Novel Transfer Activator

JP7914935B2Active Publication Date: 2026-09-03MODALIS THERAPEUTICS CORP
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
JP2021506361
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2018-08-07
Filing Date
2019-08-06
Publication Date
2026-09-03
Estimated Expiration
2039-08-06

AI Technical Summary

Benefits of technology

【0010】 本発明によれば、AAVベクターに搭載可能なサイズを有し、かつ転写活性化能を十分に発揮できる新規な転写アクチベーターが提供される。さらに、二本鎖DNA中の標的ヌクレオチド配列と特異的に結合する核酸配列認識モジュールと、前記転写アクチベーターとの複合体、並びに該複合体を用いることによる、標的化された遺伝子の転写を活性化する方法が提供される。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007914935000019
    Figure 0007914935000019
  • Figure 0007914935000020
    Figure 0007914935000020
  • Figure 0007914935000021
    Figure 0007914935000021
Patent Text Reader

Abstract

The present invention provides a transcriptional activator consisting of an amino acid sequence of 200 or less and containing the transcriptional activation sites of VP64 and RTA. A complex of a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in double-stranded DNA and a transcription activator is provided. [Selected Figure] Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a novel transcriptional activator comprising VP64 and a transcription activation domain of R transactivator (RTA). The present invention further relates to a complex of said transcriptional activator and a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in double-stranded DNA. [Background Art]

[0002] In recent years, genome editing has attracted attention as a technique for modifying target genes and genomic regions in various species. For example, by using a zinc finger nuclease (ZFN) in which a zinc finger DNA-binding domain is linked to a non-specific DNA cleavage domain, a method for performing recombination at a targeted locus in DNA in plant cells or insect cells as a host (Patent Document 1), and a method for cleaving or modifying a target gene at a site within or adjacent to a specific nucleotide sequence by using TALEN in which a transcription activator-like (TAL) effector, which is a DNA-binding module possessed by the phytopathogenic bacterium Xanthomonas, is linked to a DNA endonuclease (Patent Document 2) have been reported. Furthermore, Cas9 nuclease derived from Streptococcus pyogenes is widely used as a powerful genome editing tool in eukaryotes having a repair pathway for double-strand DNA breaks (DSBs) (e.g., Patent Document 3, Non-Patent Documents 1 and 2).

[0003] By applying genome editing technology, techniques for site-specific transcriptional regulation have also been developed. For example, methods for activating or repressing a targeted gene have been reported, which comprise binding a protein or complex obtained by fusing a transcriptional activation domain or a transcriptional repression domain (generally, VP64 is used for activation and KRAB is used for repression) to ZF or TALE, or a Cas9 system lacking the ability to cleave both strands of double-stranded DNA (dCas9), to the promoter or enhancer sequence of the target gene (e.g., Non-Patent Document 3).

[0004] However, transcriptional activation using VP64 has the problem that sufficient transcriptional activation cannot be achieved by simply using a single VP64 molecule, and it is necessary to bind multiple TALE-VP64 and dCas9-VP64 / sgRNA complexes to a single gene (e.g., Non-Patent Document 3). To overcome this, a method has been reported in which a transcriptional activator is obtained by binding other transcriptional activators (p65 and RTA) to VP64 (e.g., Non-Patent Document 4). [Prior art documents] [Patent Documents]

[0005] [Patent Document 1] WO03 / 087341A2 [Patent Document 2] WO2011 / 072246A2 [Patent Document 3] WO2013 / 176772A1 [Non-patent literature]

[0006] [Non-Patent Document 1] Mali P, et al., Science 339: 823-827 (2013) [Non-Patent Document 2] Cong L, et al., Science 339: 819-823 (2013) [Non-Patent Document 3] Hu J, et al., Nucleic Acids Res, 42: 4375-4390 (2014) [Non-Patent Document 4] Chavez A, et al., Nat Methods, 12: 326-328 (2015) [Overview of the Initiative] [Problems that the invention aims to solve]

[0007] However, when p65 and RTA are bound to VP64, the total molecular weight increases. Therefore, nucleic acids encoding a complex of the CRISPR / Cas9 system and a transcription activator have size constraints, and there is a problem that they cannot be loaded into an adeno-associated virus (AAV) vector as an all-in-one nucleic acid. Thus, one of the challenges regarding AAV-mediated delivery is to provide a transcription activator that is sized to be loaded into an AAV vector and can fully exhibit transcriptional activation ability. [Means for solving the problem]

[0008] The inventors focused on several proteins known to possess transcriptional activation ability and conceived the idea that an activator capable of solving the above problem could be created by appropriately combining such proteins. Based on this idea, they diligently conducted research and found that by combining VP64 and RTA, it is possible to achieve both a reduction in protein size and the maintenance of sufficient transcriptional activation ability. Based on this finding, further research led to the completion of the present invention.

[0009] Therefore, the present invention provides the following: [1] A transcription activator consisting of 200 or fewer amino acids, containing VP64 and the transcriptional activation site of RTA. [2] The VP64 is (1) The amino acid sequence shown in Sequence ID No. 1, (2) In the amino acid sequence of (1), one or more amino acids are deleted, substituted and / or added, or (3) An amino acid sequence that is 90% or more identical to the amino acid sequence of (1), A transcription activator as described in [1], including the following: [3] The transcriptional activation site of the RTA is (4) The sequence shown in sequence number 2, (5) Sequence shown in sequence number 3, (6)(4) or (5) amino acid sequences in which one or more amino acids are deleted, substituted and / or added, (7) An amino acid sequence that is 90% or more identical to the amino acid sequence of (4) or (5), A transcription activator as described in [1] or [2], including the following: [4] A complex comprising a nucleic acid sequence recognition module that is bound to each other and specifically binds to a target nucleotide sequence in double-stranded DNA, and a transcription activator according to any one of [1] to [3], for activating the transcription of a targeted gene in the DNA. [5] The complex according to [4], wherein the nucleic acid sequence recognition module comprises a CRISPR effector protein that lacks the ability to cleave at least one strand of double-stranded DNA. [6] The complex according to [5], wherein the CRISPR effector protein lacks the ability to cleave both strands of double-stranded DNA. [7] The complex according to [5] or [6], wherein the CRISPR effector protein is derived from Staphylococcus aureus or Campylobacter jejuni. A nucleic acid encoding a transcription activator as described in any of [8][1]~[3]. A nucleic acid encoding one of the complexes described in [9], [4], or [7]. A vector containing the nucleic acid described in

[10] [8] or [9].

[11] The vector according to

[10] , wherein the vector is an adeno-associated virus vector.

[12] A method for activating the transcription of a targeted gene in a cell, comprising the step of introducing a complex according to any one of [4] to [7], a nucleic acid according to [8] or [9], or a vector according to

[10] or

[11] into the cell.

[13] The method according to

[12] , wherein the cells are mammalian animal cells.

[14] The method according to

[13] , wherein the mammal is a human. [Effects of the Invention]

[0010] According to the present invention, there is provided a novel transcriptional activator that has a size allowable for insertion into an AAV vector and can sufficiently exert transcriptional activation activity. Further provided are a complex of a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in double-stranded DNA and the aforementioned transcriptional activator, and a method for activating transcription of a target gene by using the complex. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] [Figure 1] Figure 1 shows the structure of an AAV vector and 10 activation domains when dSaCas9 is used as a CRISPR effector protein. The number of bases in the figure is indicated by the length including the stop codon. [Figure 2] Figure 2 shows MYD88 gene activation by 9 activation domains. For each gRNA, each bar graph shows, from left to right in this order, the results for sgRNA alone, VP64, VP160, VM (VP64-MyoD), VH (VP64-HSF1), V32p65 (VP32-p65), VR (VP64-miniRTA), V64P65 (VP64-p65), VPH and VPR. [Table 1] [Figure 3] Figure 3 shows FGF21 gene activation by 9 activation domains. For each gRNA, each bar graph shows, from left to right in this order, the results for sgRNA alone, VP64, VP160, VM (VP64-MyoD), VH (VP64-HSF1), V32p65 (VP32-p65), VR (VP64-miniRTA), V64P65 (VP64-p65), VPH and VPR. [Table 2] [Figure 4]Figure 4 shows the GCG gene activation by nine activation regions. For each gRNA, the bar graphs, from left to right, show the results for sgRNA only, VP64, VP160, VM (VP64-MyoD), VH (VP64-HSF1), V32p65 (VP32-p65), VR (VP64-miniRTA), V64P65 (VP64-p65), VPH, and VPR. [Table 3] [Figure 5] Figure 5 shows MyD88 gene activation by VP64-miniRTA and VP64-microRTA. [Modes for carrying out the invention]

[0012] As used herein, the singular forms "a," "an," and "the" are intended to include both singular and plural forms unless the word is otherwise explicitly indicated by words such as "only," "single," and / or "one." As used herein, the terms "comprises," "comprising," "includes," and / or "including" identify the presence of a feature, process, operation, element, idea, and / or component being described, but do not in themselves exclude the presence or addition of one or more other features, processes, operations, elements, components, ideas, and / or groups thereof.

[0013] The present invention provides a novel transcription activator (hereinafter sometimes referred to as "the activator of the present invention") comprising VP64 and the transcriptional activation site of the Epstein-Barr virus R transactivator (RTA). The transcription activator of the present invention can activate the transcription of a targeted gene.

[0014] In the present invention, VP64 means a peptide consisting of four tandem repeats of a domain (DALDDFDLDML; SEQ ID NO: 21) consisting of amino acid residues 437-447 of VP16 derived from herpes simplex virus, accompanied by a peptide linker consisting of glycine and serine (GS), ([DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]; SEQ ID NO: 1) (Beerli RR, et al., Proc Natl Acad Sci USA. 95(25):14628-33 (1998)) or a variant thereof having transcriptional activity. Examples of such variants include amino acid sequences in which one or more (e.g., two, three, four, five or more) amino acids are deleted, substituted, and / or added to the amino acid sequence shown in SEQ ID NO: 1. Specific examples include, but are not limited to, modified versions in which the linker portion is substituted with other linkers (e.g., peptide linkers consisting of G, S, GG, SG, GGG, GSG, GSGS (SEQ ID NO: 22), GSSG (SEQ ID NO: 23), GGGGS (SEQ ID NO: 24), GGGAR (SEQ ID NO: 25), GSGSGS (SEQ ID NO: 26), or SGQGGGGSG (SEQ ID NO: 27)). Alternatively, the modified version may include a peptide having an amino acid sequence that is 90% or more (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) identical to the amino acid sequence shown in SEQ ID NO: 1. Furthermore, the peptide consisting of 10 tandem repeats of the above domain (DALDDFDLDML; SEQ ID NO: 21) ([DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]-GS-[DALDDFDLDML]; SEQ ID NO: 44) is referred to as VP160.

[0015] RTA is a protein consisting of 605 amino acid residues that possesses transcriptional activation ability (GenBank accession number: CEQ33017) (SEQ ID NO: 4), and its C-terminal domain is known to be important for transcriptional activation (Hardwick JM, J Virol, 66(9):5500-8, 1992). Specifically, the region consisting of amino acid sequences 493 to 605 of RTA (SEQ ID NO: 2) can be cited as the aforementioned domain. Among these, the region consisting of amino acid sequences 520 to 605 (SEQ ID NO: 3) is known to be particularly important. Therefore, it is preferable that the RTA contained in the activator of the present invention is a transcriptional activation site containing the amino acid sequence shown in SEQ ID NO: 2 or SEQ ID NO: 3, or a modified version thereof that possesses transcriptional activation ability. Examples of such modified versions include amino acid sequences in which one or several (e.g., two, three, four, five or more) amino acids are deleted, substituted, and / or added to the amino acid sequence shown in SEQ ID NO: 2 or 3. Specifically, since the leucine residues at positions 564, 566, 570, 578, 581 (phenylalanine), and 582 in RTA are known to be important for transcriptional activation, modified versions in which amino acid residues other than these are deleted or substituted can be mentioned, but are not limited to these modifications. Alternatively, as the aforementioned modified versions, peptides consisting of amino acid sequences that are 90% or more (for example, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) identical to the amino acid sequence shown in SEQ ID NO: 2 or 3 can be mentioned. In this specification, peptides consisting of the sequence shown in SEQ ID NO: 2 may be referred to as "miniRTA," and those consisting of the sequence shown in SEQ ID NO: 3 may be referred to as "microRTA."

[0016] The activator of the present invention comprises VP64 and the transcriptional activation site of RTA. VP64 and RTA may be bound via a linker (e.g., the peptide linker described above) or directly bound without a linker. The VP64 and the transcriptional activation site of RTA may be arranged in this order from the N-terminus to the C-terminus, or in the reverse order. Specific examples of the activator of the present invention include amino acid sequences represented by SEQ ID NO: 6 or 8, or amino acid sequences in which one or more (e.g., two, three, four, five or more) amino acids are deleted, substituted, and / or added to the amino acid sequence represented by SEQ ID NO: 6 or 8, and activators containing amino acid sequences that are 90% or more (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) identical to the amino acid sequence represented by SEQ ID NO: 6 or 8.

[0017] The identity of amino acid sequences can be calculated using the homology calculation algorithm NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) under the following conditions (expectancy=10; gap allowed; matrix=BLOSUM62; filtering=OFF). It is understood that, in order to determine identity, the entire sequence of the present invention is compared with another sequence. In other words, identity in the present invention excludes comparing short fragments (e.g., 1-3 amino acids) of the sequence of the present invention with another sequence, or vice versa.

[0018] The activator of the present invention is not particularly limited as long as it activates the transcription of the targeted gene. For miniaturization, it is preferable to consist of an amino acid sequence of 200 or fewer (e.g., 200, 190, 180, 170, 169, 168, 167 or fewer), and more preferably 110 or more (e.g., 110, 120, 130, 135, 136, 137, 138, 139, 140 or more). In a preferred embodiment, an activator consisting of about 140 or about 167 amino acids is used.

[0019] In another embodiment, a complex (which may be referred to as "the complex of the present invention") is provided, comprising a nucleic acid sequence recognition module and the activator of the present invention.

[0020] In the present invention, "nucleic acid sequence recognition module" means a molecule or molecular complex having the ability to specifically recognize and bind to a specific nucleotide sequence (i.e., a target nucleotide sequence) on a DNA strand. By binding the nucleic acid sequence recognition module to the target nucleotide sequence, the activator of the present invention linked to the module becomes capable of acting specifically on the targeted site of double-stranded DNA.

[0021] The complexes of the present invention include not only those composed of multiple molecules, but also those, such as fusion proteins, that have a nucleic acid sequence recognition module and the activator of the present invention in a single molecule.

[0022] The target nucleotide sequence in double-stranded DNA recognized by the nucleic acid sequence recognition module in the complex of the present invention is not particularly limited as long as the module can specifically bind to it, and may be any sequence in double-stranded DNA. The length of the target nucleotide sequence only needs to be sufficient for the specific binding of the nucleic acid sequence recognition module. For example, when targeting mammalian genomic DNA, the sequence is preferably 12 nucleotides or more (e.g., 12, 15, 18, 19, 20 or more) and 25 nucleotides or less (e.g., 25, 24, 23, 22 or less), depending on the genome size.

[0023] Examples of nucleic acid sequence recognition modules in the complex of the present invention include, but are not limited to, the CRISPR-GNDM system in which the CRISPR effector protein lacks the ability to cleave at least one strand (preferably both strands) of double-stranded DNA, the zinc finger motif, the TAL effector, the PPR motif, and fragments containing the DNA-binding domain of proteins that can specifically bind to DNA, such as restriction enzymes, transcription factors, and RNA polymerases. Preferred are the CRISPR-GNDM system, the zinc finger motif, the TAL effector, the PPR motif, and among these, the CRISPR-GNDM system in which the CRISPR effector protein lacks the ability to cleave both strands of double-stranded DNA is particularly preferred.

[0024] A zinc finger motif is composed of the linkage of 3 to 6 different Cys2His2 type zinc finger units (each finger recognizing approximately 3 bases) and can recognize target nucleotide sequences of 9 to 18 bases. Zinc finger motifs can be prepared by known methods such as modular assembly (Nat Biotechnol (2002) 20: 135-141), OPEN method (Mol Cell (2008) 31: 294-301), CoDA method (Nat Methods (2011) 8: 67-69), and E. coli one-hybrid method (Nat Biotechnol (2008) 26:695-701). For details on the preparation of zinc finger motifs, please refer to Patent Document 1 mentioned above.

[0025] TAL effectors have a modular repeating structure consisting of approximately 34 amino acids, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (referred to as RVD) of a single module. Since each module is highly independent, it is possible to create TAL effectors specific to target nucleotide sequences simply by linking modules together. Methods for creating TAL effectors using open resources (REAL method (Curr Protoc Mol Biol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), and Golden Gate method (Nucleic Acids Res (2011) 39: e82), etc.) have been established, allowing for the relatively simple design of TAL effectors for target nucleotide sequences. For details on the creation of TAL effectors, please refer to Patent Document 2 mentioned above.

[0026] Each PPR motif consists of 35 amino acids, and a sequence of PPR motifs that recognize a single nucleic acid base is configured to recognize a specific nucleotide sequence. Only the 1st, 4th, and ii(-2)th amino acids of each motif recognize the target base. There is no dependency on motif configuration, and there is no interference between motifs on either side. Therefore, similar to TAL effectors, it is possible to create PPR proteins specific to target nucleotide sequences simply by linking PPR motifs. For details on PPR motif construction, refer to WO2011 / 111829A1.

[0027] When using fragments of restriction enzymes, transcription factors, RNA polymerases, etc., the DNA-binding domains of these proteins are well known, so fragments containing these domains but lacking DNA double-strand cleavage ability can be easily designed and constructed.

[0028] Regarding zinc finger motifs, the efficiency of producing zinc fingers that specifically bind to target nucleotide sequences is not high, and the selection of zinc fingers with high binding specificity is complicated, making it difficult to produce many functional zinc finger motifs. TAL effectors and PPR motifs offer a higher degree of freedom in target nucleic acid sequence recognition compared to zinc finger motifs, but they require the design and construction of large proteins each time depending on the target nucleotide sequence, leaving efficiency issues. In contrast, the CRISPR-GNDM system recognizes the target double-stranded DNA sequence using a guide nucleotide complementary to the target nucleotide sequence, allowing for the targeting of any sequence simply by synthesizing an oligonucleotide that can specifically hybridize with the target nucleotide sequence. Therefore, in a more preferred embodiment of the present invention, the CRISPR-GNDM system is used as the nucleic acid sequence recognition module.

[0029] When using the CRISPR-GNDM system of the present invention, the transcription of a targeted gene can be sufficiently activated by recruiting a mutant CRISPR effector protein (hereinafter also simply referred to as "CRISPR effector protein") that lacks the ability to cleave at least one strand (preferably both strands) of double-stranded DNA. The transcriptional regulatory region of the targeted gene may be any region of the gene, as long as the transcription of the gene can be activated by recruiting the CRISPR effector protein and the activator of the present invention bound thereto. Examples of such regions include the promoter region and enhancer region, introns, and exons of the targeted gene.

[0030] In this specification, “CRISPR-GNDM system” means (a) a class 2 CRISPR effector protein (e.g., dCas9 or dCpf1), or a complex of the CRISPR effector protein and the transcription activator of the present invention, and (b) a system comprising a guide nucleotide (gN) complementary to the sequence of the transcriptional regulatory region of a target gene, which enables the recruitment of the CRISPR effector protein and the transcription regulator bound thereto to the transcriptional regulatory region of the target gene. Using the system, transcriptional activation of the gene is possible via the activator of the present invention bound to the CRISPR effector protein.

[0031] The "CRISPR effector protein" used in the present invention is not particularly limited as long as it forms a complex with gN, recognizes the target nucleotide sequence in the target gene and the protospacer adjacent motif (PAM) adjacent to it, and binds to it. Preferably, it is Cas9 or Cpf1 or a modified version thereof. Examples of Cas9 include Cas9 derived from Streptococcus pyogenes (SpCas9; PAM sequence NGG (N is A, G, T, or C; the same applies below)), Cas9 derived from Streptococcus thermophilus (StCas9; PAM sequence NNAGAAW), Cas9 derived from Neisseria meningitidis (NmCas9; PAM sequence NNNNGATT), Cas9 derived from Staphylococcus aureus (SaCas9; PAM sequence: NNGRRT), and Campylobacter jejuni. Examples of Cas9 derived from jejuni (CjCas9; PAM sequence: NNNVRYM (V is A, G, or C; R is A or G; Y is T or C; M is A or C)) include, but are not limited to, these. From a size standpoint, preferably, Cas9 is SaCas9 or CjCas9 or a variant thereof. Examples of Cpf1 include, but are not limited to, Cpf1 derived from Francisella novicida (FnCpf1; PAM sequence NTT), Cpf1 derived from Acidaminococcus sp. (AsCpf1; PAM sequence NTTT), and Cpf1 derived from Lachnospiraceae bacterium (LbCpf1; PAM sequence NTTT). In the present invention, the CRISPR effector protein used is a protein in which the ability of the CRISPR effector protein to cleave at least one strand (preferably both strands) of double-stranded DNA has been inactivated.For example, in the case of SpCas9, a variant can be used in which the 10th Asp residue is converted to an Ala residue, and / or the 840th His residue is converted to an Ala residue (a variant lacking the ability to cleave both strands of double-stranded DNA may be called "dSpCas9"). Alternatively, in the case of SaCas9, a variant can be used in which the 10th Asp residue is converted to an Ala residue, and / or the 556th Asp residue, the 557th His residue, and / or the 580th Asn residue are converted to Ala residues (a variant lacking the ability to cleave both strands of double-stranded DNA may be called "dSaCas9"). In the case of CjCas9, a variant can be used in which the 8th Asp residue is converted to an Ala residue, and / or the 559th His residue is converted to an Ala residue (a variant lacking the ability to cleave both strands of double-stranded DNA may be called "dCjCas9"). In the case of FnCpf1, a modified version can be used in which the 917th Asp residue is converted to an Ala residue, and / or the 1006th Glu residue is converted to an Ala residue. Furthermore, modified versions in which some of the amino acids of these proteins are modified may be used, as long as the ability to bind to the target nucleotide sequence is maintained. Examples of such modified versions include shortened versions in which some of the amino acid sequences are deleted. Specifically, an example of such a modified version is dSaCas9 in which amino acids 721 to 745 are deleted (the deleted portion may be replaced with the peptide linker mentioned above).

[0032] A second element of the CRISPR-GNDM system of the present invention is a guide nucleotide (gN) containing a nucleotide sequence (hereinafter also referred to as the "targeting sequence") complementary to the nucleotide sequence adjacent to the PAM of the targeted strand in the transcriptional regulatory region of the targeted gene. When the CRISPR effector protein is dCas9, the gN is provided as a chimeric nucleotide of truncated crRNA and tracrRNA (i.e., a single guide RNA (sgRNA)) or as a combination of separate crRNA and tracrRNA. The gN may be provided in the form of RNA, DNA, or a DNA / RNA chimera. Accordingly, where technically possible, the terms "sgRNA," "crRNA," and "tracrRNA" in the context of the present invention will also be used to include the corresponding DNA and DNA / RNA chimeras.

[0033] Here, the "target strand" refers to the strand that hybridizes with the crRNA of the target nucleotide sequence, while the opposite strand, which becomes a single strand through hybridization with the target strand and crRNA, is called the "non-targeted strand." When the target nucleotide sequence is represented by one strand (for example, when representing a PAM sequence, or when indicating the positional relationship between the target nucleotide sequence and PAM), it is represented by the sequence of the non-targeted strand.

[0034] The targeting sequence is not limited as long as it specifically hybridizes with the target chain in the transcriptional regulatory region of the targeted gene and can recruit the CRISPR effector protein and the activator of the present invention bound thereto to the transcriptional regulatory region. For example, when dSaCas9 is used as the CRISPR effector protein, the targeting sequences listed in Table 1 are examples. In Table 1, a targeting sequence consisting of 21 nucleotides is described, but the length of the targeting sequence is preferably 12 nucleotides or more (e.g., 12 nucleotides, 15 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides or more) and preferably 25 nucleotides or less (e.g., 25 nucleotides, 24 nucleotides, 23 nucleotides, 22 nucleotides or less). In a preferred embodiment, it is 21 nucleotides.

[0035] When using Cas9 as the CRISPR effector protein, the targeting sequence can be designed, for example, by using a publicly available guide nucleotide design website (CRISPR Design Tool, CRISPRdirect, etc.) to list 21-mer sequences containing PAMs adjacent to the 3' end of the target gene's CDS sequence (e.g., NNGRRT in the case of SaCas9). Candidate sequences with a small number of off-target sites in the host genome can be used as targeting sequences. If the guide nucleotide design software used does not have a function to search for off-target sites in the host genome, off-target sites can be searched by, for example, performing a Blast search on the host genome for the 8-12 nucleotides (seed sequences with high discriminative ability for target nucleotide sequences) on the 3' end of the candidate sequence. Even when using CRISPR effector proteins that recognize different PAMs, the targeting sequence can be designed and prepared in a similar manner. Unless otherwise specified, the targeting sequence is shown as a DNA sequence in this specification. When RNA is used as gN, "T" in each sequence should be read as "U".

[0036] [Table 4]

[0037] Any of the above nucleic acid sequence recognition modules can be provided as a fusion protein with the activator of the present invention, or a protein-binding domain such as an SH3 domain, PDZ domain, GK domain, GB domain, etc., and their binding partners may be fused to the nucleic acid sequence recognition module and the activator of the present invention, respectively, and provided as a protein complex through the interaction between the domain and its binding partner. Alternatively, an intein can be fused to the nucleic acid sequence recognition module and the activator of the present invention, respectively, and the two can be linked by ligation after protein synthesis.

[0038] The complex of the present invention, which includes a complex (including a fusion protein) formed by the binding of a nucleic acid sequence recognition module and the activator of the present invention, may be brought into contact with double-stranded DNA as an enzymatic reaction in a cell-free system. In line with the main objective of the present invention, it is desirable to introduce the nucleic acid encoding the complex into cells having the target double-stranded DNA (e.g., genomic DNA). Therefore, it is preferable to prepare the nucleic acid encoding the nucleic acid sequence recognition module and the activator of the present invention as nucleic acids encoding their fusion protein, or in a form that can form a complex in a host cell after being translated into a protein using a binding domain, intein, etc. Here, the nucleic acid may be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA and is provided in the form of an expression vector placed under the control of a functional promoter in a host cell. In the case of RNA, it is preferably single-stranded RNA.

[0039] The complex of the present invention, in which the nucleic acid sequence recognition module and the activator of the present invention are bound, does not involve double-strand DNA breaks (DSBs), and therefore, the method using the complex of the present invention can be applied to a wide range of biological materials. Accordingly, cells into which the nucleic acid encoding the nucleic acid sequence recognition module and / or the activator of the present invention is introduced can include cells of any species, from prokaryotes such as bacteria like Escherichia coli and lower eukaryotes such as yeast, to vertebrate cells including mammals such as humans, and higher eukaryotes such as insects and plants.

[0040] DNA encoding nucleic acid sequence recognition modules such as zinc finger motifs, TAL effectors, PPR motifs, and CRISPR-GNDM systems can be obtained by any of the methods described above for each module. DNA encoding sequence recognition modules such as restriction enzymes, transcription factors, and RNA polymerases can be cloned, for example, by synthesizing oligo DNA primers that cover the region encoding the desired part of the protein (the part containing the DNA binding domain) based on their cDNA sequence information, and then amplifying them by RT-PCR using total RNA or mRNA fractions prepared from cells producing the protein as a template.

[0041] Mutant CRISPR effector proteins can be obtained by introducing mutations into the DNA encoding a cloned CRISPR effector protein that convert amino acid residues at sites important for DNA cleavage activity (for example, in the case of SpCas9, the 10th Asp residue and the 840th His residue; in the case of SaCas9, the 10th Asp residue, the 556th Asp residue, the 557th His residue and the 580th Asn residue; in the case of CjCas9, the 8th ASP residue and the 559th His residue; in the case of FnCpf1, the 917th Asp residue and the 1006th Glu residue, etc., but not limited to these) into other amino acids.

[0042] The cloned DNA can be ligated with DNA encoding a nucleic acid sequence recognition module to prepare DNA encoding a fusion protein, either directly or optionally after digestion with restriction enzymes, or after the addition of a suitable linker (e.g., the peptide linker described above), a tag (e.g., HA tag, myc tag, MBP tag, FLAG tag, etc.), and / or a nuclear localization signal (or organelle localization signal if the target double-stranded DNA is mitochondrial or chloroplast DNA). Alternatively, the DNA encoding the nucleic acid sequence recognition module and the activator of the present invention may be translated in a host cell to form a complex by fusing DNA encoding a binding domain or its binding partner to the DNA encoding the nucleic acid sequence recognition module and the DNA encoding the activator of the present invention, respectively, or by fusing DNA encoding a separation intein to both DNAs. In these cases, a linker and / or a nuclear localization signal can be optionally ligated to an appropriate position on one or both DNAs. Furthermore, when the complex of the present invention is expressed as a fusion protein, the activator of the present invention may be fused to either the N-terminus or the C-terminus of the nucleic acid sequence recognition module or its components (for example, a CRISPR effector protein).

[0043] The DNA encoding the nucleic acid sequence recognition module and / or the activator of the present invention can be obtained by chemically synthesizing a DNA strand, or by constructing the full-length encoding DNA by connecting partially overlapping oligoDNA short chains using PCR or Gibson Assembly. The advantage of constructing full-length DNA by chemical synthesis or a combination of PCR or Gibson Assembly is that the codons used can be designed over the entire CDS length to suit the host into which the DNA is introduced. When expressing heterologous DNA, an increase in protein expression can be expected by converting the DNA sequence to codons that are frequently used in the host organism. Data on codon usage frequency in the host to be used can be obtained, for example, from the Genetic Code Usage Frequency Database (http: / / www.kazusa.or.jp / codon / index.html) published on the website of the Kazusa DNA Research Institute, or by referring to literature showing codon usage frequency in each host. By referring to the acquired data and the DNA sequence to be introduced, codons used in the DNA sequence that are infrequently used in the host can be converted to codons that encode the same amino acids but are more frequently used.

[0044] The RNA encoding the nucleic acid sequence recognition module and / or the activator of the present invention can be prepared, for example, by creating a vector containing the DNA encoding the module and / or the activator, and using this as a template to transcribe it into mRNA using a known in vitro transcription system. Alternatively, the RNA can be synthesized chemically.

[0045] An expression vector containing DNA encoding the activator or complex of the present invention can be prepared, for example, by ligating the DNA downstream of a promoter in a suitable expression vector.

[0046] Expression vectors include plasmids derived from E. coli (e.g., pBR322, pBR325, pUC12, pUC13); plasmids derived from Bacillus subtilis (e.g., pUB110, pTP5, pC194); plasmids derived from yeast (e.g., pSH19, pSH15); insect cell expression plasmids (e.g., pFast-Bac); animal cell expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); bacteriophages such as lambda phage; insect virus vectors such as baculoviruses (e.g., BmNPV, AcNPV); and animal virus vectors such as retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses (AAV). Considering its use in gene therapy, AAV vectors are preferred due to their ability to express the transgene over a long period and their safety as they are derived from non-pathogenic viruses.

[0047] While there are no particular restrictions on the AAV vector as long as sufficient titer and infection efficiency are ensured, it is preferably about 5kb or less (for example, about 5kb, about 4.95kb, about 4.90kb, about 4.85kb, about 4.80kb, about 4.75kb, about 4.70kb, or less). The amino acid length of the activator of the present invention is preferably 200 amino acids or less. Therefore, it is easy to design the total base length of the nucleic acid encoding the complex of the present invention and the nucleic acid encoding the guide nucleotide to be below this size limit. Consequently, the activator of the present invention has the advantage that it is not necessary to load the nucleic acid encoding the complex of the present invention and the nucleic acid encoding the guide nucleotide onto separate AAV vectors.

[0048] When using a viral vector as an expression vector, it is preferable to use a vector derived from a serotype suitable for infection of the target tissue or organ. For example, when targeting the central nervous system or retina, it is preferable to use a vector based on AAV1, 2, 3, 4, 5, 7, 8, 9, or 10; when targeting the heart, it is preferable to use a vector based on AAV1, 3, 4, 6, or 9; when targeting the lungs, it is preferable to use a vector based on AAV1, 5, 6, 9, or 10; when targeting the liver, it is preferable to use a vector based on AAV2, 3, 6, 7, 8, or 9; and when targeting skeletal muscle, it is preferable to use a vector based on AAV1, 2, 6, 7, 8, or 9. For cancer treatment, it is preferable to use AAV2. For AAV serotypes, you can refer to, for example, WO2005 / 033321A2.

[0049] The RNA encoding the nucleic acid sequence recognition module and / or the activator of the present invention can be introduced into host cells by microinjection, lipofection, or the like. RNA introduction can be performed once or multiple times at appropriate intervals (e.g., 2 to 5 times).

[0050] Furthermore, multiple DNA regions at completely different locations may be targeted. Accordingly, in one embodiment of the present invention, two or more nucleic acid sequence recognition modules can be used, each specifically binding to different target nucleotide sequences (which may be within one target gene, or within two or more different target genes, and which may be on the same chromosome or located on separate chromosomes). In this case, each of these nucleic acid sequence recognition modules forms a complex with the activator of the present invention. Here, the activator of the present invention can be a common one. For example, when using the CRISPR-GNDM system as the nucleic acid sequence recognition module, a common complex (including the fusion protein) of the CRISPR effector protein and the activator of the present invention can be used, and two or more types of chimeric RNAs can be prepared and used as gN, each of which forms a complementary strand with a different target nucleotide sequence, such as two or more crRNAs or two or more crRNAs paired with tracrRNA. On the other hand, when using zinc finger motifs or TAL effectors as the nucleic acid sequence recognition module, for example, the activator of the present invention can be fused to nucleic acid sequence recognition modules that specifically bind to different target nucleotides.

[0051] The DNA encoding gN can be chemically synthesized using a DNA / RNA synthesizer based on its sequence information. For example, the DNA encoding gRNA for SaCas9 has a targeting sequence complementary to the transcriptional regulatory region of the targeted gene, a deoxyribonucleotide sequence encoding crRNA containing at least a portion of the "repeat" region of the innate SacrRNA (e.g., GUUUUAGUACUCUG; SEQ ID NO: 31), and a deoxyribonucleotide sequence encoding tracrRNA having at least a portion of the "anti-repeat" region complementary to the repeat region of the crRNA (e.g., CAGAAUCUACUAAAAC; SEQ ID NO: 32), which is optionally linked via a tetraloop (e.g., GAAA), and the subsequent stem-loop 1 region, linker region, and stem-loop 2 region of the innate SatracrRNA (AAGGCAAAAUGCCGUGUUUAUCACGUCAACUUGUUGGCGAGAUUUUUUU; SEQ ID NO: 33). On the other hand, the DNA encoding the gRNA for dCpf1 has a deoxyribonucleotide sequence that encodes only a crRNA containing a targeting sequence complementary to the transcriptional regulatory region of the targeted gene and a preceding 5' handle (e.g., AAUUUCUACUCUUGUAGAU; sequence version 34). When using proteins other than SaCas9 and Cpf1 as CRISPR effector proteins, the tracrRNA for the protein to be used can be appropriately designed based on known sequences, etc. The DNA encoding the CRISPR effector protein, to which the DNA encoding the activator of the present invention is ligated, can be subcloned into an expression vector so that the DNA is under the control of a promoter that functions in the target host cell.

[0052] DNA encoding gN (e.g., crRNA or crRNA-tracrRNA chimera) can be introduced into host cells using the same method as described above, depending on the host.

[0053] Alternatively, RNA may be used instead of DNA to deliver the CRISPR effector molecule. In one embodiment, the CRISPR-GNDM system of the present invention, comprising (a) the complex of the present invention and (b) a gN containing a targeting sequence, can be introduced into a target cell or organism in the form of RNA encoding (a) and (b) above.

[0054] The RNA encoding the effector molecule described above can be produced, for example, via in vitro transcription, and the resulting mRNA may be purified for in vivo delivery. Briefly, a DNA fragment containing the CDS region of the effector molecule can be cloned downstream of an artificial promoter (e.g., T7, T3, or SP6 promoter) derived from a bacteriophage that drives in vitro transcription. The RNA can be transcribed from the promoter by adding components necessary for in vitro transcription, such as T7 polymerase, NTP, and IVT buffer. If necessary, the RNA may be modified to reduce immunostimulation and enhance translational and nuclease stability (e.g., 5mCAP (m7G(5')ppp(5')G capping, ARCA; anti-reverse cap analog (3'O-Me-M7G(5')ppp(5')G), 5-methylcytidine and pseudouridine modifications, 3' poly-A tail)).

[0055] Alternatively, CRISPR effector molecules and gN can be delivered using a complex of effector proteins and gN (hereinafter referred to as "nucleoproteins (NPs)") (e.g., deoxyribonucleoprotein (DNP), ribonucleoprotein (RNP)). Briefly, CRISPR effector proteins produced in vitro and gN transcribed in vitro or chemically synthesized are mixed in an appropriate ratio and then encapsulated in lipid nanoparticles (LNPs). The encapsulated LNPs can be delivered to affected animals or patients, allowing the NP complex to be directly delivered to target cells or organs.

[0056] CRISPR effector proteins can be expressed in bacteria and purified via affinity columns. Bacterial codon-optimized cDNA sequences of CRISPR effector proteins can be cloned into bacterial expression plasmids, such as the pE-SUMO vector from LifeSensors. The cDNA fragments can be tagged with small peptide sequences, such as HA, 6xHis, Myc, or FLAG peptides, at either the N-terminus or C-terminus. The plasmids can be introduced into protein-expressing bacterial strains, such as E. coli B834(DE3). After introduction, the proteins can be purified using affinity columns that bind to small peptide tag sequences, such as Ni-NTA columns or anti-FLAG affinity columns. The bound tag peptides can be removed by TEV protease treatment. The proteins can be further purified by chromatography on a HiLoad Superdex 200 16 / 60 column (GE Health-care).

[0057] Alternatively, CRISPR effector proteins can be expressed in mammalian cell lines such as CHO, COS, HEK293, and HeLa cells. For example, human codon-optimized cDNA sequences of CRISPR proteins can be cloned using mammalian expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo, pSRa); animal virus-derived vectors such as retroviruses, vaccinia viruses, adenoviruses, and adeno-associated viruses. The cDNA fragment can be tagged with a small peptide sequence such as HA, 6xHis, Myc, or FLAG peptide at either the N-terminus or C-terminus. The plasmid can be introduced into a protein-expressing mammalian cell line. Two to three days after transfection, the transfected cells can be collected, and the expressed CRISPR protein can be purified using affinity column binding to the small peptide tag sequence mentioned above.

[0058] The activator of the present invention can also be obtained by the same method as described above. [Examples]

[0059] The present invention will be better understood by referring to the following examples which provide exemplary, non-limiting embodiments of the present invention.

[0060] The inventors have designed and constructed a novel activating moiety that is comparable to or even better at transcriptional activation than existing activating moieties, while being small enough to fuse with dSaCas9 and meet the 5kb AAV vector size limit (Figure 1). Existing activating moieties include VP64 (50a.a.), VP160 (130a.a.), VPR (520a.a.), and P300 (617a.a.) (described in PMID: 27214048 / 25730490). Of these activating moieties, only VP64 and VP160 meet the AAV vector size limit when fused with dSaCas9.

[0061] Therefore, the inventors constructed and tested the following seven novel activating moieties fused with dSaCas9, and compared their trans-activating ability with that of three existing moieties (VP64, VP160, and VPR).

[0062] The amino acid and nucleotide sequences of the generated activated region 1. VP64-miniMYOD(154a.a.) consists of VP64 (italicized) linked by the GSGS linker (underlined) and 1-100a.a. (bold, PMID: 9710631) derived from human MYOD1;

[0063] [ka]

[0064] 2. VP64-miniHSF1 (154a.a.) consists of VP64 (italicized) linked by a GSSG linker (underlined) and 430-529a.a. (bold, PMID:7760831) derived from human HSF1;

[0065] [ka]

[0066] 3. VP32-miniP65 (160a.a.) consists of VP32 (italicized) linked by a GSGS linker (underlined) and 415-546a.a. (bold, PMID:1732726) derived from human P65;

[0067] [ka]

[0068] 4. VP64-miniRTA (167a.a.) consists of VP64 (italicized) linked by the GSGS linker (underlined) and 493-605a.a. (bold, RTA; PMID:1323708) derived from the Epstein-Barr virus replication and transcription activator;

[0069] [ka]

[0070] 5. VP64-miniP65 (186a.a.) consists of VP64 (italicized) and 415-546a.a. (bold, PMID:1732726) derived from human P65, linked by a GSGS linker (underlined);

[0071] [ka]

[0072] [ka]

[0073] 6. VPH(376a.a.) consists of VP64 (italic), 369-549a.a. (bold), derived from mouse P65, and 407-529a.a. (underlined, bold), derived from human HSF1, linked by NLS(PKKKRKV) (SEQ ID NO: 45) and / or SGQGGGGSG linker (underlined), PMID: 25494202);

[0074] [ka]

[0075] 7. VPR(510a.a.) consists of VP64 (italicized), 284-543a.a. (bold, PMID:5970) derived from human P65, and 416-605a.a. (underlined, bold, RTA;PMID:1323708) derived from the Epstein-Barr virus replication and transcription activator, linked by NLS(PKKKRKV) and / or GSGSGS linker (underlined).

[0076] [ka]

[0077] [ka]

[0078] 8. VP64-microRTA(140a.a.) consists of VP64 (italicized) linked by the GSGS linker (underlined) and 520-605a.a. (bold, RTA; PMID:1323708) derived from the Epstein-Barr virus replication and transcription activator;

[0079] [ka]

[0080] Plasmid cloning A novel activation region (AM) was synthesized by IDT and cloned into the NUC9-dSaCas9 vector. The fusion protein was expressed from the EFS promoter. sgRNA sequence used:

[0081] [ka]

[0082] Cell transfection HEK293FT cells were plated in 24-well plates at a density of 75,000 cells per well. Using Lipofectamine 2000 according to the manufacturer's instructions, 250 ng of the fusion protein expression plasmid NUC9-dsaCas9-AM was co-transfected with the sgRNA expression plasmid LvSG03. After 24 hours, the transfected cells were subjected to puromycin selection and collected the following day.

[0083] dSaCas9 nucleotide sequence;

[0084] [ka]

[0085] [ka]

[0086] tracrRNA sequence;

[0087] [ka]

[0088] RNA isolation and gene expression analysis For gene expression analysis, transfected cells were collected 48–72 hours after transfection, lysed in RLT buffer using the RNeasy kit (Qiagen), and total RNA was extracted. For Taqman analysis, 1 μg of total RNA was used to generate cDNA in a 10 μl volume using the TaqMan® High-Capacity RNA-to-cDNA Kit (Applied Biosystems). The generated cDNA was diluted 10-fold, and 3.33 μl was used per Taqman reaction (total volume of 10 μl per reaction). The Taqman reaction was performed using the Taqman gene expression master mix (ThermoFisher) in a Roche LightCycler 96 or LightCycler 480, and the analysis was performed using LightCycler 96 analysis software. Taqman probe product ID: MYD88;Hs01573837_g1(FAM) FGF21:Hs00173927_m1 GCG:Hs01031536_m1 HPRT:Hs99999909_m1(VIC PL) Taqman QPCR conditions: Step 1; 95℃ 10 minutes Step 2; 95℃ 15 seconds Step 3; 60℃ 30 seconds Repeat steps 2 and 3; 40 times

[0089] result Figure 1. Structure of the AAV vector and its 10 activation regions. Our AAV vector contains dSaCas9 fused with the activating region shown in the diagram below. The fusion protein is expressed by the EFS promoter, and the sgRNA is expressed by the U6 promoter. Seven novel activating regions were created: VP64-MyoD, VP64-HSF1, VP32-p65, VP64-miniRTA, VP64-microRTA, VP64-p65, and VPH. Reported activating regions (VP64, VP160, and VPR) were also tested for comparison. The AAV vector has a size limit of 5kb, and the total of its components is 4.45kb. This leaves approximately 550bp of space for the fused activating region. Therefore, the following seven activating regions fit within the vector size limit: VP64, Vp160, VP64-MyoD, VP64-HSF1, VP32-p65, VP64-miniRTA, and VP64-microRTA.

[0090] Figure 2. Activation of the MYD88 gene by nine activation regions. The activation function of six novel activating regions was tested using three different sgRNAs (MYD88-1, -2, and -3) that target the human MYD88 promoter region. Three activating regions, VP64, VP160, and VPR were also tested for comparison. In all three sgRNAs tested, VP64-RTA demonstrated the best gene activation of the six regions within the AAV vector size limit.

[0091] Figure 3. Activation of the FGF21 gene by nine activation regions. The activation function of six novel activating regions was tested using three different sgRNAs (FGF-1, -2, and -3) that target the human FGF21 promoter region. Three activating regions, VP64, VP160, and VPR, were also tested for comparison. In all three sgRNAs tested, VP64-RTA demonstrated the best gene activation of the six regions within the AAV vector size limit.

[0092] Figure 4. Activation of the GCG gene by nine activation regions. The activation function of six novel activating regions was tested using three different sgRNAs (GCG-1, -2, and -3) that target the human GCG promoter region. Three activating regions, VP64, VP160, and VPR, were also tested for comparison. In all three sgRNAs tested, VP64-RTA demonstrated the best gene activation of the six regions within the AAV vector size limit.

[0093] Figure 5. MyD88 gene activation by VP64-miniRTA and VP64-microRTA. The activation functions of VP64-miniRTA (164a.a.) and VP64-microRTA (140a.a.) were compared in the human MYD88 promoter. VP64-microRTA showed a similar level of activation as VP64-miniRTA. gMYD88_2 was used.

[0094] conclusion Our VP64-miniRTA (miniVR; 167 a.a., 501 bp) and VP64-microRTA (microVR; 140 a.a., 420 bp) are small enough to fit within the size limit (5 kb) of an AAV vector in the presence of other elements such as Cas9, sgRNA, and promoter. Therefore, the VP64-miniRTA and VP64-microRTA are powerful components for use in CRISPR technology and AAV delivery systems.

[0095] This application is based on U.S. Provisional Patent Application No. 62 / 715,432 (filed on 7 August 2018) (the entire contents of which are incorporated herein by reference).

Claims

1. A complex comprising a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in double-stranded DNA and is bound to each other, and a transcription activator, which activates the transcription of a targeted gene in the DNA. Here, the transcription activator consists of 200 or fewer amino acids, includes VP64 and the transcription activation site of RTA, and comprises the amino acid sequence shown in Sequence ID No.

8.

2. The complex according to claim 1, wherein the nucleic acid sequence recognition module comprises a CRISPR effector protein that lacks the ability to cleave at least one strand of double-stranded DNA.

3. The complex according to claim 2, wherein the CRISPR effector protein lacks the ability to cleave both strands of double-stranded DNA.

4. The complex according to claim 2 or 3, wherein the nucleic acid encoding the CRISPR effector protein consists of the base sequence shown in SEQ ID NO:

28.

5. A nucleic acid encoding the complex according to any one of claims 1 to 4.

6. A vector comprising the nucleic acid described in claim 5.

7. The vector according to claim 6, wherein the vector is an adeno-associated virus vector.

8. A method for activating the transcription of a targeted gene in a cell, comprising the step of introducing a complex according to any one of claims 1 to 4, a nucleic acid according to claim 5, or a vector according to claim 6 or 7 into the cell, wherein the cell is a cell other than a cell in the human body.

9. The method according to claim 8, wherein the cells are mammalian animal cells.

10. The method according to claim 9, wherein the mammal is a human.

Citation Information

Patent Citations

  • Targeted chromosomal mutagenesis using zinc finger nucleases

    WO2003087341A2

  • TAL effector-mediated DNA modification

    WO2011072246A2

  • Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

    WO2013176772A1

  • Crispr-CAS genome engineering via a modular AAV delivery system

    WO2018035503A1

  • Transcription-regulating fusion polypeptide

    WO2018110471A1