[0075] (i) Construction of a plasmid for introducing the TUF promoter into the cg1134(pabAB) promoter region The 5' upstream region of the cg1134 gene (SEQ ID NO: 64) was amplified using two types of DNA primers (SEQ ID NOs: 65 and 66), and the 5' region of the cg1134 gene ORF (SEQ ID NO: 67) was amplified using two types of DNA primers (SEQ ID NOs: 68 and 69) to obtain DNA fragments. In addition, a DNA fragment containing the tuf promoter (SEQ ID NO: 33) was amplified using the genome of strain ATCC13032 as a template with two types of DNA primers (SEQ ID NOs: 34 and 35) to obtain DNA fragments. Furthermore, pHKPsacB1 was used as a template and amplified with two types of DNA primers (SEQ ID NOs: 36 and 37), and the resulting PCR products were treated with DpnI (Takara Bio). Each DNA fragment of the four obtained PCR products was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio), and the plasmid pHKPsacB_Ptuf-pabAB was constructed by ligation using the In-Fusion HD Cloning Kit (Takara Bio).
[0076] Creation of a strain by introducing the TUF promoter into the (j)cg1134(pabAB) promoter region. Using electroporation for transformation, the plasmid pHKPsacB_Ptuf-pabAB described above was introduced into the KC525 strain, and the KC551sr strain was obtained by selecting for kanamycin resistance. Analysis of the KC551sr strain using PCR (Sapphire Amp (Takara Bio)) with primers SEQ ID NOs. 65 and 70 yielded the expected results, confirming that the KC551sr strain is a once-cross-recombinant homologous recombinant with the plasmid pHKPsacB_Ptuf-pabAB introduced. The KC551sr strain was cultured for 24 hours in 1 mL of LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride), and a portion of the culture solution was streaked onto LB agar containing 20% sucrose to obtain the KC551 strain. PCR using primers SEQ ID NOs. 70 and 71 (Sapphire Amp (Takara Bio)) confirmed that the KC551 strain is a double-crossover homologous recombinant with the tuf promoter introduced into the cg1134 (pabAB) promoter region, as expected.
[0077] (3) Introduction of plasmid into host cells Using the plasmids obtained above, Corynebacterium glutamicum KC551 strain was transformed by electroporation (ELEPO21, Neppazine). The resulting transformed cell saturation was spread onto LBKm agar and left to stand at 30°C for 2 days, and the resulting colonies were used as the transformed cell line.
[0078] (4) Culture of transformed strains The transformed strains obtained above were inoculated into 750 μL of CGTG15 medium (containing 50 μg / mL of kanamycin sulfate) as shown in Table 2, cultured at 30°C for 48 hours, and then the culture supernatant was obtained by removing the bacterial cells by centrifugation. The 4-amino-3-hydroxybenzoic acid production capacity of the transformed strains was calculated according to the following formula (Equation 1), and the improvement rate of 4-amino-3-hydroxybenzoic acid production capacity was calculated according to the following formula (Equation 2). Here, "WT" indicates a transformed strain into which a plasmid containing the gene encoding the wild-type enzyme has been introduced, and "MT" indicates a transformed strain into which a plasmid containing the gene encoding the mutant enzyme has been introduced.
[0079] (Math 1) 4-amino-3-hydroxybenzoic acid production capacity = Amount of 4-amino-3-hydroxybenzoic acid in culture supernatant / Amount of 4-aminobenzoic acid in culture supernatant (Math 2) Production capacity improvement rate = 4-amino-3-hydroxybenzoic acid production capacity of MT / 4-amino-3-hydroxybenzoic acid production capacity of WT
[0080] [Table 2]
[0081] (5) Results As shown in Table 3, strains into which each mutant enzyme was introduced showed improved 4-amino-3-hydroxybenzoic acid production compared to strains into which the wild-type enzyme was introduced. In particular, among the productivity improvements of transformed strains into which plasmids containing genes encoding variants in which any two amino acids at any two positions in the HFM122 amino acid sequence were introduced (dual mutant productivity improvements), the productivity improvements of transformed strains into which plasmids containing genes encoding the V47L_M106A variant, V47L_Y201F variant, V47L_Y222F variant, V47L_T294S variant, M106A_Y201F variant, and M106A_T294S variant were introduced were even higher than the productivity improvements of double mutants predicted by the following formula (Equation 3) from the productivity improvements of transformed strains into which plasmids containing genes encoding variants in which any one amino acid at any one position was introduced (single mutant productivity improvements).
[0082] (Math 3) Expected productivity improvement rate of the double mutant = productivity improvement rate of one single mutant + productivity improvement rate of the other single mutant
[0083] [Table 3]
[0084] Reference Example 1: Quantitative Determination of 4-amino-3-hydroxybenzoic acid The quantification of 4-amino-3-hydroxybenzoic acid was performed by HPLC. The culture supernatant was diluted 10-fold with 0.1% phosphoric acid, and insoluble matter was removed using an AcroPrep 96 filter plate (0.2 μm GHP membrane, Nippon Pall) before being subjected to HPLC. The HPLC instrument used was a Chromaster (Hitachi High-Tech Science). An L-column ODS (4.6 mm ID × 150 mm, Chemicals Evaluation and Research Institute) was used as the analytical column, with eluent A being a 0.1% phosphoric acid solution of 0.1 M potassium dihydrogen phosphate and eluent B being 70% methanol. Gradient elution was performed at a flow rate of 1.0 mL / min and a column temperature of 40°C. A UV detector (detection wavelength 280 nm) was used to detect 4-aminobenzoic acid and 4-amino-3-hydroxybenzoic acid. A concentration calibration curve was created using standard samples [4-amino-3-hydroxybenzoic acid (Tokyo Chemical Industries), 4-aminobenzoic acid (Tokyo Chemical Industries)], and quantification was performed based on the concentration calibration curve.
Claims
1. A polypeptide having 4-aminobenzoic acid hydroxylation activity, wherein, in the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence are the following amino acids, or in an amino acid sequence having at least 90% identity with the amino acid sequence shown in Sequence ID No. 2, the amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 are the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylalanine (d) Position 222 or equivalent: Phenylalanine (e) Position 294 or equivalent: Serine
2. A method for producing a mutant polypeptide having 4-aminobenzoic acid hydroxylation activity, comprising: substituting an amino acid residue at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids; or substituting an amino acid residue at positions corresponding to 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylalanine (d) Position 222 or equivalent: Phenylalanine (e) Position 294 or equivalent: Serine
3. A method for improving 4-aminobenzoic acid hydroxylation activity, comprising substituting amino acid residues at positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence in a polypeptide consisting of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids, or substituting amino acid residues at positions corresponding to positions 47 and 106, 47 and 201, 47 and 222, 47 and 294, 106 and 201, or 106 and 294 of the amino acid sequence shown in Sequence ID No. 2 with the following amino acids. (a) 47th position or equivalent: Leucine (b) Position 106 or equivalent: Alanine (c) Position 201 or equivalent: Phenylalanine (d) Position 222 or equivalent: Phenylalanine (e) Position 294 or equivalent: Serine
4. A polynucleotide encoding the polypeptide described in claim 1.
5. A vector or DNA fragment comprising the polynucleotide described in claim 4.
6. Transformed cells containing the vector or DNA fragment described in claim 5.
7. The transformed cells according to claim 6, which are Escherichia coli or Corynebacterium species.
8. The transformed cell according to claim 6, which is a microorganism capable of supplying 4-aminobenzoic acids.
9. A method for producing 4-amino-3-hydroxybenzoic acid compounds, comprising the step of culturing transformed cells according to claim 6, wherein the culturing is carried out in the presence of 4-aminobenzoic acid compounds.
10. A method for producing 4-amino-3-hydroxybenzoic acid compounds, comprising the step of culturing transformed cells according to claim 7, wherein the transformed cells are Escherichia coli or Corynebacterium species capable of supplying 4-aminobenzoic acid compounds.
11. A method for producing 4-amino-3-hydroxybenzoic acid, comprising the step of culturing transformed cells as described in claim 8.
12. The method according to any one of claims 9 to 11, comprising the step of recovering 4-amino-3-hydroxybenzoic acid compounds from the culture medium.
13. 4-amino-3-hydroxybenzoic acids are given by the following general formula (1): 【Chemistry 1】 [In the formula, R 1 R represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group. 2 X represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group. 1 and X 2 [This is either a hydrogen atom or a hydroxyl group, and at least one of them represents a hydroxyl group.] It is a 4-amino-3-hydroxybenzoic acid derivative represented by, 4-aminobenzoic acids are given by the following general formula (2): 【Chemistry 2】 [In the formula, R 1 R represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group. 2 This represents a hydrogen atom, a hydroxyl group, a methoxy group, an amino group, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, a carboxyl group, a methyl group, or an ethyl group. The method according to any one of claims 9 to 11, wherein the 4-aminobenzoic acid derivative is represented by .
Citation Information
Patent Citations
Ball circulation tube for ball screw
JP1979045453A
Methods for producing 3-hydroxy-4-aminobenzoic acids
JP2020039330A
Polypeptide having 4-aminobenzoic acid hydroxylation activity and use thereof
JP2021073914A
Polypeptide having 4-aminobenzoic acid hydroxylation activity and use thereof
JP2021101626A
Polypeptide having 4-aminobenzoic acid hydroxylation activity and use thereof
JP2021101627A