Coprococcus bacteria for use in the treatment of metabolic syndrome and inflammatory bowel disease

JP7914005B2Active Publication Date: 2026-09-01INST NAT DE RECHERCHE POULE LAGLICOURTURE LARIMANTATION & LANVIRONNEMAN +3
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
JP2022552931
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-03-04
Filing Date
2021-03-04
Publication Date
2026-09-01
Estimated Expiration
2041-03-04

AI Technical Summary

Benefits of technology

【0010】 本発明者らは本明細書において、高いAhR活性と関連する細菌プロバイオティクスを同定した。実際に本発明者らは、コプロコッカス·コメス(Coprococcus comes)菌及び/又はその培養上清が、マウスをDSS誘発性大腸炎から保護することができ、食事誘発性代謝障害を緩和することができ、高脂肪食(HFD)マウスにおいてコレステロール及びHDL血清レベル等の肝脂肪症の特徴を低減することができることを実証した。全てのこれらの効果はAhR依存性であることが示された。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007914005000003
    Figure 0007914005000003
  • Figure 0007914005000004
    Figure 0007914005000004
  • Figure 0007914005000005
    Figure 0007914005000005
Patent Text Reader

Abstract

The present invention relates to the preventive or curative treatment of metabolic syndrome and related disorders, and inflammatory bowel disease, using Coprococcus bacteria and / or their culture supernatants.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of pharmaceuticals, and more particularly to compositions comprising bacterial probiotics for the preventive or curative treatment of metabolic syndrome and related disorders, and inflammatory bowel disease. [Background technology]

[0002] Metabolic syndrome is the cluster of the most dangerous risk factors for heart attack and diabetes. It represents a major health problem, as a quarter of adults worldwide have metabolic syndrome. People with metabolic syndrome are twice as likely to die from a heart attack or stroke, and three times as likely to have them, compared to those without the syndrome. People with metabolic syndrome are five times more likely to develop type 2 diabetes.

[0003] Inflammatory bowel disease (IBD) is a general term used to identify a group of inflammatory disorders of the gastrointestinal (GI) tract, including Crohn's disease and ulcerative colitis. While the exact cause of IBD is not fully understood, genetic predisposition, disruption of the gut microbiota, and environmental influences are known to be involved. IBD is characterized by alternating cycles of clinical relapses and remissions. Without appropriate treatment, IBD can lead to chronic inflammation and, consequently, irreversible bowel damage.

[0004] Crohn's disease can affect any part of the GI duct, but most commonly affects the terminal part of the small intestine (ileum) leading to the beginning of the colon. Crohn's disease can appear "patchy," affecting some areas of the GI duct while other parts remain completely unaffected. In Crohn's disease, inflammation can extend to the entire wall of the intestine. Ulcerative colitis is limited to the large intestine (colon) and rectum. Inflammation occurs only in the innermost layer of the intestinal lining. Inflammation usually begins in the rectum and lower colon, but can spread continuously to include the entire colon. In some individuals, it is difficult to determine whether their IBD is Crohn's disease or ulcerative colitis. In these rare cases, the person is given a diagnosis of unclassified colitis (IC).

[0005] Some recent studies have shown that metabolic syndrome and IBD can be treated or prevented using aryl hydrocarbon receptor (AhR) agonists or bacterial probiotics that produce such agonists (see WO2018 / 065132 and WO2017 / 032739). Aryl hydrocarbon receptors (AhR) are ligand-activated nuclear receptors / transcription factors that regulate genes involved in toxin metabolism and provide a major defense against environmental exposure. AhR can be activated by dietary components such as fats and fatty derivatives, and there is evidence linking activated AhR to major diseases, including obesity (La Merill et al., 2009, Environ Health Perspect, 117, pp. 1414-1419).

[0006] In a previous patent application (WO2018 / 065132), the inventors observed that animal models of metabolic syndrome (high-fat diet (HFD)-induced metabolic syndrome or leptin-deficient mice (ob / ob mice)) were associated with reduced AhR agonist activity in their gut microbiota, and that administration of AhR agonists by pharmacological strategies or by gut bacteria that naturally produce AhR agonists reduced weight gain and improved glucose tolerance, insulin sensitivity, and fatty liver disease. The inventors also observed that in humans, AhR agonist activity in the gut microbiota was inversely correlated with metabolic syndrome. Furthermore, in another previous patent application (WO2017 / 032739), the inventors demonstrated that inoculation of Lactobacillus, which metabolizes tryptophan and produces AHR ligands, reduced colitis in an AHR-dependent manner. [Prior art documents] [Patent Documents]

[0007] [Patent Document 1] WO2018 / 065132 [Patent Document 2] WO2017 / 032739 [Patent Document 3] WO2013 / 171696 [Patent Document 4] WO2012 / 015914 [Patent Document 5] US6,432,692 [Patent Document 6] US7,419,992 [Patent Document 7] WO2009 / 093207 [Non-patent literature]

[0008] [Non-Patent Document 1] La Merill et al., 2009, Environ Health Perspect, 117, pp. 1414-1419. [Non-Patent Document 2] Schmidt and Bradfield, 1996, Annu Rev Cell Dev Biol. 12, pp. 55-89 [Non-licensed Document 3] Safe Sら, 2013, Toxicol Sci., 135, pages 1~16 [Non-licensed Document 4] Lehmann, 1995, Journal of Biological Chem., 270, pages 12953~12956 [Non-licensed Document 5] He, 2011, Environ Toxicol Chem, 30, pp. 1915-1925 [Non-licensed Document 6] Gaoら, 2009, Anal Biochem, 393, pages 163~175 [Non-licensed Document 7] Jiら, 2015, Dig Dis Sci, 60, pages 1958~1966 [Non-licensed Document 8] Furumatsuら, 2011, Dig Dis Sci, 56, pages 2532~2544 [Non-licensed Document 9] Denison, 2002, Chem. Biol. Interact. 141, pages 3~24 [Non-licensed Document 10] Denison, 2003, Annu. Rev. Pharmacol. Toxicol. 43, pages 309~334 [Non-licensed Document 11] Adachi, 2001, J. Biol. Chem., 276, pages 31475~1478 [Non-licensed Document 12] Sinal CJ ​​and Bend JR, 1997, Mol. Pharmacol., 52, 590~9 pages. [Non-licensed Document 13] Seidel SD, 2001, J. Biochem. Mol. Toxicol., 15, pp. 187-196. [Non-licensed Document 14] McMillan BJ and Bradfield CA, 2007, Proc. Natl. Acad. Sci. USA, 104, pages 1412~1417 [Non-licensed Document 15] Stevensら, 2009, Immunology., pages 127, 299~311 [Non-licensed Document 16] Bisson, 2009, J. Med. Chem, 52, pp. 5635-5641 [Non-licensed Document 17] Lawrence BP, 2008, Blood, pages 112, 1158~1165 [Non-licensed Document 18] Mezrich JDら(2012) PLoS ONE 7(9):e44547 [Non-licensed Document 19] Hu W, 2007, Mol Pharmacol., 71, pp. 1475-86 [Non-licensed Document 20] O'Donnell EFら, 2010, PLoS One, 5(10). pii:e13128 [Non-licensed Document 21] Wang Yら, 2008, Eur J Pharmacol., 601, pages 73~78 [Non-licensed Document 22] worldwide consensus definition of the metabolic syndrome(2006) [Non-licensed Document 23] Fernandez-Salguero, Science. 1995, 268, pages 722~726 [Non-licensed Document 24] Kreymborg, J. Immunol. 2007, 179, pages 8098~8104 [Non-licensed Document 25] Lamasら, 2016, Nat Med. Jun; 22(6): pages 598~605 [Non-licensed Document 26] Sokol et al., Gastroenterology. 2013 Sep;145(3):591~601.e3 p. [Non-Patent Document 27] Crane et al., 2015, Nat Med 21, pp. 166-172. [Non-Patent Document 28] Schneider et al., 2012, Nat Methods 9, pp. 671-675. [Overview of the project] [Problems that the invention aims to solve]

[0009] However, even if the link between AhR and metabolic syndrome or IBD is clarified, there remains a strong need for appropriately characterized bacterial probiotics to be used in the prevention or treatment of these pathological conditions. [Means for solving the problem]

[0010] In this specification, the inventors have identified bacterial probiotics associated with high AhR activity. In fact, the inventors have demonstrated that Coprococcus comes and / or its culture supernatant can protect mice from DSS-induced colitis, alleviate diet-induced metabolic disorders, and reduce characteristics of hepatic steatopathies, such as cholesterol and HDL serum levels, in high-fat diet (HFD) mice. All of these effects were shown to be AhR-dependent.

[0011] Accordingly, the present invention relates to a composition comprising Coprocococcus bacteria and / or a culture extract thereof exhibiting AhR agonist activity, for use in the treatment of diseases selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease.

[0012] Preferably, the bacterium is Coprocococcus comes.

[0013] More preferably, the bacterium is the Coprococcus comes strain deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession number DSM33359, or a variant thereof.

[0014] Preferably, the Coprococcus bacteria in the composition are living Coprococcus bacteria, and / or the culture extract is the culture supernatant. In particular, the composition may contain living Coprococcus bacteria and their culture supernatant, preferably living Coprococcus comes bacteria and their culture supernatant.

[0015] The composition can optionally produce an AhR agonist, preferably from bacteria belonging to the genera Allobaculum, Adlercreutzia, Anaerostipes, Bifidobacterium, Propionibacterium, Bacteroides, Eubacterium, Enterococcus, Ruminococcus, and Faecalibacterium, as well as Escherichia coli. It may further contain one or more additional bacterial probiotics selected from the group consisting of lactic acid bacteria such as Escherichia coli, and bacteria belonging to the genera Lactobacillus and Streptococcus, or selected from the group consisting of bacteria belonging to the genera Allobaculum, Adrekrautia, Propionibacterium, Enterococcus, Escherichia coli, Lactobacillus and Streptococcus.In particular, the composition includes CNCM deposit numbers CNCM I-5019, CNCM I-5020, CNCM I-5021, CNCM I-5022 and CNCM I-5023, Ruminococcus gnavus ATCC29149, Lactobacillus salivarius DSM20555, Lactobacillus reuteri DSM20016, Lactobacillus gasseri DSM20243, Faecalibacterium prausnitzii A2-165, Escherichia coli MG1665, and Anaerostipes hadras. The composition may further contain one or more additional bacterial probiotics selected from the group consisting of strains available for Anaerostipes hadrus (DSM3319), Anaerostipes caccae (DSM14662), Anaerostipes butyraticus (DSM22094), and Allobaculum stercoricanis (DSM13633). Alternatively, in another embodiment, the composition may contain no additional bacteria, and in particular no additional bacterial probiotics.

[0016] Preferably, the composition can be administered orally or via the rectal route.

[0017] Preferably, the disease is selected from metabolic syndrome or related disorders, and the disorder is preferably selected from the group consisting of cardiovascular disease, insulin resistance, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease and lipodystrophy; more preferably, the disease is selected from metabolic syndrome or related disorders, and the disorder is preferably selected from the group consisting of cardiovascular disease, insulin resistance, impaired glucose tolerance, non-alcoholic fatty liver disease and lipodystrophy. The cardiovascular disease is preferably coronary heart disease, more preferably heart attack or stroke.

[0018] In several embodiments, the disease is an inflammatory bowel disease, which is preferably selected from the group consisting of Crohn's disease, ulcerative colitis, unclassifiable colitis (IC), other non-infectious gastroenteritis, enteritis, enterocolitis and colitis, and pouchitis, and more preferably selected from Crohn's disease and ulcerative colitis. Preferably, the disease is not antibiotic-associated colitis, and more preferably not Clostridium difficile-associated diarrhea.

[0019] In another embodiment, the present invention also relates to the Coprococcus comes strain, or a variant thereof, deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession number DSM33359. [Brief explanation of the drawing]

[0020] [Figure 1-1] Figure 1. This figure shows that C. comes supernatant protects against DSS-induced colitis. Weight loss (A) and DAI (B) during DSS-induced colitis in mice treated with C. comes (bacteria + supernatant, supernatant, or dead bacteria). Colon length (C) and histological scores after HES staining (D-E) after 12 days of DSS-induced colitis. IL-17A, IFN-γ, IL-22, and IL-10 proteins after MLN cell stimulation on day 12 (F). Each graph is representative of two separate experiments, n=5-10. Statistics: Two-way ANOVA, Bonferroni post-hoc test. [Figure 1-2] Continuation of Figure 1. [Figure 1-3] Continuation of Figure 1. [Figure 2-1]Figure 2. Figure showing that C. comes protection is AhR-dependent. Change in AhR activity in H1L1.1c2 (A), Cyp1a and AhRR mRNA in the colon and liver at steady state after 3 weeks of enteral feeding with C. comes supernatant (B). Weight loss (C) and DAI (D) after DSS-induced colitis in AhR-- with or without enteral feeding of C. comes SN (D). Colon length (E), histological score (F), and HES staining after 9 days of colitis (G). Each graph is representative of two separate experiments, n=5-10. Statistics: Two-way ANOVA, Bonferroni post-hoc test. [Figure 2-2] Continuation of Figure 2. [Figure 3-1] Figure 3. Figure showing that C. comes protection is mediated through IL-22 secretion. (A) Changes in Reg3γ, Reg3β, and IL-22 mRNA in the steady-state colon after 3 weeks of enteral feeding of C. comes supernatant. (B) Weight loss (DAI) and DAI (C) after DSS-induced colitis in IL22- / - mice. (D) Colon length (HES staining) (F) after 9 days of colitis. Each graph is representative of two separate experiments, n=7-8. Statistical analysis: two-way ANOVA, Bonferroni post-hoc test. [Figure 3-2] Continuation of Figure 3. [Figure 4-1] Figure 4. This figure shows that treatment with Coprococcus comes alleviates diet-induced metabolic disorders. C. (A) Body weight gain, (B) Food intake, (C) Blood glucose levels after 16 hours of fasting, (D) AUC (Area under the curve) of OGTT, (E) Blood glucose levels after 4 hours of fasting during ITT, (F) AUC of ITT. [Figure 4-2] Continuation of Figure 4. [Figure 5] This figure shows that treatment with Coprococcus comes reduces hepatic steatohepatia in HFD mice. (A) Representative photographs of H&E-stained liver thin sections from the mice shown. (B) C. Lipid area calculated as percentage area of ​​region of interest (AOI) in liver cross-sections of Conv and HFD-supplied mice supplemented with comes or vehicle. [Figure 6]This figure shows that treatment with Coprocococcus comes reduces the serum characteristics of HFD-induced metabolic syndrome. (A) Cholesterol and (B) HDL concentrations from the serum of the mice shown. [Figure 7-1] Figure 7. This figure shows that supplementation with Coprococcus comes is insufficient to alleviate diet-induced metabolic disorders in AhR- / - mice. C. (A) Body weight gain, (B) Food intake, (C) Blood glucose levels after 16 hours of fasting, (D) AUC of OGTT, (E) Blood glucose levels after 4 hours of fasting during ITT, (F) AUC of ITT. [Figure 7-2] Continuation of Figure 7. [Figure 7-3] Continuation of Figure 7. [Figure 8] This figure shows that supplementation with Coprococcus comes in AhR- / - mice has no effect on hepatic steatosis in HFD mice. (A) Representative photographs of H&E-stained liver thin sections from the mice shown. (B) C. Lipid area calculated as percentage region of interest (AOI) in liver cross-sections of Conv and HFD-supplied mice supplemented with comes or vehicle. [Modes for carrying out the invention]

[0021] In this specification, the inventors have identified bacterial probiotics associated with high AhR activity. In fact, the inventors have demonstrated that Coprocococcus comesus and / or their culture supernatants can protect mice from DSS-induced colitis, mitigate diet-induced metabolic disorders, and reduce the characteristics of non-alcoholic fatty liver disease (NAFLD), such as hepatic steatosis, in high-fat diet (HFD) mice. All of these effects were shown to be AhR-dependent.

[0022] Accordingly, in a first aspect, the present invention relates to a composition comprising Coprocococcus and / or a culture extract thereof exhibiting AhR agonist activity, for use in the treatment of diseases selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease. The present invention also relates to the use of a composition comprising Coprocococcus and / or a culture extract thereof exhibiting AhR agonist activity, for use in the manufacture of a pharmacopoeia for the treatment of diseases selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease. The present invention further relates to a method for treating a disease selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease in a subject, the method comprising administering a composition comprising Coprocococcus and / or a culture extract thereof exhibiting AhR agonist activity to the subject.

[0023] Coprococcus (Uniprot Taxon ID: 33042) is a genus of anaerobic cocci that are part of the human fecal microbiome. In preferred embodiments, the Coprococcus bacterium is Coprococcus comes (e.g., Uniprot Taxon ID: 410072). Coprococcus comes is commercially available, for example, from the ATCC® collection (ATCC® 27758).

[0024] Coprococcus bacteria can be cultured under anaerobic conditions at 37°C in suitable media. Examples of suitable media include, but are not limited to, LYHBHI medium (Brain Heart Infusion medium supplemented with 0.5% yeast extract and 1% hemin) supplemented with cellobiose (1 mg / ml), maltose (1 mg / ml), cysteine ​​(0.5 mg / ml), vitamin K1 (0.0002%), and vitamin K3 (0.0002%), ATCC® medium 1102 (Chopped meat carbohydrate medium containing 0.1% cellobiose, 0.1% maltose, 0.1% starch, and 0.1% Tween 80), or ATCC® medium 260 (Triptycase soy agar / broth containing defibrous sheep blood).

[0025] The Coprocococcus bacteria used in this invention exhibit AhR activation properties.

[0026] As used herein, the term "AhR" has its general meaning in the art and refers to the aryl hydrocarbon receptor, a transcription factor activated by a variety of compounds that regulates the expression of xenobiotic metabolic genes. The aryl hydrocarbon receptor (AhR) is a member of the bHLH-PAS (basic helix-loop-helix / Per-ARNT-Sim) family, a family of basic helix-loop-helix transcription factors (Schmidt and Bradfield, 1996, Annu Rev Cell Dev Biol. 12, pp. 55-89; Safe S et al., 2013, Toxicol Sci., 135, pp. 1-16). It is listed in the Uniprot database as P35869. The Genbank reference sequences are NM_001612.1 and NP_001621.4.

[0027] The term "AhR activity" has its general meaning in this art and refers to biological activity related to the activation of AhR resulting from its signaling cascade, including any downstream biological effects resulting from the binding of AhR agonists, such as native ligands, to AhR. Analysis of AhR activity levels can be determined by any of the many well-known methods (Lehmann et al., 1995, Journal of Biological Chem., 270, pp. 12953-12956; He et al., 2011, Environ Toxicol Chem, 30, pp. 1915-1925; and Gao et al., 2009, Anal Biochem, 393, pp. 163-175).

[0028] The term "AhR activating property" or "AhR agonist activity" refers to the ability to induce AhR activity, that is, the ability to activate signaling pathways initiated by AhR activation and which may include any type of activation mechanism. Therefore, the microorganism itself does not necessarily have to be an AhR ligand; for example, secreted substances produced by microorganisms may have AhR activating properties. The AhR activating property of bacteria can be determined by cell-based assays such as those described in Examples, He et al., 2011, and Gao et al., 2009. In particular, the AhR activation level can be determined by luciferase activity in AhR-responsive recombinant cells such as AhR-responsive recombinant guinea pig (G16L1.1c8), rat (H4L1.1c4), mouse (H1L1.1c2), and human (HG2L6.1c3) cells. AhR activation levels can also be determined by measuring the ability to stimulate AhR-dependent gene expression using recombinant mouse hepatocellular carcinoma (Hepa1c1c7) cell-based CALUX (H1L1.1c2 and H1L6.1c2) clone cell lines and CAFLUX (H1G1.1c3) clone cell lines containing stably incorporated AhR / dioxin-responsive element (DRE)-driven firefly luciferase plasmids (pGudLuc1.1 or pGudLuc6.1, respectively) (He et al., 2011, above). Typically, AhR agonist activity is measured by performing the method described in the examples, i.e., by determining the luciferase activity in AhR-responsive recombinant cells, preferably H1L1.1c2 cells, in the presence of the bacteria under test or their culture extract, particularly their culture supernatant.In particular, AhR agonist activity may be measured by AhR-dependent chemically activated luciferase expression (CALUX) analysis in recombinant H1L1.1c2 cells containing a stably incorporated DRE-driven firefly luciferase reporter plasmid pGudLuc1.1 in the presence of the bacterium or its culture extract, especially its culture supernatant. An increase in luciferase (or AhR) activity, preferably at least 2%, at least 5%, at least 10%, at least 20%, at least 50%, at least 75%, or at least 100%, compared to a control sample without the bacterium or culture extract, indicates that the bacterium exhibits AhR agonist activity. Preferably, AhR agonist activity is measured by the method described in the examples, particularly by determining luciferase activity in AhR-responsive recombinant cells, preferably H1L1.1c2 cells, and the 10% culture supernatant of Coprococcus used in the present invention increases AhR activity by at least a 1.5 change compared to the AhR activity obtained in a control sample without the culture supernatant.

[0029] The composition of the present invention may comprise one or more strains of Coprococcus, in particular one or more strains of Coprococcus comes, and / or a culture extract of one or more strains of Coprococcus, in particular a culture extract of one or more strains of Coprococcus comes.

[0030] Preferably, the composition of the present invention comprises at least one Coprocococcus comes bacterium and / or a culture extract thereof.

[0031] More preferably, the composition of the present invention comprises Coprocococcus comes or its variants and / or culture extracts deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ, Inhoffenstr.7B, D-38124 Braunschweig, Germany) on November 21, 2019, under accession number DSM33359.

[0032] As used herein, the term “mutant” should be understood as a strain derived from, or potentially derived from, the strain (or mother strain) of the present invention by, for example, genetic engineering, radiation, and / or chemical treatment. The mutant may also be a spontaneously occurring mutant. Preferably, the mutant is a functionally equivalent mutant, for example, a mutant substantially identical to, or possessing improved characteristics (particularly AhR activation characteristics) of, the mother strain. Such a mutant is part of the present invention. In particular, the term “mutant” refers to a strain obtained by subjecting the strain of the present invention to any conventionally used mutagenic treatment, including treatment with ethanemethanesulfonate (EMS) or N-methyl-N'-nitro-N-nitroguanidine (NTG), UV light, or a spontaneously occurring mutant. While the mutant may have been subjected to several mutagenic treatments (one treatment should be understood as one mutagenic treatment followed by a screening / selection step), it is currently preferred that no more than 20, or no more than 10, or no more than 5 treatments (or screening / selection steps) be performed. In the currently preferred mutants, less than 1%, less than 0.1%, less than 0.01%, less than 0.001%, or even less than 0.0001% of nucleotides in the bacterial genome are mutated, i.e., substituted, inserted, or deleted, compared to the parent strain. Preferably, the mutant genome has at least 99% sequence identity with the parent strain genome, and the mutant exhibits AhR agonist activity.

[0033] In one embodiment, the composition of the present invention comprises inactivated Coprococcus bacteria, i.e., at least one inactivated Coprococcus strain. Preferably, the strain is Coprococcus comes. More preferably, the strain is DSM33359 or a variant thereof. In this embodiment, it is not excluded that the composition also comprises other bacterial components or culture components, such as living bacteria and / or cell fragments and / or culture media. Inactivated bacteria cannot grow when cultured in a suitable medium. Preferably, the inactivated bacteria are dead bacteria. The bacteria can be inactivated by any means known to those skilled in the art, such as heat treatment. The inactivated bacteria can be preserved before administration by any method known to those skilled in the art, such as freeze-drying and subsequent storage at a temperature preferably in the range of +4°C to -80°C.

[0034] In preferred embodiments, the composition of the present invention comprises live Coprococcus bacteria, i.e., at least one live Coprococcus strain. Preferably, the strain is Coprococcus comes. More preferably, the strain is DSM33359 or a variant thereof. In this embodiment, it is not excluded that the composition also comprises other bacterial or culture components such as dead bacteria and / or cell fragments and / or culture media. Live bacteria can be preserved before administration by freezing with liquid nitrogen, stepwise freezing or freeze-drying and subsequent storage at a temperature preferably in the range of +4°C to -80°C.

[0035] In another embodiment, the composition of the present invention comprises a culture extract of Coprocococcus bacteria, preferably a culture extract of Coprocococcus comes, more preferably a culture extract of strain DSM33359 or a variant thereof.

[0036] As used herein, the term “culture extract” refers to an extract obtained from a culture of Coprocococcus, preferably Coprocococcus comes, more preferably strain DSM33359 or its variants, in a suitable cell culture medium under suitable conditions, wherein the extract exhibits AhR agonist activity. The AhR agonist activity of the extract may be determined as described above. The extract may be any fraction obtained from a culture or bacterial cell, such as culture supernatant, cell flakes, cell walls, DNA or RNA extracts, protein extracts, and any preparations generally derived from bacterial cells or cell cultures by chemical, physical and / or enzymatic treatment. The culture extract may not contain intact bacterial cells, or may contain some remaining intact bacterial cells, preferably 10 per mL. 3 It may contain fewer than one cell.

[0037] In preferred embodiments, the culture extract is the culture supernatant. As used herein, the term “culture supernatant” refers to the supernatant obtained from growing Coprococcus, preferably Coprococcus comes, more preferably strain DSM33359 or its variants in a suitable cell culture medium under suitable conditions, the culture supernatant exhibiting AhR agonist activity. In particular, this term refers to the liquid broth remaining when cells grown in the medium are separated from the culture medium by, for example, centrifugation, filtration, sedimentation or other means well known in the art. Optionally, the culture supernatant may be further diluted, concentrated, dried and / or lyophilized. The culture supernatant may not contain living bacterial cells, or some remaining living bacterial cells, preferably 10 per mL 3 It may contain fewer than one cell. The culture supernatant may also contain cellular components such as dead bacteria and / or cell fragments.

[0038] In certain embodiments, the culture supernatant is obtained by growing Coprocococcus bacteria, preferably Coprocococcus comes, more preferably strain DSM33359 or its variants, in a suitable medium, separating the bacterial cells from the culture medium by, for example, centrifugation, filtration, or sedimentation, and collecting the culture supernatant.

[0039] In another specific embodiment, the culture supernatant is obtained by growing Coprocococcus bacteria, preferably Coprocococcus comes, more preferably strain DSM33359 or its variants in a suitable medium, lysing the bacterial cells in the culture medium, and collecting the culture supernatant (containing dead bacteria and / or cell fragments, i.e., lysates).

[0040] In more specific embodiments, the culture supernatant is obtained by growing Coprocococcus bacteria, preferably Coprocococcus comes, more preferably strain DSM33359 or its variants, in a suitable medium, dissolving the bacterial cells in the culture medium, separating the bacterial cells and cell fragments from the culture medium by, for example, centrifugation, filtration, or sedimentation, and recovering the culture supernatant.

[0041] Optionally, in any of these embodiments, the culture supernatant may be further diluted or concentrated. In some preferred embodiments, the culture supernatant is dried or lyophilized.

[0042] In further embodiments, the composition comprises Coprococcus bacteria, preferably Coprococcus comes, more preferably strain DSM33359 or a variant thereof, and its culture extract, preferably its culture supernatant. Preferably, the composition comprises live Coprococcus bacteria. In the embodiments, the composition may comprise a cell culture comprising Coprococcus bacteria. As used herein, the term “cell culture” refers to a mix of bacterial cells and the liquid broth used to culture these cells. In particular, a cell culture may be obtained by inoculating live Coprococcus bacteria into a suitable liquid broth, incubating the mix under suitable conditions (particularly anaerobic conditions), and recovering the cell culture. Alternatively, the composition may include Coprococcus bacteria, preferably live Coprococcus bacteria, and culture extracts thereof, preferably obtained by any of the methods disclosed above, in particular, the culture supernatant obtained by growing Coprococcus bacteria in a suitable medium and a) separating the bacterial cells from the culture medium by, for example, centrifugation, filtration or sedimentation and recovering the culture supernatant, or b) dissolving the bacterial cells in the culture medium and recovering the culture supernatant (containing dead bacteria and / or cell fragments, i.e., lysates), or c) dissolving the bacterial cells in the culture medium and separating the bacterial cells and cell fragments from the culture medium by, for example, centrifugation, filtration or sedimentation and recovering the culture supernatant. Optionally, the culture supernatant may be further diluted, concentrated, dried and / or lyophilized.

[0043] In another embodiment, the composition comprises Coprocococcus bacteria, preferably live Coprocococcus bacteria, and a culture extract of another Coprocococcus bacteria, preferably the culture supernatant. Preferably, the Coprocococcus bacteria used to obtain the Coprocococcus bacteria and / or culture extract is Coprocococcus comes, more preferably strain DSM33359 or a variant thereof.

[0044] In some specific embodiments, the composition contains no Coprococcus catus bacteria, no culture extract thereof, and / or no Coprococcus eutactus bacteria, no culture extract thereof.

[0045] The composition may further comprise at least one additional active ingredient, in particular one or more additional bacterial probiotics and / or one or more AhR agonists.

[0046] The compositions of the present invention may comprise one or more additional bacterial probiotics. The term “bacterial probiotics” has its general meaning in the art and refers to useful bacteria that can have beneficial effects on the health of a host, i.e., applicable to the prevention, treatment or cure of a disease or condition in a host, preferably a human. The term may refer to dead or living bacteria. Preferably, the term refers to living bacteria.

[0047] Preferably, one or more of these additional bacterial probiotics exhibit AhR-activating properties. AhR can be activated by bacterial probiotics as AhR ligands, by secretions produced by the bacterial probiotics that have AhR-activating efficacy, or by dead microorganisms or homogenates of the bacterial probiotics.

[0048] Preferably, one or more of the bacterial probiotics can produce AhR agonists. Such bacterial probiotics include bacteria belonging to the genera Alobaculum (e.g., Alobaculum stelcolicanis), Adrekrautia, Anaerostipes (e.g., Anaerostipes hadras, Anaerostipes cacae, and Anaerostipes butyraticus), Bifidobacterium, Propionibacterium, Bacteroides, Eubacterium, Enterococcus, Ruminococcus (e.g., Ruminococcus gunavas), and Faecalibacterium (e.g., Faecalibacterium prausnitzii), Escherichia coli, and Lactobacillus (e.g., Lactobacillus reuteri, Lactobacillus taiwanensis, Lactobacillus johnsonii). The lactic acid bacteria may be selected from the group consisting of bacteria such as Lactobacillus johnsonii, Lactobacillus animalis, Lactobacillus murinus, Lactobacillus salivarius, Lactobacillus gasseri, Lactobacillus bulgaricus, and Lactobacillus delbrueckii subsp. Bulgaricus) and bacteria belonging to the Streptococcus genus (e.g., Streptococcus thermophilus). In certain embodiments, the composition may contain one or more bacterial probiotics selected from the group consisting of bacteria belonging to the genera Allobaculum, Adrekrautia, Propionibacterium, Enterococcus, Escherichia coli, Lactobacillus, and Streptococcus.

[0049] In a preferred embodiment, the one or more additional probiotics are strains CNCM I-5019 (Lactobacillus taiwanensis), CNCM I-5020 (Lactobacillus murinus), CNCM I-5021 (Lactobacillus animalis), CNCM I-5022 (Lactobacillus reuteri) and CNCM, which were deposited on September 30, 2015, at the Collection Nationale de Cultures de Microorganismes (CNCM, Institut Pasteur, 25 rue du Docteur Roux, 75724 Paris Cedex 15, France). The group is selected from I-5023 (Lactobacillus reuteri), Ruminococcus gunavas ATCC29149, Lactobacillus salivarius DSM20555, Lactobacillus reuteri DSM20016, Lactobacillus gasseri DSM20243, Faecalibacterium prausnitzii A2-165, Escherichia coli MG1665, Anaerostipes hadras DSM3319, Anaerostipes cacae DSM14662, Anaerostipes butyraticus DSM22094, and Alobacillus stercolicanis DSM13633.

[0050] The composition of the present invention may also include one or more AhR agonists.

[0051] AhR agonists are small organic molecules or peptides, and include synthetic and naturally occurring compounds. The term “AhR agonist” has its general meaning in the art and refers to a compound that activates AhR, preferably selectively. An AhR agonist may be a naturally occurring AhR ligand or any compound that can directly or indirectly stimulate an AhR-related signaling cascade. As used herein, the term “selectively activates” refers to a compound that preferentially binds to and activates AhR with greater affinity and potency than its interactions with other members of the bHLH-PAS transcription factor family. Compounds that select AhR but can also activate other subtypes as partial or complete agonists are also intended. Tests and assays for determining whether a compound is an AhR agonist are well known to those skilled in the art, as described in Ji et al., 2015, Dig Dis Sci, 60, pp. 1958-1966; Furumatsu et al., 2011, Dig Dis Sci, 56, pp. 2532-2544; WO2013 / 171696; WO2012 / 015914; US6,432,692. In vitro and in vivo assays may be used to determine the potency and selectivity of candidate activators for inducing AhR activity.

[0052] Examples of AhR agonists include halogenated aromatic hydrocarbons (e.g., polychlorodibenzodioxin, dibenzofuran, and biphenyl), polycyclic aromatic hydrocarbons (e.g., 3-methylcholanthrene, benzo-α-pyrene, benzoanthracene, and benzoflavone), indole derivatives, kynurenine, kynurenic acid, tryptophan catabolic products of the microbiome, such as indole-3-aldehyde (IAld), indolepropionic acid, tryptamine, indole-3-acetic acid, 3-indoxyl sulfate, 6-formylindro(3,2-b)carbazole (FICZ), indro(3,2-b)carbazole (ICZ), 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) or its precursor 2-(1'H-indole-3'-carbonyl)-thiazole-4-carboxylic acid (ITC), and U These analogs disclosed in S7,419,992, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), 3-indoxyl sulfate (I3S), 1-(4-methylphenyl)-2-(4,5,6,7-tetrahydro-2-imino-3(2H)-benzothiazolyl)ethanone hydrobromide (pifislin-α hydrobromide), (2'Z,3'E)-6-bromo-1-methylindilbine-3'-oxime (MeB10), tryptophan derivatives, e.g., indigo dyes and indilbine, flavonoids, biphenyls, tetrapyrroles, e.g., bilirubin, arachidonic acid metabolites such as lipoxin-A4 and prostaglandin G, modified low-density lipoproteins, and several dietary carotenoids (Denison et al., 2002, Chem. Biol. Interact. 141, pp. 3-24; Denison et al., 2003, Annu. Rev. Pharmacol. Toxicol. 43, pp. 309-334; Adachi et al., 2001, J. Biol. Chem., 276, pp. 31475-1478; Sinal CJ ​​and Bend JR, 1997, Mol. Pharmacol., 52, pp. 590-599; Seidel SD et al., 2001, J. Biochem. Mol. Toxicol., pp. 15, 187-196; McMillan BJ and Bradfield CA, 2007, Proc. Natl. Acad. Sci. USA, 104, pp. 1412-1417; Stevens et al., 2009, Immunology., 127, pp. 299-311), Bisson et al., 2009, J. Med. AhR agonists (e.g., 5-hydroxy-7-methoxyflavone, 7-methoxyisoflavone, 6-methylflavone, 3-hydroxy-6-methylflavone, pinosembrin (5,7-dihydroxyflavanone) and 7,8,2'-trihydroxyflavone) disclosed in Chem, 52, pp. 5635-5641, compound VAF347[4-(3-chlorophenyl)-N-[4-(trifluoromethyl)phenyl]pyrimidine-2-amine] and its prodrug version VAG539[4-(3-chlorophenyl)-pyrimidine-2-yl]-(4-trifluoromethylphenyl)-carbamate 2-[(2-hydroxyethyl)-methyl-amino]-ethyl ester](Lawrence BP, 2008, Blood, 112, pp. 1158-1165), semacsanib (SU5416) [3-(3,5-dimethyl-1H-pyrrole-2-ylmethylene)-1,3-dihydro-indole-2-one] (Mezrich JD et al. (2012) PLoS ONE 7(9):e44547), selective AhR modulators (SAhRM) (e.g., diindolylmethane (DIM), methyl-substituted diindolylmethane, dihalo and dialkyl DIM analogs, β-naphthoflavone (βNF) (5,6-benzoflavone (5,6BZF) and e.g., Safe et al., 2013, Toxicol Sci., pp. 135, 1-16; Furumatsu et al., 2011, Dig Dis Sci, 56, pp. 2532-2544; and the portion described in WO2012 / 015914), compounds described in WO2012 / 015914 (e.g., CB7950998), 1,4-dihydroxy-2-naphthoic acid (DHNA), and natural AhR agonists (NAhRA) disclosed in WO2013 / 171696 and WO2009 / 093207, mexiletine, nimodipine, flutamide, atorvastatin, leflunomide, and Korean ginseng (Hu W et al., 2007, Mol Pharmacol., 71, pp. 1475-86; O'Donnell EF et al., 2010, PLoS One, 5(10)). This includes, but is not limited to, the following: pii:e13128; Wang Y et al., 2008, Eur J Pharmacol., 601, pp. 73-78.

[0053] In a particular embodiment, the one or more AhR agonists are selected from the group consisting of approved drugs having an agonist effect on AhR, preferably from the group consisting of mexiletine, nimodipine, flutamide, atorvastatin, leflunomide, and ginseng.

[0054] As additional active ingredients, the composition may also include one or more drugs useful for treating metabolic syndrome and related disorders, or for treating inflammatory bowel disease. Examples of drugs useful for treating inflammatory bowel disease include, but are not limited to, corticosteroids, 5-aminosalicylic acid, immunosuppressants, e.g., cyclosporine, azathioprine, 6-mercaptopurine, methotrexate, anti-TNF agents (e.g., infliximab, adalimumab, golimumab, certolizumab), anti-integrin agents (e.g., natalizumab, vedolizumab), anti-IL12 and / or IL23 antibodies (e.g., ustekinumab), JAK inhibitors (e.g., tofacitinib), antibiotics, antidiarrheals, analgesics, iron supplements, vitamin B12, calcium, and vitamin D.

[0055] In certain embodiments, the composition essentially consists of one or more Coprocococcus species, preferably one or more living Coprocococcus species, and / or its culture extract, preferably its culture supernatant. As used herein, the term “essentially consists of” is intended to mean a composition that does not contain any other active ingredients, in particular any other bacteria, and especially any other bacterial probiotics.

[0056] In preferred embodiments, the composition of the present invention is a pharmaceutical composition comprising Coprococcus as defined above, preferably live Coprococcus, and / or a culture extract thereof, preferably the culture supernatant thereof, and a pharmaceutically acceptable excipient.

[0057] As used herein, the term “pharmaceutically acceptable” means molecular entities and compositions that, when appropriately administered to mammals, particularly humans, do not produce harmful, allergic, or other adverse reactions. A pharmaceutically acceptable excipient means any type of non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation aid. Pharmaceutically acceptable excipients that may be used in compositions according to the present invention are well known to those skilled in the art and may vary depending on the disease being treated and the route of administration.

[0058] The compositions of the present invention may be administered by any method suitable for positioning in the gastrointestinal tract, preferably the small intestine and / or colon, of the target to be treated. In particular, the compositions may be administered intra-intestinal or parenteral routes, preferably by oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, topical, or rectal administration routes. Preferably, the compositions of the present invention are administered by rectal or oral routes, or are adapted to be administered by rectal or oral routes.

[0059] In one embodiment, the pharmaceutical composition may be administered by oral route. For oral administration, the pharmaceutical composition may be formulated into conventional oral dosage forms such as tablets, capsules, powders, granules, and liquid preparations such as syrups, elixirs, and concentrated drops. For example, non-toxic solid carriers or diluents containing pharmaceutical-grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium, carbonate, etc. may be used. For compressed tablets, a binder is also required, which is an agent that imparts cohesiveness to the powdered material. For example, starch, gelatin, sugars such as lactose or dextrose, and natural or synthetic gums may be used as binders. Disintegrants may also be required in tablets to facilitate tablet disintegration. Disintegrants include starch, clay, cellulose, algin, gum, and crosslinked polymers. Furthermore, lubricants and slicks may also be included in tablets to prevent the tablet material from adhering to surfaces during the manufacturing process and to improve the flow properties of the powder material during manufacturing. Colloidal silicon dioxide is most commonly used as a lubricant, and compounds such as talc or stearic acid are most commonly used as lubricants. Well-known thickeners such as corn starch, agar, natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, guar, and xanthan gum may also be added to the composition. Preservatives including methylparaben, propylparaben, benzyl alcohol, and ethylenediaminetetraacetate may also be included in the composition.

[0060] In some specific embodiments, the composition may be a beverage or drink composition, a food composition, or a feed composition.

[0061] Preferably, for oral administration, the composition is a gastric-tolerant oral form that allows the active compound contained in the composition to pass through the stomach and be released into the intestines. Substances that may be used in enteric coatings include, for example, alginic acid, cellulose phthalate acetate, plasticizers, waxes, shellac, and fatty acids (e.g., stearic acid or palmitic acid).

[0062] In another embodiment, the pharmaceutical composition may be administered via the rectal route. Suitable rectal route forms include, but are not limited to, suppositories and enemas. In particular, the active compound may be incorporated into any known suppository base by methods known in the art. Examples of such bases include cocoa butter, polyethylene glycol (carbowax), polyethylene sorbitan monostearate, and mixtures thereof with other suitable substances for modifying their melting point or decay rate.

[0063] The compositions according to the present invention can be formulated to release the active ingredient substantially immediately after administration, or at any predetermined time or period after administration.

[0064] The compositions of the present invention are used to treat diseases selected from the group consisting of metabolic syndrome and related disorders, and inflammatory bowel disease.

[0065] As used herein, the terms “treatment,” “to treat,” or “to treat” refer to any action intended to improve a patient’s health condition, such as treating, preventing, avoiding, or delaying a disease. In certain embodiments, such terms refer to the improvement or elimination of a disease or its associated symptoms. In other embodiments, the terms refer to minimizing the spread or worsening of a disease by administering one or more therapeutic agents, such as compositions of the present invention, to a subject having such a disease.

[0066] In some embodiments, the disease is metabolic syndrome or any related disorder. Metabolic syndrome is defined by a clustering of at least three of the following five medical conditions: - Abdominal (central) obesity, - Increased blood pressure, - Increased fasting plasma glucose, - High serum triglycerides, and - Low high-density lipoprotein (HDL) levels.

[0067] It is important to note that obesity is not the same as metabolic syndrome. Patients with a normal weight may have metabolic syndrome, and conversely, obese individuals may not have metabolic syndrome. In fact, as mentioned above, metabolic syndrome is established when obesity is abdominal obesity and at least two other medical conditions are observed.

[0068] According to the International Diabetes Federation, the consensus worldwide definition of the metabolic syndrome (2006) is central obesity (defined as waist circumference using ethnic-specific values) and any two of the following: - Elevated blood pressure (BP): Systolic BP > 130 or diastolic BP > 85 mmHg, or treatment for previously diagnosed hypertension. - Elevated fasting plasma glucose (FPG): >100 mg / dL (5.6 mmol / L), or previously diagnosed type 2 diabetes. - High serum triglycerides refer to >150 mg / dL (1.7 mmol / L) or special treatment for this lipid abnormality. - Low high-density lipoprotein (HDL) levels: <40 mg / dL (1.03 mmol / L) in men, <50 mg / dL (1.29 mmol / L) in women, or special treatment for this dyslipidemia.

[0069] BMI > 30 kg / m 2 In this case, central obesity can be inferred, and waist circumference does not need to be measured.

[0070] Metabolic syndrome carries a risk of developing other disorders, i.e., related disorders. Preferably, these related disorders are selected from the group consisting of cardiovascular diseases, particularly coronary heart disease, especially heart attack and stroke, insulin resistance, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease, especially non-alcoholic steatohepatitis, and steatosis. In certain embodiments, these related disorders are selected from the group consisting of cardiovascular diseases, particularly coronary heart disease, especially heart attack and stroke, insulin resistance, impaired glucose tolerance, non-alcoholic fatty liver disease, especially non-alcoholic steatohepatitis, and steatosis.

[0071] In some other embodiments, the disease is inflammatory bowel disease. As used herein, “inflammatory bowel disease” or “IBD” refers to any of the various diseases characterized by inflammation of all or part of the intestine. Examples of inflammatory bowel diseases include, but are not limited to, Crohn's disease (e.g., enteritis, ileitis, colitis, ileocolitis, gastroduodenal and perianal Crohn's disease), ulcerative colitis (e.g., ulcerative enterocolitis, ulcerative ileocolitis, ulcerative proctitis, ulcerative rectosigmoid colitis, pseudopolypitis of the colon, mucorectocolitis, and left-sided or panulcerative colitis), unclassified colitis (IC), other non-infectious gastroenteritis, enteritis, enterocolitis and colitis (e.g., non-microscopic colitis including collagenous colitis and lymphocytic colitis, radiation-induced, toxic, allergic, diet-induced, ischemic, eosinophilic gastroenteritis, enteritis, enterocolitis or colitis, diverticular-associated regional colitis, fecal diversion colitis, and Behçet's colitis), and pouchitis. In some specific embodiments, inflammatory bowel disease is not antibiotic-associated colitis, or more specifically, not Clostridium difficile-associated diarrhea.

[0072] Preferably, the inflammatory bowel disease is selected from the group consisting of Crohn's disease and ulcerative colitis, and more preferably ulcerative colitis.

[0073] The subjects treated with the compositions of the present invention are animals, preferably mammals, and more preferably humans, including adults, children, neonates, and prenatal humans. As used herein, the terms “subject,” “individual,” and “patient” are interchangeable.

[0074] In one embodiment, the subject exhibits reduced AhR activity, particularly in fecal samples, and more specifically, reduced AhR agonist activity in the gut microbiota. In a particular embodiment, AhR activity is measured in the subject. Preferably, AhR activity is the activity of the microbiota and is measured in fecal samples.

[0075] In a preferred embodiment, the subject exhibits reduced AhR activity compared to a predetermined reference value. As used herein, “reference value” refers to a threshold or cutoff value. The reference value may be determined experimentally, empirically, or theoretically. Preferably, the reference value is derived from the AhR activation level determined in one or more fecal samples from one or more healthy subjects who do not suffer from metabolic syndrome, related disorders, and / or IBD, among other things. Preferably, the subject having reduced AhR activity exhibits AhR activity at least 10% lower than the predetermined reference value, more preferably at least 20%, 30%, or 50% lower than the predetermined reference value.

[0076] The dosage of Coprococcus cells and / or culture extracts may be appropriately adjusted according to criteria such as age, symptoms, body weight, and the intended application, including obtaining a therapeutically effective dose. As used herein, the term “therapeutically effective dose” means the amount necessary to have a beneficial effect on the disease being treated, i.e., to prevent, eliminate or reduce at least one adverse effect of the disease.

[0077] In embodiments where the disease being treated is metabolic syndrome or a related disorder, the therapeutically effective amount is preferably defined as the amount necessary to have an effect on (i.e., prevent, eliminate, or reduce) one of the five medical conditions that define metabolic syndrome: - Abdominal (central) obesity (TOF1), - Increased blood pressure, - Increased fasting plasma glucose, - elevated serum triglycerides, and - low high-density lipoprotein (HDL) levels.

[0078] Additionally or alternatively, a therapeutically effective amount may be defined as the amount necessary to exert an effect on insulin sensitivity, glucose tolerance, weight gain and / or intestinal inflammation caused by HFD. In a preferred embodiment, a therapeutically effective amount exerts an effect on several of these conditions.

[0079] In multiple embodiments, the disease to be treated is IBD, and a therapeutically effective amount is preferably defined as the amount necessary to exert an effect on intestinal inflammation or any symptom of the disease such as diarrhea, fever or pain.

[0080] In some embodiments, the composition of the present invention contains 10 per mg of the composition 3 to 10 11 live Coprococcus bacterial cells, preferably Coprococcus comes cells, more preferably bacterial cells of DSM33359 or a variant thereof, and / or 0.001 mg to 1000 mg of dried or lyophilized culture supernatant per gram of the composition.

[0081] In particular, the amount of Coprococcus, preferably Coprococcus comes, more preferably DSM33359 or a variant thereof, ingested per day is 0.01×10 11 to 100×10 11 cells per body, preferably 0.1×10 11 to 10×10 11 cells per body, more preferably 0.3×10 11 to 5×10 11 cells per body.

[0082] The content of Coprocococcus bacteria, preferably Coprocococcus comes, more preferably DSM33359 or its variants, contained in the orally ingested composition of the present invention may be, for example, 1% to 100% (w / w, i.e., dry mass of bacteria / total dry mass of composition), preferably 1% to 75% (w / w), and more preferably 5% to 50% (w / w).

[0083] The composition of the present invention can be administered as a single dose or multiple doses.

[0084] In some embodiments, the composition may be administered regularly, preferably daily to monthly, more preferably daily to every two weeks, or more preferably daily to weekly. In some specific embodiments, the composition may be administered daily.

[0085] The treatment period with the composition of the present invention may range from one day to several years, preferably from one day to one year, and more preferably from one day to six months.

[0086] The present invention also relates to (i) a method for selecting a subject suffering from a disease selected from metabolic syndrome and related disorders and inflammatory bowel disease for treatment with a composition of the present invention, or (ii) a method for determining whether a subject suffering from a disease selected from metabolic syndrome and related disorders and inflammatory bowel disease is likely to benefit from treatment with a composition of the present invention, wherein reduced AhR activity in the subject, particularly in a fecal sample from the subject, indicates suitability for treatment with a composition of the present invention. More specifically, the method comprises i) determining the AhR agonist activity of the microbiome in a fecal sample obtained from the subject; ii) comparing the level determined in step i) with a predetermined reference value; and iii) selecting the subject as suitable for treatment if the level determined in step i) is lower than the predetermined reference value. The predetermined reference value is preferably a reference value derived from the AhR activation level determined in one or more fecal samples from one or more healthy subjects, particularly those not suffering from metabolic syndrome, related disorders and / or IBD.

[0087] The AhR activation level of the microbiome in fecal samples obtained from subjects can be determined by any of the above methods. In addition or alternatively, the AhR activation level of the microbiome in fecal samples obtained from subjects can be determined by measuring tryptophan metabolism, i.e., by measuring the concentrations of tryptophan (Trp), kynurenine (Kyn), and indole-3-acetic acid (IAA) (or other tryptophan metabolites), and optionally by calculating the Kyn / Trp, IAA / Trp, and Kyn / IAA concentration ratios. In addition or alternatively, the AhR activation level can also be determined by analyzing the expression of AhR target genes (e.g., interleukins IL-22 and IL-17) using colon samples obtained from subjects. + and IL-22 + This can be determined by measuring the number of cells, measuring the heterodimerization of AhR and chaperone proteins, measuring AhR nuclear translocation, or measuring AhR bound to its dimerization partner (AhR nuclear transporter (ARNT)).

[0088] Preferably, if the level determined in step i) is at least 10% lower than a predetermined reference value, more preferably at least 20%, 30%, or 50% lower than a predetermined reference value, the subject is selected for treatment with the composition of the present invention.

[0089] In another aspect, the present invention also relates to the Coprococcus comes strain or its variants deposited with the German Collection of Microorganisms and Cell Cultures (DSMZ) under accession number DSM33359. The present invention also relates to the Coprococcus comes strain or its variants deposited with the German Collection of Microorganisms and Cell Cultures (DSMZ) under accession number DSM33359 for use in the treatment of diseases selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease. The present invention also relates to the use of the Coprococcus comes strain or its variants deposited with the German Collection of Microorganisms and Cell Cultures (DSMZ) under accession number DSM33359 for the manufacture of pharmaceuticals for the treatment of diseases selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease. The present invention further relates to a method for treating a disease selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease in a subject, comprising the step of administering the Coprocococcus comes strain or a variant thereof, deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession number DSM33359.

[0090] All references cited in this specification are incorporated herein by reference. Other features and advantages of the present invention will become apparent in the following examples, which are given for illustrative purposes only and not for limiting purposes. [Examples]

[0091] method mouse Male and female C57BL / 6JRj mice were purchased from Janvier (France). C57BL / 6JRj background AhR - / -Mice were obtained from Jackson Laboratory (JAX stock number 002831) (Fernandez-Salguero et al., Science. 1995, 268, pp. 722-726) and reared at the Saint-Antoine Research Center. Il22 - / - Mice (Kreymborg et al., J. Immunol. 2007, 179, pp. 8098-8104) were obtained and reared at the Transgenose Institute (TAMM-CNRS, Orleans, France). All mice were housed in an IERP facility (INRA, Jouy-en-Josas, France) authorized by the French "Direction Departementale de la Protection des Populations (DDPP78)". All experiments were conducted according to the Comite d'Ethique en Experimentation Animale (COMETHEA C2EA-45, Jouy-en-Josas, France).

[0092] Bacterial strains and growth conditions Coprocococcus comes was grown at 37°C in an anaerobic chamber (0 ppm O2; 2% H2) on LYHBHI medium (Brainheart Infusion medium supplemented with 0.5% yeast extract (Difco) and 1% hemin (Sigma-Aldrich)) supplemented with cellobiose (1 mg / ml; Sigma-Aldrich), maltose (1 mg / ml; Sigma-Aldrich), cysteine ​​(0.5 mg / ml; Sigma-Aldrich), vitamin K1 (0.0002%; Sigma-Aldrich), and vitamin K3 (0.0002%; Sigma-Aldrich). Bacteria under various conditions were used in both DSS treatment and metabolic syndrome models: bacteria only, bacteria supplemented with supernatant, and bacteria with supernatant or dead bacteria. After 24 hours of incubation, Coprocococcus comes cultures were centrifuged at 6,000 g for 10 minutes at 4°C. The supernatant was collected and supplemented with 16% glycerol for good storage at -80°C. The pellet was resuspended in complete LYHBHI medium supplemented with 16% glycerol, or similarly supplemented with supernatant supplemented with 16% glycerol. Dead bacteria were obtained after boiling at 100°C for 30 minutes, followed by centrifugation (6,000 g, 10 minutes, 4°C), and the pellet was resuspended in complete LYHBHI medium supplemented with 16% glycerol. Mice were given 10 doses daily. 9 CFUs of Coprocococcus comes or vehicle (complete LYHBHI medium supplemented with 16% glycerol) were inoculated throughout the protocol.

[0093] AhR / luciferase reporter assay The H1L1.1c2 cell line was used as described above (Lamas et al., 2016, Nat Med. Jun;22(6):598-605). The supernatant of a 24-hour bacterial culture of a control (2, 10, or 20% LYHBHI) was incubated with the H1L1.1c2 cell line for 24 hours. AhR activity was calculated by subtracting the luminescence of the control (2, 10, or 20% LYHBHI) from the luminescence obtained using the sample and multiplying by the cytotoxicity value (LDH amount).

[0094] DSS Model Seven-week-old C57BL / 6JRj mice from Janvier Lab were housed in the inventors' pathogen-free animal facility at IERP (INRA, Jouy-en-Josas, France). Five to ten female mice were used per group in all experiments, maintained in a temperature-controlled (23°C) facility with a strict 12-hour light / dark cycle, and given free access to food and water. After one week of acclimatization, the inventors replaced the water with 2% DSS (MP Biomedical) for seven days (days 0-7), followed by a recovery period of five days until day 12. Weight loss and DAI (Disease Activity Index) were performed daily. Samples were taken after 12 days.

[0095] [Table 1]

[0096] Histological examination of the colon The distal colon (cut into three sections) was collected 12 days after the DSS model, directly infused in PFA (Rothi®-Histofix 4%) for 48 hours, transferred to a standard pre-fixation automated device in 70% ethanol, and then paraffin-embedded. HES staining was performed on 5 μm sections. Scoring was performed on the worst section and scored as previously described (Sokol et al., Gastroenterology. 2013 Sep;145(3):591~601.e3).

[0097] MLN stimulation MLN (mesenterinary lymph node) cells were collected and pulverized using a 40 μM cell strainer. The cells were resuspended in complete RPMI (10% SVF, Pen / Strep) and counted using an Accuri cytometer (BD). Two million cells were placed in a 24-well plate and stimulated with PMA (50 ng / ml, Sigma) and ionomycin (750 ng / ml, Sigma) for 48 hours at 37°C. The supernatant was collected and ELISA (Mabtech) was performed for IL-17A, IL-10, IFN-γ, and IL-22 according to the manufacturer's instructions.

[0098] Real-time PCR Samples were extracted using the Rneasy Mini kit (Qiagen). Total RNA (1 μg) was reverse transcribed using the LunaScript® Reverse Transcription SuperMix Kit (Biolabs). The mRNA levels of the target gene were quantitatively examined by RT-PCR using either the Luna® Universal qPCR Master Mix (Biolabs) or the Universal Probe qPCR Master Mix (Biolabs) according to the manufacturer's protocol. The primers and probes used were obtained from Qiagen or Thermofisher: Cyp1a1 (TaqMan, Thermofisher, Mm00487218_m1), IL-22 (TaqMan, Thermofisher, Mm01226722_g1), Reg3γ (TTCCTGTCCTCCATGATCAAAA (SEQ ID NO: 1) / CATCCACCTCTGTTGGGTTCA (SEQ ID NO: 2)), Reg3β (ATGCTGCTCTCCTGCCTGATG (SEQ ID NO: 3) / CTAATGCGTGCGGAGGGTATATTC (SEQ ID NO: 4)), and AhRR (GGAGTCTCTCAATGGCTTCG (SEQ ID NO: 5) / CCGAGTACTCTGAGGGCAAG (SEQ ID NO: 6)). The relative levels of mRNA expression were normalized to HPRT1 (QT00166768) mRNA levels using the comparative method (2-ΔΔCt). Non-reverse-transcribed RNA samples and water were included as negative controls.

[0099] Metabolic syndrome Five-week-old C57BL / 6JRj mice from Janvier Lab were housed in the inventors' pathogen-free animal facility at IERP (INRA, Jouy en Josas, France). Six to eight male mice were used per group in all experiments and maintained in a temperature-controlled (23°C) facility with a strict 12-hour light / dark cycle, with free access to food and water. Five-week-old male C57BL / 6JRj mice were freely fed either a purified control diet (Conv, Envigo MD.120508) or a high-fat diet (38% kcal fat, mainly milk fat, Envigo MD.97222) for 12 weeks. The animals' body weight was measured weekly, and weekly food consumption was measured in each cage. All animals were fasted overnight before slaughter, then euthanized by cervical dislocation, and suitable tissue samples were collected.

[0100] Oral glucose tolerance test OGTTs were performed 3–7 days before slaughter. Mice were fasted overnight before the experiment by removing food and bedding. After 15–16 hours of fasting, glucose solution (2 g / kg per mouse) was administered via oral enteral nutrition. Blood glucose levels were analyzed using a OneTouch blood glucose meter (Roche) at time 0 (fasting glucose, measured before enteral glucose nutrition) and at 15, 30, 60, and 120 minutes after enteral glucose nutrition. Glucose levels were plotted against time, and the AUC was calculated using the trapezoidal rule.

[0101] Intraperitoneal insulin resistance test ITT was performed 3–7 days before slaughter. Four hours before the start of the experiment, mice were fasted by removing food and bedding. After four hours of fasting, insulin solution (0.5 U / kg) was administered intraperitoneally. Using a OneTouch blood glucose meter (Roche), blood glucose levels were analyzed at time 0 (fasting glucose, measured before enteral glucose feeding) and at 15, 30, 60, and 120 minutes after insulin loading. Glucose levels were plotted against time, and the AUC was calculated according to the trapezoidal rule.

[0102] Measurement of plasma parameters Blood samples were collected in heparin-coated tubes via cardiac puncture and centrifuged. Plasma samples were then stored at -80°C until further analysis. Plasma cholesterol and high-density lipoprotein (HDL) levels were measured using a Biochemistry Platform (CRI, UMR1149, Paris) equipped with an Olympus AU400 Chemistry Analyzer.

[0103] Liver histological examination and liver triglyceride measurement Slices of the left lobe of the liver were fixed with 4% PFA for 48 hours, then transferred to ethanol, fixed in paraffin, trimmed, processed, and cut into slices approximately 5 μm thick, placed on glass slides, and stained with HES. Liver lipids were blinded and quantified using ImageJ software as previously described (Crane et al., 2015, Nat Med 21, pp. 166-172; Schneider et al., 2012, Nat Methods 9, pp. 671-675).

[0104] statistical analysis Data were analyzed using Prism version 7 (Graphpad Software, San Diego, USA). Non-parametric Mann-Whitney tests or parametric one-way ANOVA were performed along with Bonferroni's multiple comparison test. Values ​​are expressed as mean ± SEM. Statistical significance was defined as p-values ​​of ****<0.0001, ***<0.001, **<0.01, and *<0.05.

[0105] result Coprococcus comes supernatant is associated with high AhR activity. The inventors assayed the ability of several bacterial strains to produce AhR agonists. By testing the supernatants of various bacteria with the AhR reporter cell line H1L1.1c2, the inventors found that Coprococcus comes supernatant was associated with high AhR activity (data not shown).

[0106] C. comes supernatant protects against DSS-induced colitis. DSS-induced colitis mice were orally treated with C. comes (bacteria + supernatant, supernatant, or dead bacteria). After 12 days of DSS-induced colitis, weight loss, disease activity index (DAI), colon length, and histological score were assessed (Figure 1). Administration of C. comes and / or its supernatant was found to protect against DSS-induced colitis. In particular, C. comes supernatant was shown to induce a significant reduction in the production of the inflammatory cytokine IL-17 after MLN cell stimulation.

[0107] Protective action against C. comes for DSS-induced colitis is AhR-dependent. The inventors demonstrated that C. comes supernatant can activate AhR in vitro in H1L1.1c2 cells (Figure 2A). This result was confirmed in vivo using WT mice fed enteral nutrition with C. comes supernatant for 3 weeks. AhR activation was determined by measuring the expression of Cyp1a P450 cytochrome and AhR inhibitor (AhRR) in the colon and liver by qPCR. The increased expression levels of these in the colon of mice treated with C. comes supernatant indicate that the supernatant can activate AhR in vivo (Figure 2B).

[0108] To confirm that protection is due to AhR activation, weight loss, DAI, colon length, and histological scores were measured in AhR- / - mice with and without enteral nutrition of C. comes supernatant after DSS-induced colitis (Figures 2C-2G). No differences were observed between the group treated with negative controls and the group treated with C. comes supernatant. Therefore, the AhR-dependent mechanism of C. comes was confirmed by its lack of efficacy in protecting AhR- / - mice from DSS-induced colitis.

[0109] C. comes protection is accompanied by IL-22 secretion. After 3 weeks of enteral feeding with C. comes supernatant, the expression levels of Reg3γ, Reg3β, and IL-22 were measured in the colon of wild-type mice. A significant increase in the expression of IL-22 and two genes involved in the IL-22 pathway, Reg3γ and Reg3β, was observed after administration of C. comes supernatant (Figure 3A).

[0110] To confirm that protection requires the IL-22 pathway, weight loss, DAI, colon length, and histological scores were monitored for 9 days after DSS-induced colitis. - / - The results were determined in mice (Figures 3B-3F). No difference was observed between the group treated with the negative control and the group treated with C. comes supernatant. IL22 - / - This lack of effectiveness in protecting mice from DSS-induced colitis supports the idea that C. comes protection is mediated through IL-22 secretion.

[0111] Treatment with Coprococcus comes alleviates diet-induced metabolic disorders. A diet-induced mouse model of metabolic syndrome (HFD-supplied mice) was orally treated with C. comes (bacteria + supernatant, supernatant, or dead bacteria) for 12 weeks.

[0112] Coprococcus comes supplementation was found to reduce weight gain independently of food intake (Figures 4A-4B). HFD-supplied mice supplemented with Coprococcus comes also showed good glucose clearance during oral glucose tolerance tests (OGTT) (Figures 4C-4D) and insulin sensitivity during insulin resistance tests (ITT) (Figures 4E-4F). Coprococcus comes supplementation also reduced characteristics of hepatic steatohepatia, such as lower hepatic lipids (Figure 5) and lower serum concentrations of cholesterol and HDL (Figure 6).

[0113] C. comes protection for metabolic syndrome is AhR-dependent. Supplementation with Coprococcus comes in AhR- / - mice was shown to be insufficient to alleviate diet-induced metabolic disorders. In fact, in AhR- / - mice, Coprococcus comes supplementation had no effect whatsoever on weight gain, glucose and insulin resistance (Figure 7), or the characteristics of hepatic steatohepatia (Figure 8). This lack of efficacy in treating metabolic syndrome in HFD-supplied AhR- / - mice demonstrates an AhR-dependent mechanism of C. comes.

[0114] [Table 2]

Claims

1. A composition for use in the treatment of diseases selected from the group consisting of metabolic syndrome and related disorders and inflammatory bowel disease, comprising Coprococcus comes bacterium exhibiting AhR agonist activity and / or a culture extract thereof, wherein the bacterium is the Coprococcus comes strain deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession number DSM33359.

2. The composition according to claim 1, wherein the Coprocococcus comes bacterium is a living Coprocococcus comes bacterium.

3. The composition according to claim 1 or 2, wherein the culture extract is the culture supernatant.

4. The composition according to claim 3, comprising the culture supernatant of Coprocococcus comes.

5. The composition according to claim 3 or 4, comprising live Coprocococcus comes and its culture supernatant.

6. The composition according to any one of claims 1 to 5, further comprising one or more additional bacterial probiotics selected from the group consisting of bacteria belonging to the genera Allobaculum, Adrekrautia, Anaerostipes, Bifidobacterium, Propionibacterium, Bacteroides, Eubacterium, Enterococcus, Ruminococcus, and Faecalibacterium, Escherichia coli, and Lactobacillus, which can produce AhR agonists.

7. The composition according to claim 6, wherein the one or more additional bacterial probiotics are selected from the group consisting of bacteria belonging to the genera Alobaculum, Adrekrautia, Propionibacterium, Enterococcus, Escherichia coli, Lactobacillus, and Streptococcus.

8. The composition according to any one of claims 1 to 5, which contains no additional bacteria.

9. The composition according to any one of claims 1 to 8, which can be administered orally or via the rectal route.

10. The composition according to any one of claims 1 to 9, wherein the disease is selected from metabolic syndrome or related disorders.

11. The composition according to any one of claims 1 to 10, wherein the disease is selected from metabolic syndrome or related disorders, and the disorder is selected from the group consisting of cardiovascular disease, insulin resistance, impaired glucose tolerance, non-alcoholic fatty liver disease and steatosis.

12. The composition according to any one of claims 1 to 10, wherein the disease is metabolic syndrome.

13. The composition according to any one of claims 1 to 10, wherein the disorder is a disorder related to metabolic syndrome, and the disorder is selected from the group consisting of cardiovascular disease, insulin resistance, impaired glucose tolerance, type 2 diabetes, non-alcoholic fatty liver disease, and steatosis.

14. The composition according to any one of claims 1 to 10, wherein the disorder is a disorder related to metabolic syndrome, and the disorder is selected from the group consisting of cardiovascular disease, insulin resistance, impaired glucose tolerance, non-alcoholic fatty liver disease, and steatosis.

15. The composition according to any one of claims 11, 13, and 14, wherein the cardiovascular disease is coronary heart disease, heart attack, or stroke.

16. The composition according to any one of claims 1 to 10, wherein the disease is inflammatory bowel disease.

17. The composition according to claim 16, wherein the inflammatory bowel disease is selected from the group consisting of Crohn's disease, ulcerative colitis, unclassifiable colitis (IC), other non-infectious gastroenteritis, enteritis, enterocolitis and colitis, and pouchitis.

18. The composition according to claim 16, wherein the disease is an inflammatory bowel disease selected from Crohn's disease and ulcerative colitis.

19. The composition according to any one of claims 1 to 18, wherein the disease is not antibiotic-associated colitis.

20. The composition according to claim 19, wherein the disease is not Clostridium difficile-associated diarrhea.

21. Coprococcus comes strain deposited with the German Collection of Microorganisms and Cell Cultures (DSMZ) under accession number DSM33359.

Citation Information

Patent Citations

  • Network-based microbial compositions and methods

    JP2016519664A

  • Compositions and methods for treating inflammatory bowel disease (IBD) and other disorders

    JP2019520340A

  • Sensitive bioassay for detecting agonists of the aryl hydrocarbon receptor

    US6432692B1

  • Use of aryl hydrocarbon receptor ligand as a therapeutic intervention in angiogenesis-implicated disorders

    US7419992B2

  • Composition for topical use

    WO2009093207A1