Methods for determining the risk of developing a disease and / or the severity of the disease

JP7916604B2Active Publication Date: 2026-09-08KYOTO PREFECTURAL PUBLIC UNIV CORP +2
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2024124643
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-07-31
Publication Date
2026-09-08
Estimated Expiration
2044-07-31

AI Technical Summary

Benefits of technology

【0011】 本発明の判定するための方法によれば、糞便から得られた腸内細菌叢の情報に基づいて、その糞便が由来する幼児期から18歳未満の個体における摂食障害を伴う疾患の発症リスク及び/又は重症度を判定することができる。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007916604000003
    Figure 0007916604000003
  • Figure 0007916604000004
    Figure 0007916604000004
  • Figure 0007916604000005
    Figure 0007916604000005
Patent Text Reader

Abstract

An object of the present invention is to identify an intestinal bacterium capable of detecting disturbance of intestinal bacterial flora leading to a disease in a child, and to provide a simple method for detecting a disease based on the same.SOLUTION: Provided is a method for determining the onset risk and / or severity of a disease associated with an eating disorder in an individual from early childhood to less than 18 years of age, comprising a nucleic acid extraction step of extracting nucleic acids from feces derived from the individual, and a measurement step of measuring the ratio of nucleic acids derived from Blautiawexlerae to total nucleic acids derived from bacteria based on sequence information of the nucleic acids, wherein the ratio lower than a predetermined reference value indicates that the onset risk and / or severity of the disease in the individual is high.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to biomarkers, methods, kits, and devices for determining the risk of developing and / or the severity of a disease. [Background technology]

[0002] Abnormalities that occur during early childhood, a crucial stage of physical and mental development, often progress to irreversible diseases in adulthood. Even in such cases, it has been suggested that mitigating the severity of the abnormality during its onset, i.e., early childhood, can significantly alter the symptoms of the disease in adulthood.

[0003] In recent years, advancements in gut microbiota analysis using molecular biological techniques have led to a wealth of new insights into the gut microbiota. This has revealed that the gut microbiota is involved not only in digestive diseases but also in various systemic diseases (Non-Patent Literature 1).

[0004] This is also true for children, with reports of relationships between the gut microbiota and various diseases such as atopic dermatitis, obesity, inflammatory bowel disease, and epilepsy. However, due to difficulties in sample collection and other reasons, the number of reported cases was not as large as that for adults. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Atarashi K, et al., Cell, 2015, 163: 367-380 [Overview of the project] [Problems that the invention aims to solve]

[0006] Research investigating the relationship between gut microbiota and disease often focuses on the relationship between the overall behavior of the gut microbiota and disease. On the other hand, studies that detect disease-related disruption of the gut microbiota (dysbiosis) based on only a limited number of gut bacteria are not common, even in adults.

[0007] To enable the detection of abnormalities in early childhood, continuous monitoring, and intervention, and to realize low-burden testing and treatment applicable to children, a simple disease diagnosis method based on a limited range of intestinal bacteria is needed in children.

[0008] Therefore, the object of the present invention is to identify intestinal bacteria that can detect disturbances in the intestinal microbiota that lead to diseases in children, and to provide a simple method for detecting diseases based on these bacteria. [Means for solving the problem]

[0009] To address the above issues, the inventors conducted a cross-sectional integrated analysis of all studies on individual diseases to date, searching for intestinal bacteria that fluctuate commonly across various diseases. As a result, they identified intestinal bacteria that fluctuate significantly in various diseases involving eating disorders, and found that their relative proportions are deeply related not only to the presence or absence of the disease but also to its severity. The present invention is based on these novel findings and provides the following.

[0010] [1] A method for determining the risk and / or severity of a disease involving a feeding disorder in an individual from infancy to under 18 years of age, comprising a nucleic acid extraction step of extracting nucleic acids from feces derived from the individual, and a measurement step of measuring the ratio of nucleic acids derived from Blautia wexlerae to total nucleic acids derived from bacteria based on the sequence information of the nucleic acids, wherein a ratio lower than a predetermined standard value indicates a high risk and / or severity of the disease in the individual. [2] The method according to [1], wherein the nucleic acid is a 16S rRNA gene and / or an RNA-binding protein gene. [3] The method according to [2], wherein the RNA-binding protein gene is an elongasomal regulatory protein gene. [4] The method according to any one of [1] to [3], wherein the disease is one or more selected from the group consisting of developmental disorders, food allergies, severe intellectual and physical disabilities, constipation, and diarrhea. [5] A kit for determining the risk and / or severity of feeding disorders in individuals from infancy to under 18 years of age, comprising probes that hybridize to the nucleotide sequences of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acids derived from Blautia wexlerae. [6] The kit according to [5] further comprises a set of primers for amplifying the 16S rRNA gene and / or RNA-binding protein gene. [7] A device for determining the risk and / or severity of feeding disorders in individuals from infancy to under 18 years of age, comprising a probe that hybridizes to the nucleotide sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acids derived from Blautia wexlerae. [8] A biomarker for diseases involving feeding disorders in individuals from infancy to under 18 years of age, consisting of nucleic acids derived from Blautia wexlerae. [9] A composition comprising Blautia wexlerae for the treatment of diseases involving feeding disorders in individuals from infancy to under 18 years of age. [Effects of the Invention]

[0011] According to the method for determination of the present invention, based on information about the intestinal microbiota obtained from feces, it is possible to determine the risk and / or severity of diseases accompanied by feeding disorders in individuals from infancy to under 18 years of age from whom the feces originated. [Brief explanation of the drawing]

[0012] [Figure 1]This is a graph showing the abundance ratio of *Blautia A_141781* genus bacteria in feces of normal individuals, food allergy individuals, and ASD individuals. In the figure, "*" indicates that p<0.05, and "n.s." indicates that there was no significant difference. [Figure 2] This is a graph showing the abundance ratio of *Blautia A_141781* genus bacteria in feces of ASD individuals administered with PHGG, before and after PHGG administration. In the figure, "*" indicates that p<0.05. [Figure 3] This is a graph showing the abundance ratio of *Blautia A_141781* genus bacteria in feces of neurotypical individuals and individuals with severe physical and intellectual disability. The numerical values at the top of the graph indicate p-values. [Figure 4] This is a graph showing the abundance ratio of bacteria having a 16S rRNA gene comprising the nucleotide sequence set forth in SEQ ID NO: 13 (hereinafter referred to as "bacteria 38f") in feces of various individuals. Figure 4A shows the results for normal individuals, food allergy individuals, and ASD individuals. Figure 4B shows the results for ASD individuals administered with PHGG, before and after PHGG administration. Figure 4C shows the results for neurotypical individuals and individuals with severe physical and intellectual disability. [Figure 5] This is a graph showing the relationship between fecal organic acid concentration and the abundance ratio of bacteria 38f in individuals aged 2 to 12 years. Figure 5A shows the relationship with fecal acetic acid concentration, and Figure 5B shows the relationship with total fecal volatile organic acid concentration. In the figure, dots represent plots of each data point, the straight line represents an approximate straight line, and the shaded area represents the 95% confidence interval of the approximate straight line. [Figure 6] This is a graph showing the relationship between fecal organic acid concentration and the abundance ratio of bacteria 38f in individuals aged 19 to 25 years. Figure 6A shows the relationship with fecal acetic acid concentration, and Figure 6B shows the relationship with total fecal volatile organic acid concentration. In the figure, dots represent plots of each data point, the straight line represents an approximate straight line, and the shaded area represents the 95% confidence interval of the approximate straight line. [Figure 7] This is a graph showing the relationship between the results for *Blautia* genus bacteria and the results for bacteria 38f. In the figure, an approximate straight line is shown as a broken line, together with the equation and R value. [Figure 8]It is a graph showing the abundance ratio of *Blautia* genus bacteria in feces among various individuals. In the figure, each open circle represents a plot of each data point, and each closed circle represents a plot corresponding to each cutoff value. [Figure 9] It is a graph showing the relationship between the ratio of *Blautia wexlerae* measured by real-time PCR and the results of metagenomic analysis. Figure 9A shows the relationship with the results for bacterium 38f in metagenomic analysis, and Figure 9B shows the relationship with the results for *Blautia* genus bacteria in metagenomic analysis. In the figure, an approximate straight line is shown by a broken line together with the equation and R value.

Mode for Carrying Out the Invention

[0013] 1. Biomarker 1-1. Outline A first aspect of the present invention provides a biomarker for determining the onset risk and / or severity of a disease associated with an eating disorder. The biomarker of this aspect can be used in the determination method of the second aspect.

[0014] 1-2. Definitions Terms used in the present specification are defined below. As used herein, the "intestine" refers to the human gastrointestinal tract distal to the duodenum. Specific examples include the small intestine including the duodenum, jejunum, and ileum, and the large intestine including the cecum, appendix, colon, and rectum.

[0015] As used herein, the "gut microbiota" refers to an assembly of various bacteria or microorganisms that inhabit the interior of the human intestinal tract, and the ecosystem of the microbial community. Although the composition greatly varies depending on the individual, age, and dietary habits, a certain balance is maintained in the intestinal tract. It is known that gut microbiota not only promotes the digestion and absorption of food in the intestinal tract and antibody production, but also contributes to the suppression of colonization and proliferation of foreign microorganisms, and host metabolism and immunity. As used herein, "gut bacteria" refers to various bacteria that constitute the gut microbiota. It is said that human gut bacteria exist in units of 100 trillion, and there are more than 1000 different species.

[0016] Blautia wexlerae is an enterobacterium belonging to the genus Blautia, and is an anaerobic, Gram-positive bacterium. The representative 16S rRNA of Blautia wexlerae is the nucleotide sequence shown in Sequence ID No. 1.

[0017] In this specification, "individual" refers to a human individual that is the subject of the determination method of the present invention.

[0018] In this specification, "early childhood" refers to the period from weaning to preschool age. In this specification, early childhood encompasses both early and late childhood.

[0019] In this specification, "feces" broadly refers to the contents of the intestines. For example, it includes both feces after they have been expelled from the body and the contents of the intestines before they are expelled. The region of the intestine from which the feces originate is not particularly limited. Specifically, examples include the small intestine, including the duodenum, jejunum, and ileum, and the large intestine, including the cecum, appendix, colon, and rectum. Preferably, the feces originate from the large intestine. If the feces originate from the large intestine, they may originate from any region, for example, the ascending colon, transverse colon, descending colon, sigmoid colon, upper rectum, or lower rectum.

[0020] In this specification, "nucleic acid" refers to polynucleotides or oligonucleotides contained in feces, and in principle, to natural nucleic acids. Specifically, this includes DNA and RNA.

[0021] In this specification, “disease” means any condition or disorder that impairs or interferes with the normal function of a cell, tissue, or organ.

[0022] In this specification, "eating disorders" refers to disorders characterized by abnormalities in eating behavior, such as the amount of food consumed and / or the manner of eating. Examples of abnormalities in food consumption include overeating and anorexia, while examples of abnormalities in eating habits include picky eating.

[0023] "Picky eating" refers to the complete absence of certain foods that are normally consumed and / or the consumption of certain foods in excessive amounts. While not strictly limited, picky eating may also be based on sensory hypersensitivity or hyposensitivity (e.g., taste, smell, touch).

[0024] In this specification, "disease risk" refers to the likelihood of developing a disease. In this specification, disease risk includes not only the likelihood of developing a specific disease, but also, for example, the possibility of deterioration in health conditions that serve as preliminary indicators of disease onset (such as physical characteristics like weight and height, diet, exercise, and sleep).

[0025] In this specification, "base identity" refers to the percentage (%) of identical bases in one polynucleotide relative to the total number of bases in the other polynucleotide, after the base sequences of two polynucleotides have been aligned and, if necessary, gaps have been introduced into one of the base sequences to maximize the degree of base agreement between the two. % identity can be easily determined using known programs such as the homology search program BLAST (Basic local alignment search tool; Altschul, SF et al, J. Mol. Biol., 215, 403-410, 1990).

[0026] In this specification, "significant" means statistically significant. Statistical significance means that when the difference between the measured value of the subject and the control value is statistically analyzed, there is a significant difference between the two. For example, a small significance level for the obtained value is, specifically, less than 5% (p<0.05), less than 1% (p<0.01), or less than 0.1% (p<0.001). Here, "p(value)" indicates the probability that the test statistic happens to reach that value within the distribution based on the null hypothesis in a statistical test. Therefore, the smaller "p" is, the lower the probability that the test statistic reaches that value, and the more likely the null hypothesis is to be rejected. The statistical testing method is not particularly limited; any known test method capable of determining the presence or absence of significance may be used as appropriate. For example, the Student's t-test, covariate analysis of variance, etc., can be used.

[0027] In this specification, "biomarker" means a biomolecule (e.g., nucleic acid molecules or protein molecules) that serves as an indicator for determining the presence or absence of disease or the risk of developing a disease.

[0028] "One or more" refers to 1 to 10 items, preferably 1 to 5 items, more preferably 1 to 4 items, more preferably 1 to 3 items, and particularly preferably 1 or 2 items.

[0029] 1-3. Structure The biomarker of the present invention consists of nucleic acids derived from Blautia wexlerae. The specific species within Blautia wexlerae are not particularly limited. For example, bacteria having a 16S rRNA gene containing the nucleotide sequence shown in SEQ ID NO: 13 (hereinafter referred to as "bacterium 38f") can be suitably used. Similarly, bacteria having a 16S rRNA gene containing a nucleotide sequence that includes one or more base deletions, substitutions, additions, or insertions in the nucleotide sequence shown in SEQ ID NO: 13, and bacteria having a 16S rRNA gene containing a nucleotide sequence that has 90% or more nucleotide identity with respect to the nucleotide sequence shown in SEQ ID NO: 13 can also be suitably used.

[0030] The nucleic acid in this embodiment is not particularly limited, as long as it is a nucleic acid that can be distinguished as originating from Blautia wexlerae. Preferably, the nucleic acid in this embodiment is distinguishable from closely related species of Blautia wexlerae. The closely related species in this case are not particularly limited, but examples include Blautia luti, Blautia glucerasea, Blautia faecis, Blautia massiliensis, Blautia schinkii, Blautia obeum, Blautia caecimuris, Blautia producta, Blautia pseudococcoides, Blautia coccoides, Blautia hansenii, etc.

[0031] The type of nucleic acid is not particularly limited, but preferably it is the genomic DNA of Blautia wexlerae and / or nucleic acids derived therefrom.

[0032] The specific gene regions used are not particularly limited. For example, RNA-binding protein gene regions and / or rRNA gene regions can be suitably used.

[0033] "rRNA (ribosomal RNA)" refers to the RNA that makes up ribosomes. Examples of rRNA found in bacteria include 23S rRNA, 16S rRNA, 5S rRNA, or combinations thereof. For example, the representative 16S rRNA gene of Blautia wexlerae has the base sequence shown in Sequence ID No. 1.

[0034] An "RNA-binding protein" is a protein that binds to RNA and regulates its function and morphology. Typically, it possesses one or more RNA-binding domains, such as a KH domain or R3H domain. RNA-binding proteins with a KH domain are specifically called KH-domain proteins. An RNA-binding protein gene is a gene that codes for an RNA-binding protein.

[0035] The specific types of RNA-binding protein genes are not limited. Examples include KH domain protein genes, specifically KhpA RNA-binding protein family protein genes and elongasome regulating protein genes.

[0036] Elongasomal regulatory proteins are another name for the KhpB RNA-binding protein family of proteins, and they contain a KH domain and an R3H domain as RNA-binding domains.

[0037] When using elongasomal regulatory protein genes, the specific gene is not limited. For example, the Jag / EloR gene can be used. Jag / EloR is a protein that has a Jag domain at its N-terminus. A representative Jag / EloR gene from Blautia wexlerae has the nucleotide sequence shown in SEQ ID NO: 2.

[0038] The biomarker of the present invention may be a nucleic acid fragment that constitutes a part of the above-mentioned gene. In this case, the nucleic acid fragment only needs to indicate the expression of the target protein or gene, rather than other proteins or genes, and its length is not particularly limited. Specifically, for example, it may be 15 bases or more, 17 bases or more, 19 bases or more, 20 bases or more, 25 bases or more, 30 bases or more, 40 bases or more, 50 bases or more, 100 bases or more, 200 bases or more, 300 bases or more, 500 bases or more, 1000 bases or more, 1500 bases or more, or 2000 bases or more.

[0039] The biomarker of the present invention is a biomarker for diseases accompanied by eating disorders. Diseases accompanied by eating disorders are not particularly limited. Examples include developmental disorders, food allergies, severe intellectual and physical disabilities, constipation, diarrhea, obesity, and diabetes. Developmental disorders include, for example, autism spectrum disorder (ASD). Preferably, diseases accompanied by eating disorders are those accompanied by defecation disorders (diarrhea and / or constipation). Preferably, diseases accompanied by eating disorders are those accompanied by disruption of the intestinal flora (dysbiosis). For example, diseases accompanied by eating disorders may be those accompanied by a decrease in the concentration of organic acids in feces. The type of organic acid in this case is not particularly limited, but for example, volatile fatty acids. Generally, fatty acids with 1 to 6 carbon atoms are volatile. Specific types of organic acids are not particularly limited, but examples include formic acid, acetic acid, butyric acid, isobutyric acid, propionic acid, valeric acid, isovaleric acid, caproic acid, etc. The concentration of organic acids can be measured by any known method (for example, high-performance liquid chromatography (HPLC)). Specifically, for example, it can be measured according to the method described in Tsukahara et al. (2014) (DOI: 10.1111 / asj.12188).

[0040] "Developmental disorders" refer to mental illnesses based on brain dysfunction that manifest at a young age. Developmental disorders include autism spectrum disorder (ASD), learning disabilities, attention deficit hyperactivity disorder, and others.

[0041] Autism Spectrum Disorder (ASD) is a general term for developmental disorders characterized by persistent deficits in social communication and interpersonal interaction from early development, as well as behaviors, interests, or repetitive behaviors. It broadly includes disorders that were previously classified as early infant autism, childhood autism, Kanner autism, high-functioning autism, atypical autism, pervasive developmental disorder not otherwise specified, childhood disintegrative disorder, Asperger's syndrome, etc. It is often accompanied by eating disorders such as picky eating, and in some cases, constipation or diarrhea occurs. Diagnosis of ASD can be made through interviews, behavioral observations, and / or tests. While there are no specific limitations on the methods of judgment, examples of usable tools include the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-5), the Pervasive Developmental Disorders Scale (PARS) of the Japan Autism Association, the Infant Autism Checklist (M-CHAT), the Japanese version of the Autism Spectrum Quotient (AQ) Test, the WISC-IV Intelligence Scale, the Tanaka-Binet Intelligence Scale, the Diagnostic Inventory of Autism (ADI-R), the Diagnostic Observational Scale for Autism, 2nd Edition (ADOS-2), the Diagnostic Interview for Social and Communication Disorders (DISCO), the Wechsler Intelligence Scale (WAIS), or a combination thereof.

[0042] "Food allergy" refers to a condition in which an allergic reaction occurs after ingesting or coming into contact with a specific food. While not strictly limited, food allergies can be diagnosed through tests such as serum allergen-specific IgE antibody tests, skin prick tests, and oral food challenge tests, as well as through a medical history of clinical symptoms, or a combination thereof.

[0043] "Severe intellectual and physical disability" refers to a condition in which severe physical disability and severe intellectual or mental disability coexist. Typically, it refers to a state in which there are significant difficulties in behavior and assistance is required in daily life. It is known that it is often accompanied by eating disorders such as picky eating and diarrhea is frequently present. Although not particularly limited, it can be judged based on Oshima's classification. Specifically, for example, if an individual falls within the range of 1 to 4 in Oshima's classification, they can be judged as having severe intellectual and physical disability. Alternatively, for example, if an individual falls into level V on the Gross Motor Function Measure (GMFM) and / or level V on the Manual Ability Classification System (MACS), they may be judged as having severe intellectual and physical disability. The causes of severe intellectual and physical disability are not particularly limited, but examples include birth defects, low birth weight, exogenous disorders (encephalitis, etc.), and symptomatic disorders (epilepsy, etc.).

[0044] "Constipation" refers to insufficient bowel movements accompanied by a feeling of incomplete evacuation. Typically, this includes cases where spontaneous bowel movements occur less than three times a week, or where there has been no bowel movement for three days or more. Alternatively, it can be judged based on the condition of the stool. For example, it can be judged based on evaluation using the Bristol Stool Scale or the moisture content of the stool. For example, with the Bristol Stool Scale, a score of 2 or less, specifically 1 and / or 2, can be considered constipation. Alternatively, when judging based on the moisture content of the stool, constipation can be judged when the moisture content is 70% or less, for example, 70% or less, 69% or less, or 68.5% or less.

[0045] "Diarrhea" refers to a condition in which the water content of feces increases. In this specification, loose stools are also included. Typically, it refers to cases where the water content of feces exceeds 70%, for example, 75% or more, 77% or more, 78% or more, 79% or more, 80% or more, 85% or more, or 90% or more. Although not particularly limited, judgments may also be made based on qualitative criteria, such as evaluation based on the Bristol Stool Scale. For example, with the Bristol Stool Scale, a score of 6 or higher, specifically 6 and / or 7, can be considered diarrhea.

[0046] The individuals to whom the biomarkers of the present invention can be applied are not particularly limited to human individuals from infancy to under 18 years of age. Preferably, they are human individuals from cultural spheres where rice is one of the staple foods. For example, this includes inhabitants of East Asia, Central Asia, South Asia, Southeast Asia, and West Asia. Furthermore, individuals from whom the feces are derived are preferably Mongoloid. For example, this includes Southern Mongoloids, Northern Mongoloids, Central Mongoloids, Southern Mongoloids, Eskimo people, and Amerindo people. Specifically, for example, this includes Japanese, Koreans, Chinese, Taiwanese, Mongolians, Tibetans, Indochinese people, and Native Americans. Preferably, they are Japanese.

[0047] The age of the individual can be any age from infancy to under 18 years old, but there is no particular age limit. There is no particular lower age limit, as long as the individual has been weaned. Specific lower age limits could be, for example, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 13 months, 14 months, 15 months, 16 months, 17 months, 18 months, 19 months, 2 years, 3 years, 4 years, etc. There is also no particular upper age limit. For example, the age could be 17 years or younger, 16 years or younger, 15 years or younger, 14 years or younger, 13 years or younger, 12 years or younger, 11 years or younger, or 10 years or younger.

[0048] There are no particular limitations on the individual's condition. For example, it may be an individual known to have a specific disease (a disease involving eating disorders and / or other diseases), an individual suspected of being at high risk of developing a specific disease, an individual receiving a specific treatment, or a healthy individual.

[0049] 2. Methods for determining the risk of developing a disease and / or the severity of the disease. 2-1. Overview A second aspect of the present invention is a method for determining the risk of developing a disease and / or the severity of that disease. The determination method of the present invention includes a nucleic acid extraction step, a measurement step, and a determination step. According to the determination method of the present invention, based on the nucleic acid information contained in feces, the risk of developing a disease and / or the severity of that disease in the individual from which it originates can be determined.

[0050] 2-2.Process The method according to this embodiment includes a nucleic acid extraction step, a measurement step, and a determination step. Each step will be described in detail below.

[0051] 2-2-1. Nucleic acid extraction process The "nucleic acid extraction process" is the process of extracting nucleic acids from feces derived from an individual. The nucleic acid extraction process typically includes a pretreatment step, a lysis step, and a crude nucleic acid extraction step, and optionally includes a purification step. Each step is described below.

[0052] In the pretreatment step, the feces are suspended in a liquid so that they can be lysed. The liquid used is not particularly limited, but for example, it can be suspended in a suitable buffer such as PBS or Tris-HCl. If necessary, all or part of the suspension may be further treated by centrifugation and / or filtration before the lysing step described below to remove impurities such as undigested material.

[0053] In the lysis step, a portion of the suspension obtained in the pretreatment step is added to the cell lysate, and lysis is promoted at a constant temperature. The cell lysate used is not particularly limited. Cell lysates known in the art can be used. Specifically, they include, for example, digestive enzymes (e.g., proteases, polysaccharide-degrading enzymes, etc.), denaturants (e.g., guanidinium salts), surfactants (e.g., SDS, Triton x100, etc.), chelating agents (e.g., EDTA, etc.), and buffers (e.g., Tris-HCl, etc.). Furthermore, the cell lysate may also contain, for example, beads for physically disrupting the cells. The material of the beads used in this step is not particularly limited, but for example, glass, guanidinium, garnet, zirconium, silica, or a combination thereof can be used. When disruption with beads is performed, further disruption is usually carried out during, before, or after the lysis process. Disruption can be carried out by applying physical stimuli such as shaking or vibration. The conditions used for lysis are known in the art. Therefore, the temperature can be appropriately determined according to various conditions such as the composition of the cell lysate used, the type of feces, and the type of nucleic acid to be extracted. The specific temperature for the lysis treatment can be, for example, 50°C or higher, 60°C or higher, 70°C or higher, 80°C or higher, 90°C or higher, or 95°C or higher. The specific duration of the lysis treatment is not particularly limited. For example, it can be performed for 5 minutes or more, 10 minutes or more, 15 minutes or more, 20 minutes or more, 25 minutes or more, 30 minutes or more, 40 minutes or more, 50 minutes or more, or 60 minutes or more.

[0054] In the crude nucleic acid extraction step, the nucleic acid-containing fraction is separated from the lysate after cell lysis. Any extraction method known in the art can be used. Specific extraction methods include, for example, methods for denaturing and removing components other than nucleic acids (e.g., the phenol-chloroform method and the sodium iodide method), methods for adsorbing nucleic acids onto silica membranes or magnetic glass particles (e.g., the spin column method), and methods combining these. Commercially available nucleic acid extraction kits may also be used.

[0055] In the optional purification step, the nucleic acid is further purified from the crude nucleic acid obtained in the crude nucleic acid extraction step. The method used in this step is not particularly limited, and purification methods known in the art can be used. Specific purification methods include, for example, methods to increase the purity of all nucleic acids (e.g., alcohol method and magnetic bead method), methods to increase the purity of only specific types of nucleic acids (e.g., methods using RNase or DNase), and methods using combinations thereof. This purification step does not need to be performed separately from the other steps, and there is no particular limitation on when it is performed.

[0056] The form of feces used in this process is not particularly limited. The feces may be liquid or solid, for example.

[0057] For example, solid feces obtained from an individual may be used in its solid state as is, or it may be dissolved in a solution or the like to homogenize it, and then a portion of it may be used in a liquid state. The individual from which the feces originate is not particularly limited, but for example, it may be the individual described in the first embodiment.

[0058] Feces may be stored until they are used in this process. Storage conditions are not particularly limited, but for example, they can be stored by freezing, freeze-drying, refrigeration, room temperature, drying, or a combination thereof. Specific methods of freezing include, for example, storing them at extremely low temperatures using dry ice, a cryogenic refrigerator, or liquid nitrogen, or storing them in a regular household freezer. Specific methods of freeze-drying include, for example, using a freeze-dryer. Specific methods of refrigeration include, for example, storing the feces at a temperature of 10°C or below (for example, in a household refrigerator). In the case of room temperature storage, it is preferable to store them in a way that suppresses contamination and growth of bacteria. Specifically, for example, this includes using a storage solution containing a component that suppresses the growth of bacteria, such as guanidine, or combining it with a drying method. Specific methods of drying include, for example, using a desiccant and using a dryer (for example, a heating dryer).

[0059] There are no specific limitations on the storage period. Specific storage periods could be, for example, 1 day, 2 days, 3 days, 5 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months. Furthermore, at least part of the pre-processing steps described above may be completed during the storage period.

[0060] Each step of this process may be carried out as a series of steps using, for example, a commercially available single kit.

[0061] 2-2-2.Measurement process The "measurement step" is a step in which the ratio of nucleic acids derived from Blautia wexlerae to the total nucleic acids derived from bacteria is measured based on the nucleic acid sequence information obtained from the nucleic acid extraction step. This step can be performed after the nucleic acid extraction step or simultaneously with it.

[0062] The nucleic acids derived from Blautia wexlerae to be measured shall be as described in the first embodiment. The measurement method used in this process is not particularly limited as long as it is capable of measuring the ratio of nucleic acids originating from a specific bacterium in a nucleic acid-containing sample. Examples of measurement methods that can be used in this process include methods that use different primers or probes for each genus of bacteria to be detected (e.g., specific qPCR, T-RFLP (Terminal-Restriction Fragment Length Polymorphism), FISH (Fluorescence in situ hybridization), and microarray methods), methods that use primers common to some or all of the genus of bacteria to be detected (e.g., clone library method, DGGE / TGGE (Denaturing / Temperature Gradient Gel Electrophoresis), and metagenomic analysis), methods that use primers or probes capable of recognizing base sequences specific to the bacterial species to be detected (PCR (including RT-PCR, qPCR, real-time PCR, etc.), hybridization methods (including Northern hybridization, Southern hybridization, Northern blotting, Southern blotting, nucleic acid arrays, etc.)), or combinations thereof. The specific procedures and conditions for these methods should basically follow the methods that are well known in the field. For example, the methods described in "NGS Applications: Get Started Now! Metagenome Analysis Experimental Protocols - Tips for Sample Preparation and Analysis from Human Resident Microbiota to Environmental Metagenomes," edited by Shohei Hattori, 2016, Yodosha, etc., can be used.

[0063] For example, when using hybridization methods, particularly blotting techniques, the amount of the target nucleic acid can be detected and measured by using the probe described in the third embodiment. Specifically, this can be done, for example, by following the procedure below. First, the probe (complementary strand) is mixed with a radioactive isotope ( 32 P, 33 P, 35The nucleic acids are labeled with a fluorescent substance (such as S) or other similar material. Next, the nucleic acids in the sample are transferred to a nylon membrane or similar material. The labeled probe is applied to this membrane to hybridize the labeled probe with the nucleic acids. Finally, the signal originating from the label in the formed double strand is detected and measured using a radiation detector or fluorescence detector or similar device.

[0064] When using the PCR method, the amount of the target nucleic acid can be detected and measured by using the primers described in the third embodiment. Specifically, for example, the procedure can be followed. First, the PCR method is performed using a pair of primers capable of amplifying the target nucleic acid region, with DNA prepared from the sample as a template, and the resulting double-stranded DNA is detected. Methods for detecting double-stranded DNA include performing the above PCR using primers that have been previously labeled with radioisotopes or fluorescent substances, performing electrophoresis of the PCR product on an agarose gel and staining the double-stranded DNA with ethidium bromide or the like for detection, and transferring the produced double-stranded DNA to a nylon membrane or the like according to a conventional method and hybridizing it with a labeled probe for detection.

[0065] Furthermore, for example, when using real-time PCR, the amount of nucleic acid can be measured by the increase in the signal derived from the label accompanying the generation of the amplified product. In this case, the amount of nucleic acid is generally calculated by substituting the obtained Ct value (Threshold Cycle value) into a predetermined calibration formula. Here, the Ct value refers to the number of cycles at which the amplified product reaches a certain amount. The calibration formula refers to the relationship between the amount of amplified product and the Ct value of each serially diluted sample, obtained by performing the same amplification reaction using the primer set used for measurement, with nucleic acids extracted from serially diluted samples with known bacterial counts and / or gene copy numbers as a template. That is, the calibration formula can be derived from a calibration curve created based on amplification curves, etc., that show the amount of amplified product at each dilution stage obtained as a result of the amplification reaction, using serially diluted bacterial solutions with a previously measured bacterial count as samples, and performing the nucleic acid extraction process and amplification reaction according to this embodiment. The specific calibration formula is not particularly limited.

[0066] When using nucleic acid array analysis, an RNA chip or DNA chip is used, in which the probe described in the third embodiment is immobilized on a solid phase such as a substrate. In this method, nucleic acid molecules obtained from a sample are applied to the chip, and the presence or absence of the target nucleic acid is detected by detecting the signal on the chip.

[0067] Nucleic acids immobilized on a substrate are generally referred to as nucleic acid chips, nucleic acid arrays, or microarrays. Furthermore, DNA or RNA arrays encompass both DNA or RNA macroarrays and DNA or RNA microarrays. In this specification, the term "chip" includes all of these.

[0068] The method for measuring the chip signal is not limited to this, but for example, the signal originating from the label of the detection composition can be detected by an image detector (Typhoon 9410 (GE Healthcare), 3D-Gene (R) Methods include detection and measurement using scanners (such as those manufactured by Toray Industries, Inc.).

[0069] Surface Plasmon Resonance (SPR) is a method for highly sensitively detecting and quantifying adsorbents on the surface of a metal thin film by utilizing the surface plasmon resonance phenomenon. Surface plasmon resonance is a phenomenon in which the reflected light intensity is significantly attenuated at a specific incident angle (resonance angle) when the incident angle of laser light irradiated onto a metal thin film is changed. In this invention, a nucleic acid probe having a sequence complementary to the base sequence of a nucleic acid biomarker is immobilized on the surface of a metal thin film, and other parts of the metal thin film surface are blocked. Then, a liquid sample such as a nucleic acid solution extracted from the sample is passed through the metal thin film surface to form a base pair between the target nucleic acid and the nucleic acid probe. The target nucleic acid is then detected and quantified from the difference in measurement values ​​before and after sample passage. Detection and quantification by surface plasmon resonance can be performed, for example, using an SPR sensor commercially available from Biacore. This technology is well known in the field. For example, see Kazuhiro Nagata and Hiroshi Handa, "Real-time analytical experimental methods for biomolecular interactions," Springer-Verlag Tokyo, Tokyo, 2000.

[0070] The "Quartz Crystal Microbalance (QCM) method" is a mass measurement method that utilizes the phenomenon where the resonant frequency of a quartz crystal decreases in proportion to the mass of a substance adsorbed onto the electrode surface attached to a quartz crystal. By measuring the change in resonant frequency, it is possible to quantitatively detect minute amounts of adsorbed substances. Similar to the SPR method, detection and quantification using this method can be performed using commercially available QCM sensors. For example, target nucleic acid molecules can be detected and quantified by base pairing between a nucleic acid probe, which has a sequence complementary to the base sequence of the target nucleic acid fixed on the electrode surface, and the target nucleic acid in the sample. This technology is well known in this field; for example, refer to J. Christopher Love, LAEstroff, JKKriebel, RGNuzzo, GM Whitesides (2005) Self-Assembled Monolayers of a Form of Nanotechnology, Chemical Review, 105:1103-1170; and Toyohide Moriizumi, Takamichi Nakamoto (1997) Sensor Engineering, Shokodo.

[0071] The calculation of gene expression levels in this invention is not particularly limited, but statistical processing methods described in, for example, "Statistical analysis of gene expression microarray data" (by Speed ​​T., Chapman and Hall / CRC) and "A beginner's guide to Microarray gene expression data analysis" (by Causton HC et al., Blackwell Publishing) can be used. For example, the average of the measurements of blank spots on a DNA chip can be increased by adding 2, 3, or 6 times the standard deviation of the blank spot measurements, and probe spots with a signal value greater than or equal to that value can be considered detection spots. Furthermore, the average of the blank spot measurements can be considered as the background, and the value obtained by subtracting this from the probe spot measurements can be used as the gene expression level.

[0072] When using methods that employ different primers and probes for each genus of bacteria to be detected, for example, nucleic acids can be amplified by PCR using primers specific to the bacterial genus, such as specific qPCR or T-RFLP, and the amount of nucleic acid can be measured during or after the amplification reaction. Alternatively, nucleic acids can be detected without nucleic acid amplification using probes specific to the bacterial genus, such as FISH or microarrays. The primers and probes used in this case may target corresponding regions on the nucleic acid of each genus, or they may target different regions. Specifically, for example, when using a 16S rRNA sequence, some or all of the nine variable regions can be targeted.

[0073] Methods that use primers common to some or all of the target bacterial genus typically employ a sequencer. The processing performed on the nucleic acid before sequencing varies depending on the specific method. For example, in the clonal library method, a sequence portion specific to the bacterial genus is amplified from the extracted nucleic acid, and the amplified product is inserted into a plasmid for sequencing. In the DGGE / TGGE method, similarly amplified products are separated according to the nucleic acid strand sequence by electrophoresis, extracted from the gel, and then sequenced. In metagenomic analysis, nucleic acids are fragmented or amplified, and the products are directly sequenced. The primers used for amplification and sequencing may be the same or different. For example, when using a 16S rRNA sequence, a primer capable of hybridizing to a conserved region located between the variable regions can be used. Specific examples of primers that can amplify the variable regions V3-V4 of the 16S rRNA gene include region-specific primers 341F and 806R (as of June 24, 2021). Sequencers utilizing the Sanger method or next-generation sequencers can be used for sequencing. Any sequencing method known in the art can be used. Examples of specific sequencing methods include multiplex sequencing, single-read sequencing, and paired-end sequencing.

[0074] When identifying the genus of a bacterium from sequenced sequence information, the method is not particularly limited. For example, known analytical methods in this art, such as using analytical software or databases, can be used. If a database is used, for example, bacteria can be identified by performing a sequence identity search on the accumulated bacterial base sequences. Specific examples of databases include GenBank, ENA, and DDBJ. In addition, databases specializing in 16S rRNA sequences, such as the GREENGENES database (http: / / greengenes.secondgenome.com), can also be used.

[0075] The copy number of the sequence identified as the 16S rRNA gene of each of the above-mentioned bacteria may be considered as the number of cells of that bacterium. When using sequence information other than the sequence information stored in the database, for example, the base identity can be calculated by comparing the sequence of the obtained nucleic acid with the sequence information mentioned above, and if there is a genus with a base identity of a certain level or higher, the bacterial genus with the highest base identity can be considered as the genus of the bacterium from which the obtained nucleic acid originated. For example, if the base sequence of the nucleic acid has a base identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.9% or more, or 100% with the sequence information used to identify a specific bacterial genus, the nucleic acid may belong to that genus. Normally, the amount of nucleic acid derived from bacteria belonging to a specific genus is treated as directly reflecting the amount of bacteria belonging to that genus. Direct reflection means, for example, that the amount of bacterial cells and the amount of nucleic acid are in a 1:1 ratio, or that the amount of nucleic acid is in a 1:1 ratio to a value obtained by multiplying the amount of bacterial cells by a certain multiple.

[0076] The method for calculating the ratio of bacteria can be based on the formula (amount of nucleic acid from the target bacterium) / (amount of nucleic acid from all bacteria), and additional processing can be performed as needed. For example, arithmetic operations, exponentiation, roots, or combinations thereof can be performed as needed.

[0077] Furthermore, for example, the proportion of Blautia wexlerae may be calculated based on measurement results for Blautia bacteria and / or specific bacterial strains of Blautia wexlerae (e.g., bacterium 38f). In this case, the proportion of Blautia wexlerae can be calculated by converting values ​​based on a relational expression that shows the relationship between the amount of nucleic acid from Blautia bacteria or specific bacterial strains of Blautia wexlerae and the amount of nucleic acid in Blautia wexlerae. The relational expression in this case can be appropriately selected depending on the target bacterial strain and the measurement method used. For example, the calculation can be performed based on the relationship between the measured values ​​of Blautia wexlerae by real-time PCR and the measured values ​​of Blautia bacteria by metagenomics, and the relationship between the measured values ​​of Blautia wexlerae by real-time PCR and the measured values ​​of bacterium 38f by metagenomics, as described in the examples.

[0078] Furthermore, multiple ratios may be calculated from a single stool sample. For example, in this process, a standardized ratio obtained from the results of multiple measurements can be used. Alternatively, the ratios obtained from each of the multiple measurements can be used as individual data points for the determination described later.

[0079] The nucleic acid extraction process and this process can be carried out as a series of steps using, for example, a commercially available single kit.

[0080] 2-2-3. Judgment process Based on the measured ratio, the risk and / or severity of disease development in the individual from which the feces originated is determined. This step can be performed after or simultaneously with the measurement step described above.

[0081] In this process, a ratio of nucleic acids derived from Blautia wexlerae that is lower than a predetermined standard value indicates a high risk of developing and / or the severity of diseases accompanied by feeding disorders in the individual.

[0082] The method of comparison with the reference value is not particularly limited, but examples include visual inspection and the use of software. Examples of software-based methods include using calculation software such as Excel, using automated processing by calculation software, and using known software capable of classification based on the reference value.

[0083] The "predetermined reference values" used in this process are not particularly limited, as long as they can distinguish the risk and / or severity of diseases involving eating disorders. They can be appropriately determined based on the fecal sample, nucleic acid, sequence information, the specific disease being assessed, the measurement method used in the measurement process, etc. Both empirical and objective criteria can be used as the predetermined reference values ​​in this process. As objective criteria, for example, a cutoff value can be used.

[0084] In this specification, "cutoff value" refers to a value that can be used as a basis for determining the presence or absence of disease risk. Preferably, the cutoff value shows sufficiently high sensitivity and specificity. Generally, it is derived using known methods from ROC curves drawn based on a direct comparison between the control group and the disease group, but is not limited to this. For example, the cutoff value may be set without using an ROC curve. Any known method can be used to determine the cutoff value using an ROC curve. Specific methods include, for example, the method using the Youden Index (sensitivity - (1 - specificity)) and the method using the distance from the upper left corner (the point where both sensitivity and specificity are 100%).

[0085] A "Receiver Operating Characteristic curve (ROC curve)" is created by plotting the true position fraction (TPF), or sensitivity, on the vertical axis and the false position fraction (FPF), or (1-specificity), on the horizontal axis, while varying the cutoff point, which is the threshold for determining which test result values ​​are positive. Here, specificity is the rate at which negative individuals are accurately identified as negative.

[0086] AUC (Area Under the Curve) is the value of the area under the ROC curve and represents the discriminative ability of the index related to that ROC curve. Generally, the closer the AUC is to 1, the higher the discriminative ability, and the closer it is to 0.5, the lower the discriminative ability.

[0087] In the present invention, it is preferable to use cutoff values ​​that have sufficiently high sensitivity and specificity, for example, sensitivity and / or specificity of 60% or more, 64% or more, 65% or more, 67% or more, 70% or more, 75% or more, 78% or more, 80% or more, 85% or more, or 90% or more. It is also preferable that the AUC, which indicates the discriminative ability of the biomarker, is 0.75 or more, 0.78 or more, 0.79 or more, 0.8 or more, 0.81 or more, 0.82 or more, 0.85 or more, 0.88 or more, 0.89 or more, or 0.9 or more. Furthermore, it is preferable to use cutoff values ​​of sensitivity-(1-specificity) of 0.4 or more, 0.41 or more, 0.42 or more, 0.43 or more, 0.435 or more, 0.44 or more, or 0.45 or more.

[0088] Specific cutoff values ​​can be used, for example, for ratios based on real-time PCR, values ​​such as 0.0129, 0.0140, and 0.0050 can be used.

[0089] Multiple reference values ​​can be set. For example, a cutoff value can be set to determine the presence or absence of a risk of developing a disorder involving eating disorders, and a cutoff value can be set to determine the severity of a disorder involving eating disorders. In addition, cutoff values ​​can be set to determine the risk of developing or the severity of more specific diseases.

[0090] For example, if the proportion of Blautia wexlerae is below the cutoff value for determining the presence or absence of risk of developing a disease involving eating disorders, but not below the cutoff value for determining the severity of the disease, then that individual can be determined to be at risk of developing a disease involving eating disorders. Alternatively, for example, the degree of risk and the degree of severity can be classified into multiple stages, and a cutoff value can be set for each.

[0091] The types of judgment results in this process are not particularly limited. For example, it can be used to determine the presence or absence of risk of developing a disease involving an eating disorder, the presence or absence of a disease involving an eating disorder, the risk and / or presence or absence of a more specific disease, the severity of a disease involving an eating disorder and / or a more specific disease, and the effectiveness of a specific treatment.

[0092] In this process, in addition to determination using the biomarker of the present invention, determination may also be made based on known diagnostic criteria. The diagnostic criteria in this case are not particularly limited, but for example, the diagnostic methods exemplified in the definitions of each disease can be used.

[0093] 2-3. Effects According to the method of this embodiment, it is possible to detect disruption of the intestinal microbiota (dysbiosis) in a simple manner and objectively determine the risk and / or severity of developing diseases accompanied by eating disorders. This allows for the simple monitoring of the condition of individuals at risk of developing diseases accompanied by eating disorders or individuals suffering from such diseases, using objective indicators.

[0094] For example, the method of this embodiment can be applied to individuals receiving a specific treatment to determine the effectiveness of that treatment. Therefore, the method of this embodiment can be used as a screening method for treatments of diseases involving eating disorders.

[0095] Furthermore, if extracted nucleic acids are provided, the measurement and / or determination steps can be performed, and if information regarding the composition ratio of intestinal bacteria is provided, the determination step can be performed, to determine the risk and / or severity of diseases involving feeding disorders in the individual from which the nucleic acids or information originate.

[0096] 3. Kit 3-1. Overview A third aspect of the present invention is a kit. The kit of the present invention contains a probe or primer as an active ingredient that can detect the biomarker described in the first aspect, and is configured to measure the amount and / or ratio of Blautia wexlerae present in feces. By using the kit of the present invention, it is possible to determine the presence or absence of a risk of developing a disease and / or its severity.

[0097] 3-2. Composition 3-2-1. Probes and Primers The kit of the present invention includes, as an essential component, a probe that hybridizes to the nucleotide sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acids derived from Blautia wexlerae, and as an optional component, a primer set for amplifying the 16S rRNA gene and / or RNA-binding protein gene.

[0098] The nucleotide sequences of the primers and probes in the kit of the present invention are not particularly limited as long as they perform the functions described above, but examples include the following polynucleotides: (1) A polynucleotide consisting of 15 or more consecutive bases selected from the base sequence shown in SEQ ID NO: 1 or 2; (2) A polynucleotide having one or more base deletions, substitutions, additions or insertions in the base sequence of the polynucleotide in (1); (3) A polynucleotide having 90% or more base identity with respect to the base sequence of the polynucleotide in (1); (4) A polynucleotide that hybridizes under high-stringent conditions with a polynucleotide consisting of 15 or more consecutive bases selected from a base sequence complementary to the base sequence shown in SEQ ID NO: 1 or 2; and (5) A polynucleotide consisting of a base sequence complementary to the base sequences of the polynucleotides (1) to (4).

[0099] In this specification, "probe" includes polynucleotides capable of specifically recognizing and detecting DNA, RNA produced by gene expression, or polynucleotides derived therefrom, complementary polynucleotides, and aptamers.

[0100] In this specification, "primer" includes polynucleotides capable of specifically recognizing and amplifying DNA, RNA produced by gene expression, or polynucleotides derived therefrom, and complementary polynucleotides.

[0101] "Complementary" refers to a relationship in which nucleic acid bases can form base pairs with each other via hydrogen bonds. This includes so-called Watson-Crick base pairs (natural base pairs) or Hoogsteen base pairs.

[0102] In this specification, "hybridize" or "hybridizable" means that polynucleotides having complementary base sequences pair together to form a completely or partially complementary double helix.

[0103] In this specification, "stringent conditions" refer to conditions under which a nucleic acid probe hybridizes to its target sequence to a greater extent than to other sequences (e.g., a measurement of the mean of background measurements + standard error of background measurements × 2 or more). Stringent conditions are sequence-dependent and vary depending on the environment in which hybridization takes place.

[0104] In this specification, "high-stringent conditions" refers to environmental conditions that make nonspecific hybridization unlikely. Under high-stringent conditions, nucleic acids having the target base sequence can form hybrids, but nucleic acids having nonspecific base sequences cannot substantially form hybrids. Generally, high-stringent conditions refer to conditions with low salt concentration and high temperature. Low salt concentration refers to, for example, 15 to 750 mM, preferably 15 to 500 mM, 15 to 300 mM, or 15 to 200 mM. This includes, for example, 1.5 to 3.5 × SSC, 2 to 3 × SSC, and 2 to 2.5 × SSC. High temperature refers to, for example, 50 to 68°C or 55 to 70°C. Another condition that defines stringent conditions is the washing condition after hybridization, for example, washing after hybridization at 65°C with 0.1 × SSC and 0.1% SDS. It is desirable that the polynucleotides included in the kit of the present invention maintain a hybridized state with the target positive chain even after washing under such conditions.

[0105] Other examples of "stringent conditions" in these hybridizations are described, for example, in Sambrook, J. & Russel, D., Molecular Cloning, A LABORATORY MANUAL, Cold Spring Harbor Laboratory Press, published January 15, 2001, in Volume 1, Sections 7.42-7.45 and Volume 2, Sections 8.9-8.17, and can be used in the present invention.

[0106] The identity value is calculated using default settings with software that calculates identity between multiple nucleotide sequences (e.g., FASTA, DNASIS, and BLAST). The identity value of a nucleotide sequence is calculated by determining the number of matching bases when a pair of nucleotide sequences are aligned to maximize the degree of agreement, and then expressing this number of matching bases as the ratio of the number of matching bases to the total number of bases in the compared nucleotide sequences. Here, if there are gaps, the total number of bases is the number of bases counted with each gap as one base. For details on the method of determining identity, see, for example, Altschul et al, Nuc.Acids.Res. 25, 3389-3402, 1977 and Altschul et al, J.Mol.Biol. 215, 403-410, 1990.

[0107] The length of the consecutive bases in these polynucleotides is not particularly limited, as long as it is 15 bases or more. For example, it can be 17 bases or more, 18 bases or more, 19 bases or more, 20 bases or more, 21 bases or more, etc.

[0108] The level of identity is preferably 90% or higher, 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.5% or higher, 99.9% or higher, or 100%.

[0109] Furthermore, these polynucleotides may include polynucleotides that have a certain degree of identity with a continuous partial base sequence or its complementary base sequence contained in the base sequence of the target gene.

[0110] When used as a primer, it is preferable to include the aforementioned consecutive bases on the 3' end, which is in the extension direction. Furthermore, it is preferable to include a base sequence region consisting of a base sequence that is 100% identical to the target base sequence, and a base sequence region consisting of a base sequence that has a certain level or higher of identity with the target base sequence, starting from the 3' end. The length of the base sequence region consisting of a base sequence identical to the target base sequence is not particularly limited, but for example, it may be 2 or more bases, 3 or more bases, 5 or more bases, 10 or more bases, 15 or more bases, 17 or more bases, or 19 or more bases.

[0111] In this case, the 5' end can include any additional base sequence. The total number of bases in the primer is not particularly limited, but it can be, for example, 50 bases or less, 40 bases or less, or 30 bases or less.

[0112] Specific primer sets include, for example, a set of polynucleotides having or consisting of the nucleotide sequences of SEQ ID NOs. 3 and 4 for the 16S rRNA gene; a set of polynucleotides having or consisting of the nucleotide sequences of SEQ ID NOs. 5 and 6 for the Jag / EloR gene; or a set of polynucleotides (2) to (5) when these polynucleotides are considered to be polynucleotides (1).

[0113] Examples of conditions for performing PCR using the primers in the kit of the present invention include using a PCR buffer with a composition such as 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1-2 mM MgCl2, and processing for about 15 seconds to 1 minute at a temperature of +5 to 10°C above the Tm value calculated from the primer sequence. Methods for calculating the Tm value include Tm value = 2 × (number of adenine residues + number of thymine residues) + 4 × (number of guanine residues + number of cytosine residues).

[0114] The nucleic acids constituting the probes included in the kit of the present invention for use in the hybridization method described above are usually DNA, which can be synthesized at low cost and has high stability. However, they may also include, if necessary, chemically modified nucleic acids or pseudo-nucleic acids such as PNA (Peptide Nucleic Acid), BNA (Bridged Nucleic Acid) / LNA (Locked Nucleic Acid), methylphosphonate DNA, phosphorothioate DNA, 2'-O-methyl RNA, or combinations thereof, in whole or in part. Furthermore, the probes included in the kit of the present invention may also include fluorescent dyes (e.g., fluorescein and its derivatives, rhodamine and its derivatives, DIG, FITC, Cy3, Cy5, FAM, HEX, VIC), quencher substances (TAMRA, DABCYL, BHQ-1, BHQ-2, or BHQ-3), biotin or (strept)avidin, or modifying substances such as magnetic beads, or radioisotopes (e.g., 32 P, 33 P, 35 The product can be modified or labeled using S), etc. Hybridization is preferably carried out under stringent conditions at low salt concentration and high temperature to eliminate unintended nucleic acids that hybridize nonspecifically.

[0115] The polynucleotides or fragments thereof used in the kit of the present invention may be DNA or RNA.

[0116] The polynucleotides used in the kit of the present invention can be produced using common techniques such as DNA recombination, PCR, and automated DNA / RNA synthesis.

[0117] DNA recombination techniques and PCR methods can be used, for example, those described in Ausubel et al., *Current Protocols in Molecular Biology*, John Willey & Sons, US (1993); Sambrook et al., *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Laboratory Press, US (1989).

[0118] The target base sequence is publicly known, and as mentioned above, the method for obtaining it is also known. Therefore, by cloning this gene, polynucleotides can be produced as probes or primers that can be used in the kit of the present invention.

[0119] Such probes or primers can be chemically synthesized using an automated DNA synthesizer. The phosphoamidite method is commonly used for this synthesis, allowing for the automated synthesis of single-stranded DNA up to approximately 100 base pairs. Automated DNA synthesizers are commercially available from companies such as Polygen, ABI, and Thermo Fishers. Alternatively, they can be fabricated using cDNA cloning.

[0120] The kit of the present invention may include probes and / or primers in any combination, but typically the primers are included as a primer pair consisting of a forward primer and a reverse primer.

[0121] The kit of the present invention may further include probes and / or primers for any known gene that can be used as a biomarker capable of determining the presence or / or severity of the risk of developing a disease involving eating disorders.

[0122] When used with already amplified nucleic acids, the kit of the present invention does not need to include primers.

[0123] 3-2-2. Other Configurations The kit of the present invention may further include reagents for extracting nucleic acids (e.g., total RNA) or polypeptides from body fluids, cells, or tissues, a fluorescent labeling substance, an enzyme and culture medium for nucleic acid amplification, instructions for use, a dilution or reaction buffer containing components necessary for measurement, a washing solution, a colorimetric reagent, a reaction vessel, and the like.

[0124] The kit of the present invention may include a container. The material of the container is not limited as long as it is made of a material that does not contaminate the contents or is not contaminated by the contents. Examples include plastics such as polypropylene and polystyrene, glass, or paper with a special surface coating.

[0125] The detection equipment is not particularly limited. The detection method can be appropriately selected according to the label and reagents used, and the properties of the sample, and the equipment necessary for that detection method can be used. For example, when a fluorescent dye or luminescent substance is used, it can be detected by visual inspection, using a microscope (e.g., a fluorescence microscope), using a detector (e.g., fluorescence-activated cell sorting (FACS), a photometer, a spectrophotometer, etc.), or a combination thereof. When a non-colored low-molecular-weight substance that acts as an enzyme substrate or antigen is used as a label, it can be detected by the same detection method as when a fluorescent dye or luminescent substance is used, for example, after processing such as enzyme treatment. When a radioisotope is used as a label, it can be detected by autoradiography, a scintillation counter, positron emission tomography (PET), or a combination thereof.

[0126] The kit of the present invention may include, for example, serially diluted samples with a known bacterial count that can be used in the measurement of the second embodiment.

[0127] The kit of the present invention may include instructions for use, if necessary. The kit of the present invention may include application means such as syringes, droppers, and micropipettes, as well as storage means, if necessary.

[0128] The kit of the present invention is a kit that can be used in the method described in the second embodiment. Therefore, the kit of the present invention can be configured as a kit for any purpose described in the second embodiment.

[0129] 4. Device 4-1. Overview A fourth aspect of the present invention is a device for determining the risk and / or severity of diseases involving feeding disorders in individuals from infancy to under 18 years of age. The device of this aspect can detect and / or measure the amount of the biomarker described in the first aspect.

[0130] 4-2. Composition The device of the present invention includes, as an essential component, a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acids derived from Blautia wexlerae.

[0131] The probe was described in detail in the third embodiment, so its explanation is omitted here. Other configurations will also generally follow the description in the third aspect.

[0132] The device of the present invention may optionally include means for collecting feces from an individual, a container for collecting and storing feces, means for measuring the amount of a biomarker, and means for calculating a ratio.

[0133] The device of the present invention is a device for measuring biomarkers in which nucleic acids, such as polynucleotides, their variants, derivatives, or fragments as described above, are bound to or attached to a solid phase. Examples of solid phase materials include plastic, paper, glass, and silicon, with plastic being the preferred solid phase material due to its ease of processing. The shape of the solid phase is arbitrary and can be, for example, square, round, rectangular, or film-shaped. The device of the present invention includes, for example, devices for measurement using hybridization techniques, specifically blotting devices, nucleic acid arrays (e.g., microarrays, DNA chips, RNA chips), etc.

[0134] Nucleic acid array technology is a technique that involves creating an array, such as a chip, by attaching or bonding one nucleic acid at a time to the surface of a solid phase that has been surface-treated as needed, such as by L-lysine coating or the introduction of functional groups such as amino groups or carboxyl groups, and then using this array to measure the target nucleic acid using hybridization. Methods for attaching or bonding nucleic acids include, for example, spotting nucleic acids using a high-density dispensing machine called a spotter or arrayer, spraying nucleic acids onto the solid phase using an inkjet that ejects minute droplets from a nozzle using a piezoelectric element, or sequentially synthesizing nucleotides on the solid phase.

[0135] 5. Therapeutic composition 5-1. Overview A fifth aspect of the present invention is a therapeutic composition. The therapeutic composition of the present invention contains Blautia wexlerae as an active ingredient as an essential component. According to the composition of the present invention, diseases accompanied by feeding disorders in individuals from infancy to under 18 years of age can be treated.

[0136] 5-2. Composition 5-2-1. Components The components of the therapeutic composition of the present invention will now be described. The therapeutic composition of the present invention contains Blautia wexlerae as an active ingredient as an essential component, and a solvent and / or a carrier as optional components. Each component will be described in detail below.

[0137] (1) Active ingredients The therapeutic composition of the present invention contains Blautia wexlerae as an essential active ingredient. It may also contain one or more types of bacteria as needed.

[0138] The description of Blautia wexlerae is as described in the first embodiment. The therapeutic composition of the present invention may contain one or more types of Blautia wexlerae. The form of Blautia wexlerae contained in the therapeutic composition of the present invention is not particularly limited, but it is configured so that the administered Blautia wexlerae can grow in the intestines. The form of Blautia wexlerae contained in this composition is not particularly limited, but it is preferably alive or dormant and in a state that can be awakened under specific conditions.

[0139] The amount of active ingredient contained in the therapeutic composition of the present invention is not particularly limited. Generally, the amount varies depending on the type of active ingredient, the dosage form, and the type of solvent and carrier, which are other components described later. Therefore, it should be determined appropriately taking into account each of these conditions. It is sufficient that a single dose of this therapeutic composition contains an effective amount of the active ingredient. However, if it is necessary to administer a large amount of this therapeutic composition to the subject in order to obtain the pharmacological effect of the active ingredient, it may be administered in several divided doses to reduce the burden on the subject. In this case, the amount of active ingredient should be sufficient as long as the total amount contains an effective amount. "Effective amount" means the amount necessary for the active ingredient to exert its function and that does not cause little to no harmful side effects to the subject to which it is applied. This effective amount may vary depending on various conditions such as information about the subject, the route of application, and the number of applications. Therefore, when this therapeutic composition is used as a medicine, the amount of active ingredient is ultimately determined by the judgment of a physician or pharmacist.

[0140] In this specification, "subject" refers to the target population to which the therapeutic composition of this embodiment is applied. In this embodiment, the subject is particularly a human individual from infancy to under 18 years of age. In the present invention, the subject may be healthy or suffering from some disease, and includes, for example, individuals who are expected to suffer from a disease accompanied by an eating disorder. For example, it can be applied to individuals who are the target population of the method described in the first embodiment.

[0141] In this specification, "information about the subject" refers to various information about the characteristics and condition of the subject. Examples include age, weight, sex, overall health status, presence or absence of disease, progression and severity of disease, drug sensitivity, presence or absence of concomitant medications, and resistance to treatment.

[0142] The formulation may also contain one or more other known active ingredients for treating dysbiosis (disruption of the intestinal flora). The additional ingredients in this case are not particularly limited, but may include, for example, intestinal bacteria, or ingredients with bowel-regulating effects such as dietary fiber (e.g., guar bean-derived soluble dietary fiber (PHGG)).

[0143] (2) Solvent The therapeutic compositions of the present invention may optionally contain pharmaceutically acceptable solvents. "Pharmaceutically acceptable solvents" refers to solvents commonly used in the pharmaceutical technology. Examples include water or aqueous solutions, or organic solvents. Examples of aqueous solutions include physiological saline, isotonic solutions containing glucose or other adjuvants, phosphate buffers, and sodium acetate buffers. Examples of adjuvants include D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other low concentrations of nonionic surfactants, polyoxyethylene sorbitan fatty acid esters, etc. An example of an organic solvent is ethanol.

[0144] (3) Carrier The therapeutic compositions of the present invention may optionally include pharmaceutically acceptable carriers. "Pharmaceutically acceptable carriers" refers to additives commonly used in the pharmaceutical technology field. Examples include excipients, binders, disintegrants, fillers, emulsifiers, flow additive modifiers, lubricants, and human serum albumin.

[0145] Excipients include, for example, sugars such as monosaccharides, disaccharides, cyclodextrins, and polysaccharides, metal salts, citric acid, tartaric acid, glycine, polyethylene glycol, Pluronic®, kaolin, silicic acid, or combinations thereof.

[0146] Examples of binders include starch paste made from plant starch, pectin, xanthan gum, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, shellac, paraffin, polyvinylpyrrolidone, or combinations thereof.

[0147] Examples of disintegrants include the aforementioned starch, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, laminaran powder, sodium bicarbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid ester, sodium lauryl sulfate, monoglyceride stearate, or salts thereof.

[0148] Examples of fillers include petrolatum, the aforementioned sugars, and / or calcium phosphate.

[0149] Examples of emulsifiers include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.

[0150] Examples of fluid additive regulators and lubricants include silicates, talc, stearates, or polyethylene glycol.

[0151] In addition to the above, if necessary, the composition may also contain solubilizers, suspending agents, diluents, dispersants, surfactants, analgesics, stabilizers, absorption enhancers, bulking agents, humectants, moisturizers, wetting agents, adsorbents, flavoring and deodorizing agents, disintegration inhibitors, coating agents, colorants, preservatives, antioxidants, fragrances, flavoring agents, sweeteners, buffering agents, isotonic agents, etc., which are commonly used in therapeutic compositions.

[0152] The carrier is used to avoid or inhibit the degradation of the active ingredient by enzymes, etc., within the target body, as well as to facilitate formulation and administration methods, and to maintain the dosage form and efficacy. It should be used as appropriate as needed.

[0153] (4) Drug delivery system particles (DDS particles) The therapeutic composition of the present invention may optionally contain DDS particles. DDS particles are particles that contain an active ingredient or other carrier inside themselves, allowing them to be delivered to the target site without decomposition of the contents, especially the active ingredient, and enabling temporal and quantitative control of drug distribution in the body. Since the active ingredient of the therapeutic composition of the present invention is bacteria and needs to be delivered to the intestines, the use of DDS particles is preferable to protect it from decomposition by digestive enzymes in the body after administration. The type of DDS particle is not limited.

[0154] 5-2-2. Dosage Form The dosage form of the therapeutic composition of the present invention is not particularly limited. It is acceptable as long as it is in a form that can be delivered to the target site without inactivating the active ingredient in the target body.

[0155] The specific dosage form will vary depending on the method of administration, which will be described later. Since the methods of administration can be broadly categorized into parenteral administration and oral administration, the dosage form should be appropriate for each method of administration.

[0156] For example, preferred dosage forms include solid preparations (including tablets, capsules, drops, and lozenges), granules, powders, and other preparations, as well as topical preparations (such as ointments), topical solutions (such as injectables), sustained-release formulations, and liquid preparations (including internal solutions, emulsions, and syrups). If a solid preparation is used, it may be a dosage form with a coating known in the art, such as a sugar-coated tablet, a gelatin-coated tablet, an enteric-coated tablet, a film-coated tablet, a double tablet, or a multi-layer tablet, as needed.

[0157] The specific shapes and sizes of each of the above dosage forms are not particularly limited, as long as they fall within the range of dosage forms known in the art. The therapeutic composition of the present invention may be manufactured according to conventional methods in the art.

[0158] 5-3. Application method The therapeutic composition of the present invention may be administered orally or parenterally. Parenteral administration methods include nasal administration, enteral administration, and transmucosal administration.

[0159] Furthermore, the therapeutic composition of the present invention can be used in combination with one or more other known compositions for treating disruption of the intestinal flora (dysbiosis). Furthermore, the therapeutic composition of the present invention can be provided in the form of supplements or food and beverages. [Examples]

[0160] <Example 1: Comprehensive analysis of the relationship between diseases accompanied by eating disorders and the gut microbiota> (the purpose) By comprehensively analyzing gut microbiota data obtained in relation to eating disorders, we aim to identify gut bacteria deeply involved in these disorders.

[0161] (method) We performed an integrated analysis of gut microbiota data obtained from previous studies by the inventors (R. Inoue et al., 2016:DOI:10.1080 / 09168451.2016.1222267; R. Inoue et al., 2017:DOI:10.1080 / 09168451.2017.1383849; R. Inoue et al., 2019:DOI:10.3164 / jcbn.18-105). The methods used to obtain gut microbiota data in each study are outlined below.

[0162] 1. Data from patients with ASD (R. Inoue et al., 2016: hereinafter referred to as "Study 1") Fecal and blood samples were collected from children aged 3 to 5 years (6 individuals with ASD and 6 individuals with normal physiology). None of the individuals had any significant bowel problems in the month immediately preceding the sample collection period, and none had taken antibiotics or antihistamines.

[0163] The diagnosis of ASD was made as follows: First, individuals were classified according to the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-5). Then, for individuals suspected of having ASD, a diagnosis of ASD was made based on the Pervasive Developmental Disorder Rating Scale (PARS) and the Infant Autism Checklist (M-CHAT) of the Japan Autism Association.

[0164] Freshly excreted feces were collected aseptically and placed in a sterile container (Stool Cary, Atect) and kept at -20°C. This sterile container was transported to the laboratory within 24 hours of excretion and stored at -80°C until use. Nucleic acid extraction and purification were performed using 25 mg of feces in the following manner.

[0165] Nucleic acids were extracted from feces in nucleic acid preservation solution using QuickGene DNA tissuekitS (Kurabo Corporation). First, 25 mg of feces and 250 μL of the kit's included buffer MDT were added to a 2 mL screw-cap tube containing zirconia beads and mixed. Then, bacterial cells were disrupted by the beads, 25 μL of buffer EDT was added, and the mixture was incubated at 55°C for 60 minutes. After centrifugation (15,000 × g, 10 minutes), 200 μL of the supernatant was transferred to a microcentrifuge tube. Subsequent procedures were carried out according to the kit's instructions.

[0166] For the extracted nucleic acids, a DNA sequencing library was prepared using a MiSeq desktop sequencer (Illumina) according to the manufacturer's protocol. To this end, the V3-4 region of the 16S rRNA gene in each sample was first amplified. This amplification was performed by PCR using KAPA HiFi HotStart Ready Mix (Kapa Biosciences, Wilmington). The following 341F primer (SEQ ID NO: 3) and 806R primer (SEQ ID NO: 4) were used as primers: Forward primer: 341F primer with an overhang adapter for Illumina MiSeq linked to the 5' end side (SEQ ID NO: 11; 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3') Reverse primer: 806R primer with an overhang adapter for Illumina MiSeq linked to the 5' end side (SEQ ID NO: 12; 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTATCTAATCC-3').

[0167] Amplification products were subjected to NucleoFast (R) 96 PCR (Takara Bio) for purification, and the second round of PCR was performed using KAPA HiFi TM HotStart Ready Mix. In this procedure, an adapter sequence composed of a combination of a dual index sequence (I5 index and I7 index) and an Illumina sequencing adapter was ligated to each sample. The amplification product from the second PCR was purified, and concentration was normalized using a SequalPrep TM Normalization Plate Kit (Life Technologies). Each normalized amplification product was pooled equally and concentrated using AMPure XP beads (Beckman Coulter).

[0168] Sequence analysis was performed by MiSeq on an 11 pM library combined with phiX Control v3 (Illumina). The analysis results were further analyzed by MiSeq Reporter. Default parameters were used for these analyses.

[0169] 2. Data of food allergy patients (R. Inoue et al., 2017: hereinafter referred to as "Study 2") Fecal samples were collected from children aged 18 months to 6 years and 7 months (four children with food allergies and four children without allergies). None of the children had taken antibiotics in the month immediately preceding the sample collection period.

[0170] The diagnosis of food allergy was made using clinical symptoms and serum allergen-specific IgE testing. Fecal sample collection, nucleic acid extraction, sequencing, etc., were performed in the same manner as in Study 1.

[0171] 3. Data from ASD patients who received dietary fiber (R. Inoue et al., 2019: hereinafter referred to as "Study 3") Fecal and blood samples were collected from children aged 4 to 9 years (13 individuals with ASD) as samples. None of the individuals had taken any medications for constipation or ASD in the month immediately preceding the sample collection period.

[0172] All subjects were continuously administered 6 g of guar bean-derived water-soluble dietary fiber (PHGG) per day for at least two months. PHGG was administered in the form of food or beverage.

[0173] For all individuals, the frequency of defecation was recorded weekly by the parents from the week immediately preceding the start of PHGG administration to the week immediately preceding the end of PHGG administration. Fecal samples were collected the day before the start of PHGG administration and on the day of the end of PHGG administration. Behavioral symptoms were scored using the Japanese version of the Abnormal Behavior Checklist (ABC-J) at the same time as fecal sample collection. The diagnosis of ASD, stool collection, nucleic acid extraction, and sequencing were performed in the same manner as in Study 1.

[0174] 4. Integrated analysis of gut bacteria Linear discriminant analysis for studies 1 and 2 was performed using the statistical software JMP Pro (version 17.2). Bacterial species were classified based on the Greengenes2 (2022.10) database. A confidence level of 0.7 was used as the baseline for identifying bacterial genera.

[0175] The proportions of Blautia A_141781 bacteria among different populations were compared using the Wilcoxon rank-sum test with the statistical software R (version 4.1.2). The proportions of Blautia A_141781 bacteria before and after PHGG administration were also compared using the Wilcoxon signed-rank test. A significance level of p=0.05 was used for these comparisons.

[0176] (result) The results are shown in Figures 1 and 2. Linear discriminant analysis identified the genus Blautia A_141781 as a bacterium that showed a high correlation between the presence or absence of disease and its proportion in the gut microbiota in both studies 1 and 2. Generally, a higher proportion of Blautia A_141781 bacteria was suggested in the normal population, and the logarithm derived from the ratio of intraclass variation in the normal population to interclass variation in the diseased population... 10 The (LDA) value was extremely high at approximately 4.5, indicating that the proportion of Blautia A_141781 bacteria is an indicator that distinguishes between normal and diseased populations with extremely high accuracy.

[0177] Regarding the proportion of Blautia A_141781 bacteria, a comparison of the results for each population in the data from Studies 1 and 2 revealed that the proportion of Blautia A_141781 bacteria was consistently significantly lower in both ASD and food allergy individuals compared to normal individuals (Figure 1).

[0178] Furthermore, the proportion of Blautia A_141781 bacteria was compared before and after PHGG administration using data from Study 3. The proportion of Blautia A_141781 bacteria significantly increased after PHGG administration (Figure 2). Study 3 demonstrated that PHGG administration significantly increased the frequency of bowel movements and improved constipation tendencies in individuals with ASD, while also significantly reducing irritability scores and inflammatory symptoms. Therefore, it was shown that the proportion of Blautia A_141781 bacteria strongly correlates not only with the presence or absence of the disease, but also with its severity.

[0179] While food allergies and ASD may seem unrelated at first glance, it is known that food allergies can lead to picky eating habits because individuals cannot consume foods containing allergens, and individuals with ASD are also known to have picky eating habits. Therefore, it was suggested that there is a strong correlation between the presence and severity of diseases involving eating disorders and the proportion of Blautia A_141781 bacteria.

[0180] <Example 2: Analysis of the relationship between severe intellectual and physical disability and the ratio of Blautia A_141781 bacteria> (the purpose) This study investigates the relationship between severe intellectual and physical disorders, known to be associated with eating disorders such as picky eating, and the prevalence of Blautia A_141781 bacteria.

[0181] (method) The following studies were approved by the ethics committees of Kyoto University, Setsunan University, and Todaiji Welfare and Rehabilitation Hospital, and written informed consent was obtained from the guardians of the children participating in the studies regarding the use of fecal and blood samples for research purposes. Furthermore, the personal information of the children was kept strictly confidential throughout the studies.

[0182] Fecal samples were collected from children aged 2 to 12 years (13 individuals with severe intellectual and physical disabilities and 13 normal individuals (typically developing individuals)).

[0183] The diagnosis of severe intellectual and physical disability was made at Todaiji Welfare and Rehabilitation Hospital, based on Oshima's classification. Fecal sample collection, nucleic acid extraction, sequencing, etc., were performed in the same manner as in Study 1.

[0184] The extracted nucleic acids were also analyzed using real-time PCR with a LightCycler 480 (Roche). Primers and probes targeting the Jag / EloR gene were used. The primers, probes, and amplification conditions used are as follows: Forward primer for Blautia wexlerae: GCCAAAAGAGAAACAAGTCAGAGAA (SEQ ID NO: 5); Reverse primer for Blautia wexlerae: GACGCAAATACATCACGAAGGAATA (SEQ ID NO: 6); Forward primer for Blautia luti: CATAGCGTGTCCAGTTCCGAAAG (Sequence No. 7); Reverse primer for Blautia luti: GACCATTTTTGCAAGCTGGTACTGT (SEQ ID NO: 8); Amplification conditions: Initial denaturation: 95°C, 30 seconds; (Denaturation: 95°C, 5 seconds; Annealing and extension reaction: 60°C, 30 seconds) × 40 cycles.

[0185] The total amount of bacterial nucleic acids was measured using the following primers and probes: Forward primer for all nucleic acids: GGTGAATACGTTCCCGG (SEQ ID NO: 9); Reverse primer for all nucleic acids: TACGGCTACCTTGTTACGACTT (SEQ ID NO: 10).

[0186] (result) The results are shown in Figure 3. When the proportion of Blautia A_141781 bacteria was compared between normal individuals (typically developing individuals) and individuals with severe intellectual and physical disabilities, the proportion of Blautia A_141781 bacteria was significantly lower in individuals with severe intellectual and physical disabilities compared to normal individuals, similar to the findings for ASD and food allergies (Figure 3).

[0187] These results confirmed a strong correlation between the prevalence and severity of feeding disorders in children and the proportion of Blautia A_141781 bacteria.

[0188] <Example 3: Identification of the bacterium species Blautia A_141781> (the purpose) To identify a more detailed classification of the bacterium Blautia A_141781, which has been shown to be strongly associated with diseases involving eating disorders such as picky eating and their prevalence.

[0189] (method) Regarding bacteria belonging to the genus Blautia A_141781 registered in the Greengenes2 database, we searched for those exhibiting similar behavior to Examples 1 and 2, using amplicon sequence variants (ASVs) as the taxonomic unit.

[0190] The search involved performing linear discriminant analysis on data from Studies 1-3 and Example 2 for ASV belonging to the genus Blautia A_141781, and log 10 For ASVs with an (LDA) value of 3 or higher, the relative abundance of each individual population was compared in the same manner as in Examples 1 and 2, and ASVs exhibiting similar behavior to Examples 1 and 2 were identified.

[0191] (result) The results are shown in Figure 4. Among the bacteria of the genus Blautia A_141781, a bacterium (hereinafter referred to as "bacterium 38f") that is closely related to Blautia wexlerae and Blautia luti bacteria and possesses a 16S rRNA gene containing the nucleotide sequence shown in Sequence ID No. 13 was identified as an ASV exhibiting similar behavior to that in Examples 1 and 2.

[0192] Similar to the case of the bacterium Blautia A_141781, the proportion of bacterium 38f was significantly lower in individuals with food allergies and ASD compared to normal individuals (Figure 4A), increased with PHGG administration (Figure 4B), and was also significantly lower in individuals with severe intellectual and physical disabilities compared to normal individuals (typically developing individuals) (Figure 4C).

[0193] These results suggest that the main bacterium of the genus Blautia A_141781 that strongly correlates with the presence and severity of feeding disorders in children is bacterium 38f.

[0194] <Example 4: Analysis of the relationship between Bacteria 38f and organic acid concentration in feces> (the purpose) We will analyze the relationship between Bacteria 38f and organic acid concentration in feces.

[0195] (method) As samples derived from children, fecal samples were collected from 59 children aged 2 to 12 years (23 children with severe intellectual and physical disabilities, children with constipation or abnormal CBCL levels, and 36 children with normal levels).

[0196] As adult-derived samples, fecal samples were collected from 81 adults aged 19 to 25 years (56 with diarrhea / loose stools, 2 with constipation, and 23 with normal stools). None of the individuals had taken antibiotics in at least one month immediately prior to the sample collection period.

[0197] Diagnosis of individuals with abnormal CBCL scores was based on the Child Behavior Checklist (CBCL: version 1.5-5 or 6-18), which was administered to all individuals (children and adults). Individuals scoring 60 points or higher on the CBCL were diagnosed as abnormal.

[0198] In children, the diagnosis of constipation was based on interviews with the child or their guardian. Constipation was diagnosed when the child reported a score of "1" on the Bristol Stool Scale. In adults, the diagnosis of constipation was based on the water content of the stool; diarrhea was diagnosed when the water content was 78% or more, and constipation when it was 68.5% or less.

[0199] The concentration of organic acids in feces was measured by high-performance liquid chromatography (HPLC) according to the method described in Tsukahara et al. (2014) (DOI: 10.1111 / asj.12188). Samples were prepared by diluting 0.5g to 1g of collected feces threefold with distilled water to create a sample suspension. A Shimadzu LC-10 series HPLC was used for the high-performance liquid chromatography. The values ​​for acetic acid, propionic acid, isobutyric acid, butyric acid, isovaleric acid, and valeric acid were used as the total amount of volatile organic acids.

[0200] The total volatile organic acid concentration and acetic acid concentration were calculated as molar concentrations relative to the volume of the sample. Fecal sample collection, nucleic acid extraction, sequencing, etc., were performed in the same manner as in Study 1.

[0201] The correlation between the abundance of bacterium 38f and the concentration of organic acids in feces was examined using the statistical software R, employing linear regression analysis and Spearman rank correlation testing.

[0202] (result) The results are shown in Figures 5 and 6. In pediatric individuals, significant positive correlations were observed between acetic acid concentration (Figure 5A) and total volatile organic acid concentration (Figure 5B) and the abundance ratio of Bacteria 38f (p=0.01 and p=0.03, respectively).

[0203] On the other hand, in adult individuals, neither acetic acid concentration (Figure 6A) nor total volatile organic acid concentration (Figure 6B) showed a significant correlation with the abundance of bacterium 38f (p=0.32 and p=0.29, respectively).

[0204] These results suggest that the relative abundance of bacterium 38f is deeply involved in the concentration of organic acids in feces, but only in pediatric individuals.

[0205] <Example 5: Analysis of the possibility of diagnosing various diseases> (the purpose) We will examine whether it is possible to diagnose a disease based on the proportion of bacteria present in each disease.

[0206] (method) The correlation between the abundance ratio of Blautia bacteria and the abundance ratio of bacterium 38f was analyzed by plotting a linear approximation line in Excel based on the data obtained in Examples 1 and 2.

[0207] Furthermore, ROC analysis was performed using the statistical software JMP Pro (version 17.2) to calculate a cutoff value for differentiating between normal individuals and individuals with the disease.

[0208] (result) The results are shown in Figures 7 and 8, and Table 1. The abundance of Blautia bacteria showed a very high correlation with the abundance of bacterium 38f.

[0209] Therefore, we analyzed whether it is possible to identify diseased individuals based on the relative abundance of Blautia bacteria by calculating a cutoff value.

[0210] As shown in Figures 7 and 8, the abundance ratio of Blautia bacteria exhibited similar behavior to that of bacterium 38f. Furthermore, even among individuals classified as normal, a tendency for the abundance ratio of Blautia bacteria to decrease was observed in individuals showing abnormal values ​​on the Child Behavior Checklist (CBCL) (labeled "Abnormal Behavior" in Figure 8) or in constipated individuals (labeled "Constipated" in Figure 8).

[0211] [Table 1]

[0212] The ROC curve based on the abundance ratio of Blautia bacteria showed high discriminatory performance for the presence or absence of disease, with an AUC of 0.80 indicating reliability. The highest cutoff value for sensitivity-(1-specificity), which indicates the accuracy of the diagnosis, was 0.0570761 (corresponding to the position of the lower black circle for "ASD (before administration)" in Figure 8). With this cutoff value, it was shown that diseased individuals could be identified with a sensitivity of 0.78 and a specificity of 0.67. Additionally, a cutoff value of 0.0620042 (corresponding to the position of the upper black circle for "ASD (before administration)" in Figure 8) was obtained with a sensitivity of 0.8, and a cutoff value of 0.0222935 (corresponding to the position of the black circle for "constipation" in Figure 8) was obtained with an extremely high specificity of 0.96. Regardless of which cutoff value was used, it was shown that diseased individuals could be identified with high accuracy.

[0213] <Example 6: Identification of the species name of bacterium 38f> (the purpose) The species name of bacterium 38f is identified based on the correlation between the abundance ratio of bacterium 38f and the abundance ratio of closely related species.

[0214] (method) The correlation between the abundance ratio data of Blautia wexlerae and Blautia luti obtained in Example 3 using real-time PCR and the abundance ratio data obtained from metagenomic analysis in Studies 1-3 and Example 3 was analyzed by plotting a linear approximation in Excel.

[0215] (result) The results are shown in Figure 9. Among bacterial species closely related to bacterium 38f, the abundance of bacterium 38f was strongly correlated with that of Blautia wexlerae (Figure 9A). On the other hand, the abundance of bacterium 38f did not correlate with that of Blautia luti (R-value = 0.34). This result was similar to the correlation between the abundance of Blautia bacteria and that of Blautia luti (R-value = 0.38).

[0216] This suggests that bacterium 38f belongs to the family Blautia wexlerae.

[0217] Furthermore, Blautia wexlerae showed a strong correlation with the abundance of Blautia bacteria (Figure 9B). Based on this relationship, the cutoff value based on the abundance of Blautia wexlerae was calculated, as shown in Table 2.

[0218] [Table 2]

[0219] These results suggest that the presence and severity of eating disorders can be detected with high accuracy based on the relative abundance of Blautia wexlerae.

Claims

1. A method for determining the risk and / or severity of developing food allergies and / or severe intellectual and physical disabilities in individuals from infancy to under 18 years of age, A nucleic acid extraction step for extracting nucleic acids from feces derived from the aforementioned individual, and A measurement step to measure the ratio of nucleic acids derived from Blautia wexlerae to the total nucleic acids derived from bacteria, based on the sequence information of the nucleic acids. Includes, A ratio lower than a predetermined standard value indicates a high risk and / or severity of developing food allergies and / or severe physical and mental disorders in the individual. The aforementioned method.

2. The method according to claim 1, wherein the nucleic acid is a 16S rRNA gene and / or an RNA-binding protein gene.

3. The method according to claim 2, wherein the RNA-binding protein gene is an elongasomal regulatory protein gene.

4. A kit for determining the risk and / or severity of food allergies and / or severe intellectual and physical disabilities in individuals from infancy to under 18 years of age, comprising probes that hybridize to the nucleotide sequences of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acids derived from Blautia wexlerae.

5. The kit according to claim 4, further comprising a set of primers for amplifying a 16S rRNA gene and / or an RNA-binding protein gene.

6. A device for determining the risk and / or severity of food allergies and / or severe intellectual and physical disabilities in individuals from infancy to under 18 years of age, comprising a probe that hybridizes to the base sequence of the 16S rRNA gene and / or RNA-binding protein gene in nucleic acids derived from Blautia wexlerae.

7. A composition containing Blautia wexlerae for the treatment of food allergies and / or severe intellectual and physical disorders in individuals from infancy to under 18 years of age.

Citation Information

Patent Citations

  • How to diagnose dysbiosis

    JP2020527055A

  • Methods for Treating Autism Spectrum Disorders

    JP2023546591A

  • Methods for increasing the population of Blautia species in the gut microbiota

    JP2024507793A

  • Compositions and methods for reducing the incidence of diarrhea by increasing / enhancing Blautia obeum in the gut microbiota

    JP2025505760A

  • Method for screening bacteria of genus blautia

    WO2023068279A1