Adeno-associated virus (AAV) producing cell lines and related methods
Patent Information
- Application Number
- JP2025039219
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2019-06-25
- Filing Date
- 2025-03-12
- Publication Date
- 2026-09-03
- Estimated Expiration
- 2039-12-18
Smart Images

Figure 0007915314000001 
Figure 0007915314000002 
Figure 0007915314000003
Abstract
Description
[Technical Field]
[0001] This disclosure relates to mammalian cell lines for producing adeno-associated virus (AAV). The cells preferably comprise nucleic acids encoding helper genes and AAV genes, under the control of a desuppressible promoter. This disclosure also relates to isolated nucleic acid molecules encoding such genes and to methods for using mammalian cells for AAV production.
[0002] Sequence List This application includes an electronically submitted sequence listing in ASCII format, which is incorporated herein by reference in its entirety. The above ASCII copy, created on December 17, 2019, is named 0132-0049WO1_SL.txt and has a size of 364,567 bytes. [Background technology]
[0003] Due to its safety profile and long-term expression capability, adeno-associated virus (AAV) is an excellent viral vector for gene therapy in humans. The wild-type AAV genome consists of 4.7 kb of single-stranded DNA containing regulatory genes for replication (Rep) and structural genes for the capsid (Cap), flanked by inverted end repeats (ITRs) for viral replication and packaging. As a dependent virus, AAV replication in host cells requires co-infection with adenovirus (Ad) and a helper virus such as herpes simplex virus. Alternatively, the expression of cloning helper genes can also support AAV replication. For example, recombinant AAV can be produced in HEK293 cells by co-transfection of three plasmids: pHelper plasmids expressing adenovirus-derived E2A, E4Orf6, and VA; pRep-Cap plasmids for the Rep and Cap proteins; and an AAV transfer plasmid containing the desired target gene (GOI).
[0004] Currently, AAV production relies on several bridging platforms. In addition to the triple transfection in HEK293 cells described above, AAV can be produced by co-infecting insect cells with two baculoviruses expressing Rep-Cap and GOI, respectively. However, these baculoviruses are unstable at higher passages and take a long time to prepare (see, e.g., Urabe et al., “Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors,” Human Gene Therapy 13:1935-1943 (2002)). HeLa packaging cells with stably incorporated Rep-Cap and GOI have also been developed. These systems, however, still require wild-type adenoviruses as helper viruses, which pose a risk of contamination of AAV-producing organisms with replicated adenoviruses (see, for example, Robert et al., “Manufacturing of recombinant adeno-associated viruses using mammalian expression platforms,” Biotechnology Journal 12:1600193(1-16)(2017)).
[0005] To limit contamination and reduce costs while providing reproducible and stable results, there is a need for cell lines and related methods for producing AAV that can be easily scaled to mass production. [Overview of the Initiative]
[0006] In some embodiments, mammalian cells for producing adeno-associated virus (AAV) are provided herein, comprising a nucleic acid molecule encoding a viral helper gene under the control of a first desuppressable promoter, a nucleic acid molecule encoding an AAV gene under the control of a second desuppressable promoter, and nucleic acid molecules encoding repressive elements of the first and second desuppressable promoters.
[0007] In further embodiments, adenovirus helper genes including the E2A gene and the E4Orf6 gene are under the control of a first desuppressable promoter, AAV genes including the Rep gene and the Cap gene are under the control of a second desuppressable promoter, and a third De-suppression A virus-associated non-coding RNA under the control of a possible promoter, two inverted terminal repeat (ITR) sequences, and the first, second, and third De-suppression Mammalian cells for producing adeno-associated virus (AAV), comprising a possible promoter repression element and a nucleic acid molecule encoding the adeno-associated virus (AAV), are provided herein.
[0008] In further embodiments, adenovirus helper genes including the E2A gene and the E4Orf6 gene are under the control of a first desuppressable promoter, AAV genes including the Rep gene and the Cap gene are under the control of a second desuppressable promoter, and a third De-suppression Isolated nucleic acid molecules encoding a virus-associated non-coding RNA under the control of a possible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressable promoters are provided herein.
[0009] In a further embodiment, a method for producing adeno-associated virus (AAV) in mammalian cells, wherein the mammalian cells are controlled by an adenovirus helper gene including the E2A gene and the E4Orf6 gene under the control of a first desuppressible promoter, an AAV gene including the Rep gene and the Cap gene under the control of a second desuppressible promoter, and a third De-suppressionA method is provided herein that comprises transfecting a virus-associated non-coding RNA under the control of a possible promoter with an isolated nucleic acid molecule encoding two inverted terminal repeat (ITR) sequences and repressor elements of first, second, and third derepressable promoters; treating mammalian cells with binding partners of the repressor elements; activating the first, second, and third derepressable promoters; producing AAV; and recovering the AAV.
[0010] In a further embodiment, a method of treatment with adeno-associated virus (AAV) comprising: a mammalian cell containing adenovirus helper genes including the E2A gene and the E4Orf6 gene under the control of a first desuppressable promoter; an AAV gene including the Rep gene and the Cap gene under the control of a second desuppressable promoter; and a third De-suppression A method is provided herein that comprises transfecting a virus-associated non-coding RNA under the control of a possible promoter with an isolated nucleic acid molecule encoding two inverted terminal repeat (ITR) sequences and repressor elements of first, second, and third derepressable promoters; treating mammalian cells with binding partners of the repressor elements; activating the first, second, and third derepressable promoters; producing AAV; recovering the AAV; and administering the AAV to a mammalian patient.
[0011] In further embodiments, a method for producing adeno-associated virus (AAV) is provided herein, comprising: transfecting mammalian cells stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB with a first nucleic acid encoding adenovirus helper genes including the E2A gene, the E4Orf gene, and virus-associated non-coding RNA, under the control of a first derepressable promoter; a second nucleic acid encoding AAV genes including the Rep gene and the Cap gene, under the control of a second derepressable promoter; and optionally, a third nucleic acid encoding a gene of interest, under the control of a third derepressable promoter; treating the mammalian cells with a binding partner of TetR and / or TetR-KRAB; activating the first, second, and third derepressable promoters; producing AAV; and recovering the AAV.
[0012] In further embodiments, a method for producing adeno-associated virus (AAV) comprises: stably transfecting mammalian cells with a nucleic acid encoding TetR and / or TetR-KRAB repressor, a chicken hypersensitive site-4 (cHS4) sequence adjacent to TetR and / or TetR-KRAB repressor, and a selected gene; transfecting the stably transfected mammalian cells with a first nucleic acid encoding adenovirus helper genes including the E2A gene, E4Orf gene, and virus-associated non-coding RNA, under the control of a first derepressable promoter; a second nucleic acid encoding AAV genes including the Rep gene and Cap gene, under the control of a second derepressable promoter; and optionally, a third nucleic acid encoding a target gene under the control of a third derepressable promoter; treating the mammalian cells with a binding partner of TetR; and activating the first, second, and third derepressable promoters. A method comprising producing AAV and recovering AAV is provided herein. [BRIEF DESCRIPTION OF THE DRAWINGS]
[0013] [Figure 1] Fig. 1 is a schematic diagram showing the use of a derepressible promoter for controlling expression of a helper gene and a VA gene according to an embodiment of the present specification. [Figure 2A] Fig. 2 shows an exemplary nucleic acid molecule for production of a helper gene and a VA gene according to an embodiment of the present specification. [Figure 2B] Fig. 3 shows an exemplary nucleic acid molecule for production of a helper gene and a VA gene according to an embodiment of the present specification. [Figure 3] Fig. 4 shows induction results of a helper gene and an AAV gene according to an embodiment of the present specification. [Figure 4] Figs. 4A to 4C are schematic diagrams showing a derepressible construct for expression of an AAV gene according to an embodiment of the present specification. [Figure 5] Fig. 5 shows an exemplary derepressible p5 promoter according to an embodiment of the present specification. [Figure 6] Fig. 6 shows an exemplary derepressible p19 promoter according to an embodiment of the present specification. [Figure 7A] Fig. 7 shows an exemplary derepressible p19 promoter comprising an artificial intron according to an embodiment of the present specification. [Figure 7B] Fig. 8 shows an exemplary derepressible p19 promoter comprising an artificial intron according to an embodiment of the present specification. [Figure 8A] Fig. 9 shows results of Rep-Cap expression and AAV titer using a Rep-Cap vector according to an embodiment of the present specification. [Figure 8B] Fig. 10 shows results of Rep-Cap expression and AAV titer using a Rep-Cap vector according to an embodiment of the present specification. [Figure 9A] Fig. 11 shows additional results of Rep-Cap expression and AAV titer using a helper vector and a Rep-Cap vector according to an embodiment of the present specification. [Figure 9B]Shows additional results of Rep-Cap expression and AAV titer using the helper and Rep-Cap vectors according to the embodiments of the present specification. [Figure 10A] Shows exemplary nucleic acid constructs encoding a helper gene, an AAV gene, and a VA gene according to the embodiments of the present specification. [Figure 10B] Shows exemplary nucleic acid constructs encoding a helper gene, an AAV gene, and a VA gene according to the embodiments of the present specification. [Figure 10C] Shows exemplary nucleic acid constructs encoding a helper gene, an AAV gene, and a VA gene according to the embodiments of the present specification. [Figure 10D] Shows exemplary nucleic acid constructs encoding a helper gene, an AAV gene, and a VA gene according to the embodiments of the present specification. [Figure 11A] Shows exemplary nucleic acid constructs encoding a helper, AAV, a gene of interest, and a Rep-Cap vector according to the embodiments of the present specification. [Figure 11B] Shows exemplary nucleic acid constructs encoding a helper, AAV, a gene of interest, and a Rep-Cap vector according to the embodiments of the present specification. [Figure 11C] Shows exemplary nucleic acid constructs encoding a helper, AAV, a gene of interest, and a Rep-Cap vector according to the embodiments of the present specification. [Figure 11D] Shows exemplary nucleic acid constructs encoding a helper, AAV, a gene of interest, and a Rep-Cap vector according to the embodiments of the present specification. [Figure 11E] Shows exemplary nucleic acid constructs encoding a helper, AAV, a gene of interest, and a Rep-Cap vector according to the embodiments of the present specification. [Figure 12A] Shows exemplary nucleic acid constructs encoding TetR and TetR-KRAB according to the embodiments of the present specification. [Figure 12B] Shows exemplary nucleic acid constructs encoding TetR and TetR-KRAB according to the embodiments of the present specification. [Modes for carrying out the invention]
[0014] The use of the words "a" or "an," when used in conjunction with the term "including" in the claims and / or specification, may mean "one," but may also correspond to the meanings of "one or more," "at least one," and "more than one."
[0015] Throughout this application, the term “approximately” is used to indicate that a value includes inherent variability in error with respect to the method / device used to determine the value. Typically, the term means, depending on the context, that variability is less than approximately 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20%.
[0016] The use of the term “or” in the claims is used to mean “and / or” unless it is explicitly indicated to refer only to substitutes or those substitutes are not mutually exclusive, but this disclosure supports the definitions of substitutes only and “and / or”.
[0017] As used herein and in the claims, the terms “comprising” (and any form of “comprising,” e.g., “comprise” and “comprises”), “having” (and any form of “having,” e.g., “have” and “has”), “including” (and any form of “including,” e.g., “includes” and “include”), or “containing” (and any form of “containing,” e.g., “contains” and “contain”) are comprehensive or open-ended and do not exclude additional, undescribed, elements or method steps. Any embodiment discussed herein is intended to be implemented with respect to any method, system, host cell, expression vector, and / or composition of the present invention. Furthermore, compositions, systems, cells, and / or nucleic acids of the present invention can be used to achieve any of the methods described herein.
[0018] Adeno-associated viruses (AAVs) are used as selection vectors for gene therapy in more than 120 clinical trials worldwide. The rapidly growing demand for recombinant AAVs necessitates a highly efficient and robust manufacturing platform. However, current methods for producing AAVs, including transient transfection and helper virus systems, are very costly and labor-intensive. This specification provides plasmid / helper virus-free AAV-producing cell lines and their uses, offering efficient AAV production for a long-term solution at significantly reduced costs. The AAV-producing cell lines described herein represent a next-generation platform for both clinical and commercial AAV production.
[0019] Accordingly, in embodiments, mammalian cells for producing adeno-associated virus (AAV) are provided herein.
[0020] As used herein, the term “mammalian cells” includes cells derived from any member of the order Mammalia, such as human cells, mouse cells, rat cells, monkey cells, and hamster cells. In some embodiments, cells include mouse cells, human cells, Chinese hamster ovary (CHO) cells, CHOK1 cells, CHO-DXB11 cells, CHO-DG44 cells, CHOK1SV cells containing all variants (e.g., POTELLIGENT®, Lonza, Slough, UK), and CHOK1SV GS-KO (glutamine synthase knockout) cells containing all variants (e.g., XCEED®, Lonza, Slough, UK). Exemplary human cells include human embryonic kidney (HEK) cells such as HEK293, HeLa cells, or HT1080 cells.
[0021] Mammalian cells include mammalian cell cultures, which may be either adherent cultures or suspension cultures. Adherent cultures refer to cells that grow on a substrate surface, e.g., a plastic plate, dish, or other suitable cell culture and growth platform, and may be adhesion-dependent. Suspension cultures refer to cells that can be maintained in a culture flask or large suspension tank, for example, to allow for a large surface area for gas and nutrient exchange. Suspension cell cultures often utilize agitation or agitation mechanisms to provide proper mixing. Media and conditions for maintaining cells in suspension are generally known in the art. An exemplary suspension cell culture includes human HEK293 cloned cells.
[0022] As used herein, the term “adeno-associated virus (AAV)” refers to small, non-enveloped viruses containing single-stranded DNA belonging to the Parvoviridae family and the Dependparvovirus genus. More than 10 adeno-associated virus serotypes have been identified to date, with serotype AAV2 being the most well-characterized. Other non-exclusive examples of AAV serotypes include ANC80, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11. In addition to these serotypes, AAV pseudotypes have been developed. AAV pseudotypes contain the capsid of a first serotype and the genome of a second serotype (for example, pseudotype AAV2 / 5 corresponds to an AAV having the genome of serotype AAV2 and the capsid of AAV5).
[0023] In this specification, the term “adenovirus” refers to non-enveloped viruses of the Adenoviridae family that have an icosahedral nucleocapsid containing double-stranded DNA. More than 50 adenovirus subtypes have been isolated from humans, and many additional subtypes have been isolated from other mammals and birds. For birds, see, for example, Ishibashi et al., “Adenoviruses of animals,” The Adenoviruses, Ginsberg, ed., Plenum Press, New York, NY, pp. 497-562 (1984), and Strauss, “Adenovirus infections in humans,” The Adenoviruses, Ginsberg, ed., Plenum Press, New York, NY, pp. 451-596 (1984). These subtypes belong to the Adenoviridae family, which is now divided into two genera: mastadenoviruses and aviadenoviruses. All adenoviruses are morphologically and structurally similar. However, in humans, adenoviruses exhibit different immunological characteristics and are therefore classified into serotypes. Two human serotypes of adenovirus, AV2 and AV5, have been extensively studied and provide much of the general information about adenoviruses.
[0024] In embodiments, the mammalian cells provided herein preferably include nucleic acid molecules encoding a viral helper gene under the control of a first derepressable promoter, nucleic acid molecules encoding an AAV gene under the control of a second derepressable promoter, and repressive elements of the first and second derepressable promoters.
[0025] In exemplary embodiments, nucleic acid molecules encoding various components for AAV production are contained within mammalian cells in separate nucleic acid molecules, e.g., separate plasmids or vectors. In other embodiments, nucleic acid molecules encoding various components for AAV production are contained within the same plasmid or vector. In further embodiments, certain components are contained within the same nucleic acid molecule (e.g., a helper gene and an AAV gene), while other genes are contained within separate nucleic acid molecules (e.g., a gene encoding a repressor element).
[0026] "Nucleic acid," "nucleic acid molecule," or "oligonucleotide" refers to a polymer compound containing covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA, or MIRNA.
[0027] In the various embodiments described herein, nucleic acid molecules can encode various genes. That is, when transcribed, nucleic acid molecules produce mRNA of the genes described herein, which is then translated into desired or required proteins.
[0028] Preferably, as described herein, mammalian cells contain nucleic acid molecules encoding viral helper genes. Viral helper genes include various adenovirus genes, herpesvirus genes, and bocavirus genes (e.g., Guido et al., “Human bocavirus: Current knowledge and future challenges,” World J. Gateroenterol 22:8684-8697 (its disclosure is incorporated herein by reference in its entirety)). In exemplary embodiments, the viral helper gene is an adenovirus helper gene. Where herein referred to, the terms “adenovirus helper gene” or “AV helper gene” refer to a gene consisting of one or more nucleic acid sequences derived from one or more adenovirus subtypes or serotypes that contribute to the replication and packaging of adeno-associated viruses. In some embodiments, the adenovirus helper gene is E1A, E1B, E2A, E4 (including E4Orf6), VA, or a combination thereof, or any other adenovirus helper gene. In exemplary embodiments, the adenovirus helper genes include both the E2A gene and the E4Orf6 gene. Preferably, an internal ribosome entry site (IRES) element is located between the E2A gene and the E4Orf6 gene. The IRES element initiates translation of the E4Orf6 gene after the E2A gene in a single expression cassette, providing stability to the construct.
[0029] The various nucleic acid molecules encoding the various genes described herein are preferably under the control of a derepressible promoter. As used herein, “under control” means that a gene is regulated by a “promoter,” “promoter sequence,” or “promoter region,” which refers to a DNA regulatory region / sequence that can bind to RNA polymerase and initiate transcription of a downstream coding or non-coding gene sequence. In other words, the promoter and the gene are either an operable combination or operably linked. As used herein, the terms “in an operable combination,” “in an operable order,” and “operably linked” refer to the linking of nucleic acid sequences in such a manner that a promoter can be produced that can direct the transcription of a given gene and / or the synthesis of a desired protein molecule. This term also refers to the linking of amino acid sequences in such a manner that a functional protein is produced.
[0030] In some embodiments of this disclosure, the promoter sequence includes a transcription initiation site and extends upstream to include the minimum number of bases or elements required to initiate transcription at a detectable level above the background. In some embodiments, the promoter sequence includes a transcription initiation site and a protein-binding domain involved in RNA polymerase binding. Eukaryotic promoters often include, but do not necessarily, “TATA” and “CAT” boxes. Various promoters, including inducible promoters, may be used, for example, to drive gene expression in the host cells or vectors of this disclosure. In some embodiments, the promoter is not a leaky promoter; that is, the promoter does not constitutively express any of the gene products described herein. In other embodiments described herein, the promoter is a constitutive promoter that initiates mRNA synthesis independently of external regulatory influences.
[0031] Preferably, the promoter used to control the transcription of various genes for producing the AAV described herein is a derepressible promoter. As used herein, “derepressible promoter” refers to a structure comprising a functional promoter and additional elements or sequences that can bind to a repressor element to cause repression of the functional promoter. “Repression” refers to the reduction or inhibition of the initiation of transcription of downstream coding or non-coding gene sequences by the promoter. “Repressor element” refers to a protein or polypeptide that can bind to the promoter (or near the promoter) to reduce or inhibit the activity of the promoter. The repressor element can interact with a substrate or binding partner of the repressor element so that the repressor element undergoes a conformational change. This conformational change of the repressor element results in “derepression” of the promoter, by eliminating the ability of the repressor element to reduce or inhibit the promoter, thereby allowing the promoter to proceed with transcription initiation. “Functional promoter” refers to a promoter in which initiation transcription is possible in the absence of the action of the repressor element. Various functional promoters that can be used in carrying out the present invention are known in the art, for example, P CMV , P H1 This includes the promoters of P19, P5, P40, and adenovirus helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).
[0032] Exemplary repressor elements and their corresponding binding partners that can be used as derepressible promoters are known in the art and include systems such as the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (see, for example, Mullick et al., “The cumate gene-switch: a system for regulated expression in mammalian cells,” BMC Biotechnology 6:43(1-18)(2006) (the disclosure thereof is incorporated herein by reference in its entirety), including the disclosure of the derepressible promoter system described herein), and the TetO / TetR system described herein (see, for example, Yao et al., “Tetracycline Repressor, TetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells,” Human Gene Therapy 9:1939-1950(1998) (the disclosure thereof is incorporated herein by reference in its entirety)).
[0033] In an exemplary embodiment, the desuppressable promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). A schematic diagram illustrating an exemplary repressable promoter system is provided in Figure 1. CMV A promoter that can be desuppressed, including the promoter, and P H1 A derepressable promoter containing a promoter is shown, both containing two TetO sequences (TetO2). As illustrated, when two tetracycline repressor proteins (repressor elements of the TetR-TetO2 sequence) bind to the TetO2 sequence, P CMV Promoter and P H1Both promoters are suppressed. That is, little or no transcription occurs from these promoters. When the TetR binding partner (preferably doxycycline (Dox)) binds, the TetR protein changes its conformation and is released from the TetO2 sequence, and the functional promoters initiate their normal transcription process as they do naturally. As schematically illustrated in Figure 1, this causes the "off" state (preferably, P CMV promoter and P H1 promoter, from which no transcription occurs) to a switch of the entire system to the "on" state when Dox is added, allowing P CMV promoter and P H1 promoter to return to the natural state where they transcribe the genes under their control.
[0034] For example, as shown in Figure 1, P having a TetO2 sequence CMV promoter (preferably, the pcDNA4 / TO promoter; INVITROGEN®) is in the "off" state when bound by TetR. When Dox is added, TetR changes its conformation and is released from the TetO2 sequence of the repressible promoter, and P CMV promoter proceeds to transcribe adenoviral helper genes (e.g., E2A and E4).
[0035] As described herein and illustrated in Figure 1, a mammalian cell can further comprise a nucleic acid encoding a virus-associated (VA) non-coding RNA, which is under the control of a fourth derepressible promoter. As shown in Figure 1, this derepressible promoter is a functional promoter P H1P can also include a TetO2 sequence that controls the expression of non-coding RNA (see, for example, Wiederschain et al., “Single-vector inducible lentiviral RNAi system for oncology target validation,” Cell Cycle 8:498-504 (2009) (its disclosure, including the disclosure of the promoter system and sequence, is incorporated herein by reference)). As shown in Figure 1, P has a TetO2 sequence. H1 The promoter is in the "off" position when bound by TetR. When Dox is added, TetR changes its conformation and releases from the TetO2 sequence of the repressible promoter, P H1 The promoter proceeds to transcribe the VA1 non-coding RNA.
[0036] Figure 2A shows exemplary nucleic acid molecules that can be used in various mammalian cells and methods described herein. As shown, the CMV promoter is used upstream of both the E2A and E4Orf6 genes, ligated via an IRES element. The CMV promoter includes a CMV enhancer and a tet operator (TetO2) for control by derepression. An exemplary location of the H1 promoter, including a TetO2 sequence that controls the expression of VA non-coding RNA, is also illustrated in Figure 2A.
[0037] Figures 1 and 2A also illustrate that, in embodiments, mammalian cells may contain repressor elements under the control of a constitutive promoter. Preferably, as described herein, the encoded repressor element is a tetracycline repressor protein (TetR). As illustrated in Figures 1 and 2A, a suitable promoter for the expression of the repressor element is the hPGK promoter. By placing the repressor element under the control of a constitutive promoter, the production of the repressor element, preferably TetR, is always active. That is, TetR is produced when the nucleic acid molecule is introduced into a mammalian cell. This provides tight control of various derepressible promoters that are repressed by TetR binding to the TetO2 sequence.
[0038] As shown in Figure 2A, in exemplary embodiments, nucleic acids encoding a tetracycline repressor protein and nucleic acids encoding an in-frame transcriptional repression domain can be induced. In Figure 2A, this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence fused in-frame to the C-terminus of TetR (see, e.g., Szulc et al., “A versatile tool for conditional gene expression and knockdown,” Nature Methods 3:109-116 (2006)). The use of a KRAB sequence or other transcriptional repression domain improves the repressive activity of TetR when bound to TetO2, thereby minimizing the amount of leakage or basal gene expression before derepression (i.e., before Dox addition). Figures 2B and 12A show exemplary nucleic acid molecules lacking a KRAB sequence.
[0039] As shown in Figure 12A, in exemplary embodiments, the nucleic acid encoding the tetracycline repressor protein can be contained within or stably expressed within a mammalian cell. In Figures 2A and 12B, this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence fused in-frame to the C-terminus of TetR (see, e.g., Szulc et al., “A versatile tool for conditional gene expression and knockdown,” Nature Methods 3:109-116 (2006)). The use of a KRAB sequence or other transcriptional repression domains improves the repressive activity of TetR when bound to TetO2, thereby minimizing the amount of readout or basal gene expression before derepression (i.e., before Dox addition). Figures 2B and 12A show exemplary nucleic acid molecules lacking a KRAB sequence.
[0040] In some embodiments, the AAV gene encoded by the nucleic acid molecule includes the Rep gene and the Cap gene. Other AAV genes that may be encoded by the nucleic acid molecule include any gene derived from any AAV serotype. In some embodiments, the AAV gene is Rep78, Rep68, Rep52, Rep40, VP1, VP2, VP3, or a combination thereof. In some embodiments, the AAV gene is derived from adeno-associated virus type 2. In some embodiments, the AAV gene is derived from adeno-associated virus Anc80.
[0041] Where used herein, the term “Rep” gene refers to an AAV genomic region recognized in the art that encodes a viral replication protein required together to replicate the viral genome, or a functional homolog thereof, such as the human herpesvirus 6 (HHV-6) rep gene, which is also known to mediate AAV-2DNA replication. Thus, the rep coding region may include genes encoding AAV Rep78 and Rep68 ("long form of Rep") and Rep52 and Rep40 ("short form of Rep"), or their functional homologs. The rep coding region may be derived from any viral serotype, such as the AAV serotypes described herein, where used herein. The region does not need to contain all of the wild-type genes, but may be modified (e.g., by nucleotide insertions, deletions, or substitutions) insofar as the present rep genes provide sufficient embedding function when expressed in suitable target cells. See, for example, Muzyczka, N., Current Topics in Microbiol. and Immunol. 158:97-129 (1992) and Kotin, RM, Human Gene Therapy 5:793-801 (1994).
[0042] As used herein, the term “Cap” gene refers to an AAV genomic region recognized in the art that encodes a viral capsid protein. Exemplary (non-exclusive) examples of these capsid proteins are the AAV capsid proteins VP1, VP2, and VP3. The Cap genes used in this disclosure may originate from any AAV serotype or combination of AAV serotypes.
[0043] Figure 4A shows the innate locations and promoter drives of the Rep and Cap genes. As is known in the art, maintaining an optimal ratio of Rep78 to Rep52 genes is necessary for successful AAV production. For example, DNA replication can be inhibited by controlling Rep78 production, as discussed in “Role for Highly Regulated rep Gene Expression in Adeno-Associated Virus Vector Production,” Journal of Virology 71:5236-5243 (1997) (the disclosure is incorporated herein by reference in its entirety). Furthermore, Rep78 can be toxic if overproduced in mammalian cells. For example, see Clark et al., “Cell Lines for the Production of Recombinant Adeno-Associated Virus,” Human Gene Therapy 6:1329-1341 (1995) (the disclosure is incorporated herein by reference in its entirety), which discusses how high rep protein levels can be associated with cytotoxicity. The promoter of Rep52 expression (p19) is also located within the coding region of Rep78. To overcome these challenges, various modifications are made to the native locations of the Rep genes and promoters, as described herein.
[0044] In exemplary embodiments, mammalian cells may contain nucleic acids encoding the Rep78 gene under the control of a second derepressable promoter and the Rep52 gene under the control of a third derepressable promoter. As shown in Figure 4B, one way to achieve this arrangement is to remove the Rep52 gene from within the Rep78 gene and place it downstream of the Rep78 gene and the Cap gene. The Rep78 gene may be under the control of a derepressable promoter (p5) containing the TetO2 sequence. In such embodiments, the native p19 promoter within Rep78 is modified or mutated to be silenced. The removed Rep52 gene is also placed under the control of a derepressable promoter (p19) containing the TetO2 sequence.
[0045] Figure 5 shows three potential positions for each TetO sequence for the TATA box, rep binding element (RBE), and start element (INR) of the p5 promoter of Rep78. The wild-type P5 promoter is also schematically illustrated. Figure 6 shows three potential positions for each TetO sequence for the TATA box and Sp1 transcription factor of the p19 promoter of Rep52. The wild-type P19 promoter is also illustrated. Additional positions of the TetO sequence are also incorporated herein and can be readily assumed by those skilled in the art.
[0046] In further embodiments, the Rep78 gene may be under the control of a derepressible promoter, and the Rep52 gene may be under the control of a derepressible promoter contained within an artificial intron. Such embodiments are illustrated in Figure 4C. As illustrated, a derepressible p5 promoter (e.g., including the TetO2 sequence described herein) is located upstream of the Rep78 gene. A derepressible p19 promoter (e.g., including the TetO2 sequence) contained within an intron (referred to as In-i-p19) controls the expression of Rep52. A schematic diagram of this embodiment is provided in Figure 7A, in which two tet operator sequences are illustrated within a chimeric intron. This chimeric intron can be inserted at various positions relative to the components of the p19 promoter. For example, as shown in Figure 7B, the intron sequence is preferably located downstream of TATA-2 in the p19 promoter. The spacing can be, for example, about 1 to 25 base pairs downstream from the TATA-2 sequence.
[0047] As described herein, in exemplary embodiments, the Cap gene encoded by the nucleic acid molecule is preferably under the control of a natural promoter. That is, the Cap gene does not need to be under the control of a derepressible promoter, but a derepressible promoter may be used if desired. In preferred embodiments, the Cap gene is under the control of a p40 promoter.
[0048] In exemplary embodiments, the nucleic acid molecule comprises two inverted end repeat (ITR) sequences. As is known in the art, these ITR sequences (i.e., AAV2 ITRs) are followed downstream by a single-stranded nucleotide sequence, with its reverse complement present. The ITR sequences represent the minimum sequences required for the replication, rescue, packaging, and integration of the AAV genome. Preferably, these ITR sequences are adjacent to a gene of interest. Thus, in embodiments, the nucleic acid molecule further encodes a gene of interest. This gene of interest may be, for example, a reporter gene, a selection gene, or a gene for therapeutic purposes.
[0049] For example, as shown in Figure 10C, the target gene, such as the gene encoding green fluorescent protein (EGFP), is adjacent to two ITR sequences.
[0050] A “gene” refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acid molecules. A “gene” also refers to a nucleic acid fragment that can function as a regulatory sequence before (5' non-coding sequence) and after (3' non-coding sequence) a coding sequence. In some embodiments, a gene is incorporated in multiple copies. In some embodiments, a gene is incorporated in a predetermined number of copies.
[0051] Where used herein, the terms “target gene” or “GOI” are used to describe heterogeneous genes. Where used herein, the terms “heterogene” or “HG” refer to nucleic acid sequences, e.g., genes, that are not typically linked together and / or not typically associated with a particular cell, when relating to nucleic acid sequences such as coding sequences or control sequences. In some embodiments, heterogeneous genes are constructs whose coding sequences themselves are not found in nature (e.g., synthetic sequences with different codons than native genes). Allelic mutations or naturally occurring mutational events do not result in heterogeneous DNA as used herein.
[0052] As used herein, “reporter gene” is a gene whose expression confers a phenotype to a cell that can be readily identified and measured. In some embodiments, the reporter gene includes a fluorescent protein gene. In some embodiments, the reporter gene includes a selection gene.
[0053] Where used herein, the term “selection gene” refers to the use of a gene that encodes an enzymatic activity conferring the ability to grow in a medium lacking what would be an essential nutrient, and furthermore, a selection gene may confer resistance to antibiotics or drugs to cells on which it is expressed. A selection gene may also be used to confer a particular phenotype to a host cell. When a host cell needs to express a selection gene in order to grow in a selection medium, the gene is said to be a positive selection gene. A selection gene can also be used to select host cells that contain a particular gene. A selection gene used in this manner is said to be a negative selection gene.
[0054] Where used herein, the term “therapeutic gene” refers to any functionally relevant nucleotide sequence. Thus, a therapeutic gene in this disclosure may include any desired gene that codes for a protein that is missing or lost from a target cell genome, or a non-native protein having a desired biological or therapeutic effect (e.g., antiviral function), or the sequence may correspond to a molecule having antisense or ribozyme function. Representative (non-limiting) examples of suitable therapeutic genes include those used to treat inflammatory, autoimmune, chronic, and infectious diseases, including disorders such as AIDS, cancer, neurological disorders, cardiovascular diseases, and hypercholesterolemia; various blood disorders, including various anemias, thalassemia, and hemophilia; and those used to treat genetic defects such as cystic fibrosis, Gaucher disease, adenosine deaminase (ADA) deficiency, and emphysema. Several antisense oligonucleotides useful for antisense therapy of cancer and viral diseases (e.g., short oligonucleotides complementary to the sequence around the mRNA translation start site (AUG codon)) have been described in the art and are also examples of genes suitable for therapeutic purposes.
[0055] In some embodiments, the mammalian cells provided herein are substantially free of helper viruses. As used herein, “helper virus” is any non-AAV virus added to enable the replication and packaging of adeno-associated viruses. Representative (non-limiting) examples of helper viruses are adenoviruses and herpesviruses. In some embodiments, the term substantially free of helper viruses means cells having fewer than 100, fewer than 10, or fewer than 1 helper virus per cell. In some embodiments, the term substantially free of helper viruses means cells or cell populations that are free of helper viruses, as determined using detection methods known to those skilled in the art. In some embodiments, wild-type helper viruses are not present in the cells. In some embodiments, the term wild-type virus means any completely non-AAV virus that can replicate in the cells independently of any other virus.
[0056] The AAV-producing cells described herein provide a long-term and cost-effective solution for large-scale AAV production. Because the constitutive expression of either the helper protein or the Rep protein can be cytotoxic, the strategies described herein allow for the control of their expression by engineered, desuppressable promoters.
[0057] In further embodiments, a mammalian cell for producing adeno-associated virus (AAV) comprises, in a single nucleic acid molecule, an adenovirus helper gene including the E2A gene and the E4Orf6 gene under the control of a first desuppressible promoter, an AAV gene including the Rep gene and the Cap gene under the control of a second desuppressible promoter, and a third De-suppressionA mammalian cell is provided herein that comprises a sequence encoding a virus-associated non-coding RNA under the control of a possible promoter, two inverted terminal repeat (ITR) sequences, and repressor elements of first, second, and third derepressable promoters. In such embodiments, this single nucleic acid molecule comprises all the various sequences, along with other necessary elements, to enable the production of AAV within the cell.
[0058] Figures 10A and 10B show exemplary nucleic acid molecules containing these various sequences that can be utilized in mammalian cells to produce AAV.
[0059] As described herein, preferably, mammalian cells are mammalian cell cultures, and in embodiments, may be suspension cultures. As described herein, the use of suspension cell cultures allows for scaling up and increasing production of AAV.
[0060] As described herein and as shown in Figures 1, 2A-2B, and 10A-10B, preferably, a single nucleic acid molecule contains an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0061] Various constructs for encoding Rep genes, including Rep78 and Rep52 genes, and Cap genes are described herein. In embodiments, the Rep78 gene is under the control of a second derepressable promoter, and the Rep52 gene is under the control of a fourth derepressable promoter (for example, as shown in Figure 4B, the Rep52 gene is separate from the Rep78 gene). In further embodiments, as described herein with reference to Figures 4C and 7A-7B, for example, the Rep78 gene may be under the control of a second derepressable promoter, and the Rep52 gene may be under the control of a fourth derepressable promoter contained within an artificial intron. Preferably, the Cap gene is under the control of a native promoter.
[0062] Various desuppressible promoters are described herein, and in embodiments, the desuppressible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). In embodiments, the functional promoter of the first desuppressible promoter (i.e., controlling the expression of adenovirus helper genes including the E2A gene and the E4Orf6 gene) is a cytomegalovirus (CMV) promoter.
[0063] In embodiments, as described herein and as illustrated in Figures 1, 2A-2B, and 10A-10D, preferably, the repressor element of the derepressable promoter is under the control of the derepressable promoter so as to always limit the expression of other genes that are produced and under the control of the constitutive promoter. Preferably, the encoded repressor element is a tetracycline repressor protein to bind to the TetO2 sequence and function as a derepressable promoter. In embodiments, for example, as shown in Figures 2A, 10A, and 10C, a nucleic acid encoding a transcriptional repression domain (e.g., a KRAB sequence) is included in frame with a nucleic acid encoding a tetracycline repressor protein. This transcriptional repression domain provides improved repressive activity of TetR when bound to TetO2, thereby minimizing the amount of readouts or basal gene expression before derepression.
[0064] Exemplary mammalian cells that can be used in the embodiments and methods described herein are described throughout and include, for example, Chinese hamster ovary (CHO) cells and human cells including human embryonic kidney (HEK, e.g., HEK293) cells.
[0065] Preferably, as described herein, the mammalian cell further comprises a nucleic acid molecule encoding the gene of interest (GOI). Preferably, as shown in Figures 10C–10D, the GOI is contained between two ITR sequences.
[0066] Adenovirus helper genes, including the E2A gene and the E4Orf6 gene, under the control of a first desuppressable promoter; AAV genes, including the Rep gene and the Cap gene, under the control of a second desuppressable promoter; and a third De-suppression Isolated nucleic acid molecules encoding virus-associated non-coding RNA under the control of a possible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters are also provided herein.
[0067] As used herein, “isolated nucleic acid molecule” includes vectors and plasmids that can contain the isolated nucleic acid molecule, as well as similar structures that allow the isolated nucleic acid molecule to be manipulated, stored, shipped, and ultimately used in a variety of cell transfection systems. The isolated nucleic acid molecules described herein can be used for the production of AAV as described herein, but can also be used in a variety of non-AAV-producing cell lines (including transient transfection systems). The isolated nucleic acid molecules described herein preferably further include a variety of additional elements and sequences necessary to enable use in cell systems, including the mammalian cells described herein.
[0068] For example, two plasmid constructs are shown as in Figures 10A and 10B. As shown, in the embodiment, the internal ribosome entry site (IRES) element may be included between the E2A gene and the E4Orf6 gene. As described herein with reference to Figure 4B, in the embodiment, the Rep78 gene is under the control of a second derepressable promoter, and the Rep52 gene is under the control of a fourth derepressable promoter (i.e., isolated from the Rep52 gene).
[0069] In further embodiments, as shown with reference to Figures 10A-10B, the Rep78 gene is under the control of a derepressible promoter (the ip5 promoter shown in Figure 5, and various repeats described in Figure 5), and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron, shown as ip19 and described with reference to Figures 7A-7B. The isolated nucleic acid preferably further comprises a Cap gene under the control of a native promoter (i.e., p40).
[0070] As described herein, various derepressible promoters may be contained in isolated nucleic acid molecules and preferably include a functional promoter and two tetracycline operator sequences (TetO2). With respect to helper genes E2 and E4, as shown in Figures 10A and 10B, the functional promoter is preferably a CMV promoter containing the TetO2 sequence. For use with virus-associated non-coding RNAs, derepressible promoters preferably include an H1 promoter and the TetO2 sequence.
[0071] As described herein and as shown in Figures 10A and 10B, the repressor element (e.g., a tetracycline repressor protein) is preferably under the control of a constitutive promoter, such as the hPGK promoter. As shown in Figures 10A and 12B, the isolated nucleic acid molecule may further comprise a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding an in-frame transcriptional repression domain (e.g., a KRAB sequence). As shown in Figures 10C-10D and 11B, the isolated nucleic acid molecule may further comprise the gene of interest (GOI, e.g., GFP) between two ITR sequences.
[0072] As described herein and as shown in Figures 12A to 12B, the inhibitory element is preferably adjacent to an insulator, for example, the chicken hypersensitivity site-4 (cHS4) array.
[0073] In the embodiment, a nucleic acid encoding a transcriptional repression domain (such as KRAB) is included in frame with a nucleic acid encoding a tetracycline repression protein (e.g., TetR-KRAB).
[0074] Additional gene elements and sequence elements to be included in the isolated nucleic acid molecules described herein are known in the art and can be illustrated in Figures 10A to 10D and Figures 11A to 11E.
[0075] In the context of nucleic acid sequences as described herein, the terms “sequence identity” or “% identity” refer to the percentage of residues in a comparison sequence that are identical when the sequences are aligned within a specified comparison window. The comparison window can be a segment of at least 10 to over 1000 residues from which sequences can be aligned and compared. Alignment methods for determining sequence identity are well-known and can be performed using publicly available databases such as BLAST (blast.ncbi.nlm.nih.gov / Blast.CGI).
[0076] In some embodiments, the nucleic acid molecules each have at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity with a reference nucleic acid molecule (or a reference polypeptide or fragment of a reference nucleic acid molecule). In certain embodiments of the present disclosure, the polypeptide or nucleic acid molecule each has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%, or 100% sequence identity with a reference nucleic acid molecule (or a fragment of a reference nucleic acid molecule). In some embodiments, the nucleic acid molecules each have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% sequence identity with a reference nucleic acid molecule.
[0077] A “vector” or “expression vector” is a replicon, such as a plasmid, phage, virus, or cosmid, to which a nucleic acid molecule described herein can be bound in order to result in the replication and / or expression of the bound nucleic acid molecule in a cell. “Vectors” include episomal (e.g., plasmids) and non-episomal vectors. The term “vector” includes both viral and nonviral means for introducing nucleic acid molecules into cells in vitro, in vivo, or ex vivo. The term “vector” may also include synthetic vectors. Vectors may be introduced into desired host cells by well-known methods, including but not limited to transfection, transduction, cell fusion, and lipofection. Vectors may contain a variety of regulatory elements, including promoters.
[0078] Methods for producing adeno-associated virus (AAV) in mammalian cells are also provided herein. Preferably, the methods herein involve a mammalian cell containing adenovirus helper genes, including the E2A gene and the E4Orf6 gene, under the control of a first desuppressable promoter; AAV genes, including the Rep gene and the Cap gene, under the control of a second desuppressable promoter; and a third De-suppression The method involves transfecting a virus-associated non-coding RNA under the control of a possible promoter with an isolated nucleic acid molecule encoding two inverted terminal repeat (ITR) sequences and repression elements of first, second, and third derepressible promoters.
[0079] As used herein, “transfection” means the introduction of an exogenous nucleic acid molecule, including a vector, into a cell. A “transfected” cell contains the exogenous nucleic acid molecule within the cell, while a “transformed” cell is one in which the exogenous nucleic acid molecule within the cell induces an intracellular phenotypic change. The transfected nucleic acid molecule may be incorporated into the genomic DNA of a host cell and / or maintained by the cell, either temporarily or for extended periods outside the chromosome. A host cell or organism expressing an exogenous nucleic acid molecule or fragment is referred to as a “recombinant,” “transformed,” or “transgenic” organism. Many transfection techniques are generally known in the art. See, for example, Graham et al., Virology, 52:456 (1973), Sambrook et al., Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York (1989), Davis et al., Basic Methods in Molecular Biology, Elsevier (1986), and Chu et al., Gene 13:197 (1981). Using such techniques, one or more exogenous DNA portions, such as AAV vector cassettes, AAV helper constructs, and other nucleic acid molecules, can be introduced into suitable host cells.
[0080] Various methods for transfecting mammalian cells with isolated nucleic acid molecules (i.e., vectors) described herein are known in the art and include a variety of chemical and physical methods, such as electroporation, cell injection, calcium phosphate exposure, liposomes, or polymer-based carrier systems.
[0081] In exemplary embodiments, vectors such as PIGGYBAC® transposons can be used for the stable integration of these nucleic acid molecules, enabling the random insertion of large nucleic acid sequences into multiple copies in a single step within the cellular genome. This system comprises a PIGGYBAC® vector and a Super PIGGYBAC® transposase that recognize transposon-specific inverted terminal repeats (ITRs) and efficiently integrate the ITRs and intercalating DNA into the genome at the TTAA site. The Super PIGGYBAC® transposase is delivered to cells via a Super PIGGYBAC® transposase expression vector co-transfected with one or more PIGGYBAC® vectors.
[0082] The method further comprises treating mammalian cells with a binding partner of the repressor element. As described herein, in the presence of the repressor element, the functional promoter of a derepressible promoter that controls the transcription of various genes encoded by nucleic acid molecules is repressed. That is, the genes are not actively transcribed, but instead await derepression. The repressor element of the derepressible promoter is preferably under the control of a constitutive promoter, so that the repressor element is produced immediately after transfection of the nucleic acid molecule into the mammalian cell, as described herein. When treated with the binding partner of the repressor element, the repressor element binds to the binding partner, changes its conformation, and no longer represses the derepressible promoter. This activates the first, second, and third (and additional, if necessary) derepressible promoters (i.e., the functional promoters of the derepressible promoters) in the mammalian cell.
[0083] After activation, various elements are transcribed and translated within mammalian cells, leading to the production of AAV. The AAV is then recovered using methods known in the art.
[0084] The methods described herein can be used with any mammalian cells, including mammalian cell cultures, but preferably the mammalian cell culture is a suspension culture containing human cells, such as a HEK suspension cell culture.
[0085] As described throughout, the nucleic acid molecule may further include an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Exemplary constructs relating to the Rep78 and Rep52 genes are described herein, including the case where the Rep78 gene is under the control of a second derepressable promoter and the Rep52 gene is under the control of a fourth derepressable promoter. In additional embodiments of the method, the Rep78 gene is under the control of a second derepressable promoter and the Rep52 gene is under the control of a fourth derepressable promoter contained within an artificial intron.
[0086] As described herein, the use of an artificial intron allows for the removal of a fourth derepressable promoter after activation of the derepressable promoter and before AAV production. As described herein, the derepressable promoter within the intron ensures the repression of Rep52 gene expression before activation and also allows for the expression of Rep78 protein after removal of the intron during mRNA splicing. In exemplary embodiments of the method, the Cap gene is under the control of a native promoter such as p40.
[0087] In the embodiments, the functional promoter of the desuppressible promoter that controls the expression of the helper gene is a cytomegalovirus (CMV) promoter. Preferably, in the method described herein, the encoded repressor element is a tetracycline repressor protein, and preferably, the desuppressible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). In the embodiments, the repressor element is under the control of a constitutive promoter, such as hPGK, if the encoded repressor element is a tetracycline repressor protein.
[0088] As described herein, in embodiments utilizing the TetR and / or TetR-KRAB repressive element, treatment of cells with doxycycline alters the conformation of TetR and activates the transcription of various genes.
[0089] The methods described herein can utilize a variety of mammalian cells, including human cells such as human embryonic kidney (HEK) cells, or other mammalian cells including Chinese hamster ovary (CHO) cells.
[0090] As described throughout, in the embodiments, the AAV comprises a nucleic acid molecule encoding the gene of interest. This GOI may be a reporter gene, a selection gene, or any other gene of interest, including a gene for therapeutic purposes.
[0091] The method for producing AAV can be used in a continuous production system. In an exemplary embodiment, the use of a suspension cell culture enables high-productivity and long-term culture conditions for mass production of AAV, and allows for multiple AAV recovery from each batch of starting cells.
[0092] The manufacturing method may utilize any suitable reactor, including but not limited to agitated tanks, bubble pumps, fibers, microfibers, hollow fibers, ceramic matrices, fluidized beds, fixed beds, and / or spouted bed bioreactors. As used herein, “reactor” may include a fermenter or fermentation unit, or any other reaction vessel, and the term “reactor” is used synonymously with “fermenter.” The terms fermenter or fermentation refer to both microbial cultures and mammalian cultures. For example, in some embodiments, an exemplary bioreactor unit may perform one or more or all of the following: supplying nutrients and / or carbon sources, injecting a suitable gas (e.g., oxygen), fermenting or controlling the inflow and outflow of cell culture medium, separating gaseous and liquid phases, maintaining temperature, maintaining oxygen and CO2 levels, maintaining pH levels, agitation (e.g., stirring), and / or washing / sterilization. Exemplary reactor units, such as fermentation units, may include multiple reactors within the unit. For example, a unit may have one, two, three, four, five, ten, fifteen, twenty, twenty-five, thirty, thirty, thirty-five, forty, forty-five, fifty, sixty, seventy, eighty, ninety, or one hundred or more bioreactors within each unit, and / or a facility may include multiple units, each having one or more reactors within the facility. In various embodiments, the bioreactor may be suitable for batch, semi-feed batch, feed batch, perfusion, and / or continuous fermentation processes. Any suitable reactor diameter may be used. In embodiments, the bioreactor may have a volume of about 100 mL to about 50,000 L.Non-restrictive examples include 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, and 550 liters. Volumes include 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3500 liters, 4000 liters, 4500 liters, 5000 liters, 6000 liters, 7000 liters, 8000 liters, 9000 liters, 10,000 liters, 15,000 liters, 20,000 liters, and / or 50,000 liters. Furthermore, preferred reactors may be multi-use, single-use, disposable, or non-disposable and may be formed from any preferred material including stainless steel (e.g., 316L or any other preferred stainless steel) as well as metal alloys such as Inconel, plastic, and / or glass.
[0093] In embodiments, and unless otherwise specifically stated herein, the devices, facilities, and methods described herein may also include any suitable unit operations and / or equipment not specifically mentioned, for example, operations and / or equipment for the separation, purification, and separation of such products. Any suitable facilities and environments may be used, such as conventional stick-built facilities, modular, mobile, and temporary facilities, or any other suitable construction, facilities, and / or layout. For example, in some embodiments, a modular cleanroom may be used. Furthermore, unless otherwise specifically stated herein, the devices, systems, and methods described herein may be housed and / or implemented in a single location or facility, or in separate or multiple locations and / or facilities.
[0094] In a further embodiment, a method of treatment with adeno-associated virus (AAV) comprising: a mammalian cell containing adenovirus helper genes including the E2A gene and the E4Orf6 gene under the control of a first desuppressable promoter; an AAV gene including the Rep gene and the Cap gene under the control of a second desuppressable promoter; and a third De-suppression A method is provided herein that includes transfecting a virus-associated non-coding RNA under the control of a possible promoter with two inverted terminal repeat (ITR) sequences and repressor elements of first, second, and third derepressable promoters; treating mammalian cells with binding partners of the repressor elements; activating the first, second, and third derepressable promoters; producing AAV; recovering the AAV; and administering the AAV to a mammalian patient.
[0095] Preferably, the method is used to treat a human patient with a gene of interest, including the gene for therapeutic purposes. Administration to a human patient may include, for example, inhalation, injection, or intravenous administration, and other methods of administration known in the art.
[0096] Methods for producing AAV and the use of various desuppressable promoters are described herein.
[0097] In further embodiments, a method for producing adeno-associated virus (AAV) is provided herein, comprising: transfecting mammalian cells stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB with a first nucleic acid encoding an adenovirus helper gene including an E2A gene, an E4Orf gene, and a virus-associated non-coding RNA under the control of a first desuppressable promoter; a second nucleic acid encoding an AAV gene including a Rep gene and a Cap gene under the control of a second desuppressable promoter; and optionally a third nucleic acid encoding a gene of interest under the control of a third desuppressable promoter; treating the mammalian cells with a binding partner of TetR; activating the first, second, and third desuppressable promoters; producing AAV; and recovering the AAV.
[0098] Preferably, as described herein, the mammalian cells are mammalian cell cultures comprising suspension cultures.
[0099] As described herein, the mammalian cells are preferably human cells, including Chinese hamster ovary (CHO) cells or human embryonic kidney (HEK) cells.
[0100] As described herein, using two or three different nucleic acids or transposons to transfect mammalian cells offers advantages over combining nucleic acids in a single plasmid, including the ability to optimize the ratio of separate AAV production and packaging components and to exert temporal control over the expression of each transposon.
[0101] Preferably, as described herein, the nucleic acids encoding the E2A and E4Orf genes further include an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf gene.
[0102] Preferably, as described herein, the desuppressable promoter comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0103] Preferably, as described herein, the functional promoter of the first desuppressable promoter is a cytomegalovirus (CMV) promoter.
[0104] In some embodiments, mammalian cells used to produce adeno-associated virus (AAV) stably express one or more nucleic acids encoding TetR and / or TetR-KRAB under the control of a constituent promoter.
[0105] As described herein, stable expression of TetR and / or TetR-KRAB in mammalian cells (preferably via transposons, prior to the insertion of nucleic acids carrying viral components) maximizes the repression of potentially cytotoxic AAV genes introduced by transfection, resulting in increased temporal control over derepressible promoter elements.
[0106] In some embodiments, the KRAB suppression domain is fused in-frame with TetR.
[0107] As described herein, fusing TetR with an in-frame KRAB repressive domain ensures a low likelihood of potentially cytotoxic "leaky" expression of AAV package nucleic acids. The in-frame fused KRAB repressive domain with the TetR repressive domain provides an additional mechanism of action to achieve a high level of repression of the desuppressible promoter.
[0108] In some embodiments, mammalian cells produce a sufficient amount of TetR. As used herein, “sufficient” of TetR is defined as the amount (e.g., TetR) of repressor (e.g., TetR) and / or level of activity (i.e., before the addition of doxycycline) to stop the expression and / or activity of repressible and / or derepressible elements.
[0109] As described herein, sufficient production of TetR is necessary for the repression of the derepressible promoter under normal conditions (e.g., before the addition of doxycycline). If sufficient TetR is not produced by mammalian cells, the cells may prematurely transcribe and translate the potentially cytotoxic AAV packaging nucleic acid.
[0110] In further embodiments, the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitivity site-4 (cHS4) adjacent to the TetR and / or TetR-KRAB repressor sequence. As described herein, expression of the cHS4 sequence adjacent to the TetR and / or TetR-KRAB repressor sequence prevents silencing of TetR expression and further improves the stability of the integrated repressor in the mammalian cell genome.
[0111] In further embodiments, the treatment includes treatment with doxycycline to remove the suppression of a desuppressable promoter.
[0112] In further embodiments, each of the first, second, and third nucleic acids is adjacent to a transposon-specific inverted terminal repeat (ITR).
[0113] In further embodiments, a method for producing adeno-associated virus (AAV) comprises: stably transfecting mammalian cells with a nucleic acid encoding TetR and / or a TetR-KRAB repressor, a chicken hypersensitivity site-4 (cHS4) sequence adjacent to TetR and / or the TetR-KRAB repressor, and a selected gene; transfecting the stably transfected mammalian cells with a first nucleic acid encoding an adenovirus helper gene including the E2A gene, the E4Orf gene, and virus-associated non-coding RNA, under the control of a first derepressable promoter; a second nucleic acid encoding an AAV gene including the Rep gene and the Cap gene, under the control of a second derepressable promoter; and optionally, a third nucleic acid encoding a gene of interest, under the control of a third derepressable promoter; treating the mammalian cells with a binding partner of TetR; activating the first, second, and third derepressable promoters; producing AAV; and recovering the AAV.
[0114] In some embodiments, mammalian cells further include selection genes such as zeosin resistance genes. Further selection genes include other antibiotic resistance genes such as kanamycin and genetisin resistance genes. As described herein, the expression of zeosin resistance genes allows for the efficient selection of correctly integrated repressor elements in the mammalian cell genome.
[0115] Additional exemplary embodiments Embodiment 1 is a mammalian cell for producing adeno-associated virus (AAV), comprising a nucleic acid molecule encoding a viral helper gene under the control of a first desuppressable promoter, a nucleic acid molecule encoding an AAV gene under the control of a second desuppressable promoter, and a nucleic acid molecule encoding repressive elements of the first and second desuppressable promoters.
[0116] Embodiment 2 includes the mammalian cells described in Embodiment 1, wherein the mammalian cells are a mammalian cell culture.
[0117] Embodiment 3 includes the mammalian cells described in Embodiment 2, wherein the mammalian cell culture is a suspension culture.
[0118] Embodiment 4 includes a mammalian cell according to any one of Embodiments 1 to 3, wherein the viral helper gene is an adenovirus helper gene.
[0119] Embodiment 5 includes the mammalian cell described in Embodiment 4, wherein the adenovirus helper genes include the E2A gene and the E4Orf6 gene.
[0120] Embodiment 6 includes the mammalian cell described in Embodiment 5, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0121] Embodiment 7 includes a mammalian cell according to any one of Embodiments 1 to 6, wherein the AAV gene includes the Rep gene and the Cap gene.
[0122] Embodiment 8 includes the mammalian cell described in Embodiment 7, wherein the Rep78 gene is under the control of a second desuppressible promoter and the Rep52 gene is under the control of a third desuppressible promoter.
[0123] Embodiment 9 includes the mammalian cell described in Embodiment 7, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a third derepressible promoter contained within an artificial intron.
[0124] Embodiment 10 includes the mammalian cell described in Embodiment 8 or 9, in which the Cap gene is under the control of a natural promoter.
[0125] Embodiment 11 comprises a mammalian cell according to any one of Embodiments 1 to 10, wherein each desuppressable promoter comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0126] Embodiment 12 includes the mammalian cell described in Embodiment 11, wherein the functional promoter of the first desuppressable promoter is a cytomegalovirus (CMV) promoter.
[0127] Embodiment 13 includes a mammalian cell according to any one of Embodiments 1 to 12, wherein the repressor element is under the control of a constitutive promoter.
[0128] Embodiment 14 comprises a mammalian cell according to any one of Embodiments 1 to 13, wherein the inhibitory element is a tetracycline inhibitory protein.
[0129] Embodiment 15 includes the mammalian cell described in Embodiment 14, further comprising a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding an in-frame transcriptional repression domain.
[0130] Embodiment 16 includes mammalian cells according to any one of Embodiments 1 to 15, wherein the mammalian cells are Chinese hamster ovary (CHO) cells.
[0131] Embodiment 17 includes a mammalian cell according to any one of Embodiments 1 to 15, wherein the mammalian cell is a human cell.
[0132] Embodiment 18 includes the mammalian cells described in Embodiment 17, wherein the human cells are human embryonic kidney (HEK) cells.
[0133] Embodiment 19 comprises a mammalian cell according to any one of Embodiments 1 to 18, further comprising a nucleic acid molecule containing two inverted terminal repeat (ITR) sequences.
[0134] Embodiment 20 comprises a mammalian cell according to any one of Embodiments 1 to 19, further comprising a nucleic acid molecule encoding the gene of interest.
[0135] Embodiment 21 comprises a mammalian cell according to any one of Embodiments 1 to 20, further comprising a nucleic acid encoding a virus-associated non-coding RNA under the control of a fourth desuppressable promoter.
[0136] Embodiment 22 is a mammalian cell for producing adeno-associated virus (AAV), comprising adenovirus helper genes including the E2A gene and the E4Orf6 gene under the control of a first desuppressable promoter, AAV genes including the Rep gene and the Cap gene under the control of a second desuppressable promoter, and a third De-suppression A mammalian cell containing a nucleic acid molecule encoding virus-associated non-coding RNA under the control of a possible promoter, two inverted terminal repeat (ITR) sequences, and repressive elements of first, second, and third derepressible promoters.
[0137] Embodiment 23 includes the mammalian cells described in Embodiment 22, wherein the mammalian cells are a mammalian cell culture.
[0138] Embodiment 24 includes the mammalian cells described in Embodiment 23, wherein the mammalian cell culture is a suspension culture.
[0139] Embodiment 25 includes a mammalian cell according to any one of Embodiments 22 to 24, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0140] Embodiment 26 includes a mammalian cell according to any one of Embodiments 22 to 25, wherein the Rep78 gene is under the control of a second derepressable promoter and the Rep52 gene is under the control of a fourth derepressable promoter.
[0141] Embodiment 27 includes a mammalian cell according to any one of Embodiments 22 to 25, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.
[0142] Embodiment 28 includes the mammalian cell described in Embodiment 26 or 27, in which the Cap gene is under the control of a natural promoter.
[0143] Embodiment 29 comprises a mammalian cell according to any one of Embodiments 22 to 28, wherein each of the desuppressable promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0144] Embodiment 30 includes the mammalian cell described in Embodiment 29, wherein the functional promoter of the first desuppressable promoter is a cytomegalovirus (CMV) promoter.
[0145] Embodiment 31 includes a mammalian cell according to any one of Embodiments 22 to 30, wherein the repressor element is under the control of a constitutive promoter.
[0146] Embodiment 32 comprises a mammalian cell according to any one of Embodiments 22 to 31, wherein the inhibitory element is a tetracycline inhibitory protein.
[0147] Embodiment 33 includes the mammalian cell described in Embodiment 25, further comprising a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding an in-frame transcriptional repression domain.
[0148] Embodiment 34 includes mammalian cells according to any one of Embodiments 22 to 33, wherein the mammalian cells are Chinese hamster ovary (CHO) cells.
[0149] Embodiment 35 includes a mammalian cell according to any one of Embodiments 22 to 33, wherein the mammalian cell is a human cell.
[0150] Embodiment 36 includes mammalian cells as described in Embodiment 35, wherein the human cells are human embryonic kidney (HEK) cells.
[0151] Embodiment 37 comprises a mammalian cell according to any one of Embodiments 22 to 36, further comprising a nucleic acid molecule encoding the gene of interest.
[0152] Embodiment 38 includes adenovirus helper genes, including the E2A gene and the E4Orf6 gene, under the control of a first desuppressable promoter; AAV genes, including the Rep gene and the Cap gene, under the control of a second desuppressable promoter; and a third De-suppression An isolated nucleic acid molecule comprising virus-associated non-coding RNA under the control of a possible promoter, two inverted terminal repeat (ITR) sequences, and repression elements of first, second, and third derepressible promoters.
[0153] Embodiment 39 comprises the isolated nucleic acid described in Embodiment 38, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0154] Embodiment 40 comprises the isolated nucleic acid described in Embodiment 38 or 39, wherein the Rep78 gene is under the control of a second derepressable promoter and the Rep52 gene is under the control of a fourth derepressable promoter.
[0155] Embodiment 41 comprises the isolated nucleic acid described in Embodiment 38 or 39, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.
[0156] Embodiment 42 comprises the isolated nucleic acid described in Embodiment 40 or 41, wherein the Cap gene is under the control of a natural promoter.
[0157] Embodiment 43 comprises an isolated nucleic acid according to any of Embodiments 38 to 42, wherein each desuppressable promoter comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0158] Embodiment 44 comprises the isolated nucleic acid described in Embodiment 43, wherein the functional promoter of the first desuppressable promoter is a cytomegalovirus (CMV) promoter.
[0159] Embodiment 45 comprises an isolated nucleic acid according to any of Embodiments 38 to 44, wherein the repressor element is under the control of a constitutive promoter.
[0160] Embodiment 46 comprises an isolated nucleic acid according to any of Embodiments 38 to 45, wherein the inhibitory element is a tetracycline inhibitory protein.
[0161] Embodiment 47 further comprises the isolated nucleic acid described in Embodiment 46, which includes a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding an in-frame transcriptional repression domain.
[0162] Embodiment 48 further comprises an isolated nucleic acid according to any of Embodiments 38 to 47, which further contains the gene of interest.
[0163] Embodiment 49 is a method for producing adeno-associated virus (AAV) in mammalian cells, wherein the mammalian cells are subjected to an adenovirus helper gene including the E2A gene and the E4Orf6 gene under the control of a first desuppressible promoter, an AAV gene including the Rep gene and the Cap gene under the control of a second desuppressible promoter, and a third De-suppressionThe method comprises transfecting a virus-associated non-coding RNA under the control of a possible promoter with an isolated nucleic acid molecule encoding two inverted terminal repeat (ITR) sequences and repressor elements of first, second, and third derepressable promoters; treating mammalian cells with binding partners of the repressor elements; activating the first, second, and third derepressable promoters; producing AAV; and recovering the AAV.
[0164] Embodiment 50 includes the method of Embodiment 49, wherein the mammalian cells are a mammalian cell culture.
[0165] Embodiment 51 includes the method according to Embodiment 50, wherein the mammalian cell culture is a suspension culture.
[0166] Embodiment 52 further includes the method of any one of Embodiments 49 to 51, wherein an internal ribosome entry site (IRES) element is further included between the E2A gene and the E4Orf6 gene.
[0167] Embodiment 53 includes the method of any one of Embodiments 49 to 52, wherein the Rep78 gene is under the control of a second derepressable promoter and the Rep52 gene is under the control of a fourth derepressable promoter.
[0168] Embodiment 54 includes the method of any of Embodiments 49 to 52, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.
[0169] Embodiment 55 includes the method of Embodiment 54, wherein the fourth desuppressable promoter is removed after activation of the desuppressable promoter and before AAV production.
[0170] Embodiment 56 includes the method of Embodiment 53 or 54, wherein the Cap gene is under the control of a natural promoter.
[0171] Embodiment 57 includes the method of any of Embodiments 49 to 56, wherein each of the desuppressable promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0172] Embodiment 58 includes the method of Embodiment 57, wherein the functional promoter of the first desuppressable promoter is a cytomegalovirus (CMV) promoter.
[0173] Embodiment 59 includes the method of any one of Embodiments 49 to 58, wherein the suppression element is under the control of a constitutive promoter.
[0174] Embodiment 60 is the method according to any one of Embodiments 49 to 59, wherein the inhibitory element is a tetracycline inhibitory protein.
[0175] Embodiment 61 includes the method of Embodiment 60, wherein the nucleic acid further comprises a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding an in-frame transcriptional repression domain.
[0176] Embodiment 62 includes the method according to Embodiment 60 or 61, wherein the process includes processing with doxycycline.
[0177] Embodiment 63 includes the method of any of Embodiments 49 to 62, wherein the mammalian cells are Chinese hamster ovary (CHO) cells.
[0178] Embodiment 64 includes the method according to any one of Embodiments 49 to 63, wherein the mammalian cells are human cells.
[0179] Embodiment 65 includes the method of Embodiment 64, wherein the human cells are human embryonic kidney (HEK) cells.
[0180] Embodiment 66 includes the method of any one of Embodiments 49 to 65, wherein the AAV comprises a nucleic acid molecule encoding the gene of interest.
[0181] Embodiment 67 includes the method of Embodiment 66, wherein the AAV contains a gene for therapeutic purposes.
[0182] Embodiment 68 is a method of treatment with adeno-associated virus (AAV), wherein mammalian cells are subjected to adenovirus helper genes, including the E2A gene and the E4Orf6 gene, under the control of a first desuppressable promoter; AAV genes, including the Rep gene and the Cap gene, under the control of a second desuppressable promoter; and a third De-suppression The method comprises transfecting a virus-associated non-coding RNA under the control of a possible promoter with an isolated nucleic acid molecule encoding two inverted terminal repeat (ITR) sequences and repressor elements of first, second, and third derepressable promoters; treating mammalian cells with binding partners of the repressor elements; activating the first, second, and third derepressable promoters; producing AAV; recovering the AAV; and administering the AAV to a mammalian patient.
[0183] Embodiment 69 includes the method of Embodiment 68, wherein the mammalian cells are a mammalian cell culture.
[0184] Embodiment 70 includes the method according to Embodiment 69, wherein the mammalian cell culture is a suspension culture.
[0185] Embodiment 71 further includes the method of any one of Embodiments 68 to 70, wherein an internal ribosome entry site (IRES) element is further included between the E2A gene and the E4Orf6 gene.
[0186] Embodiment 72 includes the method of any one of Embodiments 68 to 71, wherein the Rep78 gene is under the control of a second desuppressible promoter and the Rep52 gene is under the control of a fourth desuppressible promoter.
[0187] Embodiment 73 includes the method of any one of Embodiments 68 to 72, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.
[0188] Embodiment 74 includes the method of Embodiment 73, wherein the fourth desuppressable promoter is removed after activation of the desuppressable promoter and before AAV production.
[0189] Embodiment 75 includes the method of Embodiment 73 or 74, wherein the Cap gene is under the control of a natural promoter.
[0190] Embodiment 76 includes the method of any of Embodiments 68 to 75, wherein each of the desuppressable promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0191] Embodiment 77 includes the method of Embodiment 76, wherein the first desuppressable, functional promoter of the promoter is a cytomegalovirus (CMV) promoter.
[0192] Embodiment 78 includes the method of any one of Embodiments 68 to 77, wherein the suppression element is under the control of a constitutive promoter.
[0193] Embodiment 79 is the method according to any one of Embodiments 68 to 78, wherein the inhibitory element is a tetracycline inhibitory protein.
[0194] Embodiment 80 includes the method of Embodiment 79, wherein the nucleic acid further comprises a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding an in-frame transcriptional repression domain.
[0195] Embodiment 81 includes the method according to Embodiment 79 or 80, wherein the process includes processing with doxycycline.
[0196] Embodiment 82 includes the method of any of Embodiments 68 to 81, wherein the mammalian cells are Chinese hamster ovary (CHO) cells.
[0197] Embodiment 83 includes the method of any one of Embodiments 68 to 82, wherein the mammalian cells are human cells.
[0198] Embodiment 84 includes the method of Embodiment 83, wherein the human cells are human embryonic kidney (HEK) cells.
[0199] Embodiment 85 includes the method of any one of Embodiments 68 to 84, wherein the AAV comprises a nucleic acid molecule encoding the gene of interest.
[0200] Embodiment 86 includes the method of Embodiment 87, wherein the AAV contains a gene for therapeutic purposes.
[0201] Embodiment 87 includes a method according to any one of Embodiments 68 to 86, wherein the administration includes inhalation, injection, or intravenous administration.
[0202] Embodiment 88 is a method for producing adeno-associated (AAV) virus, comprising: transfecting mammalian cells stably expressing TetR and / or one or more nucleic acids encoding TetR with a first nucleic acid encoding adenovirus helper genes, including the E2A gene, the E4Orf gene, and virus-associated non-coding RNA, under the control of a first desuppressable promoter; a second nucleic acid encoding AAV genes, including the Rep gene and the Cap gene, under the control of a second desuppressable promoter; and optionally, a third nucleic acid encoding a gene of interest, under the control of a third desuppressable promoter; treating the mammalian cells with a binding partner of TetR and / or TetR-KRAB; activating the first, second, and third desuppressable promoters; producing AAV; and recovering the AAV.
[0203] Embodiment 89 includes the method of Embodiment 88, wherein the mammalian cells are a mammalian cell culture.
[0204] Embodiment 90 includes the method of any one of Embodiments 88 to 89, wherein the mammalian cells are Chinese hamster ovary (CHO) cells.
[0205] Embodiment 91 includes the method of any one of Embodiments 88 to 90, wherein the mammalian cells are human cells.
[0206] Embodiment 92 includes the method of Embodiment 91, wherein the human cells are human embryonic kidney (HEK) cells.
[0207] Embodiment 93 includes the method of Embodiment 89, wherein the mammalian cell culture is a suspension culture.
[0208] Embodiment 94 includes the method of any one of Embodiments 88 to 90, wherein the mammalian cell further includes an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0209] Embodiment 95 includes the method of any of Embodiments 88 to 91, wherein each of the desuppressable promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0210] Embodiment 96 includes the method of Embodiment 92, wherein the first desuppressable, functional promoter of the promoter is a cytomegalovirus (CMV) promoter.
[0211] Embodiment 97 includes the method of any of Embodiments 88 to 96, wherein stably expressed TetR and / or TetR-KRAB are under the control of a constitutive promoter.
[0212] Embodiment 98 includes the method of Embodiment 97, wherein the nucleic acid encoding TetR-KRAB comprises a KRAB fused in-frame with TetR.
[0213] Embodiment 99 includes a method according to any one of Embodiments 88 to 98, wherein the process includes processing with doxycycline.
[0214] Embodiment 100 includes the method according to any one of Embodiments 88 to 99, wherein each of the first, second, and third nucleic acids is adjacent to a transposon-specific inverted terminal repeat (ITR).
[0215] Embodiment 101 includes the method of any of Embodiments 88 to 100, wherein mammalian cells express a sufficient amount of TetR and / or TetR-KRAB.
[0216] Embodiment 102 includes the method of any one of Embodiments 88 to 101, wherein the AAV includes a gene for therapeutic purposes.
[0217] Embodiment 103 comprises the method of any of Embodiments 88 to 102, further comprising the stable expression of one or more nucleic acids encoding chicken hypersensitivity site-4 (cHS4) adjacent to the TetR and / or TetR-KRAB repressor sequence in mammalian cells.
[0218] Embodiment 104 includes the method of any one of Embodiments 88 to 103, wherein the mammalian cells further include a zeosin resistance gene.
[0219] Embodiment 105 is a method for producing adeno-associated virus (AAV), comprising: stably transfecting mammalian cells with nucleic acids encoding TetR and / or TetR-KRAB repressors, a chicken hypersensitivity site-4 (cHS4) sequence adjacent to TetR and / or TetR-KRAB repressors, and a select gene; and transfecting the stably transfected mammalian cells with an adenovirus helper gene containing an E2A gene, an E4Orf gene, and virus-associated non-coding RNA, under the control of a first desuppressable promoter. The method comprises: stably transfecting a cell with a first nucleic acid encoding a gene, a second nucleic acid encoding an AAV gene including the Rep gene and the Cap gene under the control of a second derepressable promoter, and optionally a third nucleic acid encoding a gene of interest under the control of a third derepressable promoter; treating the stably transfected mammalian cell with a binding partner of TetR; activating the first, second, and third derepressable promoters; producing AAV; and recovering the AAV.
[0220] Embodiment 106 includes the method of Embodiment 105, wherein stably transfected mammalian cells produce a sufficient amount of TetR.
[0221] Embodiment 107 includes the method of either Embodiment 106 or 107, wherein the KRAB suppression domain is fused in frame with TetR. [Examples]
[0222] Example 1: Design and validation of a desuppressable helper gene To drive the expression of the E2A and E4Orf6 genes, a derepressible promoter derived from the pcDNA4 / TO vector (INVITROGEN) was used. This promoter contains a complete CMV promoter with two tetracycline operator sequences (TetO2) inserted between the TATA box and the transcription start site (TSS). In the presence of the tetracycline repressor protein (TetR), transcription initiation was blocked by binding TetR to the TetO2 site. Tetracycline or doxycycline, when added to the culture medium, binds to TetR and alters its conformation. This results in the release of TetR and derepressibility / activation of the CMV promoter, leading to induction of gene expression (Figure 1 shows the off and on conformations of the TETR / TetO2 derepressible promoter system).
[0223] To simplify the design and improve stability, an internal ribosome entry site (IRES) element was used to initiate translation of E4Orf6 after E2A in a single expression cassette driven by a single inducible CMV promoter (Figure 1).
[0224] To induce VA I non-coding RNA, an H1 promoter with TetO2 inserted was applied (see, e.g., Wiederschain et al., “Single-vector inducible lentiviral RNAi system for oncology target validation,” Cell Cycle 8:498-504 (2009)). Similarly, the addition of doxycycline released TetR and turned on VA I expression (Figure 1).
[0225] As described above, a TetR gene expression cassette is included for the control of a desuppressible promoter (see Figure 1). A constitutive human PGK promoter is used to drive the expression of TetR, followed by the expression of IRES, which directs the expression of puromycin N-acetyltransferase used to select cells into which the transposon has been incorporated (see Figure 2A).
[0226] To reduce potential leaky expression from desuppressible promoters, an enhanced TetR was also included (see, e.g., Szulc et al., “A versatile tool for conditional gene expression and knockdown,” Nature Methods 3:109-116 (2006)). Briefly, the potent repressive domain of KRAB was fused in a flame to the C-terminus of the original TetR, which enhances its repressive activity and minimizes underlying gene expression before induction. To facilitate nuclear entry of the larger TetR-KRAB fusion protein, the SV40 nuclear localization signal (NLS) was also inserted (Figure 2A, Figures 12A-12B).
[0227] The sequence of the pcDNA3.1-E2A-E4-VA-TetR vector shown in Figure 2A is provided below.
[0228] iHelper1 / pcDNA3.1-E2A-E4-VA-TetR(11,986bp)
[0229]
[0230] The sequence of the pcDNA3.1-E2A-E4-VA-TetR-V2 vector shown in Figure 2B is provided below.
[0231] iHelper2 / pcDNA3.1-E2A-E4-VA-TetR-V2(11,641bp)
[0232]
[0233] For use in transient transfection-mediated AAV production, all transfer plasmids containing a desuppressible helper (piHelper1) and a TetR expression cassette were tested. As shown in Figure 3, when the plasmids were co-transfected with control pRep-Cap and pAAV-GOI plasmids, the addition of Dox activated AAV production to approximately 30% of the level of the control helper vector that supports constitutive helper gene expression. Therefore, the desuppressible helper construct functioned for AAV production upon induction.
[0234] Example 2: Design and validation of an unrepressible Rep-Cap gene The challenges for Rep protein production are doubled. Firstly, the ratio of Rep78 to Rep52 must be maintained during induction for high-titer AAV production. Secondly, the p19 promoter required for Rep52 expression is located within the coding region of Rep78, which presents a challenge in including a derepressable promoter. To overcome these challenges, we developed two strategies (Figures 4A-4C).
[0235] First, to preserve the innate regulation of Rep gene expression (see Figure 4A), the original viral promoter was retained but modified by inserting two TetO sites around the TATA box and TSS. Two copies of the TetO sites were inserted into an upstream cleaved p5 promoter having a core element containing the TATA box, Rep-binding element (RBE), and YY1 site. Furthermore, a wild-type copy of the p5 promoter, acting as an enhancer, was placed downstream of the Cap gene to support both Rep and Cap expression (Figure 5) (see, for example, U.S. Patent No. 5,622,856).
[0236] The sequence of the desuppressable p5 promoter shown in Figure 5 is as follows:
[0237] min-p5-i1 TATTTAATCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 3)
[0238] min-p5-i2 TATTTAAtcTCCCTATCAGTGATAGAGAtcGCCCGAGTGAGCACGCAGGGTCTCCATTTTGATCCCTATCAGTGATAGAGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 4)
[0239] min-p5-i3 TCCCTATCAGTGATAGAGAtcTATTTAAGCCCGAGTGAGCACGCAGTCCCTATCAGTGATAGAGAGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 5)
[0240] Similarly, two copies of the TetO site were also inserted into the p19 promoter adjacent to the TSS site (Figure 6). To minimize interference with such insertions and maximize the original activity of these viral promoters, three insertion methods for the TetO site were designed for each promoter for best performance. Thus, a total of nine variations were examined (iRepCap1 to iRepCap9).
[0241] The sequence of a desuppressable promoter including p19, as illustrated in Figure 6, is provided below.
[0242] p19-i1 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 6)
[0243] p19-i2 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagTCCCTATCAGTGATAGAGActccagtgggcgtggactaatatggaacagtatttaagcgcctgTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 7)
[0244] p19-i3 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaaTCCCTATCAGTGATAGAGAcagtatttaagcgcctgTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 8)
[0245] Two methods were developed for the placement of a derepressible p19 promoter. In the first method, a separate expression cassette for Rep52 was produced, driven by the derepressible p19 promoter. In the first method, shown in Figure 4B, the original p19 promoter in the Rep78ORF was silenced by altering six nucleotides in the three core regulatory elements (SP1, TATA-1, and TATA-2 sites) required for p19 activity. These modifications did not alter the Rep78 protein sequence. Rep78 was controlled by a derepressible p5 promoter.
[0246] In the second method, an artificial intron was created for the insertion of the TetO site in the Rep78ORF (Figure 4C). A chimeric intron between a human β-globin-derived intron and an immunoglobulin heavy chain gene was fitted by replacing the non-essential internal sequence with the TetO2 site (Figure 7A). The new artificial intron was inserted in situ 1 bp or 25 bp downstream of TATA-2 in the p19 promoter (iRepCap-10 and iRepCap11) (Figures 4B and 7B). The new p19 promoter with an intron containing an adjacent TetO ensured suppression of Rep52 gene expression before induction while also enabling Rep78 protein expression after intron removal during mRNA splicing. Splicing efficiency was evaluated by PCR analysis of cDNA.
[0247] The nucleic acid sequences of the intron-based p19 promoter illustrated in Figures 7A and 7B are provided below.
[0248] In-p19-i1 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagt atttaaggtaagtTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtactgacatccactttgcctttctctccacagcgcctgtttgaatctcacggag (SEQ ID NO: 9)
[0249] In-p19-i2 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagta tttaagcgcctgtttgaatctcacggaaaggtaagtTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtactgacatccactttgcctttctctccacag (SEQ ID NO: 10)
[0250] To test the activity of 11 inducible Rep-Cap designs, HEK293 cells were transfected with one of the vectors as well as standard pHelper and pAAV-GFP for AAV production. Three days after transfection, cells were harvested for Rep-Cap protein expression and AAV titer analysis. Western blot analysis revealed varying expression levels of Rep and Cap proteins, many maintaining a similar Rep78 to Rep52 ratio as the control RepCap vector (Figure 8A). qPCR analysis of AAV titer showed that the designs performed similarly to or had higher titers than the control triple transfection (Figure 8B).
[0251] To test the performance of both inducible helper and inducible Rep-Cap designs together, HEK293 cells were transfected with selected iRepCap vectors, iHelper1 / 2, and pAAV-GFP, and left untreated or treated with doxycycline for 3 days. As shown in Figure 9A, Rep and Cap protein expression was induced only by the addition of Dox and the desuppression of the desuppressible promoter. Consequently, AAV titers increased significantly by more than 10-25 times upon desuppression (Figure 9B).
[0252] To stably incorporate iHelper and iRepCap, iHelper1 / 2 and iRepCap10 were selected together with AAV-GFP to assemble a functional cassette into a single PIGGYBAC® transposon transfer vector PB007 (Transposagen, Inc., Lexington, KY). Figures 10A–10D show plasmid constructs used for integration into mammalian cells, preferably HEK293 cells. To facilitate future addition of specific AAV genes of interest, some of the transcription vectors did not contain AAV-GFP (Figures 10A and 10B). HEK293 cells were transfected with both the transfer vector and transposase mRNA, and the integrated cell pool was enriched by puromycin selection. Single-cell clones were isolated and screened for AAV production with or without Dox treatment to activate derepression.
[0253] The nucleic acid sequence of the vector shown in Figure 10A is provided below.
[0254] PB007-iHelper1-iRepCap10 / PBBG7(18,281bp)
[0255] The vector sequence shown in Figure 10B is provided below.
[0256] PB007-iHelper2-iRepCap10 / PBBG8(17,936bp)
[0257] The vector sequence shown in Figure 10C is provided below.
[0258] PB007-iHelper1-iRepCap10-AAV-GFP / PBBG9(21,391bp) AGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT(SEQ ID NO: 13)
[0259] The sequence of the vector shown in FIG. 10D is provided below.
[0260] PB007-iHelper2-iRepCap10-AAV-GFP / PBBG10(21,046bp) AACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT(SEQ ID NO: 14)
[0261] Sequence of an additional vector for use in practicing the present invention:
[0262] iRepCap1 / pKan-Anc80-RepCap-p5i1-p19i1(10,497bp)
[0263] agtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 15)
[0264] iRepCap2 / pKan-Anc80-RepCap-p5i2-p19i1(10,495bp)
[0265] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 16)
[0266] iRepCap3 / pKan-Anc80-RepCap-p5i3-p19i1 (10,493 bp)
[0267] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 17)
[0268] iRepCap4 / pKan-Anc80-RepCap-p5i1-p19i2(10,495 bp)
[0269] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc (SEQ ID NO: 18)
[0270] iRepCap5 / pKan-Anc80-RepCap-p5i2-p19i2 (10,493 bp)
[0271] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 19)
[0272] iRepCap6 / pKan-Anc80-RepCap-p5i3-p19i2(10,491 bp)
[0273] gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 20)
[0274] iRepCap7 / pKan-Anc80-RepCap-p5i1-p19i3(10,495 bp)
[0275] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 21)
[0276] iRepCap8 / pKan-Anc80-RepCap-p5i2-p19i3(10,493 bp)
[0277] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 22)
[0278] iRepCap9 / pKan-Anc80-RepCap-p5i3-p19i3(10,491bp)
[0279] gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 23)
[0280] iRepCap10 / pKan-Anc80-intron-inducible RepCap (7,567 bp)
[0281]
[0282] iRepCap11 / pKan-Anc80-Intron-Induced RepCap-d2 (7,567 bp)
[0283]
[0284] The sequence of the PBBG-iHelper-Puro construct shown in Figure 11A is shown below:
[0285] PBBG-iHelper-Puro (11,801bp)
[0286]
[0287] The sequence of the PBBG-ITRGFP construct shown in Figure 11B is shown below:
[0288] PBBG-ITRGFP (7,798 bp)
[0289]
[0290] The sequence of the PBBG-iRC8 construct shown in Figure 11C is as follows:
[0291] PBBG-iRC8 (9,399bp)
[0292]
[0293] The sequence of the PBBG-iRC9 construct shown in Figure 11D is as follows:
[0294] PBBG-iRC9 (9,393bp)
[0295]
[0296] The sequence of the PBBG-Anc80iRC construct shown in Figure 11E is as follows:
[0297] PBBG-Anc80iRC (9,393bp)
[0298]
[0299] The sequence of the pcDNA-TetR-In construct shown in Figure 12A is shown below:
[0300] pcDNA-TetR-In(7147bp)
[0301]
[0302] The sequence of the pcDNA-TetR-KRAB-Ins construct shown in Figure 12B is as follows:
[0303] pcDNA-TetR-KRAB-Ins(7493bp)
[0304]
[0305] It will be readily apparent to those skilled in the art that other suitable modifications and adaptations to the methods and uses described herein can be made without departing from the scope of any of the embodiments.
[0306] While this specification illustrates and describes specific embodiments, it should be understood that the claims should not be limited to any particular form or arrangement of the described and illustrated portions. While exemplary embodiments are disclosed and specific terminology is used here, these are used only in a general and descriptive sense, and not for limiting purposes. Modifications and variations of the embodiments are possible in light of the above teachings. Therefore, it should be understood that embodiments may be carried out in ways other than those specifically described.
[0307] All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent that each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference.
Claims
1. A method for producing adeno-associated virus (AAV), a. A mammalian cell comprising one or more nucleic acids encoding TetR and / or TetR-KRAB, which stably expresses said TetR and / or TetR-KRAB, i. A first nucleic acid encoding an adenovirus helper gene, including the E2A gene, the E4Orf6 gene, and virus-associated non-coding RNA, under the control of a first derepressable promoter containing a functional promoter and two tetracycline operator sequences (TetO2), ii. A second nucleic acid encoding the AAV gene, including the Rep gene and the Cap gene, under the control of a functional promoter and a second desuppressable promoter including Teto2, iii. Transfecting with a third nucleic acid encoding the gene of interest, under the control of a functional promoter and a third desuppressable promoter containing Teto2, b. Treating the mammalian cells with the binding partner of TetR, c. Activating the first, second, and third desuppressable promoters, d. Producing the AAV, e. A method comprising recovering the AAV.
2. The method according to claim 1, wherein the mammalian cells are mammalian cultured cells.
3. The method according to claim 1 or 2, wherein the mammalian cells are Chinese hamster ovary (CHO) cells.
4. The method according to claim 1 or 2, wherein the mammalian cell is a human cell.
5. The method according to claim 4, wherein the human cells are human embryonic kidney (HEK) cells.
6. The method according to claim 2, wherein the mammalian cultured cells are suspension cultured cells.
7. The method according to any one of claims 1 to 3, wherein the first nucleic acid further comprises an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
8. The method according to claim 1, wherein the functional promoter of the first desuppressable promoter is a cytomegalovirus (CMV) promoter.
9. The method according to any one of claims 1 to 8, wherein the nucleic acid encoding TetR and / or TetR-KRAB is under the control of a constitutive promoter.
10. The method according to claim 9, wherein the nucleic acid encoding TetR-KRAB comprises a sequence encoding KRAB fused in-frame with TetR.
11. The method according to any one of claims 1 to 10, wherein the treatment comprises treatment with doxycycline.
12. The method according to any one of claims 1 to 11, wherein each of the first, second, and third nucleic acids is adjacent to a transposon-specific inverted terminal repeat (ITR).
13. The method according to any one of claims 1 to 12, wherein the mammalian cells express a sufficient amount of TetR and / or TetR-KRAB to suppress the desuppressable promoter.
14. The method according to any one of claims 1 to 13, wherein the AAV includes a gene for therapeutic purposes as the gene for the purpose.
15. The method according to any one of claims 1 to 14, further comprising the stable expression of one or more nucleic acids encoding chicken hypersensitivity site-4 (cHS4) adjacent to the nucleic acid encoding TetR and / or TetR-KRAB.
16. The method according to any one of claims 1 to 15, wherein the mammalian cell further comprises a select gene.
17. A method for producing adeno-associated virus (AAV), a. Mammalian cells, Nucleic acids encoding TetR and / or TetR-KRAB, The chicken hypersensitivity site-4 (cHS4) sequence adjacent to the nucleic acid encoding TetR and / or TetR-KRAB, To stably transfect with a selected gene and express the aforementioned TetR and / or TetR-KRAB, b. The stably transfected mammalian cells i. A first nucleic acid encoding an adenovirus helper gene, including the E2A gene, the E4Orf6 gene, and virus-associated non-coding RNA, under the control of a first desuppressable promoter containing a functional promoter and Teto2, ii. A second nucleic acid encoding the AAV gene, including the Rep gene and the Cap gene, under the control of a functional promoter and a second desuppressable promoter including Teto2, iii. Transfecting with a third nucleic acid encoding the gene of interest, under the control of a functional promoter and a third desuppressable promoter containing Teto2, c. Treating the stably transfected mammalian cells with the binding partner of TetR, d. Activating the first, second, and third desuppressable promoters, e. Producing the aforementioned AAV, f. A method comprising recovering the AAV.
18. The method according to claim 17, wherein the stably transfected mammalian cells produce a sufficient amount of TetR and / or TetR-KRAB to suppress the desuppressable promoter.
19. The method according to claim 17 or 18, wherein the nucleic acid encoding TetR-KRAB comprises a sequence encoding KRAB fused in frame with TetR.
Citation Information
Patent Citations
Method for enhancing production efficiency of recombinant aav
JP2001512674A
Cell for producing virus vector, method for producing the virus vector and method for producing virus vector using the cell
JP2002153278A
Pharmacologically induced transgene ablation system
JP2013529063A
Systems for stable gene expression
JP2018508223A
Method for generating replication defective viral vectors that are helper free
US20030152914A1