Topical and oral preparations for the skin

Abstract

To provide a novel external preparation or internal preparation having excellent melanogenesis inhibitory action, collagen production promoting action, MMP inhibitory action, hyaluronic acid production promoting action, cell propagation promoting action and antioxidant action.SOLUTION: An extract from the fruit of the genus rosa of the family rosaceae to which dry-type heating treatment by a specified method is applied has excellent melanogenesis inhibitory action, collagen production promoting action, MMP inhibitory action, hyaluronic acid production promoting action, cell propagation promoting action and antioxidant action, and also has excellent stability. Therefore, the extract from the fruit of the genus rosa of the family rosaceae to which the dry-type heating treatment is applied is applicable not only to a cosmetic field such as aging prevention of skin, but also to a medical field such as suppression of function reduction by aging, prevention, treatment or the like of cancer, and application to cosmetic, quasi drug, medicine and food products is expected.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a melanin production inhibitor, a collagen production promoter, an MMP inhibitor, a hyaluronic acid production promoter, a cell growth promoter, an antioxidant, and an internal preparation. [Background Art]

[0002] It is generally accepted that skin pigmentation observed in spots, freckles, sun tanning and the like is caused by abnormal hormones or ultraviolet stimulation that causes melanin-producing cells present in the skin to overproduce melanin pigment, which then deposits in the skin. One of the known methods for preventing such pigmentation is a method of suppressing excessive production of melanin. Conventionally, ascorbic acid (vitamin C) and the like have been used as whitening agents for internal and external applications in the treatment of pigmentation (Patent Document 1).

[0003] Fibroblasts and collagen are present in the dermis, and type I collagen accounts for 80% of the total. In addition to type I collagen, the presence of type III, V, XII and XIV collagens and the like is known. A decrease in type I collagen is one of the causes of wrinkles and sagging. Therefore, promoting the production of type I collagen is considered to be effective in preventing and improving wrinkles and sagging. Furthermore, promotion of type I collagen production is also effective for improving wound healing of the skin.

[0004] Furthermore, the skin is exposed daily to various physical and chemical stresses, including ultraviolet rays, dryness, cold, heat, and drugs. As a result, skin function deteriorates, and various signs of skin aging become apparent. Wrinkles are one such sign of skin aging. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also called fine wrinkles, are temporary wrinkles that occur due to a decrease in the amount of water in the stratum corneum of the epidermis caused by skin dryness. On the other hand, dermal wrinkles are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. The mechanisms of their formation include a decrease in the collagen synthesis ability of dermal fibroblasts due to ultraviolet rays and aging, and the promotion of collagen breakdown due to an increase in matrix metalloproteinases (MMPs).

[0005] Epidermal wrinkles caused by dryness and dermal wrinkles differ in histological morphology, onset mechanism, and treatment methods. Dermal wrinkles caused by UV radiation and aging are difficult to improve with the use of moisturizing cosmetics.

[0006] To date, several agents have been reported for the purpose of improving dermal wrinkles caused by ultraviolet radiation, including a skin wrinkle prevention and improvement agent containing hydrolyzed almond as an active ingredient (Patent Document 2), and a wrinkle improvement agent for ultraviolet irradiation containing extracts of Jochokei, Tenki, and Kisenosa as active ingredients (Patent Document 3).

[0007] MMPs play a major role in the interstitial infiltration of cancer cells, their invasion into blood vessels, and angiogenesis. The stroma is mainly composed of type I collagen, and the movement of cancer cells requires the destruction of this matrix by interstitial collagenases and other enzymes. For metastasis to be completed, it is necessary to destroy the vascular endothelial basement membrane and move within the stroma, and MMPs are also involved in this stage (Non-Patent Literature 1). Therefore, substances that have inhibitory activity against MMPs are expected to have an effect in suppressing angiogenesis and cancer metastasis in cancer tissue, and are considered useful in the prevention and treatment of cancer. Thus, inhibition of MMPs is useful in the prevention, treatment, and improvement of various diseases caused by increased MMP levels, such as cancer, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0008] Collagenase (MMP1), belonging to the MMP group, is an enzyme produced by fibroblasts and chondrocytes, and plays a major role in promoting collagen degradation. Collagen is a major structural protein that makes up about one-third of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendons, gums, and skin. When collagen molecules are cleaved at one point by collagenase, the normally stable collagen molecules denature into single-chain gelatin, which is then broken down by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer, ulcer formation, osteoporosis, and periodontitis.

[0009] Materials possessing collagenase inhibitory activity have been proposed, such as cocoa husk extract (Patent Document 4), raspberry extract (Patent Document 5), and lactoferrin (Patent Document 6). Given the increasing concern for skin aging and oral hygiene, there is a growing need to discover materials with excellent collagenase inhibitory effects that are safe, have no side effects, and are highly effective in inhibiting collagenase activity.

[0010] Gelatinase (MMP2), belonging to the MMP group, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that make up special components of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is broken down by gelatinase, the risk of diseases such as cancer, arteriosclerosis, and rheumatoid arthritis, as well as injuries such as ligament rupture, increases.

[0011] Furthermore, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile and elastic properties.

[0012] Hyaluronic acid, in particular, is known as a high-molecular-weight polysaccharide widely distributed in connective tissue, exhibiting a gel-like form in the dermis and maintaining skin elasticity. Therefore, the deterioration and decrease of hyaluronic acid are considered important in skin aging. Furthermore, because hyaluronic acid is a high-molecular-weight substance, there has been a problem in that cosmetics containing it are not easily absorbed when applied directly to the skin. For this reason, there has been a search for topical skin preparations that can promote the production of collagen and hyaluronic acid by activating fibroblasts (Patent Document 7).

[0013] Hyaluronic acid is also present in joints and is known to play a role in cushioning the impact of joint loads and smoothing joint movement. While the hyaluronic acid concentration in synovial fluid of a normal human is approximately 2.3 mg / mL, in rheumatoid arthritis, this concentration decreases to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also decreases significantly (Non-Patent Literature 2). Furthermore, a decrease in hyaluronic acid content is also known to occur in septic arthritis and gouty arthritis, similar to the case of rheumatoid arthritis (Non-Patent Literature 3). In these diseases, increasing the amount of hyaluronic acid in the synovial fluid is considered to improve lubrication, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that injecting sodium hyaluronate into the joints of patients with rheumatoid arthritis improves the above symptoms (Non-Patent Literature 4). However, treatment for these diseases is long-term. Therefore, there is a need for topical skin preparations, pharmaceuticals, and foods containing hyaluronic acid production promoters that can be easily used for prevention and treatment in daily life.

[0014] Floaters are a condition in which faint shadows resembling threads or mosquitoes appear in the field of vision. They are caused by opacities in the vitreous humor, which fills the inside of the eye, casting shadows on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet radiation, and reactive oxygen species, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous humor, and the subsequent breakdown of collagen fibers, leading to opacity within the vitreous humor. Treatment options include vitrectomy surgery and laser treatment, but these procedures are not commonly performed in Japan due to safety concerns, and treatment abroad is very expensive. Therefore, there is a need for pharmaceuticals and foods containing hyaluronic acid production promoters that can be used daily to prevent and improve physiological floaters.

[0015] Generally, the proliferation and division capacity of epidermal keratinocytes decreases with age, and the epidermal layer itself thins (Non-Patent Literature 5). Biological factors such as Epidermal Growth Factor (EGF) and female hormones (estrogen) act on the proliferation of epidermal keratinocytes in the skin, but their secretion decreases with age. This decline in the metabolic function of epidermal keratinocytes due to aging slows down the rate of skin turnover, causing rough skin and skin aging. In addition, the accumulation of keratinocytes that peel off from the surface of the stratum corneum hinders the smooth excretion of melanin within the epidermis, causing hyperpigmentation and dullness of the skin. Furthermore, it is known that wound healing in the epidermis is slowed. In order to prevent or improve the progression of these phenomena, there has been much research into ingredients that promote the proliferation of epidermal keratinocytes and proposals for topical skin preparations.

[0016] Furthermore, the skin is located in the outermost layer of the body and is an organ that is easily subjected to the generation of reactive oxygen species due to the effects of ultraviolet rays and other factors, and is constantly exposed to this oxidative stress. On the other hand, reactive oxygen species scavenging enzymes exist within skin cells, and as long as the amount of reactive oxygen species generated does not exceed their capacity, they protect skin cells from damage caused by reactive oxygen species. However, it is known that the activity of reactive oxygen species scavenging enzymes within skin cells decreases with age, and when damage caused by reactive oxygen species exceeds this defense response, the skin is oxidized, cellular function deteriorates, and aging progresses. In addition, it is thought that in organs other than the skin, when exposed to reactive oxygen species that exceed their scavenging capacity, functional decline occurs, leading to aging, or the development of various lifestyle-related diseases such as cancer and myocardial infarction. Therefore, reactive oxygen species scavenging agents and antioxidants have been investigated with the aim of protecting the body from damage caused by reactive oxygen species, and cosmetics, quasi-drugs, pharmaceuticals, and foods containing reactive oxygen species scavenging enzymes such as SOD and catalase, SOD-like active substances, and other reactive oxygen species scavenging agents and antioxidants have been developed (Patent Documents 8 and 9).

[0017] Dry heat treatment refers to a processing method that applies heat to a material without adding water, using a medium such as fire, air, oil, or metal plates. Generally, dry heat treatment is believed to cause changes in chemical components such as proteins, making it possible to alter the color, taste, and aroma. The changes in chemical components also vary depending on the heating temperature and duration.

[0018] Conventionally, it has been known that the flowers and buds of the Rosa genus of the Rosaceae family have a collagen synthesis promoting effect (Patent Document 10), that the Damask rose (Rosa damascena) of the Rosa genus has antioxidant, anti-inflammatory, and whitening effects (Patent Document 11), and that the fruit extract of Rosa roxburghii has moisturizing and texture-enhancing effects (Patent Document 12). However, it was not known that dry heat treatment of the fruit of the Rosa genus of the Rosaceae family would result in extracts exhibiting significant melanin production inhibitory effects, collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects compared to fruit of the Rosa genus of the Rosaceae family that has not undergone dry heat treatment. [Prior art documents] [Patent Documents]

[0019] [Patent Document 1] Japanese Unexamined Patent Publication No. Hei 5-229931 [Patent Document 2] Japanese Unexamined Patent Publication No. 2000-119125 [Patent Document 3] Japanese Unexamined Patent Publication No. 2006-199611 [Patent Document 4] Japanese Unexamined Patent Publication No. Hei 3-44331 [Patent Document 5] Japanese Unexamined Patent Publication No. 2003-137801 [Patent Document 6] Japanese Unexamined Patent Publication No. Hei 5-186368 [Patent Document 7] Japanese Unexamined Patent Publication No. 2007-1924 [Patent Document 8] Japanese Unexamined Patent Publication No. 2019-125060 [Patent Document 9] Japanese Unexamined Patent Publication No. 2013-218808 [Patent Document 10] Japanese Unexamined Patent Publication No. 2020-7363 [Patent Document 11] Japanese Unexamined Patent Publication No. 2014-240375 [Patent Document 12] Japanese Unexamined Patent Publication No. 2016-222612 [Non-Patent Documents]

[0020] [Non-Patent Document 1] "Matrix Metalloproteinases in Gastrointestinal Cancer", The Japanese Society of Gastroenterology, Vol. 100, p. 152, 2003 [Non-Patent Document 2] “Arthritis Rheumatism”, Vol.10, pp 357, 1967 [Non-Patent Document 3] "Connective Tissue Composition", Kanehara Publishing Co., Ltd., p. 481, 1984 [Non-Patent Document 4] "Inflammation," Japanese Society for Inflammation, Vol. 11, p. 16, 1991. [Non-Patent Document 5] Varani J et al., J Invest Dermatol, Vol.3,pp 57-60,1998 [Overview of the project] [Problems that the invention aims to solve]

[0021] There is a demand for safe, highly stable materials that exhibit excellent melanin production inhibition, collagen production promotion, MMP inhibition, hyaluronic acid production promotion, cell proliferation promotion, and antioxidant effects, but currently, no materials that fully satisfy this need have been provided. [Means for solving the problem]

[0022] Due to these circumstances, the inventors conducted diligent research and found that an extract of the fruit of the Rosa genus of the Rosaceae family, subjected to dry heat treatment, possesses excellent melanin production inhibitory effects, collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects, and is also highly stable. Furthermore, they found that a topical or internal preparation containing this extract is safe and stable, and exhibits excellent melanin production inhibitory effects, collagen production promoting effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects, making it a potentially multifunctional cosmetic and health material and pharmaceutical product, thus completing the present invention.

[0023] In other words, the present invention encompasses the following inventions. (1) A topical skin preparation characterized by containing an extract of the fruit of a Rosa genus in the Rosaceae family, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (2) A collagen production promoter characterized by containing an extract of the fruit of the Rosa genus of the Rosaceae family, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (3) An MMP inhibitor characterized by containing an extract of the fruit of a Rosa genus in the Rosaceae family, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (4) A hyaluronic acid production promoter characterized by containing an extract of the fruit of a Rosa genus in the Rosaceae family that has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (5) A cell proliferation promoter characterized by containing an extract of the fruit of a Rosa genus in the Rosaceae family that has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (6) An antioxidant characterized by containing an extract of the fruit of the Rosa genus of the Rosaceae family, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (7) A wrinkle-improving agent characterized by containing an extract of the fruit of the Rosa genus of the Rosaceae family, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (8) A melanin production inhibitor characterized by containing an extract of the fruit of a Rosa genus in the Rosaceae family that has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (9) A skin whitening agent characterized by containing an extract of the fruit of the Rosa genus of the Rosaceae family, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. (10) A food composition for the prevention and improvement of various diseases caused by increased MMP, characterized by containing an extract of the fruit of the Rosaceae family, Rosa genus, which has been subjected to dry heat treatment by heating to 100°C or higher without the addition of water. [Effects of the Invention]

[0024] According to the present invention, a melanin production inhibitor (whitening agent), collagen production promoter, MMP inhibitor, hyaluronic acid production promoter, cell proliferation promoter, and antioxidant are provided, all containing an extract of a fruit of the genus Rosa of the Rosaceae family that has been subjected to dry heat treatment. [Modes for carrying out the invention]

[0025] The species of Rosa genus in the Rosaceae family used in this invention are not particularly limited, and include, for example, Rosa roxburghii, Rosa canina, Rosa acicularis, Rosa amblyotis, Rosa uchiyamana, Rosa multiflora, Rosa rugosa, Rosa banksiae, Rosa jasminoides, Rosa sambucina, Rosa gallica, Rosa carolina, Rosa chinensis, Rosa gentiliana, Rosa damascena Rosa damascena, Rosa pimpinellifolia, Rosa minutifolia, or varieties and hybrids of these Rosa species can also be used. Many cultivars of these Rosa species are known, and the fruits of these cultivars may also be used. In this invention, due to its high effectiveness, it is preferable to use the dry-heat treated fruits of Rosa species of the Rosaceae family, which are known as wild species.

[0026] For fruits of the Rosa genus in the Rosaceae family, it is preferable to use those with a longest diameter in the range of 1 to 10 cm. In addition, it is especially preferable to use those with a longest diameter in the range of 1 to 4 cm. Furthermore, the fruits used can be fresh, or dried, such as naturally dried or sun-dried fruits.

[0027] As mentioned above, dry heat treatment refers to a processing method in which heat is applied to a material without adding water, using a medium such as fire, air, oil, or metal plates. Generally, dry heat treatment is believed to cause changes in chemical components such as proteins, making it possible to alter the color, taste, and aroma. The changes in chemical components also differ depending on the heating temperature and time.

[0028] The temperature for dry heat treatment of fruits of the Rosa genus (Rosaceae family) is preferably 100°C or higher, more preferably 120-300°C. Furthermore, 150-250°C is particularly preferred. Above 300°C, carbonization of the plant is likely to progress, making it unsuitable for extraction. The duration of the dry heat treatment varies depending on the temperature, but is preferably 10 minutes or more, more preferably 15-60 minutes. Furthermore, 20-40 minutes is particularly preferred. Heating for more than 60 minutes often leads to carbonization of the plant, making it unsuitable for extraction. These treatments may also be performed in multiple steps, such as 2 to 5 times. In such cases, the total time is preferably as described above.

[0029] Dry heat treatment methods can utilize equipment such as dryers, roasters, metal trays, frying pans, metal pots, pressure cookers, stone pots, iron plates, roasting pans, hot plates, roasting stones, aluminum foil, toaster ovens, and grills, and stirring can be performed as needed. Furthermore, fruits treated with dry heat treatment become darker in color compared to those dried by conventional methods, often changing to brown to dark brown depending on the circumstances.

[0030] The method of extracting from the fruits of the Rosaceae family, genus Rosa, that have been subjected to dry heat treatment is not particularly limited; for example, it may be extracted by heating or by room temperature extraction. Furthermore, the dry heat-treated fruits may be used as is for extraction, or they may be dried, crushed, or finely chopped beforehand.

[0031] The solvent extraction method is not particularly limited and can be performed by methods such as heat extraction (e.g., 40-100°C), room temperature extraction (e.g., 15-25°C), low temperature extraction (e.g., 0-15°C), stirring extraction, or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are used, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are used. These solvents may be used individually or in mixtures of two or more. Particularly preferred extraction solvents include water, a water-ethanol mixed polar solvent, or a water-1,3-butylene glycol mixed polar solvent. The concentration of lower alcohols and liquid polyhydric alcohols varies depending on the desired effectiveness, but is preferably 5% by weight or more, more preferably 20% by weight or more, and most preferably 50% by weight or more. In addition, a solvent with pH adjusted by adding an acid or alkali to the above extraction solvent can also be used.

[0032] There are no particular limitations on the amount of solvent used. For example, it should be 5 times or more, preferably 10 times or more, the amount of solvent used relative to the dry weight of the fruit of the Rosa genus of the Rosaceae family that has been subjected to dry heat treatment. However, for convenience in operations such as concentration or isolation after extraction, it is preferable to use 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used and the pressure during extraction.

[0033] The above extract may be used as is, but if necessary, it may be used after treatment such as concentration (concentration by vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, etc., to the extent that the effects of the present invention are achieved. Furthermore, the extracted solution may be treated by concentration to dryness, spray drying, freeze-drying, etc., and used as a dried product.

[0034] The present invention may use the above extract as is, or it may contain ingredients used in cosmetics, quasi-drugs, pharmaceuticals, or foods, such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, humectants, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, and acidulants, to the extent that the effects of the extract are not impaired.

[0035] The present invention can be used in cosmetics, quasi-drugs, pharmaceuticals, and foods, and its dosage forms include, for example, lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath products, foundations, powders, lipsticks, ointments, poultices, tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0036] For external use, the content of the above extract used in this invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, when converted to solid matter. Furthermore, 0.01 to 5% by weight is most preferable. Below 0.0001% by weight, sufficient effect is unlikely to be expected. Above 10% by weight, enhancement of effect is unlikely to be observed, and it is uneconomical.

[0037] When administered internally, the dosage varies depending on age, weight, symptoms, therapeutic effect, administration method, processing time, etc. Generally, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0038] Next, in order to describe the present invention in detail, examples of the production, formulation, and experiment of the extract used in the present invention are given as examples, but the present invention is not limited thereto. The percentages of content shown in the production and formulation examples are in weight percentages. [Examples]

[0039] For production examples 1-4, we used Rosa rugosa fruits (80% by weight moisture content) that were uniformly arranged on a stainless steel tray and subjected to dry heat treatment at 200°C for 30 minutes under a blown-air condition.

[0040] (Manufacturing Example 1) Preparation of hot water extract of Rosa rugosa fruit subjected to dry heat treatment 10 g of dried Rosa rugosa fruit that had undergone dry heat treatment was mixed with 200 mL of water and extracted at 95-100°C for 2 hours. The resulting extract was filtered and freeze-dried to obtain 6.0 g of hot water extract of Rosa rugosa fruit that had undergone dry heat treatment.

[0041] (Manufacturing Example 2) Preparation of a 50% ethanol extract of Rosa rugosa fruit that has been subjected to dry heat treatment. 10 g of dried Rosa rugosa fruit, which had been heat-treated using a dry method, was immersed in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days to extract the solution. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 2.4 g of 50% ethanol extract of heat-treated Rosa rugosa fruit.

[0042] (Manufacturing Example 3) Preparation of ethanol extract from the fruit of Rosa rugosa that has been subjected to dry heat treatment. 10 g of dried Rosa rugosa fruit, which had been heat-treated using a dry method, was immersed in 200 mL of ethanol at room temperature for 7 days to extract the solution. After filtering the resulting extract, it was concentrated to dryness using an evaporator to obtain 0.070 g of ethanol extract of heat-treated Rosa rugosa fruit.

[0043] (Manufacturing Example 4) Preparation of 1,3-butylene glycol extract from dry heat-treated Rosa rugosa fruit 10 g of dried Rosa rugosa fruit, which had been heat-treated using a dry method, was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to extract the solution. The resulting extract was filtered to obtain 195 g of 1,3-butylene glycol extract of heat-treated Rosa rugosa fruit.

[0044] (Comparative manufacturing examples 1-4) Preparation of extracts from Rosa rugosa fruit that have not undergone dry heat treatment. In production examples 1 to 4, the dried fruit of Rosa rugosa that had undergone dry heat treatment was replaced with the dried fruit of Rosa rugosa that had not undergone dry heat treatment, yielding 4.2g, 1.1g, 0.58g, and 190g of each extract, respectively. [Examples]

[0045] (Example prescription 1) Lotion Formula Content (%) 1. Hot water extract of Rosa rugosa fruit that has undergone dry heat treatment (Production Example 1) 0.1 2,1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Components 1-6 and 11 and components 7-10 are uniformly dissolved, mixed together, and filtered to obtain the product.

[0046] (Comparative formulation example 1) Conventional lotion In Formulation Example 1, the hot water extract of the fruit of Rosa rugosa, which had been subjected to dry heat treatment, was replaced with purified water to create a conventional lotion.

[0047] (Prescription example 2) Cream Formula Content (%) 1. 50% ethanol extract of Rosa rugosa fruit that has undergone dry heat treatment. (Manufacturing Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-9, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1 and 11-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. Add component 10 at 45°C, and further cool to 30°C to obtain the final product.

[0048] (Prescription example 3) Emulsion Formula Content (%) 1. Ethanol extract of Rosa rugosa fruit that has undergone dry heat treatment. (Manufacturing example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 1-8, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 10-13, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring. At 45°C, add component 9, and further cool to 30°C to obtain the final product.

[0049] (Prescription example 4) Gel Formula Content (%) 1. Dry heat treatment of the fruit of Rosa rugosa 1,3-Butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5.Fragrance (appropriate amount) 6.1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve components 2-5 and components 1 and 6-11 uniformly, then mix them together to obtain the product.

[0050] (Prescription example 5) Pack Formula Content (%) 1. Hot water extract of Rosa rugosa fruit treated with dry heat (Production Example 1) 1.0 2. Dry heat treatment of the fruit of Rosa rugosa 1,3-Butylene glycol extract (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-11 uniformly to form the product.

[0051] (Prescription example 6) Foundation Formula Content (%) 1. 50% ethanol extract of Rosa rugosa fruit that has undergone dry heat treatment. (Manufacturing Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetanol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengara 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 2-8, maintain at 80°C to form the oil phase. Swell component 9 thoroughly in component 19, then add components 1 and 10-13 and mix uniformly. Add components 14-17, which have been crushed and mixed in a pulverizer, and stir with a homomixer, maintaining at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45°C, and cool to 30°C while stirring to obtain the product.

[0052] (Prescription example 7) Bath additive Formula Content (%) 1. Ethanol extract of Rosa rugosa fruit that has undergone dry heat treatment. (Manufacturing Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to bring the total volume to 100. [Manufacturing Method] Mix ingredients 1-5 uniformly to form the product.

[0053] (Prescription example 8) Ointment Formula Content (%) 1. Hot water extract of Rosa rugosa fruit treated with dry heat (Production Example 1) 5.0 2. Dry heat treatment of the fruit of Rosa rugosa 1,3-Butylene glycol extract (Production Example 4) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Heat and dissolve components 3-6, mix, and maintain at 70°C to form the oil phase. Heat and dissolve components 1, 2 and 7-9, mix, and maintain at 75°C to form the aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool to 30°C while stirring to obtain the final product.

[0054] (Prescription example 9) Powder Formula Content (%) 1. Hot water extract of Rosa rugosa fruit treated with dry heat (Production Example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1-3 and prepare as a powder.

[0055] (Prescription example 10) Tablets Formula Content (%) 1. Ethanol extract of Rosa rugosa fruit that has undergone dry heat treatment. (Manufacturing Example 3) 5.0 2. Dried corn starch 25.0 3. Carboxymethylcellulose calcium 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Mix ingredients 1-4, then add an aqueous solution of ingredient 5 as a binder and form into granules. Add ingredient 6 to the formed granules and compress into tablets. Each tablet should weigh 0.52g.

[0056] (Prescription example 11) Tablet confectionery Formula Content (%) 1. Ethanol extract of Rosa rugosa fruit that has undergone dry heat treatment. (Manufacturing Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing Method] Mix ingredients 1-4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet should weigh 1.0g.

[0057] (Prescription example 12) Beverages Formula Content (%) 1. Hot water extract of Rosa rugosa fruit that has undergone dry heat treatment (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Dilute with purified water to make a total volume of 100. [Manufacturing Method] Dissolve ingredients 1-3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0058] Next, to explain the effects of the present invention in detail, experimental examples will be given. [Examples]

[0059] Experimental Example 1: Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were placed in a φ60mm dish in a 3×10 4 Cells were seeded individually and cultured for 5 days at 37°C under 5% CO2 conditions in a MEM culture medium containing 10% FBS to which each sample was added to a final concentration of 1 μg / mL. After culturing, the cells were detached and centrifuged to obtain a pellet, which was then dissolved in PBS(-) by sonication. Protein quantification was performed using the Lowry method (J. Biol. Chem., 193, 265-275, 1951). In addition, to measure melanin content, 4N NaOH was added to the remaining cell lysate taken for protein quantification, and after heating at 60°C for 2 hours, the absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation). Melanin content was determined from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the decrease in melanin content in the sample-added group to the control group (no sample added).

[0060] These experimental results are shown in Table 1. As a result, it was found that the extract of Rosa rugosa fruit subjected to the dry heat treatment of the present invention had a superior melanin production inhibitory effect compared to the extract of Rosa rugosa fruit that was not subjected to the dry heat treatment. In particular, the melanin production inhibitory effect of the hot water extract of Rosa rugosa fruit subjected to the dry heat treatment (Production Example 1) was remarkably high. Furthermore, similar effects were observed in the extract of Rosa rugosa fruit subjected to the dry heat treatment of the present invention obtained by other extraction methods.

[0061] [Table 1]

[0062] Experimental Example 2: Measurement of Type I collagen (COL1A1), MMP1, MMP2, and hyaluronic acid synthase 2 (HAS2) mRNA expression levels. COL1A1, MMP1, MMP2, and HAS2 mRNA expression levels were measured. Human dermal fibroblasts were placed in a φ60 mm dish in a 1 × 10⁶ dish. 5Cells were seeded and cultured in DMEM culture medium containing 10% FBS at 37°C and 5% CO2. Once confluent, each sample was cultured for 24 hours in DMEM(-) culture medium to final concentrations of 1, 10, and 100 μg / mL, and then total RNA was extracted. Total RNA extraction from cells was performed using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured using real-time RT-PCR based on the total RNA extracted from cells. High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used for real-time RT-PCR. Specifically, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other procedures followed the prescribed method, and the expression levels of COL1A1, MMP1, MMP2, and HAS2 mRNA were determined as a percentage of the expression level of the internal standard, β-actin mRNA. The COL1A1 expression enhancement rate was calculated as the ratio of the COL1A1 mRNA expression level in the sample-added group to the COL1A1 mRNA expression level in the control (no sample added) group. The MMP1 expression suppression rate, MMP2 expression suppression rate, and HAS2 expression enhancement rate were calculated similarly. The primers used to measure the expression levels of each gene are as follows.

[0063] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT(Sequence ID 1) TTGCAGTGGTAGGTGATGTTCTG(Sequence ID 2) Primer set for MMP1 GGGAGATCATCGGGACAACTC (Sequence ID 3) TGAGCATCCCCTCCAATACC(Sequence ID 4) Primer set for MMP2 CCGTCGCCCATCATCAA (Sequence ID 5) CTTCTGCATCTTCTTTAGTGTGTCCTT(Sequence No. 6) Primer set for HAS2 TGGATGACCTACGAAGCGATTA(Sequence ID 7) GCTGGATTACTGTGGCAATGAG(Sequence No. 8) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (Sequence ID 9) GTGTTGGCGTACAGGTCTTTG (Sequence No. 10)

[0064] The results of these experiments are shown in Tables 2-5. As a result, the dry heat treatment of Rosa rugosa fruit according to the present invention showed superior COL1A1 expression promoting effect (collagen production promoting effect), MMP1 expression suppressing effect (MMP1 inhibitory effect), MMP2 expression suppressing effect (MMP2 inhibitory effect), and HAS2 expression promoting effect (hyaluronic acid production promoting effect) compared with the dry heat treatment of Rosa rugosa fruit extract. In particular, the COL1A1 expression promoting effect was significantly higher in the hot water extract of dry heat treated Rosa rugosa fruit (Production Example 1), the MMP1 expression suppressing effect and HAS2 expression promoting effect were significantly higher in the dry heat treated Rosa rugosa fruit ethanol extract (Production Example 3), and the MMP2 expression suppressing effect was significantly higher in the dry heat treated Rosa rugosa fruit 50% ethanol extract (Production Example 2). Furthermore, the same effect was observed in extracts of Rosa rugosa fruit that were subjected to the dry heat treatment of the present invention and obtained by other extraction methods.

[0065] [Table 2]

[0066] [Table 3]

[0067] [Table 4]

[0068] [Table 5]

[0069] Experimental Example 3: Cell Proliferation Promotion Test Human keratinocytes were cultured in DMEM culture medium containing 0.1% FBS in a 96-well plate, with 1 × 10⁶ cells per well. 3 Cells were seeded individually, and each sample was added to achieve final concentrations of 0.1 and 1 μg / mL. The cells were then cultured at 37°C under 5% CO2 conditions for 5 days. Cell counts were measured by staining. Specifically, after culturing, the culture medium was removed, and the cells were fixed with methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1N HCl was added to each well and thoroughly mixed. The absorbance at 650 nm was measured using a microplate reader. Cell proliferation rate was calculated as the ratio of the number of cells in the sample-added group to the number of cells in the control group (no sample added).

[0070] These experimental results are shown in Table 6. As a result, the extract of Rosa rugosa fruit subjected to the dry heat treatment of the present invention showed superior cell proliferation promoting activity compared to the extract of Rosa rugosa fruit that was not subjected to the dry heat treatment. In particular, the 50% ethanol extract of Rosa rugosa fruit subjected to the dry heat treatment (Production Example 2) showed a remarkably high cell proliferation promoting effect. Furthermore, similar effects were observed with the extract of Rosa rugosa fruit subjected to the dry heat treatment of the present invention obtained by other extraction methods.

[0071] [Table 6]

[0072] Experimental Example 4: Reactive Oxygen Species Scavenging Effect The free radical scavenging and removal activity was evaluated. As a model for free radicals, α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), a stable free radical, was used. It was reacted with the sample at a constant ratio for a certain period of time, and the amount of radicals that decreased was measured from the decrease in absorbance at 517 nm.

[0073] Method for measuring free radical scavenging activity Each sample was added to 2 mL of 1.0 M acetate buffer (pH 5.5) to a final concentration of 10 μg / mL. To this, 2 mL of ethanol and 1 mL of 0.5 mM DPPH ethanol solution were added to prepare the reaction solution. For oil-soluble samples, the sample was added to 2 mL of ethanol to prepare the reaction solution. The mixture was then reacted at 37°C for 30 minutes, and the absorbance at 517 nm (A) was measured using water as a control. A blank absorbance (B) was also measured using purified water instead of the sample. The free radical scavenging and removal rate was calculated using the following formula. Free radical scavenging and removal rate (%) = (1 - A / B) × 100

[0074] These experimental results are shown in Table 7. As a result, it was found that the extract of Rosa rugosa fruit subjected to the dry heat treatment of the present invention was more stable and had superior free radical scavenging activity (antioxidant activity) compared to the extract of Rosa rugosa fruit that was not subjected to the dry heat treatment. In particular, the antioxidant effect of the 50% ethanol extract of Rosa rugosa fruit subjected to the dry heat treatment (Production Example 2) was remarkably high. Similar effects were also observed in the extract of Rosa rugosa fruit subjected to the dry heat treatment of the present invention obtained by other extraction methods.

[0075] [Table 7]

[0076] Experimental Example 5: Usage Test We conducted usage tests on Formulation Example 1 and Comparative Formulation Example 1 of the present invention, and evaluated the feel of the lotion containing the dry heat-treated fruit extract of Rosa rugosa according to the present invention.

[0077] Five male and female panelists were divided into groups and blindly used each sample. They compared the user experience of Formula Example 1 and Comparative Formula Example 1, and also evaluated the presence or absence of skin problems.

[0078] As a result, the lotion obtained using formulation example 1 had a better feel to it than comparative formulation example 1, and could be used safely without causing skin problems. Furthermore, there were no issues with the degradation of the formulation ingredients. [Industrial applicability]

[0079] Based on the above, the dry heat treatment of the fruit extract of the genus Rosa of the Rosaceae family, as described above, exhibits excellent melanin production inhibitory activity, collagen production promoting activity, MMP inhibitory activity, hyaluronic acid production promoting activity, cell proliferation promoting activity, and antioxidant activity, and also exhibits excellent stability. Therefore, the dry heat treatment of the fruit extract of the genus Rosa of the Rosaceae family, as described above, can be used not only in the field of beauty, such as for skin aging, but also in the field of medicine, such as for suppressing functional decline due to aging, and for cancer prevention and treatment, and is expected to be applied to cosmetics, quasi-drugs, pharmaceuticals, and food products.

Claims

1. A topical skin preparation characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

2. A collagen production promoter characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

3. An MMP inhibitor characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

4. A hyaluronic acid production promoter characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

5. A cell proliferation promoter characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

6. An antioxidant characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

7. A wrinkle-improving agent characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to a dry heat treatment by heating to over 100°C without the addition of water.

8. A melanin production inhibitor characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

9. A skin whitening agent characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to a dry heat treatment by heating to over 100°C without the addition of water.

10. A food composition for the prevention and improvement of various diseases caused by increased MMP, characterized by containing an extract of the fruit of Rosa rugosa that has been subjected to dry heat treatment by heating to over 100°C without the addition of water.

Images