Compositions and methods for stabilizing targeted proteins by redirecting endogenous deubiquitinating enzymes

JP7917444B2Active Publication Date: 2026-09-08THE TRUSTEES OF COLUMBIA UNIV IN THE CITY OF NEW YORK
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
JP2022542933
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-01-14
Filing Date
2021-01-14
Publication Date
2026-09-08
Estimated Expiration
2041-01-14

Smart Images

  • Figure 0007917444000008
    Figure 0007917444000008
  • Figure 0007917444000009
    Figure 0007917444000009
  • Figure 0007917444000010
    Figure 0007917444000010
Patent Text Reader

Abstract

The present disclosure provides, inter alia, bivalent Nanobody molecules and methods for treating or ameliorating the effects of diseases such as long QT syndrome or cystic fibrosis in a subject using the bivalent Nanobody molecules disclosed herein. Methods for identifying and preparing Nanobody binders that target proteins of interest are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-reference of related applications

[0001] This application claims the benefit of priority of U.S. Provisional Patent Application No. 62 / 961082, filed January 14, 2020, which is incorporated herein by reference in its entirety. [Technical Field]

[0002] This disclosure provides, in particular, divalent nanobody molecules and methods for using divalent molecules to treat or improve the effects of diseases such as long QT syndrome or cystic fibrosis in a subject.

[0003] Inclusion by referencing the sequence list This application includes references to amino acid and / or nucleic acid sequences, which were submitted concurrently as a sequence listing text file, "CU19201-seq.txt", with a file size of 35 KB, created on December 6, 2019. The aforementioned sequence listing is incorporated herein by whole reference in accordance with 37 C. FR §1.52(e)(5).

[0004] Government financial assistance This invention was developed with government support under grant number HL122421, awarded by the National Institutes of Health. The government has certain rights to this invention. [Background technology]

[0005] Protein stability is crucial for the proper functioning of all proteins within a cell. Many disease processes arise from deficiencies in the stability or expression of one or more proteins, ranging from genetic mutations that destabilize ion channels (i.e., cystic fibrosis, CFTR) to virus-mediated elimination of host defenses (i.e., MHCI acceptors) and degradation of cell cycle inhibitors in tumor cell proliferation (i.e., p27, p21). Ubiquitin is a critical post-translational modification, the master regulator of protein turnover and degradation. Nevertheless, the extensive biological roles and complexities of ubiquitin signaling have presented significant obstacles to the development of therapies that selectively stabilize a given target protein by targeting this pathway.

[0006] Ubiquitination is mediated by a stepwise cascade of three enzymes (E1, E2, E3), resulting in the covalent bonding of 76 ubiquitin residues to exposed lysine of target proteins. Ubiquitin itself contains seven lysine residues (K6, K11, K27, K29, K33, K48, K63), which, along with its N-terminus (Met1), can function as secondary attachment sites, resulting in diverse polymer chains that can be interpreted as sorting signals, transport signals, or degradation signals. Ubiquitination is associated with genetic disorders (cystic fibrosis, cardiac arrhythmias, epilepsy, and neuropathic pain), metabolic regulation (cholesterol homeostasis), infections (host system hijacking by viral and bacterial pathogens), and cancer biology (degradation of tumor suppressors, evasion of immune surveillance).

[0007] Deubiquitinating enzymes (DUBs) are specialized isopeptidases that provide distinctive features to ubiquitin signaling through the modification and removal of ubiquitin chains. There are more than 100 human DUBs, comprising six distinct families: 1) Ubiquitin-Specific Protease (USP) family, 2) Ovarian Tumor Protease (OTU) family, 3) Ubiquitin C-Terminal Hydrolase (UCH) family, 4) Josephine Domain family, 5) Novel Ubiquitin-Containing DUB Family Interacting Motifs (MINDY), and 6) JAB1 / MPN / Mov34 Metalloenzyme Domain family (JAMM). Each class of DUB possesses unique catalytic properties; in stark contrast to the JAMM and OTU families, the USP family hydrolyzes all ubiquitin chain types, encompassing a diverse range of enzymes with different ubiquitin binding preferences. Recently, DUBs have attracted interest as drug targets, with several companies seeking DUB inhibitors. However, targeting DUBs for therapeutic purposes presents challenges. This is due to the intermingling of DUB regulatory pathways, where individual DUBs typically target multiple protein substrates, and specific substrates can be regulated by multiple DUB types.

[0008] Ion channel disorders, characterized by abnormal transport, stability, and dysfunction of ion channels / acceptors, constitute a significant unmet clinical need in human disease. Hereditary ion channel disorders are rare diseases encompassing a wide range of impairments in the nervous system (epilepsy, migraine, neuropathic pain), cardiovascular system (long QT syndrome, Brugada syndrome), respiratory system (cystic fibrosis), endocrine system (diabetes mellitus, hyperinsulinemia-induced hypoglycemia), and urinary system (Bartter syndrome, diabetes insipidus). Next-generation genome sequencing is rapidly expanding the list of thousands of channel mutations (with diverse underlying mechanisms of pathology), yet these rare diseases are mostly treated only symptomatically. For example, cystic fibrosis, the most common fatal genetic disease in Caucasians, arises from defects in chloride ion channels, which are cystic fibrosis membrane conductance regulators (CFTRs). The most studied mutation (ΔF508) accounts for approximately 85% of all cases and causes channel misfolding and ubiquitin-dependent transport defects. In another serious disorder, long QT syndrome, there are over 500 mutations in two channels (KCNQ1, hERG), covering nearly 90% of all hereditary cases. Human transport defects in these two channels underlie the mechanisms of most of the mutations that cause these diseases. Therefore, understanding the underlying causes of these loss-of-function is crucial for adopting individualized strategies to treat the underlying dysfunctions in each disease. [Overview of the initiative] [Means for solving the problem]

[0009] This disclosure provides a divalent molecule comprising a) a deubiquitinating enzyme (DUB) conjugate; b) a target conjugate; and c) a variable linker between the DUB conjugate and the target conjugate, wherein the DUB conjugate is selected from intracellular antibody fragments, scFvs, nanobodies, antibody mimes, monobodies, DARPins, lipocalins, and target sequences.

[0010] The present disclosure also provides a method of treating or ameliorating the effects of a disease in a subject, comprising the step of administering to the subject an effective amount of the bivalent molecule disclosed herein.

[0011] The present disclosure further provides a method for identifying and preparing a nanobody binder that targets a protein of interest, the method comprising: a) constructing a naive yeast library that expresses synthetic nanobodies; b) incubating the naive yeast library with the protein of interest; c) selecting yeast cells that express nanobodies binding to the protein of interest by magnetic-activated cell sorting (MACS); d) amplifying the selected cells to construct an enriched yeast library; e) incubating the enriched yeast library with the protein of interest; f) selecting yeast cells that express nanobodies binding to the protein of interest by fluorescence-activated cell sorting (FACS); g) amplifying the selected cells to construct a further enriched yeast library; h) repeating steps e) to g) twice; and i) sorting the selected yeast cells as single cells and culturing the same as monoclonal colonies for binding validation and plasmid isolation.

[0012] The application file contains at least one drawing in color. Copies of this patent publication or published patent application with the color drawing(s) will be provided by the Patent Office upon request and payment of the required fee.

[0013] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The present disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. Brief Description of the Drawings

[0014] [Figure 1A]A diagram showing that enDUBs reverse NEDD4L-mediated ubiquitination of KCNQ1. Figure 1A is a schematic diagram of targeted deubiquitination mediated by enDUBs (nano, PDB: 3K1K). The inset shows the modular domains of OTUD1 and enDUB-O1. [Figure 1B] On the left is a pull-down of KCNQ1 probed with an anti-KCNQ1 antibody from HEK293 cells expressing KCNQ1-YFP ± NEDD4L with nano alone or enDUB-O1. On the right is anti-ubiquitin labeling of the KCNQ1 pull-down after stripping the previous blot. [Figure 1C] A graph showing relative KCNQ1 ubiquitination calculated as the ratio of anti-ubiquitin to anti-KCNQ1 signal intensity (n=4; mean). **p<0.002, one-way ANOVA with Tukey's multiple comparisons test. [Figure 1D] A flow cytometry dot plot showing surface (BTX647 fluorescence) and total (YFP fluorescence) KCNQ1 expression in cells expressing BBS-KCNQ1-YFP. The vertical and horizontal lines represent the thresholds for YFP-positive and BTX647-positive cells, respectively, based on analysis of single-color controls. [Figure 1E] A graph showing quantification of flow cytometry experiments for surface KCNQ1 expression (Figure 1F), analyzed from YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=4; mean ± s.e.m). Data are normalized to values from the control group, KCNQ1 without NEDD4L (dotted line). *p<0.01, Student's unpaired two-tailed t-test. [Figure 1F] A graph showing quantification of flow cytometry experiments for total KCNQ1 expression, analyzed from YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=4; mean ± s.e.m). Data are normalized to values from the control group, KCNQ1 without NEDD4L (dotted line). *p<0.01, Student's unpaired two-tailed t-test. [Figure 1G] A graph showing an exemplary family of KCNQ1 currents from whole-cell patch-clamp recordings in CHO cells [Figure 1H]Graph showing population IV curves for nano (black circles, n=9), nano+NEDD4L (red squares, n=9), and enDUB-O1+NEDD4L (blue triangles, n=12). *p<0.01 vs nano+NEDD4L, two-way ANOVA with Tukey's multiple comparison test. [Figure 2A] Figure showing that enDUBs rescue transport-deficient mutant LQT1 channels. Left: schematic diagram of LQT1 patient mutation along the C-terminus of KCNQ1. Right: graph showing quantification of flow cytometry experiments on surface expression (BTX647) of LQT1 mutant channels in the presence of nano alone (red) or enDUB-O1 (blue), analyzed from YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=3; mean ± sem). Data are normalized to values ​​from the WT KCNQ1 control group (dotted line). *p<0.05, Student's independent two-sided t-test. Right inset: confocal images of live cells expressing BBS-tagged WT KCNQ1-YFP (top), G589D-YFP+nano (middle), or enDUB-O1 (bottom), stained with BTX647 (magenta). [Figure 2B] Figure showing exemplary families of WT KCNQ1 currents and mutant KCNQ1 currents reconstituted in CHO cells. [Figure 2C] Graph showing population IV curves for WT+Nano (black squares, n=10), R591H+Nano (pink triangles, n=8), and R591H+Nano+ML277 (red triangles, n=13). **p<0.001, two-way ANOVA with Tukey's multiple comparison test. [Figure 2D] This graph shows the population IV curves for R591H+enDUB-O1 (light blue circles, n=9) and R591H+enDUB-O1+ML277 (blue circles, n=9). Data for WT KCNQ1 and R591H+nano are reproduced from Figure 2C (black and pink lines). *p<0.01, **p<0.001, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 2E] Confocal images of cardiomyocytes from adult guinea pigs expressing WT KCNQ1-YFP (top), G589D-YFP+ nano (middle), or enDUB-O1 (bottom). [Figure 2F] Graphs showing the mean current response to a slow voltage increase up to +100mV from cardiomyocytes expressing WT KCNQ1-YFP (left; n=17), G589D-YFP (right) + nano alone (red; n=16), or enDUB-O1 (blue; n=14) (mean ± sem). [Figure 2G] Graph (mean ± sd) showing the quantification of the I peak at +100mV in individual cells from the data shown in f. *p<0.03, **p<0.002, one-way ANOVA with Tukey's multiple comparison test. [Figure 2H] This graph shows representative action potential recordings from cardiomyocytes expressing WT KCNQ1-YFP (left), G589D-YFP (right) + nano alone (red), or enDUB-O1 (blue). [Figure 2I] Graph showing quantification of action potential duration (APD90) at 90% repolarization (n=11-13; mean ± sd). **p<0.0002, one-way ANOVA with Tukey's multiple comparison test. [Figure 3A] Figure 3A shows that enDUB, in combination with Orkambi, promotes novel rescue of mutated CFTR channels. Figure 3A is a schematic diagram of six CF patient mutations (classes II and VI) mediated by the BBS-CFTR-YFP channel. The inset shows the modular components of USP21 and enDUB-U21. [Figure 3B] Graphs showing quantification of flow cytometry experiments on surface expression (BTX647) of CFTR mutant channels in the presence of nano alone (black) or + lumacaphthol (3 μM) (red), and enDUB-O1 alone (blue) or + lumacaphthol (3 μM) (green), analyzed from YFP-positive and CFP-positive cells (n ≥ 5000 cells per experiment; N = 3; mean ± sem). Data are normalized to values ​​from the WT CFTR control group (dotted line). *p<0.02, **p<0.0001, bidirectional ANOVA followed by Dunnett's test. [Figure 3C]This figure shows an exemplary family of basal, forskolin-activated (10 μM), and CFTRinh-172-treated (10 μM) WT CFTR currents from whole-cell patch-clamp measurements in HEK293 cells. [Figure 3D] This graph shows the population IV curves for basal (black square, n=16) and forskolin-activated (red square, n=16) WT CFTR currents. [Figure 3E] A diagram showing an exemplary family of untransfected basal and forskolin-activated cells. [Figure 3F] A diagram illustrating exemplary families of basal and forskolin activation at 4326delTC. [Figure 3G] A diagram illustrating an exemplary family of basal and forskolin activation in N1303K CFTR mutant-expressing cells. [Figure 3H] This figure shows an exemplary family of forskolin activation and VX770 enhancement (5 μM) currents for 4236delTC mutant channels after 24 hours of VX809 treatment (3 μM) and co-expression with nano (left) or enDUB-U21 (right). [Figure 3I] This graph shows the population IV curve for forskolin activation and VX770 enhancement current from 4326delTC mutants expressing nano (black circles, n=17) compared with VX809-treated 4326delTC cells expressing nano (red squares, n=15) or enDUB-U21 (green triangles, n=14). [Figure 3J] Figure 3H, in the same format as Figure 3H, for the N1303K mutant channel (n≧8). **p<0.0001, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 3K] A graph in the same format as Figure 3I for the N1303K mutant channel (n≧8). **p<0.0001, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 4A] Figures illustrating the functional rescue of common and rare transport-deficient CFTR mutations in FRT cells. Figure showing the structure of a full-length CFTR channel (PDB:5UAK), source: Liu et al., 2017. NBD1 is highlighted in red. [Figure 4B] The top image shows a schematic diagram of nanobody selection via a yeast surface display library. The bottom image shows an exemplary flow cytometry plot of the yeast library after MACS / FACS enrichment with a target binding agent (red). [Figure 4C] The top diagram shows a schematic of the FRET binding assay in HEK293 cells co-expressing Cerulean-nb.E3h (donor) and Venus-CFTR (acceptor). The bottom diagram shows the flow cytometry-based FRET binding curves for FRET donor efficiency as a function of free acceptors, using Cerulean-nb.E3h (blue) and Cerulean alone as a control (black) (n≧10,000 cells per experiment; N=2). [Figure 4D] This figure shows an exemplary family of forskolin activation and VX770-enhancing currents in FRT cells that stably express WT CFTR (left) or N1303K after 24 hours of VX809 treatment and co-express either CFP alone (center) or enDUB-U21CF.E3h (right). [Figure 4E] This graph shows population IV curves for forskolin-activated WT (black circles, n=7) and N1303K (red squares, n=8) cells compared to VX809-treated, forskolin-activated, and VX770-enhanced N1303K cells expressing CFP alone (green triangles, n=12) or enDUB-U21CF.E3h (blue triangles, n=10). **p<0.0005, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 4F] This figure shows an exemplary family of forskolin activation and VX770-enhancing currents in FRT cells that stably express WT CFTR (left) or F508dell after 24 hours of VX809 treatment and co-express either nb.T2a (center) or enDUB-U21CF.E3h (right). [Figure 4G]Graph showing population IV curves for forskolin-activated WT (black circles, n=7) and F508del (red squares, n=8) cells compared to VX809-treated, forskolin-activated, and VX770-enhanced N1303K cells expressing CFP alone (brown diamond, n=8), nb.T2a (green triangle, n=11), or enDUBU21CF.T2a (blue triangle, n=12). **p<0.005, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 5A] Figure showing that enDUB-O1 requires catalytic activity and target specificity for ubiquitin-dependent rescue of the KCNQ1 channel. (Left) Schematic diagram of experimental strategy; BBS-Q1-YFP was co-transfected with nanobodies alone (gray line), NEDD4L + nanobodies (red line), or NEDD4L + enDUB-O1 (blue line). (Right) Cumulative distribution histogram of Alexa647 fluorescence from flow cytometry analysis. Plots created from populations of YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=2). [Figure 5B] This figure shows that enDUBs reverse the ubiquitination of KCNQ1 mediated by NEDD4L. It shows the same experiment as 5A, but uses enDUB-O1*, which is catalytically inactive in C320S. [Figure 5C] This figure shows that enDUBs reverse NEDD4L-mediated ubiquitination of KCNQ1. It shows the same experiment as in Figure 5A, but uses untagged BBS-Q1 co-expressed with enDUB-O1 as a control for target specificity. [Figure 6A] Figure showing that the ubiquitin state of the G589D LQT1 mutation is not enhanced compared to WT and V524G channels. Western blots of KCNQ1 pulldown probed with anti-KCNQ1 antibody from HEK293 cells expressing WT, G589D, and V524G KCNQ1-YFP channels, using nano alone (left) or enDUB-O1 (right) (representative of two independent experiments). [Figure 6B] Figure 6A shows antiubiquitin labeling of KCNQ1 pulldown after stripping the Western blot. [Figure 7A] This figure shows that enDUB treatment rescues the entire expression of KCNQ1, but not the surface transport of the N-terminal ERAD-associated LQT1 mutation. A schematic diagram of two ERAD-associated LQT1 patient mutations along the N-terminus of KCNQ1 is shown. [Figure 7B] This figure shows flow cytometry analysis of total Q1 expression (YFP fluorescence) in cells expressing WT BBS-KCNQ1-YFP+ nanobodies (left, control, black) and L114P mutation+ nanobodies (center, red) or enDUB-O1 (right, blue). [Figure 7C] Histograms of the cumulative distribution of YFP fluorescence for the experiment shown in Figure 7B (left) and a similar experiment using the Y111C KCNQ1 mutation (right). Plots created from populations of YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=2). [Figure 7D] Figure 7B shows flow cytometry analysis of surface Q1 expression (Alexa647 fluorescence) using the same format. [Figure 7E] Cumulative distribution histogram of surface Q1 expression (Alexa647 fluorescence) using the same format as Figure 7C. [Figure 8A] Figure showing that enDUB-U21 has greater efficacy than enDUB-O1 in surface rescue of the N1303K CFTR mutant channel. Cumulative distribution histograms of Alexa647 fluorescence from flow cytometry analysis of cells expressing WT BBS-CFTR-YFP+ nano (dotted line) and the N1303K mutant, and co-expressing nano alone (red line), enDUB-O1 (blue-green line), and enDUB-U21 (blue line). Plots created from populations of YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=2). [Figure 8B] Figure 8B shows the same experimental setup as Figure 8A, but with VX809 incubated for 24 hours along with nano (green line), enDUB-O1 (blue-green line), and enDUB-U21 (blue line). [Figure 9A]Figure showing that enDUB-U21 requires catalytic activity and target specificity for ubiquitin-dependent rescue of CFTR mutations. (Left) shows an outline of the experimental strategy; WT BBS-CFTR-YFP+ nano (dashed line) or N1303K mutation co-transfected with nano (red line) or enDUB-U21 (blue line). (Middle) Cumulative distribution histogram of Alexa647 fluorescence from flow cytometry analysis and quantification (right). Plots created from populations of YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=3; mean ± sem). Data are normalized to values ​​from the WT CFTR control group (dotted line). [Figure 9B] This shows the same experiment as in Figure 9A, but using enDUB-U21*, which is catalytically inactive with C221S. [Figure 9C] This shows the same experiment as in Figure 9A, but uses mCherry-targeted nanobodies and enDUB-U21 as controls for target specificity. [Figure 10A] This figure shows that enDUB-U21 enhances the functional rescue of 4326delTC CFTR mutant channels in combination with lumakhutol ± ibakhutol. It illustrates a family of basal (top, black), forskolin-activated (middle, red), and VX770-enhanced (bottom, green) currents for 4236delTC mutant channels after 24 hours of VX809 treatment (3 μM) and co-expression with nano (left) or enDUB-U21 (right). [Figure 10B] The population IV curves for basal (black squares), forskolin-activated (red circles), and VX770-enhanced (green triangles) currents from 4326delTC mutations expressing nano alone (left; n=15) or co-expressing enDUB-U21 (right; n=14) are shown. [Figure 11A]This figure shows that enDUB-U21 enhances the functional rescue of N1303K CFTR mutant channels in combination with lumakhutol ± ibakhutol. It illustrates a family of basal (top, black), forskolin-activated (middle, red), and VX770-enhanced (bottom, green) currents for N1303K mutant channels after 24 hours of VX809 treatment (3 μM) and co-expression with nano (left) or enDUBU21 (right). [Figure 11B] The population IV curves for basal (black squares), forskolin-activated (red circles), and VX770-enhanced (green triangles) currents from the N1303K mutation expressing nano alone (left; n=9) or co-expressing enDUB-U21 (right; n=11) are shown. [Figure 12A] This demonstrates the development of NBD1 conjugates from a yeast surface display nanobody library. Figure 12A shows measured binding affinity of nine nanobody clones to yeast using serial dilutions of purified FLAG-NBD1. [Figure 12B] The flow cytometry surface labeling assay and cumulative distribution histograms are shown for WT CFTR surface density alone (dotted line) or when co-expressed with nanobody clones. [Figure 13A] This figure shows that enDUB-U21CF.E3h, in combination with Orkambi, functionally rescues mutations caused by distinct class II and VI CFs in HEK293 cells. It is a schematic diagram of the YFP sensor halide quenching assay. [Figure 13B] The images show exemplary traces of YFP quenching in HEK293 cells expressing the 4326delTC mutation, including mCh (gray) or mCh-tagged 4326delTC mutation only (red), and 4326delTC mutations treated with VX809 (green) or VX809 + enDUB-U21CF.E3h (blue) after the addition of forskolin and VX770. [Figure 13C] This shows an overview of the iodide inflow rate (n=9). **One-way ANOVA with Tukey's multiple comparison test, p<0.0001 vs 4326delTC. [Figure 13D]A figure in the same format as Figure 13B for the N1303K mutant channel (n=8). **One-way ANOVA with Tukey's multiple comparison test for p<0.0001 vs. N1303K. [Figure 13E] Figure 13C shows the same format as Figure 13C for the N1303K mutant channel (n=8). **One-way ANOVA with Tukey's multiple comparison test for p<0.0001 vs. N1303K. [Figure 13F] This graph shows population IV curves for basal (left), forskolin-activated (middle), and VX770-enhanced (right) currents from 4326delTC mutations, treated with mCh-tagged WT CFTR channels (black circles, n=41) or VX809, and co-expressing CFP alone (red squares, n=29), nb.E3h (green triangles, n=9), or enDUB-U21CF.E3h (blue triangles, n=12). *p<0.02, **p<0.0001, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 14A] This figure shows that enDUB-U21CF.T2a, in combination with lumacaftol ± ibacaftol, rescues the transport and function of the F508del mutant channel in HEK293 cells. Flow cytometry-based FRET binding curves are shown for FRET donor efficiency as a function of free acceptors, using Cerulean-nb.T2a (green) and Cerulean alone control (black) (n≧10,000 cells per experiment; N=2). [Figure 14B] This shows quantification of flow cytometry experiments on surface expression (BTX647) of the F508del mutant channel in the presence or absence of VX809 treatment (shaded or plain) in YFP-positive and CFP-positive cells (n≧5000 cells per experiment; N=4; mean ± sem), CFP alone (red), enDUB-U21CF.E3h (orange), nb.T2a (green), or enDUB-U21CF.T2a (blue), with or without VX809 treatment. Data are normalized to the WT CFTR control group, and the dotted line represents F508del VX809 treatment only. †P<0.05 vs CFP+VX809, **p<0.0002 vs all, one-way ANOVA with Tukey's multiple comparison test. [Figure 14C] This graph shows population IV curves for basal (left), forskolin-activated (middle), and VX770-enhanced (right) currents from F508del mutations co-expressing mCh-tagged WT CFTR channels (black circles, n=41) or VX809, or CFP alone (red squares, n=8), nb.T2a (green triangles, n=10), or enDUB-U21CF.T2a (blue triangles, n=9). *p<0.05, **p<0.0001, bidirectional ANOVA with Tukey's multiple comparison test. [Figure 15A] A diagram illustrating the underlying symptoms and current treatments for cystic fibrosis (CF). [Figure 15B] A schematic diagram detailing the ubiquitin-dependent regulation of CFTR surface expression, stability, and function. The anterograde transport pathway is highlighted in blue, and the retrograde transport pathway is highlighted in red. [Figure 16A] The structure of CFTR, an exemplary protein target, is shown. NBD1 is highlighted in red. On the right is the structure of the stabilizing enzyme DUB. [Figure 16B] The top image shows a schematic diagram of nanobody selection via a yeast surface display library. The bottom image shows a plot of flow cytometry after MACS / FACS enrichment with target binding agents (red). [Figure 16C] The top image shows the nanobody-based proof-of-concept ReSTORx molecule, ReSTORAb, consisting of an "active" component (DUB binder; blue) and a "target" component (NBD1 binder; orange). The bottom image shows the FRET analysis and binding curves for each component. [Figure 16D] The left image shows a schematic diagram of the CFTR surface labeling assay and the co-expression of ReSTORAb targeting CFTR. The right image shows a flow cytometry plot from ReSTORAb rescue of the mutant channel. [Figure 16E] Figure 16D shows the same assay as Figure 16D, using USP2 as the deubiquitinating enzyme. [Figure 16F] Figure 16D shows an assay similar to that in the presence of lumacafthol (VX-809). [Figure 17] Schematic diagram of ReSTORAb based on exemplary divalent nanobody [Figure 18] This figure shows that ReSTORAb, based on divalent nanobody structures, can rescue transport defects in long QT syndrome (LQTS). [Modes for carrying out the invention]

[0015] One embodiment of the present disclosure is a divalent molecule comprising a) a deubiquitinating enzyme (DUB) conjugate; b) a target conjugate; and c) a variable linker between the DUB conjugate and the target conjugate, wherein the DUB conjugate is selected from intracellular antibody fragments, scFvs, nanobodies, antibody mimes, monobodies, DARPins, lipocalins, and target sequences.

[0016] In some embodiments, the DUB is endogenous. In some embodiments, the DUB is selected from the ubiquitin-specific protease (USP) family, the ovarian tumor protease (OTU) family, the ubiquitin C-terminal hydrolase (UCH) family, the Josephine domain family (Josephin), the ubiquitin-containing novel DUB family interacting motifs (MINDY), and the JAB1 / MPN / Mov34 metalloenzyme domain family (JAMM). In some embodiments, the DUB is USP21 or USP2.

[0017] In some embodiments, the DUB conjugate is selected from intracellular antibody fragments, scFvs, nanobodies, antibody mimes, monobodies, DARPins, lipocalins, and target sequences. In some embodiments, the DUB conjugate is a nanobody. In some embodiments, the nanobody binds to a member of the USP family. In some embodiments, the nanobody binds to USP2. In some embodiments, the nanobody binds to USP21. In some embodiments, the nanobody contains a sequence represented by any one of sequence numbers 1-6. In some embodiments, the nanobody includes a) a complementarity determination region (CDR) represented by SEQ ID NO: 7, CDR2 represented by SEQ ID NO: 8, and CDR3 represented by SEQ ID NO: 9; b) CDR1 represented by SEQ ID NO: 10, CDR2 represented by SEQ ID NO: 11, and CDR3 represented by SEQ ID NO: 12; c) CDR1 represented by SEQ ID NO: 13, CDR2 represented by SEQ ID NO: 14, and CDR3 represented by SEQ ID NO: 15; d) CDR1 represented by SEQ ID NO: 16, CDR2 represented by SEQ ID NO: 17, and CDR3 represented by SEQ ID NO: 18; e) CDR1 represented by SEQ ID NO: 19, CDR2 represented by SEQ ID NO: 20, and CDR3 represented by SEQ ID NO: 21; or f) CDR1 represented by SEQ ID NO: 22, CDR2 represented by SEQ ID NO: 23, and CDR3 represented by SEQ ID NO: 24.

[0018] In some embodiments, abnormal ubiquitination of the target to which the target binding agent binds causes the disease. In some embodiments, the disease is a hereditary ion channel disease. As used herein, the term “hereditary ion channel disease” refers to a rare disease encompassing a wide range of disorders in the nervous, cardiovascular, respiratory, endocrine, and urinary systems. In this disclosure, “hereditary ion channel disease” includes, but is not limited to, epilepsy, migraine, neuropathic pain, cardiac arrhythmias, long QT syndrome, Brugada syndrome, cystic fibrosis, diabetes mellitus, hyperinsulinemia-induced hypoglycemia, Bartter syndrome, and diabetes insipidus. In some embodiments, the disease is long QT syndrome. In some embodiments, the disease is cystic fibrosis.

[0019] In some embodiments, the target to which the target binding agent binds is a cystic fibrosis membrane conductance regulator (CFTR).

[0020] In some embodiments, the target binding agent is selected from intracellular antibody fragments, scFvs, nanobodies, antibody mimes, monobodies, DARPins, lipocalins, and target sequences. In some embodiments, the target binding agent is a nanobody. In some embodiments, the nanobody binds to the NBD1 domain of cystic fibrosis membrane conductance regulator (CFTR). In some embodiments, the nanobody comprises a sequence represented by any one of SEQ ID NOs. 25-38. In some embodiments, the nanobody is a) a complementarity determination region (CDR) represented by SEQ ID NO: 39, CDR2 represented by SEQ ID NO: 40, and CDR3 represented by SEQ ID NO: 41; b) CDR1 represented by SEQ ID NO: 42, CDR2 represented by SEQ ID NO: 43, and CDR3 represented by SEQ ID NO: 44; c) CDR1 represented by SEQ ID NO: 45, CDR2 represented by SEQ ID NO: 46, and CDR3 represented by SEQ ID NO: 47; d) CDR148 represented by SEQ ID NO: ~, CDR2 represented by SEQ ID NO: 49, and CDR3 represented by SEQ ID NO: 50; e) CDR1 represented by SEQ ID NO: 51, CDR2 represented by SEQ ID NO: 52, and CDR3 represented by SEQ ID NO: 53; f) CDR1 represented by SEQ ID NO: 54, CDR2 represented by SEQ ID NO: 55, and CDR3 represented by SEQ ID NO: 56; g) CDR1 represented by SEQ ID NO: 57, CDR2 represented by SEQ ID NO: 58, and SEQ ID NO: 5 9 represents CDR3; h) CDR1 represented by SEQ ID NO: 60, CDR2 represented by SEQ ID NO: 61, and CDR3 represented by SEQ ID NO: 62; i) CDR1 represented by SEQ ID NO: 63, CDR2 represented by SEQ ID NO: 64, and CDR3 represented by SEQ ID NO: 65; j) CDR1 represented by SEQ ID NO: 66, CDR2 represented by SEQ ID NO: 67, and CDR3 represented by SEQ ID NO: 68; k) CDR1 represented by SEQ ID NO: 69, CDR2 represented by SEQ ID NO: 70, and CDR3 represented by SEQ ID NO: 71; l) CDR1 represented by SEQ ID NO: 72, CDR2 represented by SEQ ID NO: 73, and CDR3 represented by SEQ ID NO: 74; m) CDR1 represented by SEQ ID NO: 75, CDR2 represented by SEQ ID NO: 76, and CDR3 represented by SEQ ID NO: 77; or n) CDR1 represented by SEQ ID NO: 78, CDR2 represented by SEQ ID NO: 79, and CDR3 represented by SEQ ID NO: 80.

[0021] In some embodiments, the linker is an alkyl group, polyethylene glycol (PEG), or other similar molecules, or a click linker. As used herein, “alkyl group” can be branched or linear, substituted or unsubstituted. The length of the alkyl group is selected to maximize the efficient binding of the DUB binder and the target binder, or at least to avoid substantial interference. For example, the alkyl group may be C1-C 25 For example, C1~C 15 , C1~C 10 , and C1-C5, including C1-C 20 These may include, for example. Therefore, alkyl linkers may contain carbon chains of order C1, C2, C3, C4, C5, C6, C7, C8, C9, C10, C11, C12, C13, C14, C15, C16, C17, C18, C19, C20, C21, C22, C23, C24, C25, or higher. As used herein, “click linker” is a type of biocompatible small molecule used in bioconjugation that enables the binding of a selected substrate to a specific biomolecule. This is based on “click” chemistry, which is well described in Kolb et al. (2001) “Click Chemistry: Diverse Chemical Function from a Few Good Reactions”. Angewandte Chemie International Edition. 40 (11): 2004-2021.

[0022] Another embodiment of the present disclosure is a method for treating or improving the effects of a disease in a subject, comprising the step of administering an effective amount of the divalent molecule disclosed herein to the subject.

[0023] In some embodiments, the subject is human. In some embodiments, the disease is selected from the group consisting of hereditary ion channel diseases, cancer, vascular conditions, infections, and metabolic diseases. In some embodiments, the hereditary ion channel disease is selected from the group consisting of epilepsy, migraine, neuropathic pain, cardiac arrhythmias, long QT syndrome, Brugada syndrome, cystic fibrosis, diabetes mellitus, hyperinsulinemia-induced hypoglycemia, Bartter syndrome, and diabetes insipidus. In some embodiments, the hereditary ion channel disease is cystic fibrosis.

[0024] As used herein, the terms “to treat,” “treating,” and “therapy,” as well as their grammatical variations, mean subjecting an individual subject to a protocol, regimen, process, or therapy, where it is desirable to obtain a physiological response or outcome in that subject, e.g., a patient. However, since not all subjects treated may respond to a particular treatment protocol, regimen, process, or therapy, treatment does not require that the desired physiological response or outcome be achieved in every subject or subject group, e.g., a patient group. Therefore, a given subject or subject group, e.g., a patient group, may not respond to treatment or may respond inappropriately to treatment.

[0025] As used herein, the terms “improve,” “improve,” and their grammatical variations mean reducing the severity of the symptoms of a disease in an object, preferably a human being.

[0026] As used herein, “administer,” “administering,” and variations thereof mean introducing a composition or drug, such as a synthetic membrane-receptor complex, to a subject, including simultaneous and sequential introduction of the composition or drug. Introduction of a composition or drug to a subject may be by any suitable route, including oral, pulmonary, intranasal, parenteral (intravenous, intramuscular, intraperitoneal, or subcutaneous), rectal, lymphatic, or topical. Administration may include self-administration and administration by another person. A suitable route of administration allows the composition or drug to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or drug into the subject's vein. Administration may be carried out by any suitable route.

[0027] As used herein, “Subject” means a mammal, preferably a human. In addition to humans, the category of mammals within the scope of this disclosure includes, for example, livestock, domesticated animals, and laboratory animals. Some examples of livestock include cattle, pigs, horses, and goats. Some examples of domesticated animals include dogs and cats. Some examples of laboratory animals include primates, rats, mice, rabbits, and guinea pigs.

[0028] Another embodiment of the present disclosure is a method for identifying and preparing nanobody binders targeting a protein of interest, comprising: a) constructing a naive yeast library expressing synthetic nanobodies; b) incubating the naive yeast library with the protein of interest; c) selecting yeast cells expressing nanobodies that bind to the protein of interest by magnetically activated cell sorting (MACS); d) amplifying the selected cells to construct a concentrated yeast library; e) incubating the concentrated yeast library with the protein of interest; f) selecting yeast cells expressing nanobodies that bind to the protein of interest by fluorescence-activated cell sorting (FACS); g) amplifying the selected cells to construct a further concentrated yeast library; h) repeating steps e) through g) twice; and i) sorting the selected yeast cells as single cells and culturing them as monoclonal colonies for binding verification and plasmid isolation.

[0029] In some embodiments, the protein of interest is a cystic fibrosis membrane conductance regulator (CFTR). In some embodiments, the protein of interest is a deubiquitinating enzyme (DUB).

[0030] Additional definitions The term "amino acid" means naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimes that function similarly to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those that are later modified, such as hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. "Amino acid analogs" mean compounds that have the same basic chemical structure as naturally occurring amino acids, such as hydrogen, a carboxyl group, an amino group, and a carbon atom bonded to an R group, such as homoserine, norleucine, methionine sulfoxide, and methionine methylsulfonium. Such analogs may have a modified R group (e.g., norleucine) or a modified peptide backbone, but retain the same basic chemical structure as naturally occurring amino acids. Imino acids, such as proline, also fall within the scope of "amino acid" as used herein. "Amino acid mimes" mean compounds that have a structure different from the general chemical structure of amino acids, but function similarly to naturally occurring amino acids.

[0031] As used herein, the terms “polypeptide,” “peptide,” and “protein” are interchangeable to refer to polymers of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of corresponding natural amino acids, as well as natural amino acid polymers, those containing modified residues, and amino acid polymers that do not exist in nature.

[0032] As used herein, “nucleic acid,” “oligonucleotide,” or “polynucleotide” means at least two nucleotides covalently linked to each other. Many variants of nucleic acids can be used for the same purposes as a given nucleic acid. Thus, nucleic acids also include substantially identical nucleic acids and their complements.

[0033] Nucleic acids may be single-stranded or double-stranded, or may contain portions of both double-stranded and single-stranded sequences. Nucleic acids may be DNA, both genome and cDNA, RNA, or hybrids, where nucleic acids may contain combinations of deoxyribonucleotides and ribonucleotides, as well as combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids can be synthesized as single-stranded molecules or expressed in cells (in vitro or in vivo) using synthetic genes. Nucleic acids can be obtained by chemical synthesis or recombinant methods.

[0034] Nucleic acids may also be RNA such as mRNA, tRNA, short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA), transcription gene silencing RNA (ptgsRNA), Piwi-interacting RNA, pri-miRNA, pre-miRNA, microRNA (miRNA), or anti-miRNA.

[0035] As used herein, the term “antibody” encompasses immunoglobulins, and fragments thereof, that are naturally occurring, partially, or entirely synthetically produced. The term also extends to any protein having a binding domain homologous to an immunoglobulin-binding domain. These proteins may be derived from natural sources or partially or entirely synthetically produced. “Antibodies” further include polypeptides containing a framework region derived from an immunoglobulin gene or fragment thereof that specifically binds to and recognizes an antigen. The use of the term “antibody” means to include whole antibodies, polyclonal, monoclonal, and recombinant antibodies, and fragments thereof, and further includes single-chain antibodies, humanized antibodies; mouse antibodies; chimeric, mouse-human, mouse-primate, primate-human monoclonal antibodies, anti-idiotype antibodies, antibody fragments, e.g., scFv, (scFv)2, Fab, Fab', and F(ab')2, F(ab1)2, Fv, dAb, and Fd fragments, diabodies, nanobodies, and antibody-associated polypeptides. Antibodies include bispecific antibodies and multispecific antibodies, insofar as they exhibit the desired biological activity or function.

[0036] As used herein, the term “antigen-binding fragment” refers to a fragment of intact immunoglobulin and any portion of a polypeptide containing an antigen-binding region capable of specifically binding to an antigen. For example, an antigen-binding fragment may be, but is not limited to, an F(ab')2 fragment, a Fab' fragment, a Fab fragment, an Fv fragment, or an scFv fragment. A Fab fragment has one antigen-binding site and includes variable regions of the light and heavy chains, a constant region of the light chain, and a first constant region CH1 of the heavy chain. A Fab' fragment differs from a Fab fragment in that it further includes a hinge region of the heavy chain, with at least one cysteine ​​residue at the C-terminus of the heavy chain CH1 region. An F(ab')2 fragment is generated, thereby linking the cysteine ​​residue of the Fab' fragment to the hinge region via a disulfide bond. An Fv fragment is the smallest antibody fragment, containing only the heavy chain variable region and the light chain variable region, and recombinant techniques for producing Fv fragments are well known in the art. Double-chain Fv fragments may have a structure in which the heavy chain variable region is linked to the light chain variable region by a non-covalent bond. Single-chain Fv(scFv) fragments may generally have a dimeric structure similar to double-chain Fv fragments, where the heavy chain variable region is covalently linked to the light chain variable region via a peptide linker, or the heavy chain and light chain variable regions are directly linked to each other at their C-terminus. Antigen-binding fragments can be obtained using proteases (e.g., digesting the entire antibody with papain to obtain the Fab fragment, and then digesting it with pepsin to obtain the F(ab')2 fragment), and can be prepared by recombination techniques. The dAb fragment consists of a VH domain. Single-chain antibody molecules may contain polymers with many individual molecules, such as dimers, trimers, or other polymers.

[0037] As used herein, “vector” refers to an assembly capable of directing the expression of a desired protein. A vector must contain a transcription promoter element operably ligated to one or more genes of interest. A vector may consist of deoxyribonucleic acid ("DNA"), ribonucleic acid ("RNA"), or a combination of the two (e.g., a DNA-RNA chimera). Optionally, a vector may contain a polyadenylated sequence, one or more restriction sites, and one or more selection markers, such as neomycin phosphotransferase or hygromycin phosphotransferase. In addition, depending on the selected host cell and the vector used, other genetic elements such as replication origins, additional nucleic acid restriction sites, enhancers, sequences that confer transcriptional inducibility, and selection markers may also be incorporated into the vectors described herein.

[0038] As used herein, the terms “cell,” “host cell,” or “recombinant host cell” refer to a host cell that has been engineered to express a desired recombinant protein. Methods for producing recombinant host cells are well known in the art. See, for example, Sambrook et al. (MOLECULAR CLONING: A LABORATORY MANUAL (Sambrook et al, eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1989)) and Ausubel et al. (CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Ausubel et al., eds., John Wiley & Sons, New York, 1987). In this disclosure, host cells are transformed with vectors described herein.

[0039] The recombinant host cells used herein may include, but are not limited to, bacteria, yeasts, insects, and mammalian cell lines, as are any host cells used for recombinant protein production.

[0040] As used herein, the terms “increase,” “enhance,” “stimulate,” and / or “induce” (and similar terms) generally refer to an action that directly or indirectly improves or increases a concentration, level, function, activity, or behavior compared to its natural state, expected state, mean state, or control state.

[0041] As used herein, the terms “inhibit,” “suppress,” “reduce,” “interfere,” and / or “reduce” (and similar terms) generally refer to actions that directly or indirectly reduce a concentration, level, function, activity, or behavior compared to its natural state, expected state, mean state, or control state.

[0042] The terms used herein are for the sole purpose of describing specific embodiments and are not intended to limit them. Where used herein and in the appended claims, the singular forms "a," "an," and "the" refer to plural subjects unless the context specifically indicates otherwise.

[0043] In the enumeration of numerical ranges in this specification, each number that intersects them with a similar degree of precision is explicitly intended. For example, in the range 6 to 9, the numbers 7 and 8 are intended in addition to 6 and 9, and in the range 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly intended.

[0044] The following embodiments are provided to further illustrate certain aspects of the present disclosure. These embodiments are for illustrative purposes only and are not intended to limit the scope of the present disclosure in any way. [Examples]

[0045] Example 1 Targeted deubiquitination can rescue patients with transport-deficient ion channel diseases. Hereditary or de novo mutations in ion channels underlie a variety of diseases (known as ion channel diseases), including cardiac arrhythmias, epilepsy, and cystic fibrosis (Kullmann, 2010; Bohnen et al. 2016; Cutting, 2014). Impairment of channel transport to the cell surface underlies many different ion channel diseases (Curran and Mohler, 2015), representing a shared mechanism that still presents an untapped opportunity for developing common strategies to treat different rare diseases. Ubiquitination is a common post-translational modification in ion channels that limits surface density by inhibiting forward transport, promoting endocytosis, and facilitating degradation (Foot et al. 2017; MacGurn et al. 2012). Here, we show that targeted deubiquitination can rescue transport-deficient mutant ion channels causing different diseases. We developed a modified deubiquitinating enzyme (enDUB) featuring a nanobody fused to a minimal deubiquitinating enzyme catalyst component, enabling selective removal of ubiquitin chains from target channels (Table 1). This targeted deubiquitination approach successfully rescued surface transport and functional currents of different mutant ion channels (KCNQ1 and cystic fibrosis transmembrane regulator (CFTR)) that cause long QT syndrome (LQT1) and cystic fibrosis (CF), respectively. In a guinea pig ventricular cardiomyocyte model of LQT1, enDUB treatment resulted in slow delayed rectification of KCNQ1. + Current and normalized action potential duration were saved. Furthermore, CFTR-targeted enDUBs, when combined with Orkambi, an FDA-approved therapy, showed remarkable synergistic effects in the functional salvation of CF mutations. Therefore, we propose targeted deubiquitination as a powerful general approach to classify and rescue a diverse range of diseases in which impaired ion channel transport to the cell surface is a major mechanism.

[0046] Ion channel disorders, caused by genetic or de novo mutations in ion channels, underlie a wide range of diseases across the nervous system (epilepsy, migraine, neuropathic pain) (Kullmann, 2010), cardiovascular system (long QT syndrome, Brugada syndrome) (Bohnen et al. 2016), respiratory system (cystic fibrosis) (Cutting, 2014), endocrine system (diabetes mellitus, hyperinsulinemia-induced hypoglycemia) (Ashcroft and Rorsman, 2013), and urinary system (Barter syndrome, diabetes insipidus) (Imbrici et al. 2016). Each ion channel typically contains hundreds of disease-causing mutations, presenting a tremendous challenge to treatment. Mechanism-based approaches to correct the underlying abnormalities, generally applicable to various ion channels, are advantageous but lacking (Imbrici et al. 2016; Wulff et al. 2019).

[0047] Long Qt syndrome type 1 (LQT1) and cystic fibrosis (CF) arise from loss-of-function mutations in the KCNQ1 (Kv7.1) (Bohnen et al. 2016; Tester et al. 2005) and cystic fibrosis transmembrane regulator (CFTR) (Cutting, 2014) channels, respectively. LQT1 increases the risk of exertional cardiac arrhythmias and sudden cardiac death, while CF patients exhibit impaired mucus clearance from the airways, leading to recurrent bacterial infections, uncontrolled inflammation, lung injury, and reduced life expectancy. For both KCNQ1 and CFTR, a prominent mechanism underlying many loss-of-function mutations is impaired channel transport to the surface (Wilson et al. 2005; Hardt et al. 1999; Cheng et al. 1990). This disclosure utilizes this shared mechanism to develop a method suitable for therapeutic development and applicable to a variety of ion channels.

[0048] Since ubiquitination / deubiquitination are major determinants of ion channel surface density (Figure 1A), it is hypothesized that transport-deficient ion channels can be rescued by removing ubiquitin from mutant channels. Given that ubiquitination is a widespread physiological phenomenon, the goal is to develop targeted deubiquitination techniques that avoid the problematic off-target effects generally associated with targeting the ubiquitin / proteasome system (Nalepa et al. 2006; Huang and Dixit, 2016). First, we consider K, which is known to be downregulated at the protein and functional levels by the E3 ubiquitin ligase NEDD4L. + We utilized the ion channel YFP-tagged KCNQ1 (Jespersen et al. 2007). We developed a YFP-targeted engineered deubiquitinase (enDUB-O1) by fusing a minimal catalytic unit of ovarian tumor deubiquitinase 1 (OTUD1), a deubiquitinase that is essentially preferred over K63 polyubiquitin chain hydrolysis (Mevissen et al. 2013), to a nanobody specific to GFP / YFP rather than CFP18 (Figure 1A, inset). We tested the efficacy and selectivity of enDUB-O1 using biochemical and functional assays in transiently transfected HEK293 cells (Figures 1B-1H).

[0049] Immunoprecipitation experiments in control cells expressing KCNQ1-YFP and anti-GFP nanobodies (nano) showed potent expression of ubiquitinated KCNQ1 channels, reflecting endogenous E3 ligase activity (Figures 1B and 1C). Co-expression of NEDD4L with KCNQ1-YFP and nano decreased KCNQ1 levels (Figure 1B, left) but increased ubiquitin signaling (Figures 1B and 1C). In the presence of NEDD4L, enDUB-O1 rescued KCNQ1 expression and prevented increased channel ubiquitination (Figures 1B and 1C).

[0050] Flow cytometry assays were performed to simultaneously measure the total expression and surface density of KCNQ1-YFP and to evaluate the ability of enDUB-O1 (expressed in a 1:1 ratio with CFP using a P2A self-cleaving peptide plasmid) to counteract the effects of NEDD4L on these two indicators. NEDD4L significantly reduced KCNQ1 surface density (assessed by fluorescent bungarotoxin binding to the extracellular epitope tag) and total expression (assessed by YFP fluorescence), and both effects were reversed by enDUB-O1 (Figures 1D-1F). EnDUB-O1 without catalytic activity* did not rescue KCNQ1-YFP surface density, demonstrating that DUB enzyme activity is required for this effect (Figure 5B). Furthermore, enDUB-O1 did not rescue the surface density of KCNQ1 channels lacking the YFP tag, confirming the specificity of the targeted enDUB approach (Figure 5C).

[0051] The function of KCNQ1 channels rescued by enDUB-O1 was determined using whole-cell patch-clamp electrophysiology. Control cells expressing KCNQ1+ nano showed a potent KCNQ1 current that was abolished by NEDD4L expression (Figure 1G and 1H); co-expression with enDUB-O1 completely rescued the KCNQ1 current (Figure 1G and 1H), confirming the effectiveness of enDUB-mediated targeted deubiquitination for specifically deubiquitinating and stabilizing the functional channel of interest on the cell surface.

[0052] The next question was whether enDUB rescues the transport-deficient mutant KCNQ1 channel underlying LQT1. We used flow cytometry to examine the effects of 14 different C-terminal LQT1 mutations of KCNQ1 (Tester et al. 2005; Aromolaran et al. 2014), and the previously described N-terminal endoplasmic reticulum-associated degradation (ERAD)-dependent mutation (L114P) (Peroz et al. 2009) on channel surface density (Figure 2A). In addition to L114P, nine of the 14 C-terminal mutations showed a significant reduction in surface transport compared to WT KCNQ1 (Figure 2A, red bars). Surprisingly, the surface density of six mutant channels was partially or completely rescued by enDUB-O1 co-expression (Figure 2A, blue bars and inset). The response mutation channels were clustered along the KCNQ1 coiled-coil tetramerization domain (helix D), defining spatial "hotspots" suitable for rescuing transport via enDUB (Figure 2A, purple text).

[0053] Functionally, the homotetrameric R591H channel showed a dramatically reduced current compared to WT KCNQ1, consistent with impaired surface transport (Figures 2B and 2C). Application of the KCNQ1 activator ML277 (Mattmann et al. 2012) (1 μM) slightly increased the R591H current, indicating that only a small portion of the channel is surface-based (Figures 2B and 2C). Co-expression of enDUB-O1 significantly reduced the R591H current to approximately 50% of that of WT KCNQ1, suggesting that the mutation causes additional impairment in either open probability or conductance, in light of complete relief of surface density (Figure 2A) (Figures 2B and 2D). Notably, ML277 significantly increased the R591H current amplitude, which was rescued with enDUB-O1, beyond WT KCNQ1 levels (Figures 2B and 2D).

[0054] LQT1 is typically inherited in an autosomal dominant manner, with each patient possessing one WT and one mutant allele (Bohnen et al. 2016). Therefore, we then consider the following:Ks attempted to recapitulate the nature of LQT1 heterotetramers in cardiomyocytes, a species that is important for the repolarization of cardiac action potentials. We used adenovirus to express YFP-tagged WT or LQT1 mutant KCNQ1 channels in isolated adult guinea pig cardiomyocytes (Figure 2E). Compared with cardiomyocytes expressing WT KCNQ1, cardiomyocytes harboring G589D showed a reduction in delayed outward current measured by slow voltage ramp up to +100 mV (Figures 2F and 2G), and significantly prolonged action potential duration (APD), a characteristic of LQTS (Figures 2H and 2I). Surprisingly, treatment of cardiomyocytes expressing G589D with enDUB-O1 reduced I Ks and APD to WT KCNQ1 levels (Figures 2F-2I).

[0055] Notably, the susceptibility of mutant KCNQ1 to enDUB-O1-mediated rescue is not simply correlated with the level of channel ubiquitination 3 / 4 for example, the baseline ubiquitin signal of G589D was lower than that observed for V524G, a mutant that is not rescued by enDUB-O1 (Figures 6A-6B). Furthermore, although enDUB-O1 rescued total protein expression, it did not rescue the surface density of ERAD-sensitive L114P and Y111C (Figures 7A-7E), suggesting an additional mechanism that prevents forward trafficking of misfolded proteins independent of ubiquitination status.

[0056] To determine whether functional channels can be similarly rescued in another ion channel disease where trafficking impairment is the main root cause, we investigated Cl -We focused on cystic fibrosis (CF), a devastating monogenic disorder resulting from loss-of-function mutations in the ion channel CFTR. Over 2000 different CF mutations have been mapped to CFTR, many of which reduce channel surface density due to folding / transportation disorders (Class II) or decreased plasma membrane stability (Class VI) (Veit et al. 2016; Boeck and Amaral, 2016). The discovery of pharmacological chaperones (corrective factors) and gating modifiers (enhancing factors) from high-throughput screening led to Orkambi, an FDA-approved combination therapy consisting of lumakhatl (VX809; corrective factor) and ibakhatl (VX770; enhancing factor) for treating homozygous F508del mutations (Wainwright et al. 2015; Goor et al. 2011; Goor et al. 2009). Nevertheless, the clinical efficacy of Orkambi is often suboptimal (change in forced expiratory volume is approximately 3%), and a significant number of CFTR mutations are resistant to treatment, highlighting the urgent need for the development of complementary therapies (Boeck and Amaral, 2016; Farinha and Matos, 2016).

[0057] BBS-tagged YFP-CFTRs were designed to allow simultaneous assessment of total channel expression and surface density using flow cytometry, and the effects of six different mutations, previously classified as class II (F508del, R560T, N1303K) or class VI (Q1412X, 4279insA, 4326delTC), were examined (Figure 3A). All six mutations significantly impaired channel surface density compared to WT CFTRs (Figure 3B, black bars). In 24-hour pre-incubation of cells with Lumacaftol, surface expression of F508del and R560T did not increase, but transport of the remaining four mutations improved (Figure 3B, red bars), providing a gold standard correction factor benchmark for evaluating the effectiveness of enDUBs. We utilized a second enDUB (enDUB-U21) containing the catalytic component of the ubiquitin-specific protease USP21 (Figure 3A), which removes all ubiquitin binding types (Faesen et al. 2011). In pilot experiments, enDUB-U21 was more effective than enDUB-O1 (Figures 8A-8B) in rescuing CFTR transport, leading us to adopt the former in CFTR experiments. Similar to lumacaphthol, enDUB-U21 did not significantly rescue the surface densities of F508del and R560T; however, it was equally or more effective in correcting four other mutations, two of which (N1303K and 4279insA) were rescued to WT CFTR levels (Figure 3B, blue bars). Since catalytically inactive enDUB-U21 and enDUB-U21 targeting mCh did not improve the surface expression of YFP-tagged N1303K, both DUB activity and CFTR targeting are necessary to reverse the transport deficiency (Figures 9A-9C). Most importantly, co-expression of lumacafthol and enDUB-U21 resulted in synergistic relief of mutant CFTR surface density, suggesting a novel combination corrective therapy for CF (Figure 3B; green bars).

[0058] The next crucial step was to determine whether the mutant CFTR channels rescued with enDUB-U21 were functional. We focused on N1303K and 4326delTC, representing class II and class VI mutations, respectively. HEK293 cells expressing WT CFTR exhibited a potent forskolin-activated chloride current, which was blocked by CFTR inhibitors (Figures 3C and 3D) and not observed in untransfected cells (Figure 3E). In contrast, cells expressing either N1303K or 4326delTC alone did not produce a forskolin-induced current (Figures 3F and 3G), consistent with their limited surface transport and disease-causing mutation status. In nanoexpressing cells, pre-incubation with lumacaftor generated relatively small forskolin-induced 4326delTC currents (Figures 10A-10B) and N1303K currents (Figures 11A-11B), which were further enhanced by ibakhtor (Figures 3H-3K). Interestingly, under the same conditions, cells co-expressing enDUB-U21 generated significantly larger forskolin-stimulated 4326delTC or N1303K currents (Figures 10A-10B and 11A-11B), which were further enhanced by ibakhtor (Figures 3H-3K).

[0059] While GFP-targeted enDUBs have demonstrated significant proof-of-concept effectiveness for targeted deubiquitination techniques in rescuing various transport-deficient recombinant mutant channels, the key next step was to develop nanobodies directed toward CFTR itself to enable targeting of the endogenous channel. Therefore, we used purified CFTR NBD1 domains (Figure 4A) as bait and identified conjugates using yeast nanobodies library surface display techniques (McMahon et al. 2018) (Figure 4B). After several rounds of magnetically activated cell sorting (MACS) and fluorescence-activated cell sorting (FACS) selection, we isolated 14 unique nanobodies conjugates with a range of affinity for NBD1, as reported by yeast binding assays (Figure 12A; Table 1). Encouragingly, many nanobodies conjugates did not inherently hinder channel surface transport when co-expressed with WT CFTR (Figure 12B). In a pilot study, we used a halide-sensitive YFP quenching assay (Galietta et al. 2001) to screen various nanobodies for the enDUB-mediated functional rescue of CFTR iodide current in HEK293 cells (Figure 13A). enDUB (enDUB-U21) CF.E3h We selected a single nanobody clone, nb.E3h, because it exhibits superior performance in both halide sensor and patch-clamp assays when converted to (called) (Figures 13A-13F). Binding of nb.E3h to full-length CFTR within cells was confirmed by flow cytometry fluorescence resonance energy transfer (flow-FRET) assay (Figure 4C).

[0060] To test the efficacy of enDUB targeting CF in the context of related cells, we utilized a predictive in vitro CF model (Fischer rat thyroid (FRT) epithelial cells stably expressing mutant CFTR channels) that had been used to generate preclinical data prior to clinical trials (Goor et al. 2011; Goor et al. 2009; Yu et al. 2012) and to facilitate the expansion of the FDA drug labeling for Kalydeco (ibacaftol) (Ratner, 2017; Durmowicz et al. 2018). Consistent with previous findings (Han et al. 2018; Goor et al. 2014), FRT cells stably expressing the N1303K channel showed little functional current compared to WT control cells and did not respond to VX809+VX770 treatment (Figures 4D and 4E). Surprisingly, enDUB-U21 combined with the same CFTR modulator did not respond. CF.E3h The N1303K current provided impressive salvation for up to 40% of WT cells (Figures 4D and 4E).

[0061] F508del represents the most common CF mutation, and the phenylalanine deletion in NBD1 results in loss of thermal stability of CFTR folding, assembly, and transport (Lukacs and Verkman, 2012; Okiyoneda et al. 2013; Okiyoneda et al. 2010). In HEK293 cells, enDUB-U21 CF.E3hIn the presence of VX809, only a slight improvement in F508del surface expression was observed (Figures 14A-14C). It is hypothesized that an alternative enDUB with the dual ability to 1) enhance the thermal stability of NBD1 upon binding and 2) modulate the CFTR ubiquitin state via catalytic action would result in improved F508del rescue. In particular, recent studies have developed a nanobody (nb.T2a) that binds to isolated wt and F508del NBD1 with thermal stabilizing properties in cell-free preparations (Sigoillot et al. 2019); however, the functional effects of nb.T2a on full-length F508del CFTR mutations in situ have not been investigated. We have introduced nb.T2a into our enDUB-U21 system (enDUB-U21 CF.T2a By adapting it to ), we tested the potential synergistic effect of thermal stabilization of enDUB. nb.T2a expression combined with VX809 resulted in a slight increase in F508del surface transport, but our functionalized enDUB-U21 CF.T2a +VX809 showed a significant enhancement of surface salvage in HEK293 cells (Figures 14A-14C). Furthermore, superior functional salvage was supported by patch-clamp studies of HEK293 and enDUB-U21 CF.T2a Compared to VX809±nb.T2a alone, it significantly improved the F508del functional current (Figures 14A-14C). Finally, in FRT cells that stably express F508del, enDUB-U21 CF.T2a Combination therapy with VX809 and VX770 resulted in functional F508del salvage down to approximately 45% of the WT level, showing a significant improvement compared to VX809 + VX770 ± nb.T2a treatment alone (Figures 4F and 4G).

[0062] Taken together, our data reveal targeted deubiquitination as a powerful strategy for rescuing disparate transport-impaired ion channels underlying heterogeneous diseases. High-throughput screening has enabled the identification of pharmacological correctors (such as lumacafthol for CFTR), but these are typically effective against only one target channel, and their mechanisms of action remain unclear. On the other hand, cold, nonspecific chemical chaperones (e.g., glycerol) (Okiyoneda et al. 2013; Delisle et al. 2004) can rescue different subsets of transport-impaired ion channels; however, this approach is not suitable for therapeutic development. From this perspective, enDUB represents an exciting new mechanism-based strategy with targeting specificity and adaptability across various channel types, which can be constructed for custom therapeutic applications. Beyond membrane proteins, it is intriguing to explore opportunities to modulate diverse ubiquitin-dependent processes targeting different protein targets in living cells (Nalepa et al. 2006; Huang and Dixit, 2016). Translating these insights into effective molecular therapies for various diseases offers exciting prospects for future research.

[0063] Materials and methods Molecular biology and plasmid vector cloning A customized bicistronic CMV mammalian expression vector (nano-xx-P2A-CFP) was generated as described above (Kanner et al. 2017); we PCR-amplified the coding sequence of the GFP nanobody (vhhGFP4) (Rothbauer et al. 2008) and cloned it to xx-P2A-CFP using the NheI / AflII site. To generate the enDUB-O1 construct, the OTU domain + UIM (residues 287-481) was PCR-amplified from OTUD1 (Addgene#61405) using the AscI / AflII site separated by a flexible GSG linker. To create a catalytically inactive enDUB-O1*, a point mutation was introduced at the catalytic cysteine ​​residue [C320S] by site-directed mutagenesis. A second customized bicistronic vector (CFP-P2a-nano-xx) was generated as described above (Kanner et al. 2017). To generate enDUB-U21, the USP domain (residues 196-565) was PCR-amplified from USP21 (Addgene#22574), and this fragment was cloned into CFP-P2a-nano-xx using an AscI / NotI site. To create catalytically inactive enDUB-U21*, a point mutation was introduced into the catalytic cysteine ​​residue [C221S] by site-directed mutagenesis. Using the same cloning strategy as above, mCh-targeted enDUB-U21 was generated using the mCh nanobody, LaM-4 (Fridy et al. 2014).

[0064] The KCNQ1 construct was generated as previously described (Aromolaran et al. 2014). Briefly, the enhancement yellow fluorescent protein (EYFP) was fused to the C-terminus of KCNQ1 in a frame using overlap extension PCR. The 13-residue bungarotoxin binding site (BBS; TGGCGGTACTACGAGAGCAGCCTGGAGCCCTACCCCGAC; SEQ ID NO: 81) (Aromolaran et al. 2014; Sekine-Aizawa and Huganir, 2004) was introduced between residues 148-149 of the extracellular S1-S2 loop of KCNQ1 using the QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene) according to the manufacturer's instructions. LQT1 mutations were introduced into the N-terminus and C-terminus of KCNQ1 by site-directed mutagenesis. NEDD4L (PCI_NEDD4L; Addgene#27000) was donated by Joan Massague (Gao et al. 2009).

[0065] CFTR constructs were derived from pAd.CB-CFTR (ATCC® 75468). To create CFTRYFP, EYFP was fused to the N-terminus of CFTR using PCR amplification. To create BBS-CFTR-YFP, the BBS site was introduced between residues 901-902 of the fourth extracellular loop (ECL4) of CFTR using overlap extension PCR (Peters et al. 2011). Patient-specific CF mutations were introduced into NBD1, NBD2, and the C-terminus of CFTR by site-directed mutagenesis. A YFP halide sensor (EYFP H148Q / I152L) was used (Galietta et al. 2001) (Addgene#25872). To create enDUBs targeting CF, a modular CFP-P2axx-U21 vector with an extended (GGGGS)x5(GGGTG) linker upstream of the USP domain was created. Next, we cloned the selected NBD1 nanobody binder using the BglII / AscI moiety.

[0066] Generation of adenovirus vectors Adenovirus vectors were generated using the pAdEasy system (Stratagene) according to the manufacturer's instructions, as previously described (Aromolaran et al. 2014). Plasmid shuttle vectors (pShuttle CMV) containing cDNA of nano-P2A-CFP, WT KCNQ1-YFP, and G589D KCNQ1-YFP were linearized with PmeI and electroporated into BJ5183-AD-1 electrocompetent cells pre-transformed with pAdEasy-1 virus plasmid (Stratagene). Successful recombinant transformants were identified using PacI restriction digestion. Positive recombinants were amplified using XL-10-Gold bacteria, and the recombinant adenovirus plasmid DNA was linearized with PacI digestion. HEK cells were cultured in 60 mm diameter dishes at 70-80% confluence and transfected with the linearized adenovirus DNA digested with PacI. Transfected plates were monitored for cytopathic effects (CPE) and adenovirus plaques. Cells were harvested and subjected to three consecutive freeze-thaw cycles, followed by centrifugation (2,500 × g) to remove cell debris. A 10 cm dish of 90% confluent HEK293 cells was infected using the supernatant (2 mL). After observing CPE for 2-3 days, a new plate of HEK293 cells was reinfected using the cell supernatant. Virus proliferation and purification were performed as described above (Aromolaran et al. 2014). Briefly, confluent HEK293 cells grown on 15 cm culture dishes (×8) were infected with the viral supernatant (1 mL) obtained as described above. After 48 hours, cells were harvested from all plates, pelletized by centrifugation, and resuspended in 8 mL of buffer containing Tris·HCl 20, CaCl21, and MgCl21 (pH 8.0) (in mM units). The cells were lysed by four consecutive freeze-thaw cycles, and the cell debris was pelleted by centrifugation. The virus-containing supernatant was purified by a discontinuous gradient of cesium chloride (CsCl) by layering three concentrations of CsCl (1.25, 1.33, and 1.45 g / mL).After centrifugation (50,000 rpm; SW41Ti Rotor, Beckman-Coulter Optima L-100K ultracentrifuge; 1 hour, 4°C), the viral band at the contact surface between the 1.33 g / mL and 1.45 g / mL layers was removed and dialyzed against PBS (12 hours, 4°C). Aliquots of the adenovirus vector were frozen in 10% glycerol at -80°C until use. The production of enDUB-O1-P2A-CFP was performed by Vector Biolabs, Inc. (Malburn, Pennsylvania, USA).

[0067] Cell culture and transfection Human fetal kidney (HEK293) cells were used. The cells were mycoplasma-free as measured by the MycoFluor Mycoplasma Detection Kit (Invitrogen). Low-passage HEK293 cells were cultured at 37°C in DMEM supplemented with 8% fetal bovine serum (FBS) and 100 mg / mL penicillin-streptomycin. HEK293 cell transfection was achieved using calcium phosphate precipitation. Briefly, plasmid DNA was mixed with 62 μL of 2.5 M CaCl2 and sterile deionized water (final volume 500 μL). The mixture was added dropwise to 500 μL of 2 × HEPES-buffered saline (mM units): HEPES 50, NaCl 280, Na2HPO4 1.5, pH 7.09, with constant tapping. The resulting DNA-calcium phosphate mixture was incubated at room temperature for 20 minutes and added dropwise to HEK293 cells (60-80% confluent). After 4-6 hours, the cells were treated with Ca 2+ The samples were washed with phosphate-buffered saline (which did not contain phosphate) and maintained in supplemental DMEM.

[0068] Chinese hamster ovary (CHO) cells were obtained from ATCC and cultured at 37°C in Kaighn-modified hamster F-12K (ATCC) supplemented with 8% FBS and 100 mg / mL penicillin-streptomycin. CHO cells were transiently transfected with the desired construct (KCNQ1 (0.5 μg) and nano-P2A-CFP (0.5 μg) or enDUBO1-P2A-CFP (0.5 μg)) in 35 mm tissue culture dishes using X-tremeGENE HP (1:2 DNA / reagent ratio) according to the manufacturer's instructions (Roche).

[0069] We used FRT epithelial cells that stably express WT and mutant CFTR channels (Han et al. 2018). FRT cells were maintained at 37°C in Coon-modified Ham F-12 (Sigma) supplemented with 5% FBS, 100 mg / mL penicillin-streptomycin, 7.5% w / v sodium bicarbonate, and 100 μg / mL hygromycin (Invitrogen). Transient transfection of FRT cells was achieved using Lipofectamine 3000 according to the manufacturer's instructions (Thermo).

[0070] Adult guinea pig cardiomyocytes were isolated according to the guidelines of the Columbia University Animal Experiments Committee. Prior to isolation, plated dishes were pre-coated with 15 μg / mL laminin (Gibco). Adult Hartley's guinea pigs (Charles River) were euthanized with 5% isoflurane, their hearts were removed, and ventricular myocytes were isolated by first perfusing with KH solution (mM): 118 NaCl, 4.8 KCl, 1 CaCl225 HEPES, 1.25 K2HPO4, 1.25 MgSO4, 11 glucose, 0.02 EGTA, pH 7.4, followed by perfusing with calcium-free KH solution using a Langendorff perfusion apparatus. **Enzymatic digestion with 0.3 mg / mL collagenase type 4 (Worthington) containing 0.08 mg / mL protease and 0.05% BSA was performed for 6 minutes in calcium-free KH buffer.** After digestion, 40 mL of high potassium +The solution was perfused to the heart (mM): 120 potassium glutamate, 25 kCl, 10 HEPES, 1 MgCl2, and 0.02 EGTA, pH 7.4. Subsequently, cells were treated with high potassium. + The cells were dispersed in solution. Healthy rod-shaped muscle cells were cultured in 199 medium (Life Technologies) supplemented with 10 HEPES (Gibco), 1× MEM non-essential amino acids (Gibco), 2 L-glutamine (Gibco), 20 D-glucose (Sigma Aldrich), 1% vol / vol penicillin-streptomycin-glutamine (Fisher Scientific), 0.02 mg / mL vitamin B-12 (Sigma Aldrich), and 5% (vol / vol) FBS (Life Technologies) (mM) to promote adhesion to the dish. **After 5 hours, the culture medium was replaced with 199 medium containing 1% (vol / vol) serum, but otherwise supplemented as described above.** The cultures were maintained in a humidified incubator at 37°C and 5% CO2.

[0071] Flow cytometry assay of total channels and surface channels The cell surface and total ion channel pool were assayed by flow cytometry in transfected HEK293 live cells as described above (Kanner et al. 2017; Kanner et al. 2018). Briefly, 48 hours after transfection, cells cultured in a 12-well plate were assayed using Ca 2+ and Mg 2+ The cells were gently washed with ice-cold PBS (mM units: 0.9 CaCl2, 0.49 MgCl2, pH 7.4) containing Alexa Fluor 647, and then incubated in blocking medium (DMEM containing 3% BSA) at 4°C for 30 minutes. Next, the HEK293 cells were treated with 1 μM Alexa Fluor 647-conjugated α-bungarotoxin (BTX). 647 Incubate in DMEM / 3% BSA with Life Technologies (in a locker) at 4°C for 1 hour, followed by PBS (Ca 2+ and Mg 2+ The cells were washed three times with (including). 2+The proteins were gently recovered in PBS without any additives and assayed by flow cytometry using a BD LSRII Cell Analyzer (BD Biosciences, San Jose, California, USA). CFP-tagged and YFP-tagged proteins were excited at 405 nm and 488 nm, respectively, while Alexa Fluor 647 was excited at 633 nm.

[0072] FRET flow cytometry assay The FRET binding assay was performed by flow cytometry in transfected HEK293 live cells, as described above (Lee et al. 2016). In short, cells were cultured for 24 hours after transfection, incubated with cycloheximide (100 μM) for 2–4 hours, and with H89 (30 μM) for 30 minutes. Analysis was then performed to reduce cellular variability in the maturation of the fluorescent protein and basal kinase activity. The cells were then cooled in ice-cold PBS (Ca 2+ and Mg 2+ Wash gently with (including), Ca 2+ The cells were collected in PBS without any additives and assayed by flow cytometry using a BD LSRII Cell Analyzer (BD Biosciences, San Jose, California, USA). Cerulean (Cer), Venus (Ven), and FRET signals were analyzed using the following laser / filter configurations: BV421 (Ex: 405 nm, Em: 450 / 50), FITC (Ex: 488 nm, Em: 525 / 50), and BV520 (Ex: 405 nm, Em: 525 / 50), respectively. For each experiment, several controls were prepared, including an untransfected blank for background subtraction, monochromatic Ven and Cer for spectral separation, Cer+Ven co-expression for concentration-dependent pseudo-FRET estimation, and a series of Cer-Ven dimers for FRET calibration. FRET donor / acceptor efficiency was analyzed using custom Matlab software. フリー and [donor] フリー The FRET coupling curve was generated as a function of .

[0073] Electrophysiology For potassium channel measurements, the total cell membrane current in CHO cells at room temperature was recorded using an EPC-10 patch-clamp amplifier (HEKA Electronics) controlled by PatchMaster software (HEKA). Coverslips containing attached CHO cells were placed on the glass bottom of a recording chamber (0.7–1 mL volume) mounted on the stage of an inverted Nikon Eclipse Ti-U microscope. Micropipettes were made from 1.5 mm thin-walled glass and flame-polished. Internal solution content (mM): 133 KCl, 0.4 GTP, 10 EGTA, 1 MgSO4, 5 K2ATP, 0.5 CaCl2, and 10 HEPES (pH 7.2). External solution content (mM): 147 NaCl, 4 KCl, 2 CaCl2, and 10 HEPES (pH 7.4). The pipette resistance was typically 1.5 MΩ when filled with internal solution. IV curves were created from a family of step depolarizations (from a holding potential of -80mV to -40mV in 10mV steps, ranging from -40mV to +100mV). Current was sampled at 20kHz and filtered at 5kHz. Traces were acquired at 10-second repetition intervals.

[0074] Whole-cell recordings of cardiomyocytes were performed 48–72 hours after infection. Internal and external solutions were used as described above. Whole-cell currents were induced using a slow voltage rise protocol (-80mV to +100mV over 2 seconds). Action potential recordings under current clamp were obtained by 0.25Hz stimulation with short current pulses (150pA, 10ms). ** For CFTR channel measurements, whole-cell recordings were performed in HEK293 and FRT cells at room temperature. Internal solution content (mM): 113 L-aspartic acid, 113 CsOH, 27 CsCl, 1 NaCl, 1 MgCl2, 1 EGTA, 10 TES, 3 MgATP (pH 7.2). External content (mM): 145 NaCl, 4 CsCl, 1 CaCl2, 1 MgCl2, 10 glucose, and 10 TES (pH 7.4). IV curves were constructed from a family of step depolarizations (from a holding potential of -40 mV in 20 mV steps from -80 to +80 mV). CFTR currents were activated by perfusion with 10 μM forskolin. In experiments using lumacafthol (3 μM), the drug was added 24 hours after transfection and incubated at 37°C. Ibacaftol was administered acutely at a concentration of 5 μM. Current was sampled at 20 kHz and filtered at 7 kHz. Traces were acquired at 10-second repetition intervals.

[0075] Immunoprecipitation and Western blotting HEK293 cells, Ca 2+The solution was washed once with PBS (which does not contain [specific compound]), collected, and resuspended in RIPA lysis buffer (in mM) containing Tris (20, pH 7.4), EDTA (1), NaCl (150), 0.1% (mass / volume) SDS, 1% Triton X-100, and 1% sodium deoxycholate. The solution was then supplemented with a protease inhibitor mixture (10 μL / mL, Sigma-Aldrich), PMSF (1 mM, Sigma-Aldrich), N-ethylmaleimide (2 mM, Sigma-Aldrich), and PR-619 deubiquitinating enzyme inhibitor (50 μM, LifeSensors). The lysate was prepared by incubation at 4°C for 1 hour with occasional vortex stirring, and clarified by centrifugation (10,000 × g, 10 minutes, 4°C). The supernatant was transferred to a new tube, and aliquots were taken for quantification of total protein concentration as determined by the Bis-Sinconinate Protein Identification Kit (Pierce Technologies). The lysates were pre-treated by incubation with 10 μL of Protein A / G Sepharose beads (Rockland) at 4°C for 40 minutes, and then incubated with 0.75 μg of anti-Q1 (Alomone) at 4°C for 1 hour. Equal volumes of total protein were added to a spin column containing 25 μL of Protein A / G Sepharose beads and tumbled overnight at 4°C. The immunoprecipitate was washed three times with RIPA buffer and twice with RIPA-500mM NaCl, spun down at 500×g, eluted with 40 μL of warmed sample buffer [50 mM Tris, 10% (vol / vol) glycerol, 2% SDS, 100 mM DTT, and 0.2 mg / mL bromophenol blue], and boiled (55°C, 15 minutes). Proteins were separated on a BisTris gradient precast gel (Life Technologies) containing 4–12% BisTris in Mops-SDS running buffer (Life Technologies) at a constant voltage of 200V for approximately 1 hour. 10 μL of PageRuler Plus Prestained Protein Ladder (10–250 kDa, Thermo Fisher) was loaded along with the sample.Protein bands were transferred onto a nitrocellulose membrane by tank transfer in transfer buffer (25 mM Tris, pH 8.3, 192 mM glycine, 15% (V / V) methanol, and 0.1% SDS). The membrane was blocked at room temperature for 1 hour in a solution of 5% skim milk (BioRad) in Tris-buffered saline-tween (TBS-T) (25 mM Tris, pH 7.4, 150 mM NaCl, and 0.1% Tween-20), and then incubated overnight at 4°C with primary antibody (anti-Q1, Alomone) in the blocking solution. The blot was washed three times with TBS-T for 10 minutes each time, and then incubated with horseradish peroxidase-conjugated secondary antibody at room temperature for 1 hour. After washing with TBS-T, the blot was developed with a chemiluminescence detection kit (Pierce Technologies) and visualized with a gel imager. Next, the membrane was stripped with a harsh stripping buffer (2% SDS, 62 mM Tris, pH 6.8, 0.8% β-mercaptoethanol) at 50°C for 30 minutes, rinsed with running water for 2 minutes, and washed with TBST (3×, 10 minutes). The membrane was pretreated with 0.5% glutaraldehyde and reblotted with anti-ubiquitin (VU1, LifeSensors) according to the manufacturer's instructions.

[0076] Yeast surface display of nanobody binders The nanobody binder was isolated using the yeast surface display library method described above (McMahon et al. 2018). Human NBD1 with an N-terminal Hisx6-Smt3 fusion (residues 387-646, Δ405-436) was obtained from the Arizona State University plasmid repository (clone: ​​HsCD00287374). The FLAG tag was inserted immediately downstream of the Hisx6-Smt3 tag using a Gibson assembly. The protein was expressed and purified by His using a custom order (Genscript). The Hisx6-Smt3 tag was removed using a SUMO protease kit (Invitrogen), and Ulp1 protease was incubated overnight at 4°C, followed by affinity chromatography purification (HisPur spin column; Thermo). Naive yeast library (6 × 10⁶) 9Yeast was incubated in galactose-containing tryptophan dropout (Trp-free) medium at 25°C for 2-3 days to induce nanobody expression. The induced cells were washed and resuspended in selection buffer (PBS, 0.1% BSA, 5 mM maltose). The first round of magnetically activated cell sorting (MACS) selection began with a pre-wash step, incubating the yeast with anti-FLAG M2-FITC conjugated antibody (Sigma) and anti-FITC microbeads (Miltenyi) at 4°C for 30 minutes, and then passing them through an LD column (Miltenyi) to remove the antibody / microbead binder. Next, NBD1-conjugated nanobodies were MACS enriched by incubating the pre-clarified yeast with 500 nM Hisx6-Smt3-FLAG-NBD1 and anti-FLAG M2-FITC at 4°C for 1 hour, followed by washing in selection buffer and incubation with anti-FITC microbeads at 4°C for 20 minutes. Labeled yeast was passed through an LS column (Miltenyi), washed three times with selective buffer, and eluted by removing the MACS magnetic stand (Miltenyi). The concentrated NBD1 conjugate was grown overnight in glucose-containing Trp medium at 30°C. Nanobody expression was induced by incubation in galactose Trp medium, as outlined above, resulting in the enrichment of the NBD1 library (approximately 1 × 10⁶). 8 The process was repeated using yeast. Subsequently, the initially induced cells (hereafter, approximately 5 × 10) were used. 6Yeast was incubated with 500 nM Hisx6-Smt3-FLAG-NBD1, followed by fluorescence-activated cell sorting (FACS) to remove the Smt3 conjugate by incubation with 500 nM FLAG-NBD1. Two rounds of positive selection were performed. Nonspecific FITC-conjugated antibody conjugates were removed by a third round of negative selection FACS in which cells were incubated with anti-FLAG FITC alone. Finally, high affinity NBD1 conjugates were selected by incubation with 100 nM FLAG-NBD1, and the FACS cells were sorted into 96-well plates as single cells and grown as monoclonal colonies for binding validation studies and plasmid isolation. Cells (approximately 10) were treated with serially diluted (5000, 1000, 500, 100, 50, 10, and 1) FLAG-NBD1 (in nM units). 5 By labeling the yeast, a uniquely validated NBD1 binder was subjected to Kd measurement on the yeast.

[0077] YFP halide quenching assay The YFP halide quenching plate-reader assay was based on a previous study (Galietta et al. 2001). In short, HEK293 cells were divided into 24-well black-walled plates (VisiPlate; PerkinElmer) and co-transfected with halide-sensitive eYFP (H148Q / I152L), mCh alone or mCh-tagged mutant CFTR channels, and CFP alone or an enDUB-U21 construct targeting CFP-P2a CF. After 2-3 days, the cells were transfected with PBS (Ca 2+ and Mg 2+ The samples were washed once with (containing) and incubated in 200 μL of PBS (containing 145 mM NaCl) at 37°C for 30 minutes. Baseline YFP readings (Ex: 510 nm, Em: 538 nm) were obtained using a SpectraMax M5 plate reader (Molecular Devices). Equal volumes of 2× activation solution containing iodide were added to obtain the final concentration (70 mM NaI, 10 μM forskolin, 5 μM VX770), and time-series recordings of YFP fluorescence were taken every 2 seconds. The assay was performed at 37°C.

[0078] Confocal microscope Cells were seeded on a 35mm MatTek dish (MatTek Corporation). Cardiomyocytes were fixed with 4% formaldehyde at room temperature (RT) for 10 minutes. HEK293 viable cells were then treated with BTX as described above. 647 The samples were stained with [a specific dye]. Images were captured using a Nikon A1RMP confocal microscope equipped with a 40x oil immersion objective lens.

[0079] Data and statistical analysis Data were analyzed offline using FlowJo, PulseFit (HEKA), Microsoft Excel, Origin, and GraphPad Prism software. Statistical analysis was performed in Origin or GraphPad Prism using built-in functions. Statistically significant differences between means (p<0.05) were determined using one-way ANOVA with Tukey's multiple comparison test or an unpaired two-tailed t-test to compare the two groups. Unless otherwise specified, data are presented as mean ± sem.

[0080] Example 2 RESTORx: Next-generation therapies based on the stabilization of targeted proteins Protein stability is a key point in the regulation of all proteins within a cell. Ubiquitination plays a major role in intracellular protein homeostasis, and dysregulation of this process can lead to the pathogenesis of many diseases. This disclosure focuses primarily on cystic fibrosis (CF), a rare genetic disorder with high unmet needs. While the majority of CF mutations result in defects in the stability of the chloride channel CFTR, current gold standard treatments are overwhelmingly symptom-based: lung airway clearance techniques, inhalation of mucus diluents, and antibiotic treatment for bacterial infections (Figures 15A-15B). Although these treatments have improved life expectancy (approximately 30-40 years), there is no definitive cure, and the quality of life for CF patients continues to rapidly deteriorate. More recently, there has been progress in the development of pharmacological chaperones, or "corrective factors," that appear to enhance the transport of mutated CFTR to the cell membrane; however, to date, the clinical efficacy of such treatments has been relatively modest, and many mutations remain resistant to treatment.

[0081] This disclosure employs a completely different small molecule approach for CFTR transport and stability rescue (Figure 16A). In particular, the goal was to leverage the potent yet reversible nature of ubiquitination with a novel hypothesis: could endogenous deubiquitinases (DUBs) be recruited to mutant CFTR channels to selectively modulate the ubiquitin state, enhance channel stability, and restore function? We call this general approach rescue and stabilization (ReSTORED) for endogenous DUB redirection, and the resulting molecules that leverage this mechanism are called rescue and stabilization therapies (ReSTORx). Essentially, our ReSTORx are heterobifunctional molecules composed of three distinct modules: 1) a DUB-binding molecule, 2) a target-binding molecule, and 3) a variable linker that connects these two. Thus, our ReSTORx compounds function as molecular crosslinks, linking endogenous DUB activity to the target protein of interest. To test this new approach, we first developed nanobody-based binders for both DUB and CFTR proteins using a yeast surface display library (Figure 16B; Table 1). The resulting ReSTORx molecule, ReSTORAb based on divalent nanobody (Figure 17), was able to bind to both proteins in living cells and significantly rescued mutant CFTR surface transport to the wild-type (WT) state (Figures 16C-16F). Furthermore, it was shown that ReSTORAb based on divalent nanobody could rescue LQTS transport deficiencies (Figure 18).

[0082] [Table 1-1]

[0083] [Table 1-2]

[0084] Unlike existing or investigational CF therapies, ReSTORx technology emerges as a first-in-class CFTR stabilizer rationally designed to remove targeted ubiquitin from mutational channels. Its unique mechanism of action promotes synergy with current modulators and rescues previously unresponsive CFTR mutations. Furthermore, the modular nature of ReSTORx technology suggests a highly adaptable protein stabilization platform. Thus, the "active" DUB recruiting component can be easily adapted for use with any given target-binding molecule, with the potential to improve the efficacy of currently marketed drugs or to functionalize previously inactive compounds that engage targets without therapeutic effect.

[0085] The potential impact of such a ReSTORx platform extends to the ubiquitin therapeutic space. Competition in ubiquitin therapy is primarily limited to non-selective inhibitors of the ubiquitin-proteasome system (UPS). Proteasome inhibitors have been commercially successful, such as Velcade® (bortezomib), the first UPS modulator to be brought to market, which generated $3 billion in revenue in 2014 alone; however, because these drugs target the entire proteolytic pathway, their lack of target specificity limits their use and results in significant side effects for patients. As a result, the focus is gradually shifting from proteasome inhibitors to targeting specific components of the UPS (i.e., E3 ubiquitin ligases). However, even these ubiquitin enzymes suffer from the complexity of regulating many different substrates. In contrast, the ReSTORx molecules disclosed herein leverage the enormous unmet market need for selective UPS modulators, enjoying both targeting specificity and generalizability in action. This entirely new treatment method has the potential to further expand its applications to the treatment of other hereditary channelopathy conditions and cancers.

[0086] References The following references are incorporated herein by reference to the extent that they provide exemplary procedures or other details that supplement what is described herein.

[0087] TIFF0007917444000003.tif209161TIFF0007917444000004.tif246160TIFF00079174440 00005.tif246160TIFF0007917444000006.tif246160TIFF0007917444000007.tif196160

[0088] All patents, patent applications, and publications cited herein are incorporated herein by reference in their entirety as if they were described herein in their entirety.

[0089] Although this disclosure is described in this manner, it will be clear that this disclosure can be modified in various ways. Such modifications should not be considered deviations from the spirit and scope of this disclosure, and all such modifications are intended to be included within the following claims. Preferred embodiments of the present invention are described below in separate sections. Embodiment 1 It is a divalent molecule, a) Deubiquitinating enzyme (DUB) binders; b) Targeted binding agents; and c) A variable linker between the DUB binder and the target binder Includes, The DUB conjugate is a bivalent molecule selected from intracellular antibody fragments, scFvs, nanobodies, antibody mimes, monobodies, DARPins, lipocalins, and target sequences. Embodiment 2 The divalent molecule according to Embodiment 1, wherein the DUB is endogenous. Embodiment 3 The divalent molecule according to Embodiment 1, wherein the DUB is selected from the ubiquitin-specific protease (USP) family, the ovarian tumor protease (OTU) family, the ubiquitin C-terminal hydrolase (UCH) family, the Josephine domain family (Josephin), a motif that interacts with a novel ubiquitin-containing DUB family (MINDY), and the JAB1 / MPN / Mov34 metalloenzyme domain family (JAMM). Embodiment 4 The divalent molecule according to Embodiment 1, wherein the DUB is USP21 or USP2. Embodiment 5 The divalent molecule according to Embodiment 1, wherein the DUB binder is a nanobody. Embodiment 6 The divalent molecule according to Embodiment 5, wherein the nanobody is bound to a member of the USP family. Embodiment 7 The divalent molecule according to Embodiment 5, wherein the nanobody is bound to USP2. Embodiment 8 The divalent molecule according to Embodiment 5, wherein the nanobody is bound to USP21. Embodiment 9 The divalent molecule according to Embodiment 8, wherein the nanobody includes an arrangement represented by any one of Sequence IDs 1 to 6. Embodiment 10 The aforementioned nanobody a) Complementarity Determination Region (CDR) represented by Sequence ID 7, CDR2 represented by Sequence ID 8, and CDR3 represented by Sequence ID 9; b) CDR1 represented by Sequence ID No. 10, CDR2 represented by Sequence ID No. 11, and CDR3 represented by Sequence ID No. 12; c) CDR1 represented by sequence number 13, CDR2 represented by sequence number 14, and CDR3 represented by sequence number 15; d) CDR1 represented by sequence number 16, CDR2 represented by sequence number 17, and CDR3 represented by sequence number 18; e) CDR1 represented by SEQ ID NO: 19, CDR2 represented by SEQ ID NO: 20, and CDR3 represented by SEQ ID NO: 21; or f) CDR1 represented by Sequence ID 22, CDR2 represented by Sequence ID 23, and CDR3 represented by Sequence ID 24 A divalent molecule according to Embodiment 8, including the above. Embodiment 11 The divalent molecule according to Embodiment 1, wherein abnormal ubiquitination of the target to which the target-binding agent binds causes disease. Embodiment 12 The divalent molecule according to Embodiment 11, wherein the disease is a hereditary ion channel disease. Embodiment 13 The divalent molecule according to Embodiment 12, wherein the hereditary ion channel disease is selected from the group consisting of epilepsy, migraine, neuropathic pain, cardiac arrhythmia, long QT syndrome, Brugada syndrome, cystic fibrosis, diabetes mellitus, hyperinsulinemia-induced hypoglycemia, Bartter syndrome, and diabetes insipidus. Embodiment 14 The divalent molecule according to Embodiment 12, wherein the disease is QT prolongation syndrome. Embodiment 15 The divalent molecule according to Embodiment 12, wherein the disease is cystic fibrosis. Embodiment 16 The divalent molecule according to Embodiment 1, wherein the target to which the target binding agent binds is a cystic fibrosis membrane conductance regulator (CFTR). Embodiment 17 The divalent molecule according to Embodiment 1, wherein the target binding agent is selected from intracellular antibody fragments, scFvs, nanobodies, antibody mimes, monobodies, DARPins, lipocalins, and target sequences. Embodiment 18 The divalent molecule according to Embodiment 1, wherein the target binding agent is a nanobody. Embodiment 19 The divalent molecule according to Embodiment 18, wherein the nanobody binds to the NBD1 domain of cystic fibrosis membrane conductance regulator (CFTR). Embodiment 20 The divalent molecule according to Embodiment 19, wherein the nanobody includes an arrangement represented by any one of SEQ ID NOs: 25 to 38. Embodiment 21 The aforementioned nanobody a) Complementarity Determination Region (CDR) represented by Sequence ID No. 39, CDR2 represented by Sequence ID No. 40, and CDR3 represented by Sequence ID No. 41; b) CDR1 represented by Sequence ID 42, CDR2 represented by Sequence ID 43, and CDR3 represented by Sequence ID 44; c) CDR1 represented by Sequence ID 45, CDR2 represented by Sequence ID 46, and CDR3 represented by Sequence ID 47; d) CDR1 represented by sequence number 48, CDR2 represented by sequence number 49, and CDR3 represented by sequence number 50; e) CDR1 represented by sequence number 51, CDR2 represented by sequence number 52, and CDR3 represented by sequence number 53; f) CDR1 represented by sequence number 54, CDR2 represented by sequence number 55, and CDR3 represented by sequence number 56; g) CDR1 represented by SEQ ID NO: 57, CDR2 represented by SEQ ID NO: 58, and CDR3 represented by SEQ ID NO: 59; h) CDR1 represented by sequence number 60, CDR2 represented by sequence number 61, and CDR3 represented by sequence number 62; i) CDR1 represented by sequence number 63, CDR2 represented by sequence number 64, and CDR3 represented by sequence number 65; j) CDR1 represented by sequence number 66, CDR2 represented by sequence number 67, and CDR3 represented by sequence number 68; k) CDR1 represented by sequence number 69, CDR2 represented by sequence number 70, and CDR3 represented by sequence number 71; l) CDR1 represented by sequence number 72, CDR2 represented by sequence number 73, and CDR3 represented by sequence number 74; m) CDR1 represented by SEQ ID NO: 75, CDR2 represented by SEQ ID NO: 76, and CDR3 represented by SEQ ID NO: 77; or n) CDR1 represented by sequence number 78, CDR2 represented by sequence number 79, and CDR3 represented by sequence number 80 A divalent molecule as described in Embodiment 19, including the above. Embodiment 22 The divalent molecule according to Embodiment 1, wherein the linker is alkyl, polyethylene glycol (PEG), or a click linker. Embodiment 23 A method for treating or improving the effects of a disease in a subject, comprising administering an effective amount of a divalent molecule described in any of Embodiments 1 to 22 to the subject. Embodiment 24 The method according to Embodiment 23, wherein the subject is a human. Embodiment 25 The method according to Embodiment 23, wherein the disease is selected from the group consisting of hereditary ion channel diseases, cancer, vascular conditions, infections, and metabolic diseases. Embodiment 26 The method according to Embodiment 25, wherein the hereditary ion channel disease is selected from the group consisting of epilepsy, migraine, neuropathic pain, cardiac arrhythmia, long QT syndrome, Brugada syndrome, cystic fibrosis, diabetes mellitus, hyperinsulinemia-induced hypoglycemia, Bartter syndrome, and diabetes insipidus. Embodiment 27 The method according to Embodiment 25, wherein the hereditary ion channel disease is cystic fibrosis. Embodiment 28 A method for identifying and preparing nanobody binders that target a target protein, a) Step of constructing a naive yeast library expressing synthetic nanobodies; b) Incubating the naive yeast library with the target protein; c) Selecting yeast cells expressing nanobodies that bind to the target protein by magnetically activated cell sorting (MACS); d) A step of amplifying the selected cells and constructing a concentrated yeast library; e) Incubating the concentrated yeast library with the target protein; f) Selecting yeast cells expressing nanobodies that bind to the target protein by fluorescence-activated cell sorting (FACS); g) A step of amplifying the selected cells and constructing a further concentrated yeast library; h) The step of repeating steps e) through g) twice; and i) Select the chosen yeast cells as single cells and culture them as monoclonal colonies for binding verification and plasmid isolation. Methods that include... Embodiment 29 The method according to Embodiment 28, wherein the target protein is a cystic fibrosis membrane conductance regulator (CFTR). Embodiment 30 The method according to Embodiment 28, wherein the target protein is a deubiquitinating enzyme (DUB).

Claims

1. It is a divalent molecule, a) Nanobody deubiquitinating enzyme (DUB) binders; b) Nanobody targeting agents that bind to the NBD1 domain of cystic fibrosis membrane conductance regulators (CFTRs); and c) A variable linker between the DUB binder and the target binder Includes, The target is a target protein for deubiquitination by the DUB, and the divalent molecule is a divalent molecule that mediates the deubiquitination of the target protein.

2. The divalent molecule according to claim 1, wherein the DUB is endogenous.

3. The divalent molecule according to claim 1, wherein the DUB is selected from the ubiquitin-specific protease (USP) family, the ovarian tumor protease (OTU) family, the ubiquitin C-terminal hydrolase (UCH) family, the Josephine domain family (Josephin), a motif that interacts with a novel ubiquitin-containing DUB family (MINDY), and the JAB1 / MPN / Mov34 metalloenzyme domain family (JAMM).

4. The divalent molecule according to claim 1, wherein the DUB is USP21 or USP2.

5. The divalent molecule according to claim 1, wherein the DUB binder nanobody is bound to a member of the USP family.

6. The divalent molecule according to claim 1, wherein the DUB binder nanobody is bound to USP2.

7. The divalent molecule according to claim 1, wherein the DUB binder nanobody is bound to USP21.

8. The divalent molecule according to claim 7, wherein the DUB binder nanobody includes a sequence represented by any one of sequence numbers 1 to 6.

9. The DUB binder nanobody, a) Complementarity determination region (CDR) represented by Sequence ID No. 7, CDR2 represented by Sequence ID No. 8, and CDR3 represented by Sequence ID No. 9; b) CDR1 represented by sequence number 10, CDR2 represented by sequence number 11, and CDR3 represented by sequence number 12; c) CDR1 represented by Sequence ID 13, CDR2 represented by Sequence ID 14, and CDR3 represented by Sequence ID 15; d) CDR1 represented by Sequence ID 16, CDR2 represented by Sequence ID 17, and CDR3 represented by Sequence ID 18; e) CDR1 represented by Sequence ID No. 19, CDR2 represented by Sequence ID No. 20, and CDR3 represented by Sequence ID No. 21; or f) CDR1 represented by Sequence ID 22, CDR2 represented by Sequence ID 23, and CDR3 represented by Sequence ID 24 The divalent molecule according to claim 7, comprising:

10. The divalent molecule according to claim 1, wherein abnormal ubiquitination of the target to which the target binding agent binds causes disease.

11. The divalent molecule according to claim 10, wherein the disease is a hereditary ion channel disease.

12. The divalent molecule according to claim 11, wherein the disease is cystic fibrosis.

13. The divalent molecule according to claim 1, wherein the target binding agent nanobody includes an arrangement represented by any one of sequence numbers 25 to 38.

14. The aforementioned target binding agent nanobody a) Complementarity determination region (CDR) represented by Sequence ID No. 39, CDR2 represented by Sequence ID No. 40, and CDR3 represented by Sequence ID No. 41; b) CDR1 represented by Sequence ID No. 42, CDR2 represented by Sequence ID No. 43, and CDR3 represented by Sequence ID No. 44; c) CDR1 represented by Sequence ID No. 45, CDR2 represented by Sequence ID No. 46, and CDR3 represented by Sequence ID No. 47; d) CDR1 represented by Sequence ID No. 48, CDR2 represented by Sequence ID No. 49, and CDR3 represented by Sequence ID No. 50; e) CDR1 represented by Sequence ID 51, CDR2 represented by Sequence ID 52, and CDR3 represented by Sequence ID 53; f) CDR1 represented by Sequence ID 54, CDR2 represented by Sequence ID 55, and CDR3 represented by Sequence ID 56; g) CDR1 represented by Sequence ID 57, CDR2 represented by Sequence ID 58, and CDR3 represented by Sequence ID 59; h) CDR1 represented by Sequence ID 60, CDR2 represented by Sequence ID 61, and CDR3 represented by Sequence ID 62; i) CDR1 represented by Sequence ID 63, CDR2 represented by Sequence ID 64, and CDR3 represented by Sequence ID 65; j) CDR1 represented by Sequence ID 66, CDR2 represented by Sequence ID 67, and CDR3 represented by Sequence ID 68; k) CDR1 represented by Sequence ID 69, CDR2 represented by Sequence ID 70, and CDR3 represented by Sequence ID 71; l) CDR1 represented by Sequence ID 72, CDR2 represented by Sequence ID 73, and CDR3 represented by Sequence ID 74; m) CDR1 represented by Sequence ID 75, CDR2 represented by Sequence ID 76, and CDR3 represented by Sequence ID 77; or n) CDR1 represented by Sequence ID 78, CDR2 represented by Sequence ID 79, and CDR3 represented by Sequence ID 80 A divalent molecule according to claim 1, comprising:

15. The divalent molecule according to claim 1, wherein the linker is an alkyl group, polyethylene glycol (PEG), or a click linker.

16. A pharmaceutical composition for treating or improving the effects of a disease in a subject, comprising an effective amount of a divalent molecule as described in any one of claims 1 to 15.

17. The pharmaceutical composition according to claim 16, wherein the subject is a human.

18. The pharmaceutical composition according to claim 16, wherein the disease is a hereditary ion channel disease.

19. The pharmaceutical composition according to claim 18, wherein the hereditary ion channel disease is cystic fibrosis.

Citation Information

Patent Citations

  • Bifunctional molecules for targeting UCHL5

    WO2019238816A1

  • Survival-targeting chimeric (surtac) molecules

    WO2020169650A1