Non-coding RNA for cancer detection

JP7917952B2Active Publication Date: 2026-09-09RGT UNIV OF CALIFORNIA
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025243921
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2017-11-12
Filing Date
2025-12-09
Publication Date
2026-09-09
Estimated Expiration
2038-11-09

Smart Images

  • Figure 0007917952000021
    Figure 0007917952000021
  • Figure 0007917952000022
    Figure 0007917952000022
  • Figure 0007917952000023
    Figure 0007917952000023
Patent Text Reader

Abstract

To provide non-coding RNA for detecting cancer.SOLUTION: The present disclosure relates generally to the detection or diagnosis of subjects based on the detection or quantification of non-coding RNA sequences in a sample, and specifically to the identification and use of molecular biomarkers of cancer, including breast cancer. The described invention provides novel small non-coding RNAs that serve as biomarkers that indicate the presence of cancer, such as breast cancer, and can be used to accurately diagnose breast cancer in a subject.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related applications This application is U.S. Provisional Patent Application No. 62 / 584,899, filed on November 12, 2017. Priority is claimed, and its contents are incorporated herein by reference in their entirety.

[0002] This disclosure generally relates to the detection or quantification of non-coding nucleic acid sequences in a sample. Detection of non-coding RNA molecules or diagnosis of target organisms, specifically molecular biotechnology for cancer, including breast cancer. Regarding the identification and use of markers. [Background technology]

[0003] Widespread reprogramming of gene expression distribution is a characteristic of cancer development. Therefore The systematic identification of regulatory pathways that drive pathological gene expression patterns is crucial for understanding cancer. This is an important step toward treatment. Over many years, numerous regulatory mechanisms have been involved in the treatment of cancer cells. Oncogenic expression of genes involved in differentiation, survival, invasion, and metastasis has been linked to these mechanisms. Numerous studies have focused on the transcriptional pathways underlying carcinogenesis, but post-transcriptional regulatory pathways are also important. It has been revealed that it is a major regulator of the process. For example, gene silencing MicroRNAs (small non-coding RNAs) are a subclass of small RNAs that function in the field. A) was one of the post-transcriptional regulators that first characterized breast cancer progression (1). RNA Binding proteins (RBPs) are also important post-transcriptional regulators of gene expression, and several specific... We have shown that specific RBPs influence carcinogenesis and cancer progression (e.g., 2-5). In recent years, other classes of small non-coding RNAs, such as tRNA(6) and tRNA fragments(7), have been discussed. It has been demonstrated that ) plays a fundamental role in the progression of breast cancer.

[0004] Despite the involvement of a diverse repertoire of regulatory mechanisms in cancer, coexistence among them The characteristics they possess are that they either utilize existing intracellular pathways or cause dysregulation. In other words, cancer cells excessively activate carcinogenic pathways, and tumors To downregulate the tumor-suppressing pathway, somatic mutations (e.g., KRAS, 8), gene fusion Synthesize (e.g., BCR-ABL, 9), epigenetic modification (e.g., promoter enhancement) Numerous strategies such as chillation, 10) and disruption of regulatory mechanisms (NFκB transcription factors, 10) Adopt (11, 12). These strategies address the pathological adjustments of existing control programs. While dependent on the node, cancer cells develop specific regulatory pathways that drive tumorigenesis. There is a often overlooked possibility that it can be created. [Overview of the project] [Means for solving the problem]

[0005] The present invention, as described, indicates the presence of cancer such as breast cancer and enables accurate diagnosis of breast cancer in the subject. This provides novel small non-coding RNAs that can function as biomarkers that can be used for this purpose. In some embodiments, the method of the present invention involves extracellular circulating small molecule RN in a suitable sample. This includes the detection of A. In some embodiments, the sample is a human serum sample. In the application method, the sample is a fractionated human sample containing exosomes with small non-coding mRNA. This is a serum sample.

[0006] The present invention also relates to detecting the presence of non-coding RNA in blood or serum samples. . In some embodiments, the present disclosure provides a method for detecting hyperproliferative cells in a subject , comprising detecting the absence, presence, or amount of non-coding nucleic acid in a serum or plasma sample . In some embodiments, the method of the present invention comprises isolating total RNA from a sample , detecting the presence of a non-coding mRNA sequence, and correlating the amount of non-coding m RNA with the likelihood that the subject comprises one or more hyperproliferative cells . In some embodiments, the method of the present invention comprises isolating total RNA from a sample , detecting the presence of a non-coding mRNA sequence, and correlating the amount of non-coding mRNA with the likelihood that the subject comprises one or more cancer cells. In some embodiments, the method of the present invention comprises isolating total RNA from a sample, detecting the presence of a non-cod ing mRNA sequence, and correlating the amount of non-coding mRNA with whether the subject has one or more solid tumor cells. In some embodiments , the method of the present invention comprises isolating total RNA from a sample, and detecting a non-coding mRNA sequence , and correlating the amount of non-coding mRNA with whether the subject has one or more breast cancer cells .

[0007] In some embodiments, the method described herein is for determining a diagnosis, comprising determining the presence of one or a combination of non-coding nucleic acids in a sample derived from a subject's plasma or serum sample by the method described above , and providing a diagnosis based on the presence of one or a combination of said non-coding nucleic acids . In some embodiments, the diagnosis determined is cancer, such as breast cancer.

[0008] In some embodiments, the computer-implemented method is used for determining the presence or absence of one or a combi nation of non-coding nucleic acids, and comprises performing the method described above, quantifying the a bundance of one or a combination of non-coding nucleic acids of a reference substance from one or more samples comprising one or a combination of non-coding nucleic acids, computationally determining a normali zed amount of one or a combination of non-coding nucleic acids in the one or more samples, and determini ng the presence or absence of one or a combination of non-coding nucleic acids based on the normalized am ount. In some embodiments, quantification comprises sequencing a sample of total RNA isolated from a test sample. In some embodi ments, computational analysis is performed on sequence data obtained from whole blood or serum samples . In some embodiments, the result of the computer-implemented method described above is an output, which can be a diagnosis, for example, a diagnosis of a hyperproliferative disorder such as breast cancer. In oth er embodiments, additional sample-related information, for example, information regarding the presence o r absence of a known tumor antigen in a sample can be output. The output can be provided by various means described herein, for example, the result can be visually output, for example, to a computer monitor, or th e output can be a hard copy, for example, a printed paper report. The present invention provides, for example, the following items. (Item 1) A method for diagnosing a subject having benign, pre-malignant, or malignant hyperproliferative cells, comp rising the step of detecting the presence, absence, and / or amount of at least one non-coding RNA or a fun ctional fragment thereof in a sample. ​(Item 2) The method described in item 1, wherein the subject is a person diagnosed with or suspected of having breast cancer. . (Item 3) The detection step described in item 1 occurs after the step of obtaining a sample from the target. The method. (Item 4) Among the non-coding RNAs selected from SEQ ID NOs: 1 to 201, the sample derived from the target organism is selected from SEQ ID NOs: 1 to 201. One or a combination of the following, or any nucleic acid from Tables 1, 2, and / or 3 In contrast, at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, One or a combination of non-coding nucleic acid sequences containing 99% sequence homology is complementary to The following is described in any one of items 1-3, further including exposure to at least one nucleic acid molecule. The method. (Item 5) The at least one non-coding RNA is T3p or a functional fragment thereof, item 1 The method described in any one of items ~4. (Item 6) The aforementioned detection step detects the presence, absence, and / or amount of BRCA gene expression. The method described in any one of items 1-5, further including the act of dispensing. (Item 7) The presence or absence of at least one non-coding RNA or its homologous sequence in the sample, and / or the step of detecting the amount of the sample is the at least one non-coding RNA or contact with one or more probes specific to the functional fragment thereof, and before Items 1 to 6 include normalizing the amount in the sample to the measured value taken from the control sample. The method described in any one of the items. (Item 8) For the measurement of the amount of at least one non-coding RNA or its homologous sequence in the control sample The amount of at least one non-coding RNA or its homologous sequence in the sample is determined by the subject. Further including relating to the probability or possibility of having a benign, premalignant, or malignant tumor, The method described in any one of items 1 to 7. (Item 9) The aforementioned benign, premalignant, or malignant hyperproliferative cells originate from chest tissue, items 1-8. The method described in any one of the items. (Item 10) The aforementioned sample is blood or serum derived from the subject, as described in any one of items 1 to 9. Law. (Item 11) The method described above involves selecting one or more basal or luminal cancers in the subject. To diagnose the presence of pre-malignant or malignant hyperproliferative cells, one of items 1-10 applies. Method of description. (Item 12) The aforementioned sample is seeded with at least one cell derived from the target, or from seeded cells. A method described in any one of items 1 to 11, obtained from a culture. (Item 13) At least one biopsy derived from the subject was cultured using culture medium, and a small amount of tissue derived from the subject's chest tissue was obtained. This further includes culturing the cells under conditions and for a period of time sufficient to grow at least one cell. The method described in any one of items 1 through 12. (Item 14) The amount of at least one non-coding RNA or its functional fragment in the sample is measured. TEP is a process that involves digitally imaging the sample and extracting non-coding RNA or its functional fragments from the sample. Exposure to a known amount of labeled antibody specific to the epitope, and the non-coding RNA of the sample Or, expose the functional fragment to one or more dyes specific to it, or the non-container Exposure to at least one labeled probe complementary to the sequence of the root RNA or its functional fragment. To do this, expose the sample to chromatography, isolate the total RNA of the sample, and Exposing the entire RNA to sequence analysis, and / or the sample to mass spectrometry. The method described in any one of items 1 through 6, which includes one or a combination of the following: (Item 15) The method according to item 14, further comprising analyzing the morphology of cells derived from the aforementioned sample. (Item 16) The aforementioned sample is obtained by collecting, brushing, biopsy, or surgically removing the target plasma, serum, or blood. A human tissue sample containing tissue or liquid samples obtained by targeted excision, one of items 1-15 The method described in section [section number]. (Item 17) The aforementioned sample is newly obtained, formalin-fixed, alcohol-fixed, and / or the method described in any one of items 1 to 16, including paraffin-embedded cells. (Item 18) The presence or absence of at least one non-coding RNA or its homologous sequence in the sample, and / or the step of detecting the amount may involve a chemiluminescent probe, a fluorescent probe, and / or The method described in any one of items 1 to 17, including the use of fluorescence microscopy. (Item 19) The presence or absence of at least one non-coding RNA or its homologous sequence in the aforementioned sample, The step of detecting the amount and / or the total RNA of the sample is a small amount complementary to T3p. Any one of items 1 through 18, including making contact with at least one probe. method. (Item 20) The presence or absence of at least one non-coding RNA or its homologous sequence in the aforementioned sample, The step of detecting the amount and / or the total RNA of the sample is as shown in Tables 1 and 2. one or combination of nucleic acid sequences containing any of the sequences in and / or 3 Further including contacting at least one complementary probe, as described in item 19. The method. (Item 21) A method for detecting cancer cells in a target, The aforementioned sample is subjected to a probe complementary to one or a combination of non-coding RNA sequences. By contacting one or a combination of these in a certain amount, the non-coding RNA is subjected to the aforementioned trials. A method including detecting whether or not a substance is present in a material. (Item 22) To detect the presence of a single non-coding RNA or its homologous sequence, or to quantify its quantity. The step described in item 21 is performed after the step of obtaining a sample from the subject. method. (Item 23) The method described above is Based on the presence, absence, or quantity of a single non-coding RNA and / or its homologous sequence. Calculating one or more scores based on this; and The amount of the non-coding RNA and / or its functional fragment in the control sample is the same as the amount of non-coding RNA in the control sample. If the amount exceeds the amount of NA and / or its functional fragment, or the non-coding RNA and The amount of the bacterium / or its functional fragment in a sample taken from an object known to have cancer If the amount of non-coding RNA and / or its functional fragment is substantially equal to the amount of the subject, However, to be diagnosed with cancer, one or more of the above scores are obtained from the non-coding RNA and / Further including relating to the presence, absence, or quantity of its functional fragment, item The method described in 21 or 22. (Item 24) The nucleic acid sequences of those in Tables 1, 2, and / or 3 or Tables 1, 2, and / or At least 70%, 80%, 85%, 90%, 95% for any of the three sequences , one or a combination of nucleic acid sequences containing 96%, 97%, 98%, and 99% sequence homology To detect the presence of two or more non-coding RNAs selected from the combination or to determine this The method described in any one of items 21 to 23, further including quantification. (Item 25) The aforementioned sample is obtained by collecting, brushing, biopsying, or taking the target serum, plasma, or blood. Human tissue samples, including tissue obtained by surgical excision, as described in any one of items 21-24. The method. (Item 26) The aforementioned sample is newly obtained, formalin-fixed, alcohol-fixed, and / or any of items 21-25, including total RNA from paraffin-embedded cells The method described in section [section number]. (Item 27) Quantify the amount of at least one non-coding RNA and / or fragment thereof in the sample. The steps described above include isolating total RNA from the sample, as described in items 21-26. The method described in either of the above terms. (Item 28) Items 21-2 are either a single complementary probe or an RNA sequence that is T3p. The method described in any one of item 7. (Item 29) The person whose sample is plasma, blood, or serum, as described in any one of items 21-28. Law. (Item 30) A method for diagnosing breast cancer in a subject, (a) The presence of non-coding RNA and / or functional fragments thereof in the sample of the subject or The amount of the sample is brought into contact with a probe specific to non-coding RNA and / or its homologous sequence. To detect or quantify by causing; and (b) The presence or amount of the non-coding RNA and / or its homologous sequence is detected or A method that includes diagnosing a subject with breast cancer when quantifiable. (Item 31) Detecting the presence or quantity of non-coding RNA and / or its homologous sequences. The aforementioned step is performed after the step of taking a sample from the subject, as described in item 30. The method. (Item 32) Step (a) is, Based on the presence, absence, or quantity of non-coding RNA and / or its homologous sequences This further includes calculating one or more scores, Step (b) is, The amount of the non-coding RNA and / or its homologous sequence in the control sample If the amount exceeds A and / or its homologous sequence, or if the non-coding RNA and / Alternatively, the amount of that homologous sequence in non-conjugate sequences in samples taken from subjects known to have breast cancer. If the amount is substantially equal to that of the geno RNA and / or its homologous sequence, then the subject is breast cancer To be diagnosed as having non-coding RNA and / or so This further includes relating to the presence, absence, or quantity of a functional fragment, item 30 or The method described in 31. (Item 33) Items 30-3 further include detecting the presence of cancer antigens or quantifying their amount. The method described in any one of item 2. (Item 34) The aforementioned sample is obtained by collecting, brushing, biopsying, or surgically removing the target plasma, serum, or blood. A human tissue sample containing cells or tissue obtained by excision, according to any one of items 30-33. Method of description. (Item 35) The aforementioned sample is newly obtained, formalin-fixed, alcohol-fixed, and / or any of items 30-34, including total RNA from paraffin-embedded cells The method described in section [section number]. (Item 36) The amount of at least one non-coding RNA and / or homologous sequence in the sample is determined. The quantification step may use fluorescence imaging and / or digital imaging. The method described in any one of items 30-35, including doing the following. (Item 37) The probe optionally contains a fluorophore and comprises one or more nuclei complementary to T3p. The acid sequence as described in any one of items 30 to 36. (Item 38) The method according to any one of items 30 to 37, wherein the sample is human serum. (Item 39) A method of treating a subject who has been diagnosed with or is suspected of having breast cancer and is in need of treatment, (a) one or a combination of non-coding RNA and / or homologous sequences thereof. A step of bringing one or more different probes into contact with the sample; (b) The presence or absence of non-coding RNA and / or homologous sequences thereof in the sample, This is a step to quantify the quantity; (c) Based on the presence, absence, or quantity of the non-coding RNA and / or its homologous sequence The next step is to calculate one or more scores; (d) The amount of non-coding RNA and / or its homologous sequence in the control sample If the amount exceeds NA and / or homologous sequences, the one or more scores of the noncode In the step of relating to the presence, absence, or quantity of doRNA and / or its homologous sequence The associated step includes a step of diagnosing the subject with breast cancer; and to (e) a method comprising the step of administering to the subject a therapeutically effective amount of the treatment agent for breast cancer. Law. (Item 40) A method of treating a person who has been diagnosed with or is suspected of having cancer and requires treatment. That is, (a) One or more probes specific to non-coding RNA and / or its homologous sequence Step of bringing the sample into contact with the blotter; (b) A stool sample that quantifies the amount of non-coding RNA and / or its homologous sequence in the sample. Top; (c) One or more scores based on the amount of the non-coding RNA and / or its homologous sequence. A step of calculating a normalized number; (d) The amount of non-coding RNA and / or its homologous sequence in the control sample If the amount exceeds NA and / or homologous sequences, the one or more scores of the noncode A step of relating to the amount of doRNA and / or its homologous sequence, the association The steps include the step of diagnosing the subject with cancer; and (e) A method comprising the step of administering to the subject a therapeutically effective amount of a treatment agent for the cancer. Law. (Item 41) The probe is one or a combination of the sequences in Table 1, Table 2, and / or Table 3. One or more nucleic acid sequences complementary to the nucleic acid sequence selected from the above, as described in item 40. The method. (Item 42) One item contains a substrate containing fluorophores, chemiluminescent agents, and / or quenchers. Method 40. (Item 43) It is a system, (a) Sample and, (b) one non-coding RNA and / or homologous sequence that binds to at least one or multiple probes and / or stains, (c) At least one pair that binds to the non-coding RNA and / or its homologous sequence One that can quantify the presence, absence, and / or intensity of a robe or dye. A system including the above-mentioned devices. (Item 44) The aforementioned sample was taken from a subject who has been identified as having or is suspected of having breast cancer. The system described in item 43 is adopted. (Item 45) A method for characterizing the developmental stage or pathology of a sample containing hyperproliferating cells, (a) Multiple probes specific to non-coding RNA and / or its homologous sequence are applied to the sample. Steps to bring into contact; (b) A stool sample that quantifies the amount of non-coding RNA and / or its homologous sequence in the sample. Top; (c) Based on the presence, absence, or quantity of non-coding RNA and / or its homologous sequences The steps of calculating one or more normalized scores; and (d) The amount of non-coding RNA and / or its homologous sequence in the control sample The one or more scores such that the amount exceeds the amount of NA and / or homologous sequences. The step of relating the amount of the non-coding RNA and / or its homologous sequence The associated step includes characterizing the sample as containing hyperproliferating cells. A method that includes steps. (Item 46) A method for determining whether a subject has a malignant tumor, The presence or absence of non-coding RNA and / or its homologous sequence in the sample derived from the aforementioned target, Alternatively, the amount of the sample can be used to probe the non-coding RNA and / or its homologous sequence in a way that is specific to it. Contact with substrates specific to b and / or non-coding RNA and / or its homologous sequence. A method that includes detection by causing it to happen. (Item 47) The presence or absence of non-coding RNA and / or homologous sequences in the sample derived from the aforementioned target. The present or quantity of the sample is used to determine the specificity of non-coding RNA and / or its homologous sequence. Contact with a substrate specific to the lobe and / or T3p or its functional fragment. The method described in item 46, further comprising detection by means of. (Item 48) A method for determining whether a subject has cancer that expresses BRCA, The presence or absence of non-coding RNA and / or its homologous sequence in the sample derived from the aforementioned target, Alternatively, the amount of the sample can be used to probe the non-coding RNA and / or its homologous sequence in a way that is specific to it. Contact with substrates specific to b and / or non-coding RNA and / or its homologous sequence. A method that includes detection by causing it to happen. [Brief explanation of the drawing]

[0009] [Figure 1A]This report describes the discovery, annotation, and validation of cancer-specific orphan non-coding RNAs in breast cancer. Figure 1A is a heatmap showing the relative amounts of 437 small non-coding RNAs that were significantly expressed in breast cancer cell lines but not significantly expressed in normal HUMEC cells. HUMEC cells were treated with triple repeats, while all other cell lines were analyzed with double repeats. Figure 1B is a heatmap showing that of the 437 small RNAs identified in (Figure 1A), 201 were significantly expressed in the small RNA gene expression profiles of breast tumor biopsies collected as part of the Cancer Genome Atlas (TCGA-BRCA), and that these 201 were hardly present in adjacent normal tissues collected from approximately 200 individuals in this dataset. Figure 1C is a heatmap showing that these 201 cancer-specific small RNAs were classified as orphan non-coding RNAs or oncRNAs and independently validated in a third dataset comparing small RNA profiles from four normal epithelial samples and ten patient-derived xenograft models. [Figure 1B] Same as above. [Figure 1C] Same as above. [Figure 2A]This study demonstrates that orphan small RNAs are relatively abundant in cancer cells and rarely detected in normal tissues. In Figure 2A, to identify cancer-specific small RNAs, RNAs that are rarely present in normal cells / tissues but commonly expressed in cancer cells were searched for. Such RNA species were identified from two independent sources: (i) profiles of breast cancer cell lines compared to HUMEC, and (ii) The Cancer Genome Atlas dataset (TCGA-BRCA) containing approximately 200 normal tissue biopsies and approximately 1000 tumor samples. These two independent sets were then superimposed to identify orphan non-coding RNAs (oncRNAs). Strong overlap was observed between these two analyses, as shown in Figure 2A (hypergeometric test, P-value approximately 0). In Figure 2B, the total abundance of 201 oncRNAs was calculated for 4 normal epithelial samples and 10 PDX models. As shown in Figure 2B, total oncRNA expression can perfectly predict whether a sample is cancerous or normal (both AUC and AUPRC are equal to 1.0). [Figure 2B] Same as above. [Figure 3A]This study demonstrates a strong association between oncRNA T3p and breast cancer progression. Figure 3A is a volcano plot comparing oncRNA expression in low-metastatic breast cancer cells to their highly metastatic derivatives. OncRNA T3p, which is significantly upregulated in highly metastatic cells, is highlighted. Figure 3B is a schematic diagram showing that T3p is located at the 3' end (CR7 domain) of TERC, the RNA component of telomerase. Figure 3C shows T3p (cpm) expression in breast tumor biopsies and their corresponding normal tissues from the TCGA-BRCA dataset. The associated p-value was calculated using a paired Wilcoxon test. Figure 3D shows T3p expression across the entire TCGA-BRCA dataset. Figure 3E shows a survival analysis of the TCGA-BRCA dataset for patients stratified based on T3p expression in tumors. The top and bottom thirds of samples were included in this analysis (log-rank test). Figure 3F shows T3p expression between normal, stage I, and stage II or III samples in the TCGA-BRCA dataset (*: P<0.05; ***, P:<0.001; Mann-Whitney test used). [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 3D] Same as above. [Figure 3E] Same as above. [Figure 3F] Same as above. [Figure 4A]This shows that oncRNA T3p is associated with high-grade breast cancer. Figure 4A shows the aggregate number of samples in the TCGA-BRCA dataset based on sample type (normal vs. breast cancer). Fisher exact tests and chi-squared tests associated with each contingency table are also included. Figure 4B shows the stratification of patients in the TCGA-BRCA dataset based on whether their T3p was detected in tumor biopsy. Even slight detection of T3p in biopsy is associated with poor survival in breast cancer (p calculated based on log-rank test). Figure 4C shows a comparison of T3p expression levels in TCGA-BRCA samples segmented based on ER, PR, or HER2 status. Figure 4D shows that T3p is significantly expressed in the breast cancer PDX model (***: P<0.001; Mann-Whitney test). [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 4D] Same as above. [Figure 5] This study demonstrates that T3p promotes metastatic progression. The gene expression changes induced by anti-T3p LNA are nearly equivalent regardless of whether (i) scrambled LNA or (ii) anti-TERC (but not T3p) LNA controls are used. Pearson correlation coefficients and associated p-values ​​are included. [Figure 6A]T3p is shown as a gene expression regulator and a promoter of metastatic progression. Figure 6A shows a comparison of gene expression changes induced by anti-T3p LNA in MDA-LM2 cells compared to T3p mimetic in MDA-MB-231 cells. An accompanying Pearson correlation (P value approximately 0) has been reported. Figure 6B shows bioluminescence imaging plots of lung metastases by MDA-LM2 cells transfected with anti-T3p LNA (LNA-T3p) or scrambled LNA (LNA-Scr) (n=4 or 5 in each cohort). Statistical significance was measured using two-way ANOVA. The area under the curve was also calculated for each mouse (normalized lung photon flux multiplied by change in elapsed days). Error bars indicate the standard error of the mean. **: P<0.01 by one-sided Mann-Whitney test. Figure 6C visually shows the number of visible metastatic nodules counted in 3 mice from each cohort. The right panel shows representative lung sections stained by hematoxylin-eosin (H&E) from each cohort, along with the median count. Error bars indicate the standard error of the mean. *: P<0.05 by one-sided Mann-Whitney test. [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 7A] This shows systematic profiling of oncRNA in the exosome compartment. Figure 7A shows that the majority of oncRNA was detected in exosome small RNA data collected from MDA-MB-231 cells but not in normal HUVEC cells. Figure 7B shows small RNA profiling of exosome RNA collected from breast cancer cell lines and normal HUVECs. A heatmap showing the detection of oncRNA between extracellular populations is shown. Figure 7C shows the detection of oncRNA in serum samples collected from breast cancer patients with stage II and III disease. As a criterion for evaluation, data from 11 healthy individuals in an independent study were used as a reference. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 8A]This demonstrates that T3p can be detected in exosomes and circulating compartments. Figure 8A shows the results of previously published small RNA-seq data (7) and quantitative RT-PCR verification of T3p upregulation in highly metastatic MDA-LM2 cells compared to less metastatic parent cells (n=6 in each sample, **: P<0.01; using two-sided Mann-Whitney test). Figure 8B shows that T3p can be detected at high levels in an absolute majority of serum collected from patients and is present at very low levels (or undetectable) in serum samples collected from healthy individuals. [Figure 8B] Same as above. [Figure 9A] This shows that oncRNA T3p is associated with high-grade breast cancer. Figure 9A shows normalized T3p expression by small RNA sequencing of the cell lines indicated on the X axis. All cancer lines were prepared and processed with bio-triple repeats, and HMEC with bio-double repeats. Cell lines are morphologically segmented by subtype: HMEC (circles on the left of the panel), triple-negative breast cancer (TNBC; squares, triangles, and diamonds in the center of the panel), HER2-positive (circles and squares on the right of the panel), and luminal (triangles on the right of the panel). Figure 9B shows a comparison of T3p expression levels in TCGA-BRCA samples segmented based on ER, PR, or HER2 status (n=1033, 1030, and 715, respectively). Mean ± standard deviation is shown for each cohort. Figure 9C shows relative T3p expression measured by qRT-PCR in two low-metastatic and two high-metastatic breast cancer PDX models. [Figure 9B] Same as above. [Figure 9C] Same as above. [Figure 10A]This demonstrates that T3p can be detected in extracellular and circulating compartments. Figure 10A shows that T3p was present in sequenced small RNAs isolated from extracellular vesicles (EVs) from 7 / 8 breast cancer cell lines, but not in HMEC EVs. Samples were biologically replicated, processed, and prepared, and aggregated before calculation of counts per million reads. Cell lines morphologically classified by subtype: HMEC (first column from the left on the X-axis), triple-negative breast cancer (TNBC; four columns to the right of HMEC), HER2-positive (two columns to the right of the HER2 set in the samples), and luminal (the last two columns on the far right of the graph). Figure 10B shows the Pearson correlation coefficients of oncRNA expression levels between the total intracellular (IC) compartment and the total extracellular (CM) compartment, and between the IC and extracellular vesicle (EV) compartments. Biologically independent experiments with n=2 per cell line. Figure 10C shows 10 bootstrap-based receiver operating characteristic (ROC) curves illustrating the classification performance of a gradient boosting classifier trained on cRNA expression levels from the TCGA-BRCA dataset and tested on serum samples from healthy volunteers or breast cancer patients (GSE49035). Figure 10D shows that T3p can be detected at high levels in an absolute majority of serum samples collected from patients, but is present at very low levels (or undetectable) in serum samples collected from healthy individuals. The right panel shows T3p levels in serum collected from individual breast cancer patients. n=40 bioindependent samples. Mean ± standard error of the mean. P-values ​​were calculated using the two-sided Mann-Whitney test. Figure 10E shows that T3p can be detected at high levels in an absolute majority of serum samples collected from patients, but is present at very low levels (or undetectable) in serum samples collected from healthy individuals. The right panel shows T3p levels in serum collected from individual breast cancer patients. n=40 bioindependent samples. The value is shown as mean ± standard error of the mean. The p-value was calculated using the two-tailed Mann-Whitney test.Bootstrap ROC curves (10 iterations) were generated for a gradient boosting classifier trained on miRNA expression within the TCGA-BRCA dataset and tested on serum samples from healthy volunteers or breast cancer patients (data hidden). [Figure 10B] Same as above. [Figure 10C] Same as above. [Figure 10D] Same as above. [Figure 10E] Same as above. [Figure 10F] Same as above. [Modes for carrying out the invention]

[0010] This disclosure indicates the presence of breast cancer and is used to accurately diagnose or stage the breast cancer in question. This provides novel small non-coding RNAs that can function as biomarkers. In one embodiment of the present invention, the method involves the detection of extracellular circulating small RNAs in a suitable sample. .

[0011] definition Before describing the present invention in detail, we provide definitions of certain terms used herein. do.

[0012] Unless otherwise defined, the technical and scientific terms used herein are the same as those used in this specification. It has the same meaning as that generally understood by those skilled in the art in the technical field to which it belongs. For example, Singleton et al.,Dictionary of Microbiol ogy and Molecular Biology 2nd ed., J. Wile y & Sons (New York, NY 1994) is used in this application. This provides a general guide to many terms used by those skilled in the art. Furthermore, the implementation of the present invention is as not specifically stated. As far as is, molecular biology (including recombinant technology), microbiology, and cell biology are within the scope of the skills of those skilled in the art. Conventional techniques in physics and biochemistry are used. Such techniques include "Molecular Cl oning:A Laboratory Manual”,2nd edition(S ambrook et al., 1989), “Oligonucleotide Sy “Animal Cell” (MJ Gait, ed., 1984), “Animal Cell Culture” (RIFreshney, ed., 1987), “Method s in Enzymology” (Academic Press, Inc.), “H andbook of Experimental Immunology”,4th edition(DMWeir & CCBlackwell, eds.,Bl ackwell Science Inc., 1987), “Gene Transfe. r Vectors for Mammalian Cells”(JMMille r & MP Calos, eds., 1987), “Current Protoc. ols in Molecular Biology”(FMAusubel et al., eds., 1987), and “PCR: The Polymerase C "Hain Reaction", (Mullis et al., eds., 1994) This is explained in detail in the following literature.

[0013] Where used in this disclosure and claims, the singular form "one (a)" is used. The plural forms of "an" and "the" are included unless explicitly stated otherwise. ru.

[0014] Where embodiments are described herein using the term "including", then "consisting of" and Also, other similar embodiments described with the words "essentially consisting of" It will be understood that the embodiments are provided. Furthermore, the embodiments will use the term "essentially consisting of" If specified in the specification, any other similar entity described with the phrase "consisting of" It can be understood that the implementation methods are also provided.

[0015] Where used in this specification in phrases such as "A and / or B", the term "and" refers to the term "and" " / or" means A and B; A or B; A (alone); and B (alone). To illustrate. Similarly, when used in phrases such as "A, B and / or C", the term "and" "B / or" is intended to encompass each of the following specific expressions: A, B, and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B Call C; A (alone); B (alone); and C (alone).

[0016] As used herein, the terms “about” or “approximately” mean 5% or less of a given value or range. This refers to percentages of 4%, 3%, 2%, and 1% or less.

[0017] As used herein, the term “antibody” means a substance that has at least one antigen-binding site. Proteins, polypeptides, peptides, carbohydrates, polynucleotides, lipids, or the aforementioned This refers to immunoglobulin molecules that recognize and specifically bind to targets such as combinations of targets. When used in this context, the above terms refer to the intact antibody as long as it exhibits the desired biological binding activity. Liclonal antibodies, intact monoclonal antibodies, single-chain antibodies, antibody fragments (e.g., Fa b, Fab', F(ab')2, and Fv fragments), single-chain Fv(scFv) antibody, bimodal Heterochromic antibodies and other polyspecific antibodies, monospecific antibodies, monovalent antibodies, chimeric antibodies, humanized antibodies, A fusion protein containing an antibody, an antigen-binding site of the antibody, and any other protein containing an antigen-binding site. It contains modified immunoglobulin molecules. The antibodies are α, δ, ε, γ, and Based on the identity of these heavy chain constant domains, referred to as μ, the following five immunoglobulins It can be one of the following major classes: IgA, IgD, IgE, IgG, and Ig M or its subclasses (isotypes) (e.g., IgG1, IgG2, IgG3, I) (IgA4, IgA1, and IgA2). Different classes of immunoglobulins are different and well It has a known subunit structure and three-dimensional arrangement. The antibody is either naked or toxin-containing. It can also be compounded with other molecules, including but not limited to radioactive isotopes.

[0018] The term "antibody fragment" refers to a portion of an intact antibody, and the antigen of the intact antibody cannot be determined. This refers to a variant region. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv. Examples include fragments, linear antibodies, single-chain antibodies, and polyspecific antibodies formed from antibody fragments. However, it is not limited to these. When used herein, “antibody fragment” means at least It contains one antigen-binding site or epitope-binding site. The term "variable region" of an antibody is used. This refers to the variable region of the antibody light chain or the variable region of the antibody heavy chain, either alone or in combination. Alternatively, the variable region of the light chain is generally known as one of three complementarity-determining regions, also known as the "hypervariable region." It consists of four framework regions (FRs) linked by CDRs. These are brought together in close proximity by framework regions and contribute to the formation of antigen-binding sites on antibodies. To determine the CDR, at least two techniques exist: (1) heterogeneous A method based on sequence diversity (i.e., Kabat et al., 1991, Seq uences of Proteins of Immunological Inte rest,5th Edition,National Institutes of (Health, Bethesda, MD) and (2) Crystallographic studies of antigen-antibody complexes The method is based on (Al-Lazikani et al., 1997, J.Mol.Bio (l., 273:927-948). In addition, the combination of these two methods is CDR It is sometimes used in the relevant technical field to determine [something].

[0019] As used herein, the term "biomarker" refers to substances present in an individual at different concentrations. This refers to biomolecules that are useful in predicting the state of cancer in an individual. Examples of biomarkers include nucleic acids. Examples include proteins, variants, and fragments thereof, but are not limited to these. It is not defined. A biomarker is the nucleic acid, either whole or in part, that codes for the biomarker. This may be DNA containing a sequence or complements of such a sequence. Biomers useful in the present invention Kerr nucleic acids include DNA and other nucleic acid sequences, either whole or partial, that are of interest. It is thought that both RNA and RNA are included.

[0020] As used herein, the term “body fluid” means blood (or blood such as plasma or serum). (fraction of), lymph, mucus, tears, saliva, sputum, urine, semen, feces, CSF (cerebrospinal fluid), breast milk This refers to body fluids containing non-coding RNA (ncRNA), including ascites fluid. Several implementation forms In this state, the body fluid is urine. In some embodiments, the body fluid is fractionated, containing exosomes. It is serum.

[0021] As used herein, the terms “cancer” and “cancerous” refer to a population of cells that are out of control. Refers to or describes a physiological state in mammals characterized by reproduction. In that embodiment, the cancer is breast cancer.

[0022] As used herein, the terms “associate” or “associate” mean two things. This refers to the statistical relationship between events, where events can include numerical values, datasets, etc. For example, when an event involves numerical values, a positive correlation (also referred to as a "direct correlation" in this specification) is formed. (This means that as one increases, the other also increases.) In this context, it is also called "inverse correlation"), which means that as one increases, the other decreases. The present invention provides small non-coding RNAs, and the level of these small non-coding RNAs is It correlates with certain outcome measures, such as the relationship between the level and the likelihood of developing breast cancer. For example, low Increased levels of molecular non-coding RNA may show a negative correlation with the likelihood of a favorable clinical outcome in patients. In this case, for example, the possibility of long-term survival without cancer recurrence and / or transformation of the patient's cancer. Positive responses to medical therapy may decrease. Such negative correlations may indicate that patients have a poor prognosis. It has been shown that there is a possibility of an insufficient response to chemotherapy, and this can be seen in various ways. For example, this can be statistically demonstrated by a high hazard ratio.

[0023] As used herein, the term “high stringency” means the following conditions: (1 ) For cleaning, use low ionic strength and high temperature, for example, 15 mM sodium chloride at 50°C / Conditions for using 1.5 mM sodium citrate / 0.1% sodium dodecyl sulfate; (2) During hybridization, a denaturing agent such as formamide is added, for example, at 42°C for 5x 50% (v / v) of SSC (0.75M NaCl, 75mM sodium citrate) Formamide and 0.1% bovine serum albumin / 0.1% Ficol / 0.1% Poly Conditions for using vinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5); Or (3) 50% formamide in 5x SSC at 42°C during hybridization. 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, Using 10% dextran sulfate, and 0.2x SSC and 50% formamide... After washing at 42°C, the following washing is performed at 55°C with 0.1x SSC containing EDTA. The conditions.

[0024] The term "excessive proliferation disorder" refers to abnormal proliferation, abnormal growth, abnormal aging, and abnormal cell growth in living organisms. This refers to a disease or disorder characterized by a state of quiescence or abnormal removal, encompassing all forms of hyperplasia and neoplasia. , and cancer. In some embodiments, the hyperproliferative disease affects the gastrointestinal or urinary tract. It is a cancer of which originates. In some embodiments, the hyperproliferative disease is found in the adrenal gland, bladder, bone, bone marrow, Brain, spine, chest, neck, gallbladder, ganglia, digestive tract, stomach, large intestine, heart, kidneys, liver, lungs, muscles , ovaries, pancreas, parathyroid gland, penis, prostate, salivary gland, skin, spleen, testes, thymus, thyroid gland, ma or uterine cancer. In some embodiments, the term hyperproliferative disease is selected from the following: The cancers that can be selected are: lung cancer, bone cancer, CMML, pancreatic cancer, skin cancer, head and neck cancer, and cutaneous melanoma. This includes intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, stomach cancer, colorectal cancer, breast cancer, and orchiectomy. Surgery, gynecological tumors (e.g., uterine sarcoma, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, or vulva cancer) Cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer (e.g., thyroid, parathyroid gland) Cancer of the glands or adrenal glands), soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, chronic cancer This includes acute leukemia, solid tumors in childhood, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer. Cancers of the tubules (e.g., renal cell carcinoma, renal pelvis carcinoma), or tumors of the central nervous system (e.g., central nervous system Primary lymphoma, spinal axial tumor, brainstem glioma, or pituitary adenoma.

[0025] As used herein, the term "identical" or "identical" in the context of two or more nucleic acids. "Sex percentage" or "homology" means being identical or having no conservative amino acid substitutions. Compare and align for the greatest match without considering it as part of sequence identity (if necessary) A specific percentage of nucleotides or amino acids that are identical when a gap is introduced accordingly. This refers to two or more sequences or subsequences that contain no acid residues. The identity percentage is calculated by sequence comparison. It can be measured using software or algorithms, or by visual inspection. Various algorithms can be used to obtain sequence comparisons of nucleotide or amino acid sequences. The Zoom and software are well known in the art. These include BLAS. T, ALIGN, Megalign, BestFit, GCG Wisconsin P This includes, but is not limited to, packages and their variations. In some embodiments, the two nucleic acids of the present invention are substantially identical, and this is because they are To achieve the greatest match, either using a sequence comparison algorithm or by visual inspection. When compared and aligned, at least approximately 70%, at least approximately 75% %, at least about 80%, at least about 85%, at least about 90%, and several actual In the application form, at least approximately 95%, 96%, 97%, 98%, and 99% of nucleotides are present. This means that there is amino acid residue sequence identity. In some embodiments, identity means At least about 10, at least about 20, at least about 40-60 nucleotides, at least The sequence spans approximately 60-80 nucleotides, or any integer value between them. It exists. In some embodiments, identity is at least about 80-100 nucleotides. They exist over regions longer than 60-80 nucleotides, such as in some embodiments, and in some embodiments The sequences are substantially identical across the entire length of the sequences being compared.

[0026] As used herein, the term “level” refers to the fixed copy number of a non-coding RNA transcript. This refers to sexual or quantitative determination. The level of RNA transcripts in the first sample, for example, clinically relevant In a related subgroup of patients (e.g., patients with cancer), a second sample, e.g., related If the RNA transcript is higher than in the subpopulation (e.g., patients without cancer), then the RNA transcript is higher. This indicates an "increased level" of RNA transcripts in tumor samples obtained from individual patients. In the context of Bell's analysis, the level of RNA transcripts in the subjects is clinically relevant. If the RNA transcript leans towards or more closely approaches a level characteristic of a patient subpopulation, then, This indicates an increased level.

[0027] As used herein, the term “metastasis” refers to the development of similar cancerous lesions at new locations. Metastasis refers to the process by which cancer spreads or migrates from its place of origin to other parts of the body. "Sexual" or "metastatic" cells lack adhesive contact with adjacent cells and are the primary site of disease. It is something that moves from one site to another (for example, via the bloodstream or lymphatic system).

[0028] As used herein, the term "monoclonal antibody" refers to a single antigenic determinant or antigen. This refers to a homogeneous population of antibodies involved in the highly specific recognition and binding of a pitope. Typically, polyclonal cells contain a mixture of different antibodies produced against various different antigenic determinants. This is in contrast to monoclonal antibodies. The term "monoclonal antibody" refers to an intact, full-length monoclonal antibody. Noclonal antibodies, as well as antibody fragments (e.g., Fab, Fab', F(ab')2, F v) Single-chain (scFv) antibody, fusion protein containing the antibody portion, and antigen-binding site It includes any other modified immunoglobulin molecules. Furthermore, it includes "monoclonal antibodies." "Hybridoma production, phage selection, recombinant expression, and transgenic animals" This refers to antibodies produced by any number of technologies, including but not limited to these.

[0029] As used herein, the term "normalized" in reference to non-coding RNA transcripts is used in reference to This refers to the level of RNA transcripts relative to the average level of transcripts in a set of RNA transcripts. Irradiated RNA transcripts are based on the principle that their variability across patients, tissues, or treatments is minimal. Alternatively, non-coding RNA transcripts are tested RNA transcripts or such tests. This can be normalized to the entire subset of RNA transcripts.

[0030] "Patient response" includes, but is not limited to, (1) slowing down and complete cessation of growth. (1) Some degree of inhibition of tumor growth, (2) reduction in the number of tumor cells, (3) reduction in tumor size. (4) Inhibition of tumor cell infiltration into adjacent peripheral organs and / or tissues (i.e., reduction) (5) Inhibition of transition (i.e., reduction, deceleration or complete stop) (6) Antitumor immunity that may result in tumor regression or rejection, but does not necessarily have to be achieved. (7) Enhancement of the epidemic response, (8) Some degree of relief of one or more symptoms associated with cancer, (9) Post-treatment (9) including an increase in the length of survival and / or a reduction in mortality at a given time after treatment, It can be evaluated using any endpoint that demonstrates patient benefit.

[0031] The terms "polynucleotide," "nucleic acid," and "nucleic acid molecule" are defined herein as follows: Used interchangeably, it refers to nucleotide polymers of any length, including DNA and RNA. Polynucleotides are composed of deoxyribonucleotides, ribonucleotides, and modified nucleotides. Rheotides or bases, and / or analogs thereof, or DNA or RNA polyparticles It can be any substrate that can be incorporated into the polymer by melase.

[0032] The terms “polypeptide,” “peptide,” and “protein” are defined herein as follows: Used interchangeably, it refers to a polymer of amino acids of any length. Polymers can be linear or fractional. It can be a branched chain, may contain modified amino acids, and may be interrupted by non-amino acids. The above terms are, Naturally modified or intervened, e.g., disulfide bond formation, glycosylation, lipidization. , any other operation or modification such as acetylation, phosphorylation, or binding with a labeling component Therefore, it also includes modified amino acid polymers. For example, the similarity of one or more amino acids The body (including, for example, unnatural amino acids) and other modifications known in the art. Polypeptides are also included in the definition. The polypeptide of the present invention is an antibody or fusion protein. Therefore, in certain embodiments, polypeptides can be single chains or associated chains (for example) It can be understood that these can occur as dimers.

[0033] As used herein, the term “prognosis” refers to the recurrence, metastasis, and spread of neoplastic diseases such as breast cancer. This refers to the prediction of the likelihood of death or progression due to cancer, including drug resistance.

[0034] As used herein, the term “reference” RNA transcript refers to its level in the test sample. This refers to RNA transcripts that can be used for comparison with the levels of NA transcripts. In this embodiment, the reference RNA transcript is β-globin, alcohol dehydrogenate. Examples include housekeeping genes such as ze, or any other RNA transcript, and their level The expression of RNA transcripts does not fluctuate depending on the disease state of cells containing RNA transcripts. In the assay, all RNA transcripts or subsets of the RNA being assayed are reference RNA transcribed. It can function as a copy.

[0035] As used herein, the term “small non-coding RNA” (ncRNA) means a protein This refers to RNA that is not translated into other languages, such as transfer RNA (tRNA) and ribosomal RNA (ribosomal RNA). (microRNA), snoRNA, microRNA (miRNA), siRNA, nuclear small molecules ( snRNA, Y RNA, vault RNA, antisense RNA, tiRNA (transcription) Initiation RNA), TSSa-RNA (transcription initiation site-associated RNA), and piwiRNA ( This includes piRNAs. Small ncRNAs have a nucleotide length of less than 200. Preferably, as used herein, the low molecular weight ncRNA is 50 to 100 nucleotides. ncRNAs are of endogenous origin (e.g., human small non-coding RNAs) or exogenous origin. It may be of origin (e.g., virus, bacteria, parasite). "Canonical" ncRN A refers to the RNA sequence as predicted from the genome sequence, and identifies a specific RNA. It is the most abundant sequence. "Trimmed" ncRNA is the exonucle. Rease-mediated nucleotide trimming results in the 5' end and / or / This refers to ncRNA from which one or more nucleotides have been removed from the 3' end. "cRNA" refers to small non-coding RNA sequences that are longer than canonical small non-coding RNA sequences. and are terms understood in the relevant technical field. The nucleotides constituting the extension are , corresponding to the nucleotides of the precursor sequence, and therefore, nucleotide addition without a template. In contrast, it is encoded by the genome. In some embodiments, it is described herein as open Any of the methods shown can detect any or a combination of the above-disclosed RNAs. This includes doing so.

[0036] As used herein, the term “subject” refers to humans, non-human primates, dogs, cats, and rodents. This refers to any animal (e.g., mammals), including but not limited to animals. Furthermore, the subject is a human subject. The terms "subject," "individual," and "patient" are used in this specification. They are used interchangeably in writing. Therefore, the terms "subject," "individual," and "patient" are interchangeable. This includes individuals with cancer (e.g., breast cancer) and surgical removal of cancerous tissue. This includes individuals that have received or are candidates for receiving the treatment.

[0037] The term "therapeutic effective dose" refers to a sufficient amount to achieve the desired therapeutic effect, for example, a dose of a given treatment. Symptoms related to the disease, for example, the prognosis for disorders related to cancer growth or overgrowth. This refers to the amount that prevents, improves, or reduces the disease. The amount of compound administered to the subject is the amount that causes the disease The type and severity of the illness, as well as individual characteristics, such as health status, age, sex, weight, and It depends on drug resistance. It also depends on the degree, severity, and type of the disease. The supplier can determine the appropriate dosage based on these and other factors. The given plan may affect what constitutes the effective dose. Furthermore, several divided doses The time-delayed dose may be administered daily or sequentially, or the dose may be continuously infused. It may be administered by spit or bolus injection. Furthermore, the dosage of the compound of the present invention may be therapeutic or It can increase or decrease proportionally, as indicated by the urgency of the prevention situation. Usually, The effective amount of the compound of the present invention sufficient to achieve the therapeutic effect is per kilogram of body weight per day. The range is approximately 0.000001 mg to approximately 10,000 mg per kilogram of body weight per day. Preferably, the dose range is about 0.0001 mg per kilogram of body weight per day. ~Approximately 100 mg per kilogram of body weight per day. Chemicals disclosed herein The combinations are administered either in combination with each other or with one or more additional therapeutic compounds. obtain.

[0038] The term "salt" refers to acidic salts formed by inorganic and / or organic acids, as well as inorganic and / or basic salts formed by organic bases. Examples of these acids and bases are given in this book. This is common knowledge. Such acid addition salts are usually pharmaceutically acceptable, but if they are not pharmaceutically acceptable... Salts of acid may be useful in the preparation and purification of the compound of the present invention. The acid addition salts of the compound are most appropriately formed from pharmaceutically acceptable acids, for example, inorganic acids (e.g.) (For example, hydrochloric acid, hydrobromic acid, sulfuric acid, or phosphoric acid) and organic acids (for example, succinate, maleic acid) This includes substances formed by acetic acid or fumaric acid. Other pharmaceutically unacceptable substances. Salts (e.g., oxalates) are used, for example, for the isolation of the compounds of the present invention, experimentally, or subsequently. It can be used for conversion to pharmaceutically acceptable acid addition salts. The solvates of the present invention and Hydrates are also included within the scope of the present invention. Certain compounds of the present invention are hydrolyzable in vivo. A functional ester or amide is a compound of which has free hydroxy or amino functionality. The substance is subjected to the presence of a base in an inert solvent (e.g., dichloromethane or chloroform) as desired. It can be formed by treatment with an ester acid chloride of ester. Suitable bases include triethyl It contains luamine or pyridine. Conversely, the compounds of the present invention having a free carboxyl group Standard conditions may include, following activation, treatment with a desired alcohol in the presence of a suitable base. It can be esterified using [a specific method]. Examples of pharmaceutically acceptable addition salts include non-toxic inorganic [another specific method]. and organic acid addition salts, for example, hydrochloride salts derived from hydrochloric acid, and odors derived from hydrobromic acid. Hydrochlorides, nitrates derived from nitric acid, perchlorates derived from perchloric acid, phosphoric acid Phosphates derived from, sulfates derived from sulfuric acid, formate derived from formic acid, acetic acid Acetates derived from aconitate, aconitates derived from aconitate, and ascorbic acid Derived ascorbates, benzenesulfonates derived from benzenesulfonic acid Benzoates derived from benzoic acid, cinnamates derived from cinnamic acid, citric acid Citrate derived from, embonate derived from, enanthic acid derived from Enanthates derived from fumarate, fumarates derived from glutamate Glutamate, glycolate derived from glycolic acid, lactic acid derived from lactic acid Salt, maleate derived from maleic acid, malonate derived from malonic acid, man Mandelate derived from delic acid, methanesulfonic acid derived from methanesulfonic acid Salt, naphthalene-2-sulfonate derived from naphthalene-2-sulfonic acid, phthal Phthalates derived from acids, salicylates derived from salicylic acid, and sorbates derived from sorbic acid. Derived sorbate, stearate derived from stearic acid, and derived from succinic acid. Derived succinate, tartarate derived from tartaric acid, derived from p-toluenesulfonic acid Examples include toluene-p-sulfonates, but are not limited to these. The salts are sodium, lysine, and arginine salts of the compounds of the present invention. Salts are well known in the art and can be formed by the procedures described.

[0039] Other acids, such as oxalic acid, that cannot be considered pharmaceutically acceptable are not included in the compounds of the present invention. and in the preparation of salts useful as intermediates in obtaining the pharmaceutically acceptable acid addition salts thereof It may be used. The metal salt of the compound of the present invention may be an alkali metal salt, for example, a carboxyl group The present invention contains sodium salts of the compound of the present invention. Mixture of isomers obtainable by the present invention The compound can be separated into individual isomers by methods known to the present day, and the diastereoisomers are For example, partitioning between multiphase solvent mixtures, recrystallization and / or crystallization in silica gel, for example. Chromatographic separation, or, for example, by medium-pressure liquid chromatography using a reversed-phase column The racemic mixture can be separated, for example, by the formation of salts with an optically pure salt-forming reagent and By separating the mixture of diastereoisomers obtained, for example by fractional crystallization, Alternatively, it can be separated by chromatography on an optically active column material.

[0040] As used herein, the term "sample" means the subject of interest as described herein. This refers to biological samples obtained from or derived from a source. In some embodiments, Sources of interest include living organisms such as animals or humans. In some embodiments, A biological sample includes biological tissue or biological fluid. In some embodiments, the biological sample is Bone marrow; blood; blood cells; ascites; tissue or microneedle biopsy specimen; body fluid containing cells; buoyancy Sexual nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymphatic fluid; gynecological fluids; Skin swabs; vaginal swabs; oral swabs; nasal swabs; tube lavage solution or bronchoalveolar lavage solution. Any washing or rinsing solution; aspirated fluid; swabs; bone marrow specimens; tissue biopsy specimens; surgical specimens; stool, etc. Body fluids, secretions, and / or excretions; and / or cells derived therefrom. or may include them. In some embodiments, the biological sample is obtained from an individual. It is a cell or contains cells. In some embodiments, the sample is obtained by any suitable means These are "primary samples" obtained directly from the source of interest. For example, several implementations Morphologically, primary biological samples include biopsies (e.g., fine-needle aspiration or tissue biopsy), surgical procedures, and body fluids. By selecting a method from a group that includes the collection of (for example, blood, lymph fluid, feces, etc.) It is obtained by [method]. In some embodiments, as is clear from the context, the term "sample" means, By processing the primary sample (for example, by removing one or more components of the primary sample) Therefore, the preparation obtained (by adding and / or one or more agents) It refers to. For example, filtration using a semipermeable membrane. Such a "treated sample" could be, for example, a sample or Extracted from or the primary sample is, for example, mRNA amplification or reverse transcription, certain components nucleic acids or tannins obtained by subjecting them to techniques such as isolation and / or purification. It may contain protein.

[0041] As used herein, the terms “to treat” or “to treat” are used with respect to the treatment of 1) To treat, delay, alleviate, and / or prevent the progression of the symptoms of the diagnosed condition or disorder. 1) Treatment means to stop the disease and 2) means to prevent or delay the onset of the target disease or disorder. It refers to both drug prevention and preventive measures. Therefore, as for those who require treatment, already Persons diagnosed with a disability; persons prone to having a disability; and persons for whom a disability should be prevented This includes those who... In some embodiments, the subject is a patient who exhibits one or more of the following... In combination, the method of the present invention will successfully "treat": a reduction in the number of cancer cells and / or Complete absence of cancer cells; reduction of tumor size; inhibition of tumor growth; soft tissue formation of cancer cells Inhibition of and / or non-existence of cancer cell invasion into peripheral organs, including diffusion into tissue and bone. Presence; Inhibition of metastasis of tumors or cancer cells and / or their absence; Inhibition of cancer growth and Absence or absence; reduction of one or more symptoms associated with a specific cancer; morbidity and Reduced mortality rate; improved quality of life; reduced tumorigenesis; reduced number or frequency of cancer stem cells. ; or several combinations of such effects.

[0042] As used herein, the term "tumor" refers to all tumor cells, whether malignant or benign. This refers to the growth and proliferation of cells and tissues, as well as all precancerous and cancerous cells and tissues.

[0043] The term "T3p" is encoded or generated by the human TERC nucleotide sequence. This refers to the last 45 nucleotides (in the 5'-3' direction) of the non-coding RNA. The sequence is PCT number PCT / US2008 / 055709 and the associated sequence list. It may be found in [the relevant section], and its contents are incorporated herein by reference in their entirety.

[0044] As used herein, the term “tumor sample” includes tumor material obtained from cancer patients. This refers to a sample. The above term refers to a tumor tissue sample, for example, tissue obtained by surgical excision. and includes tissue obtained by biopsy, for example, core biopsy or microneedle biopsy. In a specific embodiment, the tumor sample is a tissue sample fixed and embedded in wax, for example, formalin It is a tissue sample that has been fixed and embedded in paraffin. Furthermore, the term "tumor sample" refers to a primary tumor. This includes samples containing tumor cells obtained from sites other than tumors, such as circulating tumor cells. The above terms refer to cells that are descendants of a patient's tumor cells, such as primary tumor cells or circulating tumor cells. This also includes cell culture samples derived from cells. The above terms refer to the excretion from tumor cells in vivo. Samples that may contain protein or nucleic acid material, such as bone marrow, blood, plasma, serum, etc. The above terms include tumor cells that have been enriched or otherwise manipulated after they have been obtained. Polynucleotides and / or polynucleotides obtained from prepared samples and patient tumor materials This also includes samples containing lipeptides.

[0045] cancer small RNA biomarkers The human genome is composed of a vast amount of small non-protein-coding RNA (ncRNA) transcripts. It contains a very rich amount of transfer RNA (tRNA), ribosomal RNA (rRNA), and nucleus. Somatic small RNA (snoRNA), microRNA (miRNA), small interfering RNA ( siRNA, nuclear small RNA (snRNA), and Piwi-binding RNA (piRN) A) is described as having multiple ncRNA classes (Amaral et al., 2 008, Martens-Uzunova et al., 2013). Small molecule non-coding. RNA binds to target mRNA at a site with appropriate sequence complementarity, thereby translating the RNA lip. It acts as a lesser (Ameres et al., 2007), but has very abundant cytoplasm. Y RNA controls RNA quality by influencing the intracellular position of the Ro protein. It functions in principle (Sim et al., 2009). Mature low for mRNA translation The repressive activity of molecular non-coding RNAs silences retrotransposons at their default intracellular locations. In addition to singular piRNAs, other classes include siRNA and endogenous siRNA. It is shared with ncRNA (Chuma and Pillai, 2009). The activity of endoRNA depends on its sufficient abundance in the cytoplasm and its localization to the endosomal membrane. Interaction with RNA-induced silencing complex (RISC) is dependent (Gibbing s et al.,2009, Lee et al.,2009a) found that small amounts of low-milli Sub-noncoding RNAs have a smaller effect on translational repression. As a result, a certain Even subtle changes at the level of small non-coding RNAs can already affect cellular processes. However, strong disturbances can cause disease. In addition to abundance, only (RISC) proteins... Furthermore, interaction with RNA partners and correct intracellular localization are crucial for small non-coding RNAs. These are interrelated factors that control the physiological functions of (Mullokandov et al.) .,2012, Wee et al.,2012).

[0046] Small RNA molecules can be secreted into extracellular vesicles of cell origin, such as exosomes. (mRN) It has been discovered that both A and small non-coding RNA species are contained in exosomes. Therefore, exosomes are used for the transport of RNA content and their degradation in the environment. It can provide means for protection and stable detection of RNA biomarkers Make the supply source available.

[0047] This disclosure compares subjects with breast cancer to subjects who are "normal," i.e., subjects without breast cancer. Low molecular weight non-coding RNs that are known to be differentially present in biological samples derived from the target organism. Regarding biomarkers. Small non-coding RNA biomarkers or small non-coding RNA biomarkers. The set of RNA biomarkers includes small non-coding RNA biomarkers in the sample. Or, differences in the expression levels of a set of small non-coding RNA biomarkers are statistically significant. when it is determined to be significant, it exists differentially between samples. Common tests for statistically significant differences and include, but are not limited to, t-test, ANOVA, Kruskal-Wallis, Wilcoxon, Mann-Whitney and odds ratio. The low-molecular-weight non-coding RNA biomarkers, alone or in combination, can be used to provide a measure of the relative risk that a subject has or does not have cancer.

[0048] Low-molecular-weight non-coding RNA biomarkers for breast cancer are obtained through sequencing of small RNA from multiple breast cancer subtypes and human breast epithelial cells, as well as identification of previously unknown low-molecular-weight non-coding RNAs that are specifically expressed in breast cancer cells. Two hundred previously unknown low-molecular-weight non-coding RNAs specifically expressed in breast cancer cells have been identified in this way (see Table 1). Currently, these low-molecular-weight non-coding RNA biomarkers can be used to determine the cancer status of a subject, for example, a subject whose breast cancer status was previously unknown or a subject suspected of suffering from breast cancer. This can be achieved by determining the level of one or more of the identified low-molecular-weight non-coding RNAs or a combination thereof in a biological sample derived from the subject. A difference in the level of one or more of these low-molecular-weight non-coding RNA biomarkers compared to that in a biological sample derived from a normal subject is an indicator that the subject has breast cancer.

[0049] Compared with normal subjects, a subject who has a difference in the level of one or more low-molecular-weight non-coding RNA biomarkers includes early, moderate or intermediate, or severe or terminal breast cancer. ​​​May have breast cancer. In one embodiment, one or more small non-coding RNA biomarkers Bell can be used to diagnose breast cancer in subjects exhibiting symptoms characteristic of early-stage cancer.

[0050] In one embodiment, the level of one or more small non-coding RNA biomarkers is used to target It can be used to monitor the progression of cancer, for example, the progression of breast cancer. The state of the cancer in question can change over time. For example, cancer may worsen over time or It may improve. With such deterioration or improvement, one or more small non-coding RNA biomers Kerr's level is changed in a statistically significant manner so that it can be detected in samples derived from the subject. It can transform. For example, the level of one or more of the small non-coding RNA biomarkers The incidence may increase over time with the development of breast cancer. Therefore, the course (progression) of breast cancer in the subject This involves the detection of one or more small non-coding RNA biomarkers in a first sample derived from the subject. To determine Bell, and one or more low molecular weight non-coding R in the second sample derived from the subject. This can be monitored by determining the level of the NA biomarker, where the second The second sample is acquired after the first sample. The level of the second sample is compared with that of the first sample. The level in the table indicates disease progression. For example, Table 1 and Table 2 show the progression from the first sample to the second sample. Alternatively, an increase in the level of one or more of the small non-coding RNA biomarkers in Table 3 indicates that This indicates that the subject developed breast cancer or that the disease worsened. Conversely, from the first sample to the second... Add one of the small non-coding RNA biomarkers from Table 1, Table 2, or Table 3 to the sample. A decrease in the above levels indicates that the disease has improved. In one embodiment, one or more small molecules The coding RNA biomarkers are those listed in Table 3 and their combinations.

[0051] The levels of small non-coding RNA biomarkers in biological samples derived from the test subject were positive. Whether or not the levels differ from those of small non-coding RNA biomarkers that are normally present in the target organism is a test. The levels of small non-coding RNA biomarkers in samples derived from the test subjects were compared to appropriate controls. This can be confirmed by selecting a suitable control for the assay in question. Those skilled in the art will be able to select a suitable control for the assay in question. A suitable control can be selected. For example, a suitable control could be a known subject, such as a normal person without cancer. A biological sample may originate from an object known to be a normal object. When obtained from, the level of small non-coding RNA biomarkers in the test subject A statistically significant difference compared to a suitable control indicates that the subject has breast cancer. In one embodiment, The difference in the levels of small non-coding RNA biomarkers is increased. A suitable control is, It can also serve as a reference standard. A reference standard is used to estimate the state of breast cancer in a given sample by referring to the test sample. It serves as a reference level for comparison, allowing it to be compared to a standard. The reference standard is a known Subjects, for example, subjects known to be normal or subjects known to have breast cancer. This may represent the level of one or more small non-coding RNA biomarkers in [the specified location]. The reference standard is a set of known objects, for example, a set of objects known to be normal. or one or more small non-coding RNAs in a population of subjects known to have breast cancer It can represent the level of the omarker. The reference standard is, for example, a pool of samples from multiple individuals. To do so, and to measure the levels of small non-coding RNA biomarkers in pooled samples. obtained by measurement, thereby providing a standard for an averaged population . Such a reference standard can represent the average level of small non-coding RNA biomar kers in a population of individuals. The reference standard can, for example, also be obtained by averaging the levels of small non-coding RNA biomarkers determined to be present in individual sam ples obtained from a plurality of individuals. Such a standard also represents the average level of small non-coding RNA biomarkers in a population of individuals. The reference standard can also be a collection of values each representing the level of a target small non-coding RNA biomarker in a popu lation of individuals. In certain embodiments, a test sample can be compared against such a collectio n of values to estimate the breast cancer status of a subject. In certain embodiments, the reference standard is an absolute value. In such embodiments, a test sample can be compared against the absolu te value to estimate the breast cancer status of a subject. In one embodiment, comparison of the lev el of one or more small non-coding RNA biomarkers in a sample against an appropriate control is perf ormed by executing a software classification algorithm. In some embodiments, increased expression o f one or a combination of non-coding RNAs listed in Tables 1, 2, and / or 3 is an expression that is about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95 percent, or about 100% or more higher compared to the expression of the same non-cod ing RNA in a normal sample. In some embodiments, increased expression of one or a combination of non -coding RNAs listed in Tables 1, 2, and / or 3 is an expression that is about 2X, 3X, 4X, 5X, 6X, 7X, 8X, 9X, or 10X or more higher compared to the expression of the same one or combination of non In some embodiments, approximately 7 of the nucleic acid sequences in Tables 1, 2, and / or 3 are used. 0%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, also This refers to one or more non-coding RNA sequences or nucleic acid sequences that have approximately 99% homology. In that embodiment, the expression of one or more sequences from Tables 1, 2, or 3 is performed. The mere presence or expression of one or more non-coding RNAs, either alone or in combination. In the embodiment, approximately 70%, 80%, and 8% of the nucleic acid sequences in Tables 1, 2, and / or 3 are used. 1%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91% Homologousity of %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99% This corresponds to the expression of one or more sequences having sexual properties, either alone or in combination. The mere presence or expression of one or more non-coding RNAs. In some embodiments, this Their homologous sequences are among the nucleic acid sequence fragments disclosed in Tables 1, 2, and / or 3. Includes one or more of the following.

[0052] Those skilled in the art will readily anticipate additional appropriate controls that may be suitable depending on the assay in question. It is possible. The appropriate comparisons mentioned above are illustrative and intended to be limiting. There isn't one.

[0053] Generally, small non-coding RNA biomers in normal subjects are listed in Table 1, Table 2, or Table 3. A biological sample derived from the test subject was compared to an appropriate control representing one or more levels of the Kerr scale. One of the small non-coding RNA biomarkers in Table 1, Table 2, or Table 3 of the sample An increase in the upper level would indicate that the subject of the study has breast cancer. Two or more small molecules In some cases where coding RNA biomarker levels are measured in the subjects of study, appropriate Compared to the control group, the levels of one or more small non-coding RNA biomarkers were increased. The levels of one or more additional small non-coding RNA biomarkers remain unchanged or increase. In such cases, one or more levels of small non-coding RNA biomarkers may be added. Appropriate counters representing the levels of low-molecular-weight non-coding RNA biomarkers in normal subjects The difference compared to the normal state indicates that the subject has breast cancer. The determination of such differences is as described in this specification. As described in the book, this can be assisted by the execution of software classification algorithms.

[0054] Biological samples The expression levels of one or more small non-coding RNA biomarkers are found in the organism from which the subject originates. It can be measured in the sample. A sample derived from the subject is derived from the subject. Samples may be further processed after they are obtained from the subject. For example, RNA can be extracted from the sample. It can be isolated. In this example, the RNA isolated from the sample is also a sample derived from the subject. A useful biological test for determining the levels of one or more small non-coding RNA biomarkers. The material can basically be obtained from any source, including cells, tissues, and fluids throughout the body. .

[0055] In some embodiments, the levels of one or more small non-coding RNA biomarkers are determined. The biological samples used for determination include circulating small non-coding RNAs, such as extracellular small molecules. This is a sample containing non-coding RNA. Extracellular small non-coding RNA is from the fluid of the circulating system. Body fluids, such as blood samples or lymph samples, or other body fluids, such as urine. They circulate freely in a wide range of biological materials, including saliva. Therefore, several implementations In this state, it is used to determine the level of one or more small non-coding RNA biomarkers. The biological samples to be examined include body fluids such as blood, its fractions, serum, plasma, urine, saliva, tears, and sweat. These include semen, vaginal fluid, lymph, bronchial secretions, CSF, and whole blood. In some embodiments, these include semen, vaginal fluid, lymph, bronchial secretions, CSF, and whole blood. The sample is a non-invasively acquired sample. In some embodiments, the sample is of human origin. This is a serum sample.

[0056] In some embodiments, any of the methods disclosed herein uses a small sample. This includes using. In some embodiments, the disclosed method involves about 20 microliters The following samples: 40 microliter sample, 80 microliter sample, 100 microliters 1 liter sample, 200 microliter sample, 300 microliter sample, 4 00 microliter sample, 500 microliter sample, 600 microliter Sample, 700 microliter sample, 800 microliter sample, 900 microliters 1 ml sample, 1 ml sample, 1.1 ml sample, 1.2 ml sample Torl sample, 1.3 ml sample, 1.4 ml sample, 1.5 ml sample Sample of 1 ml, sample of 1.6 ml, sample of 1.7 ml, sample of 1.8 ml Total RN in the samples of the 1.9 ml sample and the 2.0 ml sample. This includes isolating A and / or amplifying non-coding RNA. Several implementations In this case, the sample size is approximately 25 microliters of the target plasma, whole blood, or serum. The liquid sample is approximately 2 milliliters.

[0057] In some embodiments, the disclosed method involves approximately 20 microliters or less of serum, 40 microliter serum, 80 microliters serum, 100 microliters serum 200 microliters of serum, 300 microliters of serum, 400 microliters Tol's serum, 500 microliters of serum, 600 microliters of serum, 700 microliters 100 microliters of serum, 800 microliters of serum, 900 microliters of serum , 1 milliliter of serum, 1.1 milliliters of serum, 1.2 milliliters of serum, 1. 3 ml serum, 1.4 ml serum, 1.5 ml serum, 1.6 milliliters of serum, 1.7 milliliters of serum, 1.8 milliliters of serum, 1.9 milliliters Isolating total RNA from liters of serum, 2.0 milliliters of serum samples, and / or including amplification of non-coding RNA.

[0058] Circulating small non-coding RNAs include small non-coding RNAs in cells and microvesicles. , extracellular small non-coding RNA in exosomes, and cells or microvesicles Examples include non-vesicular small extracellular small non-coding RNAs (non-vesicular small extracellular small non-coding RNAs). In some embodiments, the levels of one or more small non-coding RNA biomarkers are measured. Biological samples used for determination (e.g., samples containing circulating small non-coding RNA) ) may contain cells. In other embodiments, the biological sample does not have to contain cells, or may substantially not be included (e.g., serum sample). In some embodiments, circulating low-molecular-weight Samples containing child non-coding RNA (e.g., extracellular small non-coding RNA) are blood-derived. These are samples. Examples of blood-derived samples include, for example, plasma samples, serum samples, Examples include blood samples. In other embodiments, a sample containing circulating small non-coding RNA is used. The sample is a lymphatic fluid sample. Circulating small non-coding RNAs are also found in urine and saliva. Similarly, biological samples derived from these sources also contain one or more small non-coding RNAs. It is suitable for determining the levels of biomarkers.

[0059] In some embodiments, any of the methods of the present disclosure may involve a sample or cells or an egg. This includes the step of isolating total RNA from xosomes or microvesicles for expression analysis. Methods for isolating RNA from blood, plasma, and / or serum (e.g., Tsui N See B et al. (2002) Clin. Chem. 48, 1647-53. (The entire text is incorporated herein by reference), as well as the isolation of RNA from urine. Methods (e.g., Boom R et al. (1990) J Clin Microbi See ol.28,495-503 (the entirety of which is incorporated herein by reference). It is stated that)).

[0060] Determination of the level of low-molecular-weight RNA biomarkers in a sample. The level of one or more small non-coding RNA biomarkers in a biological sample is any appropriate It can be determined by the following method: by measuring the level or amount of low-molecular-weight non-coding RNA in the sample. Any reliable method can be used to do so. Generally, small non-coding RNAs are, for example, For example, amplification-based methods (e.g., polymerase chain reaction (PCR), real-time polymerase chain reaction) Polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), low (e.g., ring circle amplification), hybridization-based methods (e.g., hybridization Scaling arrays (e.g., microarrays), NanoString analysis, Northern Array Lot analysis, branched DNA (bDNA) signal amplification method, in situ hybridise (e.g., ionization), and sequencing-based methods (e.g., Illumina or IonT) Public for mRNA, including next-generation sequencing methods using the Orrent platform. Detection from RNA samples and other samples (including fractions thereof) isolated by various methods of knowledge. It can be quantified. Other exemplary techniques include ribonuclease protection assays (RP). A) and mass spectrometry are mentioned.

[0061] In some embodiments, RNA is converted to DNA (cDNA) before analysis. A can be generated by reverse transcription of isolated small non-coding RNA using conventional techniques. In some embodiments, small non-coding RNAs are amplified before measurement. Other embodiments Therefore, the level of small non-coding RNA is measured during the amplification process. In this application method, the levels of small non-coding RNAs are not amplified before measurement. Several exemplary methods suitable for determining non-coding RNA levels are described in more detail below. These methods are described below. These methods are provided merely as examples. Other preferred methods may be used in the same way. It is obvious to those skilled in the art that it can be used.

[0062] A. Amplification-based methods This includes, but is not limited to, PCR, RT-PCR, qPCR, and rolling circle amplification. Numerous amplification bases for detecting the levels of undefined, small non-coding RNA nucleic acid sequences. There are various methods. Other amplification-based techniques include, for example, ligase chain reaction, and Amplification using a ligation-capable probe (multiplex ligatabl e probe amplification, in vitro transcription (IVT), chain substitution amplification Width, transcription-mediated amplification, RNA (Eberwine) amplification, and other methods known to those skilled in the art. The law is cited.

[0063] A typical PCR reaction involves several steps to selectively amplify the target nucleic acid species, or The cycle includes: a denaturation step in which the target nucleic acid is denatured; a set of PCR primers ( In other words, forward primers and reverse primers anneal complementary DNA strands. The annealing step involves ringing, and the heat-resistant DNA polymerase extends the primer. The elongation step. By repeating these steps multiple times, the DNA flag The ment is amplified to produce an amplicon corresponding to the target sequence. A typical PCR reaction is This includes more than 20 cycles of degeneration, annealing, and elongation. Often, annealing The ring step and extension step can be performed simultaneously, in which case there are two cycles. This includes only the following steps: Reverse transcription reaction (cDNA complementary to small non-coding RNA). Reverse transcription (which produces a series of cells) can be performed before PCR amplification. This includes the use of DNA polymerase (reverse transcriptase) and primers.

[0064] Kits for quantitative real-time PCR of small non-coding RNAs are known and commercially available. It is being used. An example of a suitable kit is the TaqMan miRNA assay (Appli ed Biosystems) and mirVana.qRT-PCR miRNA detection Kits (Ambion) are examples, but are not limited to these. Before reverse transcriptase, low Molecular non-coding RNA can be adapted to a universal primer sequence, polyadenylated sequence, or other compatible sequence. Ligation is performed on single-stranded oligonucleotides containing a ter sequence, and a universal ply is used. Primers complementary to the Mer sequence, poly(T) primers, or complementary to the adapter sequence It can be amplified using primers containing a specific sequence.

[0065] In some cases, custom qRT-PCR is used to determine the level of small non-coding RNAs. Assays can be developed to measure small non-coding RNAs in biological samples (e.g., body fluids). For example, the method involving extended reverse transcription primers and locked nucleic acid modification PCR. Using this method, custom qRT-PCR assays can be developed. A coding RNA assay is a dilution system of chemically synthesized small non-coding RNAs corresponding to the target sequence. This can be tested by performing an assay on the column. This determines the detection limit and each up This enables the determination of the linear range for quantitative analysis of sieve. Furthermore, when used as a calibration curve, these This data allows for the estimation of the absolute abundance of small non-coding RNAs measured in biological samples. Make it Noh.

[0066] Depending on the case, check the amplification curve and evaluate the Ct value to be within the linear range of each amplification plot. It may be possible to verify this. Typically, the linear range extends over several orders of magnitude. Each candidate being assayed Regarding small non-coding RNAs, we obtained chemically synthesized versions of small non-coding RNAs. By analyzing the dilution series, the sensitivity limit and linear range of quantification of the assay can be determined. The relative expression level is, for example, Livak et al., Methods (2001 It may be determined as described in December;25(4):402-8 ru.

[0067] In some embodiments, two or more small non-coding RNAs are amplified in a single reaction volume. For example, multiplex q-PCR such as qRT-PCR uses two or more pairs of primers and / or By using two or more probes, at least two points of interest can be identified in one reaction volume. It enables simultaneous amplification and quantification of target small non-coding RNAs. The primer pair allows for the simultaneous amplification and quantification of each small non-coding RNA. It includes at least one amplification primer that specifically binds to molecular non-coding RNA, and the probe The molecules are labeled so that they can be identified from one another, thereby enabling multiple small molecule non-coding R Simultaneous quantification of NA becomes possible.

[0068] Rolling circle amplification linearizes cyclic oligonucleotide probes under isothermal conditions. DNA polymerase-driven reactions that can replicate either by geometric dynamics or (For example, Lizardi et al., Nat. Gen. (1998) 19(3)) :225-232;Gusev et al., Am. J. Pathol. (2001) 159(1):63-69, Nallur et al., Nucleic Acids See Res.(2001)29(23):E118). The presence of two primers Underneath, one hybridizes to the (+) strand of DNA, and the other hybridizes to the (-) strand. Furthermore, the combined pattern of strand substitutions was observed within 90 minutes for each DNA molecule. 9Generating more than one copy It brings about tandem linking of closed circular DNA molecules by using a single primer. A bound copy can be formed. Using the DNA bound to the matrix, this process It is also possible to perform a reverse transcription. The template used for rolling circle amplification is a reverse transcription. This method can be used for small non-coding RNA sequences and very small non-coding RN sequences. It can be used as a highly sensitive indicator of expression level at concentration A (for example, Cheng et al.,Angew Chem.Int.Ed.Engl.(2009)48( 18):3268-72, Neubacher et al., Chembiochem See (2009)10(8):1289-91).

[0069] B. Hybridization-based methods Small non-coding RNAs can be hybridized using hybridization arrays (e.g., microarrays). NanoString analysis, Northern blot analysis, branched DNA (bDNA) signaling This includes, but is not limited to, amplification methods and in situ hybridization. It can be detected using hybridization-based methods.

[0070] Microarrays are used to simultaneously measure the expression levels of numerous small non-coding RNAs. It can be used. Printing onto a glass slide using tapered pins, pre-fabricated masks The photolithography and dynamic micromirror devices used are dynamic Photolithography using a micromirror device, inkjet Using various techniques, including electrochemistry with a etchprint or microelectrode array, Microarrays can be fabricated. Microarrays based on arrays of microfluidic qRT-PCR reactions Chromofluid TaqMan Low-Density Array and related qRT-P Microfluidic methods based on CR (Critical Reaction) are also useful.

[0071] Axon B-4000 scanner and Gene-Pix Pro 4.0 software Images can be scanned using Wire or other suitable software. Non-positive spots after ground removal and outliers detected by the ESD procedure are removed. The obtained signal intensity values ​​are normalized to the median per chip, and then... Then, to obtain the geometric mean and standard error for each small non-coding RNA, Each signal can be converted to a base-2 logarithm, and a one-sample t-test can be performed. To increase data robustness, each small non-coding RNA is spotted multiple times, and each Independent hybridization of samples can be performed on the chip.

[0072] Microarrays for expression profiling of individual small non-coding RNAs in disease It can be used. For example, RNA can be extracted from the sample, and if desired, Small non-coding RNAs are size-selected from all RNA. Oligonucleotide linkers are used. It can be attached to the 5' and 3' ends of small non-coding RNAs, and the resulting liger The sense strand PCR product is used as a template for the RT-PCR reaction. The lymer, by attaching a fluorophore to its 5' end, allows the PCR product to be seated. The nucleotide chain can be labeled. The PCR product is denatured and then high-denatured in a microarray. Bredized. The corresponding small non-coding RNA on the array, called the target nucleic acid, is captured. The PCR product complementary to the probe sequence is base-paired at the spot where the capture probe is immobilized. Hybridization occurs through formation. The spot is then scanned by a microarray laser scanner. When excited using -, it emits fluorescence.

[0073] Next, using several positive and negative controls and array data normalization methods, each The fluorescence intensity of the pot was evaluated in terms of the copy number of specific small non-coding RNAs, and the result As a result, it becomes possible to evaluate the expression levels of specific small non-coding RNAs.

[0074] Small non-coding RNAs were extracted from bodily fluid samples without size selection. It is also possible to use whole RNA containing NA directly. For example, T4 RNA ligase The 3' end of RNA is labeled using a fluorophore-labeled short RNA linker. This is possible. A fluorescein complementary to the corresponding small non-coding RNA capture probe sequence on the array. Lophore-labeled small non-coding RNAs are base-paired at the spot where the capture probe is fixed. Hybridization occurs via formation. Then, several positive and negative controls and arrays are formed. Using data normalization, the fluorescence intensity of each spot is determined to be a copy of a specific small non-coding RNA. -Evaluated from a numerical perspective, and as a result, the expression level of specific small non-coding RNAs was evaluated. It will be brought about.

[0075] Spotted oligonucleotide microarrays, pre-fabricated oligonucleotides This includes microarrays or spotted long-chain oligonucleotide arrays, Several types of microarrays, not limited to these, may be used.

[0076] nCounter Analysis System (NanoStrin) without amplification g Technologies, Seattle, Wash.) uses low molecular weight noncoagulants. It can also detect doRNA. This technology involves two nucleic acids that hybridize in solution. Use base probes (e.g., reporter probe and capture probe). After bridging, excess probe is removed and the probe is processed according to the manufacturer's protocol. The lobe / target complex is analyzed. The nCounter miRNA assay kit is N Available from anoString Technologies, and highly similar to low It can identify molecular non-coding RNAs with high specificity.

[0077] We use branched DNA (bDNA) signal amplification to detect small non-coding RNAs. It is also possible (for example, Urdea, Nature Biotechnology (19 See 94), 12:926-928). Small molecule non-bDNA signal amplification based on bDNA signal amplification. Encoding RNA assays are commercially available. One such assay is QuantiGen e(registered trademark)2.0 miRNA Assay(Affymetrix, Santa Clara (Calif.)

[0078] Northern blotting and in situ hybridization were used to analyze small molecules. Encoding RNA may be detected. Northern blot and in situ hybridization. Appropriate methods for performing this procedure are known in the art.

[0079] In some embodiments, biomarker expression is measured by multi-sample profile testing and enzyme binding. Immunoadsorption assay (ELISA), radioimmunoassay, Western blot assay, immunoassay Fluorescence assay, enzyme immunoassay, immunoprecipitation assay, chemiluminescence assay, immunohistochemistry This includes dot blot assays, or slot blot assays, but these The antibody is measured by an assay known to those skilled in the art, but is not limited to such assays. In some embodiments used, the antibody is labeled to be detectable. Antibody labels include: Immunofluorescence labeling, chemiluminescence labeling, phosphorescent labeling, enzyme labeling, radiolabeling, avidin / biotin Examples include, but are not limited to, colloidal gold particles, colored particles, and magnetic particles. In some embodiments, the expression of biomarkers is measured by an IHC assay. ru.

[0080] In some embodiments, the expression of a biomarker is specifically bound to the biomarker. It is measured using a drug. Any molecular entity that shows specific binding to a biomarker is tested. It can be used to measure the level of that biomarker protein in a material. Specifically The drugs that can be bound include antibodies, antibody fragments, antibody mimetics, and polynucleotides. Examples include aptamers, but are not limited to these. Engineers are needed The degree of specificity is the specific assay used to detect biomarker proteins. It is understood that this is determined by. In some embodiments, the present disclosure relates to a solid support (e.g., antibodies, antibody fragments, antibody mimetics, and antibodies that can bind to T3p or its salts. ELISA plates, gels, beads, or columns containing / or polynucleotides Regarding the system, including.

[0081] C. Sequence-based methods Advanced sequencing methods may also be used, where available. For example, small molecule non-coding R NA stands for Illumina next-generation sequencing (e.g., HiSeq, HiScan, Ge nomeAnalyzer, or MiSeq system (Illumina, Inc.) For example, using Sequencing-By (San Diego, Calif.) - Can be detected using synthesis or TruSeq methods. Small molecules Non-coding RNA is Ion Torrent Sequencing (Ion Torrent Sequencing). (Ent Systems, Inc., Gulliford, Conn.) or other appropriate It can also be detected using semiconductor arrangement determination methods.

[0082] D. Additional tools for detecting small non-coding RNAs To quantify small non-coding RNAs using RNase mapping, mass spectrometry is used. It can be used. Isolated RNA can be subjected to MS or tandem MS (MS / MS) Before analyzing them using the approach, highly specific RNA endonucleases (RN) (For example, RNase Tl, which cleaves all unmodified guanosine residues at the 3' end) It can be enzymatically digested. The first method developed involves directly cupping the ESI-MS. Online chromatography of endonuclease digests by reverse-phase HPLC with ringing. - Separation was used. Based on the RNA sequence, the mass shift from the expected mass was used for transcription. The presence of post-modification can be revealed. Next, ions with unusual mass / charge values ​​are tandem To isolate the nucleoside for MS sequencing and determine the sequence configuration of the post-transcriptionally modified nucleoside, It is possible.

[0083] Matrix-assisted laser desorption / ionization mass spectrometry (MALDI-MS) is also used for post-transcriptional modifications. It is used as an analytical method to obtain information about nucleosides. The method can be distinguished from ESI-based methods by the separation step. In DI-MS, a mass spectrometer is used to isolate small non-coding RNAs.

[0084] To analyze limited amounts of intact small non-coding RNA, custom-fabricated nano Spray ion source, Nanovolume Valve (Valco Instrume) nts), and splitless nanoHPLC systems (DiNa, KYA Techn A linear ion trap-orbitrap hybrid mass fraction with ologies) Analyzer (LTQ Orbitrap XL, Thermo Fisher Scienti fic) or tandem quadrupole time-of-flight mass spectrometer (QSTAR XL, Appli By using ed Biosystems, nanoESI-MS and coupling A capillary LC system can be used. Analytes / TEAAs are nano-L The material is loaded onto a C-trap column, desalted, and then concentrated. Intact low molecular weight non-concentrated The root RNA is eluted from the trap column and directly injected into the Cl8 capillary column. Chromatographic separation was performed by RP-HPLC using a gradually increasing polar solvent gradient. Using an ionization voltage that allows scanning of ions in negative polarity mode, Chromatographic eluent is sprayed from the tip of a sprayer attached to a pyrarie column. It can be done.

[0085] Additional methods for detecting and measuring small non-coding RNAs include, for example, Strat. Third Wave Technologies, Inc., Surface plasmon resonance (SPR), cDNA, MTDNA (metallic DNA; Adva nce Technologies, Saskatoon, SK, and US Gen Examples include single-molecule methods developed by omics. Surface enzymatic reactions are performed at the nanoscale. Micro-spheric imaging using a novel method combined with particle amplified SPR imaging (SPRI) Multiple small non-coding RNAs can be detected in array format. The surface reaction of the enzyme was hybridized onto a locked nucleic acid (LNA) microarray. A poly(A) tail is created on small non-coding RNAs. Then, DNA-modified nanoparticles are formed. The larvae are adsorbed onto the poly(A) tail and detected by SPRI. This ultra-high sensitivity nanoparticle amplification S The PRI method is used for atomographic low-molecular-weight non-coding RNA profiling. It is possible.

[0086] E. Detection of amplified or unamplified small non-coding RNAs In certain embodiments, labels, dyes, or labeled probes and / or primers Used to detect amplified or unamplified small non-coding RNAs. Those skilled in the art can determine which detection method is appropriate based on the sensitivity of the detection method and the abundance of the target. This will become clear. Depending on the sensitivity of the detection method and the abundance of the target, amplification may be required before detection. It may or may not be necessary. Those skilled in the art prefer to amplify small non-coding RNAs. This will reveal a reliable detection method.

[0087] The probe or primer is a standard base (A, T or U, G, and C) or It may contain modified bases. Examples of modified bases include U.S. Patent No. 5,432,272, and the same patent. AEGIS bases described in numbers 5,965,364 and 6,001,983 (Available from Eragen Biosciences) is one example, but it is not limited to this. In certain aspects, bases are linked by natural phosphodiester bonds or different chemical bonds. They are bonded together. Examples of different chemical bonds include those described in, for example, U.S. Patent No. 7,060,809. The listed methods include linkage by peptide bonds or locked nucleic acids (LNAs), however... These are not the only options.

[0088] In a further embodiment, oligonucleotide probes or primers present in the amplified reactant - is suitable for monitoring the amount of amplification product produced as a function of time. In one embodiment, a probe having different single-stranded characteristics from the double-stranded characteristics detects nucleic acids. It is used for the following: As a probe, it is used in 5'-exonuclease assays (for example). TAQMAN probe (see U.S. Patent No. 5,538,848), stem ☐ Molecular beacon (referencing U.S. Patent Nos. 6,103,476 and 5,925,517) (Referring to light), stemless or linear beacon (WO9921881, U.S. 6,4 See issues 85,901 and 6,649,349), peptide nucleic acids (PNA) ) Molecular beacons (see U.S. Patent Nos. 6,355,421 and 6,593,091) (referring to) linear PNA beacons (see, for example, U.S. Patent No. 6,329,144) (and), non-FRET probe (see U.S. Patent No. 6,150,097), Sunr ise(trademark) / AmplifluorB(trademark) probe (U.S. 6,548,2 See issue 50), stem-loop and double-strand SCORPION probe (U.S. Patent See Patent No. 6,589,743), bulge loop probe (U.S. Patent No. 6,590 See Patent No. 091), Pseudoknot probe (US Patent No. 6,548,250) See also), Cyclicon (see U.S. Patent No. 6,383,752), MG B Eclipse® probe (Epoch Biosciences), hair piercing See probe (U.S. Patent No. 6,596,490), PNA Light Up Pro Antiprimer quench probe (Li et al., Clin. Chem.) 53:624-633(2006)), self-assembled nanoparticle probes, and, for example, US Examples include the ferrocene-modified probe described in Japanese Patent No. 6,485,901. However, it is not limited to these.

[0089] In certain embodiments, one or more of the primers in the amplification reaction include a label. Obtain. In yet another embodiment, different probes or primers are used to detect each other. Includes a label that can be output. In some embodiments, nucleic acids such as probes or primers are It can be marked with two or more identifiable signs.

[0090] In some embodiments, the label is coupled to one or more probes and has one of the following characteristics Having one or more: (i) providing a detectable signal; (ii) interacting with a second marker Using a second label, for example, a detection method provided by FRET (Fluorescence Resonance Energy Transfer), (iii) Modification of available signals; (iii) Hybridization (e.g., double-strand formation) (iv) Stabilize the binding complex or affinity set, e.g., affinity complex antibody-antigen complexes, ion-bonded complexes, hapten ligands (e.g., biotin-avidin) ) provides members. In yet another embodiment, the use of labels is known labels, bonds, linking groups , one of the many known techniques using reagents, reaction conditions, and analytical and purification methods This can be achieved using

[0100] Small non-coding RNAs can be detected by direct or indirect methods. In direct detection methods, one or more small non-coding RNAs are detected by the nucleic acid molecule. It is detected by a label that can be used as a probe. In such a method, small non-coding RNAs are probes. It can be labeled before binding. Therefore, binding is possible when the labeled probe is bound to the probe. It is detected by screening for small non-coding RNAs. The probe is desired. This allows the beads in the reaction volume to be connected.

[0091] In certain embodiments, nucleic acids are detected by direct binding to a labeled probe, and The probe is detected afterwards. In one embodiment of the present invention, amplified small molecule noncoding RN Nucleic acids such as A are combined with a probe to capture the desired nucleic acid using FlexMAP. It is detected using crossspheres (Luminex). Several methods exist, for example, fluorescence Detection by label-modified polynucleotide probes or branched DNA (bDNA) ) May be accompanied by detection.

[0092] In some embodiments, the expression of biomarkers is specific to each biomarker. Measurement is performed using a PCR-based assay that includes a mer and / or probe. When used in detail, the term "probe" specifically refers to a biomolecule that selectively binds to a particular target biomolecule. This refers to any molecule that can do this. In this specification, in some embodiments, the term " "Probe" refers to the substrate and / or reaction product and / or disclosed herein. Indirectly or directly, covalently or noncovalently, it binds to any of the proteases. This refers to any molecule that can combine or associate, and such association or bonding is not disclosed herein. It can be detected using a method that allows for detection. In some embodiments, the probe is a fluorescent probe. It is a probe, antibody, or absorbance-based probe. The chromophore pNA (p-nitroaniline) is the target nucleic acid disclosed herein. It can be used as a probe for sequence detection and / or quantification. Several implementations In this state, the probe contains a fluorescent molecule or substrate that becomes fluorescent when exposed to the enzyme. It may be a nucleic acid sequence, and the nucleic acid sequence is one of the nucleic acid sequences in Tables 1, 2 and / or 3. 70%, 80%, 81%, 82%, 83%, 84%, 85% for any deviation or combination %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95 Nucleic acid sequences containing %, 96%, 97%, 98%, 99%, or approximately 100% sequence identity It is complementary to the fragment.

[0093] The target molecule is any of the nucleic acid sequences identified in Tables 1, 2, and / or 3. These can be combinations. In some embodiments, the target molecule is as shown in Tables 1, 2 and / or 70%, 80%, 81%, 82% for any or combination of nucleic acid sequences in 3 %, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92% , containing 93%, 94%, 95%, 96%, 97%, 98%, or approximately 99% sequence identity It is a nucleic acid sequence. The probe may be synthesized by those skilled in the art using known techniques. , or may be derived from biological preparations. Probes include RNA, DNA, and proteins. Examples include, but are not limited to, proteins, peptides, aptamers, antibodies, and organic molecules. No. The terms "primer" or "probe" refer to oligonucleotides having a specific sequence. It includes oligonucleotides having a specific sequence. In some embodiments, The target molecule is one or a combination of nucleic acid sequences identified in Tables 1, 2 and / or 3. Any or any combination of nucleic acid sequences in Tables 1, 2, and / or 3 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 8% of the bite 7%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 9 Any or a combination of nucleic acid sequences containing 7%, 98%, or approximately 99% sequence identity It is any amplified fragment of se.

[0094] In other embodiments, nucleic acids are detected by indirect detection methods, such as biotinylation. The probe uses a dye complexed with streptavidin to detect bound nucleic acids. They can be combined. The streptavidin molecule is on amplified small non-coding RNA. The Otin label binds to the bound small non-coding RNA, which then binds to the streptavidin molecule. It is detected by detecting the pigment molecules. In one embodiment, streptavidi The pigment molecules complexed with Streptavidin contain PHYCOLINK. R-Phycoerythrin (PROzyme). Other complexed dye molecules are It is publicly known to the contractors.

[0095] The labeling method involves generating a detectable fluorescence, chemiluminescence, or bioluminescence signal. Examples include light-emitting compounds that quench light, light-scattering compounds, and light-absorbing compounds, but these include Not limited (for example, Kricka, L., Nonisotopic DNA Pro be Techniques,Academic Press,San Diego(1 992) and Garman A., Non-Radioactive Labeling See g, Academic Press (1997). Reporter Fluorescein Dual-labeled fluorescent probes containing fore and quencher fluorophores are available in several forms. Used in this state. A pair of fluorophores with different emission spectra are used to combine them. It will be understood that they are selected in a way that makes them easily distinguishable.

[0096] In certain embodiments, the label enhances or stabilizes double-stranded hybridization. Hybridization stabilization parts that cause or affect this, for example, insertion Agents or insert dyes (such as ethidium bromide and SYBR-Green, but these (Not limited to) small groove binders and crosslinking functional groups (e.g., Blackburn) et al., eds. “DNA and RNA Structure” in N ucleic Acids in Chemistry and Biology(19 See 96).

[0097] In other embodiments, hybridization is used to quantify small non-coding RNAs. and / or ligation-based methods may be used, including oligonucleotides. Ligation (OLA) method and hybridization to target nucleic acid sequences, distinguishable One example is a method that allows a probe to be separated from an unbound probe. The HARP-like process disclosed in U.S. Patent Application Publication No. 2006 / 0078894 A probe can be used to measure the amount of miRNA. In such a method, the probe and a label After hybridization with the target nucleic acid, the hybridized probe is hybridized The probes are modified to distinguish them from unsoyed probes. It can be amplified and / or detected. Generally, the probe inactivation region is the probe Contains a subset of nucleotides within the target hybridization region. To reduce or prevent amplification or detection of non-bred HARP probes, In other words, in order to enable the detection of target nucleic acids, hybridize the target nucleic acid sequence. Distinguishing between HARP probes that have been hybridized and their corresponding non-hybridized HARP probes. Using a drug that can be used, the probe inactivation step after hybridization The procedure is performed. This drug prevents the amplification of non-hybridized HARP probes. Therefore, it can be inactivated or modified. Probe ligation reactions It can also be used to quantify small non-coding RNAs. Multiple ligation dependence. Probe amplification method (Schouten et al., Nucleic Acids Re In search 30:e57(2002), cells adjacent to each other on the target nucleic acid immediately... The hybridizing probe pairs are linked to each other, driven by the presence of the target nucleic acid. In some embodiments, the MLPA probe has adjacent PCR primer binding sites. MLPA probes are specifically amplified when coupled, thereby enabling small molecule noncoding. This enables the detection and quantification of RNA biomarkers.

[0098] Detection of low-molecular-weight RNA biomarker levels The small non-coding RNA biomarkers described herein are used to assess the condition of breast cancer. It can be used individually or in combination in diagnostic tests to evaluate the condition of breast cancer. The condition includes the presence or absence of breast cancer. The breast cancer condition includes monitoring the course of breast cancer. This may include monitoring, for example, the progression of the disease. Based on the condition, additional measures may be prescribed, for example, including additional diagnostic tests or therapeutic interventions. ru.

[0099] Generally, the ability of a diagnostic test to correctly predict the state of a disease depends on the accuracy of the assay, and the assay itself. Sensitivity, assay specificity, or "area under the curve" (AUC), e.g., receiver operating characteristics. (ROC) is measured in terms of area under the curve. When used herein, accuracy is measured in terms of error. This is a measure of the proportion of classified samples. Accuracy is measured, for example, by dividing by the total number of samples in the test population. It can be calculated as the total number of correctly classified samples. Sensitivity is the number of samples that are positive by the test. This is a measure of the predicted "true positivity," and is calculated by dividing the number of correctly identified breast cancers by the total number of breast cancer samples. This can be calculated as the number of samples. Specificity is the "true negative" that is predicted to be negative by the test. This is a measure of "normality," and is calculated as the number of correctly identified normal samples divided by the total number of normal samples. It can be calculated. AUC is a plot of sensitivity versus false positive rate (1-specificity) of receiver operating characteristics. This is a measure of the area under the curve. A larger AUC indicates a higher accuracy rate for the test. Another useful measure of sex is the "positive rate," which is the percentage of actual positives that are tested as positive. Examples include the "positive predictive value" and the "negative predictive value," which is the percentage of actual negative results that are tested as negative. In a preferred embodiment, one of the samples derived from subjects having different breast cancer conditions is selected. The levels of the above small non-coding RNA biomarkers are measured in comparison to a suitable control. In this case, compared to a normal subject, p=0.05 is at least p=0.05, for example, p=0.05, p=0 It shows statistically significant differences such as 0.01, p=0.005, and p=0.001. In the application method, the small non-coding RNA biomarkers described herein may be used individually or in combination. The diagnostic tests used in conjunction should have an accuracy of at least approximately 75%, for example, at least approximately 75%. %, approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 97%, approximately 99%, or approximately 100% This demonstrates the accuracy of the small non-coding RNA biomer described herein. In other embodiments, the small non-coding RNA biomer described herein Diagnostic tests using CAR individually or in combination have a specificity of at least approximately 75%, for example. For example, at least about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 9 It exhibits specificity of 9%, or about 100%. In other embodiments, the low molecular weight non- Diagnostic tests using coding RNA biomarkers individually or in combination are at least It also has a sensitivity of about 75%, for example, at least about 75%, about 80%, about 85%, about 90%, about 9 It exhibits sensitivity of 5%, approximately 97%, approximately 99%, or approximately 100%. In other embodiments, see this specification. The medical diagnosis involves using the small non-coding RNA biomarkers described in this book individually or in combination. The decompression tests each have a specificity and sensitivity of at least about 75%, for example, at least about 75%. %, approximately 80%, approximately 85%, approximately 90%, approximately 95%, approximately 97%, approximately 99%, or approximately 100% It demonstrates specificity and sensitivity (for example, at least about 80% specificity and at least about 8 0% sensitivity, or, for example, at least about 80% specificity and at least about 95% sensitivity Degrees).

[0100] Each biomarker listed in Tables 1, 2, and 3 is associated with the presence of breast cancer compared to a normal population. These substances are differentially present in biological samples derived from the subject, and each contributes to the determination of breast cancer in the subject. These methods are useful for simplifying the biomass in the sample derived from the subject. This involves measuring the level of the biomarker. It also involves determining the level of the biomarker in the sample. This involves using any suitable method, for example, the method described herein, to detect biomarkers in the sample. This may include measuring, detecting, or analyzing the level of biomarkers in a sample. Determining the Bell involves measuring, detecting, or testing the level of biomarkers in a sample. This may also include investigating the results of the assay. The above method involves the level of biomarkers in the sample. This may also involve comparing the product to an appropriate control. When evaluated using an appropriate control, the product may be Changes in omarker levels compared to those of a normal subject indicate the breast cancer status of the subject. This indicates the upper or lower limit of the biomarker levels that classify someone as not having a specific breast cancer condition. Diagnostic levels of biomarkers may be used. For example, in a sample from an individual with breast cancer... If the above biomarkers are elevated compared to a normal individual, a diagnostic cutoff is possible. Measurements exceeding 5 provide a diagnosis of breast cancer. Generally, individual small molecules noncoding in Tables 1-3 RNA biomarkers are superior in breast cancer samples compared to samples obtained from normal individuals. It is adjusted. As is well understood in the art, it is used in assays. Adjusting the specific diagnostic cutoff allows you to adjust the sensitivity of the diagnostic assay as desired. Allows adjustment of specificity. Specific diagnostic cutoffs, for example, Biomarkers in a statistically significant number of samples from subjects with different breast cancer conditions Measuring quantities and cutting them with the desired level of accuracy, sensitivity, and / or specificity. This can be determined by inducing an OFF state. In certain embodiments, the diagnostic cutoff is this As described in the specification, this can be determined with the assistance of a classification algorithm.

[0101] Therefore, at least one of the samples containing circulating small non-coding RNAs derived from the target To diagnose breast cancer in a subject by determining the level of small non-coding RNAs A method for detecting the normal level of at least one small non-coding RNA in a target subject. The difference (determined by comparison with an appropriate control) is a method of indicating the presence of breast cancer in the subject. This is provided. In one embodiment, at least one small non-coding RNA is preferably This includes one or more small non-coding RNAs from Table 1. In one embodiment, at least A single small non-coding RNA preferably contains one or more small non-coding RNs from Table 2. A is included. In one embodiment, at least one small non-coding RNA is preferably This includes one or more small non-coding RNAs from Table 3. For example, the present invention is based on the subject matter. At least one small non-coding RNA in a sample containing circulating small non-coding RNA A method for determining the level of NA, wherein the level of at least one small non-coding RNA An increase compared to a control provides a method for indicating the presence of breast cancer in a subject.

[0102] If desired, the method of the present invention may be used to level at least one small non-coding RNA in a sample. Based on this, it further includes providing a diagnosis of whether or not the subject has breast cancer. It may be seen. In addition, or otherwise, the method of the present invention is compared with at least one suitable control. The difference or level of one small non-coding RNA is associated with the diagnosis of breast cancer in the subject. This may further include providing a diagnosis directly to the subject. It may be provided to other parties involved in the care of the person concerned.

[0103] As shown herein, individual small non-coding RNA biomarkers are milk While useful for cancer diagnostic applications, combinations of small molecule non-coding RNA biomarkers are simple. When used in Germany, it showed higher efficacy in predicting breast cancer status than small molecule non-coding RNA biomarkers. It can provide a moderate rate. Specifically, the detection of multiple small non-coding RNA biomarkers is This can increase the accuracy, sensitivity, and / or specificity of diagnostic tests. Exemplary small molecule non-corticosteroids. Table 1 shows exemplary low RNA biomarkers and biomarker combinations. Table 2 shows molecular non-coding RNA biomarkers and combinations of biomarkers. Exemplary small non-coding RNA biomarkers and biomarker combinations are shown in the table. As shown in 3. The present invention includes individual biomarkers and biomarkers as listed in these tables. Omarker combinations, as well as those in the methods and kits described herein. Use is included.

[0104] Therefore, in a sample containing circulating small non-coding RNA derived from the target, two or more low molecules A method for diagnosing breast cancer in subjects by determining the level of non-coding RNAs. The law is one in which the level of small non-coding RNA differs from that of a normal subject (appropriate control). A method is provided to indicate the presence of breast cancer in a subject (determined by comparison). In this state, the small non-coding RNA is preferably one of the small non-coding RNAs shown in Table 1. It includes one or more of the following. In one embodiment, the small non-coding RNA is preferably as shown in Table 2. It contains one or more of the small non-coding RNAs shown. In one embodiment, it contains one or more small non-coding RNAs. The doRNA preferably includes one or more of the small non-coding RNAs shown in Table 3. .

[0105] Two or more small non-coding RNAs in a sample containing circulating small non-coding RNAs derived from the target organism Determine the level of NA, and the levels of two or more small non-coding RNAs in the sample are normal. The levels of the same small non-coding RNA present in both the normal population and the population with breast cancer The dataset shown is compared to the data, and the subjects are judged to have or have breast cancer based on the comparison. A method for diagnosing breast cancer in subjects who do not have the condition is also provided. The law requires that the dataset be a suitable control or reference standard for comparison with samples from the subject. It functions in this way.

[0106] Comparison with datasets from samples derived from the target species involves two or more small non-coding RNAs in the sample. The overall level and the same low molecular weight non-conjugate present in normal subjects or subjects with breast cancer A classification algorithm that calculates whether or not there is a statistically significant difference between the levels of gen RNA and other factors. It can be assisted by...

[0107] Generation of classification algorithms for evaluating cancer status In some embodiments, the data generated using a sample such as a “known sample” is as follows: Then, it can be used to "train" a classification model. "Known samples" are classified in advance. For example, a sample classified as originating from a normal subject or a subject with breast cancer. The data used to form the classification model, derived from the spectrum, is called "training data." It can be called a "taset." Once trained, the classification model generates using unknown samples. The classification model can recognize patterns in data derived from the spectrum. This can then be used to classify unknown samples into classes. For example, a specific raw material Body samples can be associated with certain biological states (e.g., symptomatic vs. non-symptomatic). It may be useful in predicting whether or not something will happen.

[0108] In some embodiments, the training dataset used to form a classification model is The data is obtained using quantitative PCR (e.g., Ct values ​​obtained using the double-delta Ct method). From, or high-throughput expression profiling such as microarray analysis (e.g.) Total counts or normalized counts from small molecule non-coding RNA expression assays ) can be obtained directly from.

[0109] Classification models classify a set of data into classes based on the target parameters present in the data. Formed using any appropriate statistical classification (or "learning") method that attempts to separate them To obtain. Classification can be either supervised or unsupervised. An example of a classification process is Jain, "Statistical Pattern Rec ognition:A Review”, IEEE Transactions on Pattern Analysis and Machine Intelligenc It is described in e, Vol.22, No.1, January 2000, and the instructions are It is incorporated by reference.

[0110] In supervised classification, training data containing examples of known classifications defines each of the known classes. It is posted to a learning mechanism that learns one or more sets of meaningful relationships. Then, new The data can be applied to a learning mechanism, and then the learning mechanism uses the learned relationships to create new data. Classify the data. An example of a supervised classification process is a linear regression process (e.g., multi-line Form regression (MLR), partial least squares (PLS) regression, and principal component regression (PCR), 2 minutes Decision trees (e.g., recursive partitioning processes such as CART—classification trees and regression trees), backpropagation networks Artificial neural networks such as those used in software, discriminant analysis (e.g., Bayesian classifiers or Firmware Classifiers) Scherr analysis, logistic classifiers, and support vector classifiers (support vectors) Tormaline is one example.

[0111] In other embodiments, the classification model created may be formed using an unsupervised learning method. Unsupervised classification does not pre-classify the spectrum from which the training dataset originates. We attempt to learn classification based on similarity in the training dataset. Unsupervised learning methods include This includes cluster analysis. Cluster analysis identifies clusters that are very similar to each other and other clusters. A "cluster" should ideally have members that are very different from the members of the same group. We attempt to divide the data into groups. Then, we measure several distances between data items. The separation metric is used to measure similarity, thereby identifying data items that are closer to each other. They will be clustered together. The clustering technique used is McKeen's K-means algorithm. And Kohonen's self-organizing map algorithm is an example of a method used for classifying biological information. The learning algorithm claimed for use in this context is, for example, International Patent Publication No. WO01 / 3. 1580(Barnhill et al., “Methods and devices s for identifying patterns in biological "systems and methods of use thereof"), United States Patent Application No. 2002 0193950 A1 (Gavin et al, "Met "Hod or analyzing mass spectra"), U.S. Patent Application No. No. 2003 0004402 A1 (Hitt et al., “Process f or discriminating between biological sta. tes based on hidden patterns from biolog "Cal data"), and U.S. Patent Application No. 2003 0055615 A1 (Zhang and Zhang, “Systems and methods fo r processing biological expression data” The contents of the aforementioned patent application are incorporated herein by reference in their entirety. Born.

[0112] The classification model can be formed and used on any suitable digital computer. Examples of digital computers include Unix® and Windows®. , or any standard operating system such as Linux® based or micro, small, or large computers using specialized operating systems The following can be cited.

[0113] The training dataset(s) and classification model are executed by a digital computer. or can be represented by the computer code used. The computer code is optical Any suitable computer readable disc or magnetic disk, stick, tape, etc. It can be stored on any available media, and can be any C, C++, Visual Basic, etc. It can be written in an appropriate computer programming language.

[0114] The above learning algorithm is for classification of small non-coding RNA biomarkers in breast cancer. It can be used to develop algorithms. Then, the classification algorithm can be used alone or Diagnostic values ​​(e.g., cutoff points) for biomarkers used in combination By providing it, it can be used in diagnostic testing.

[0115] Additional diagnostic tests The level of small non-coding RNA biomarkers indicating the presence of breast cancer in the subjects It can be used as an independent diagnostic indicator. If desired, the method of the present invention may be used for the diagnosis of breast cancer. This may include performing at least one additional test to facilitate the diagnosis of breast cancer. To do this, determine the level of one or more small non-coding RNA biomarkers. In addition, other trials may be conducted. These trials may be used in clinical practice to facilitate the diagnosis of breast cancer. Any other test or combination of tests used may be small molecule non-coding R as described herein. It can be used in conjunction with NA biomarkers.

[0116] Treatment method In some embodiments in which the subject is diagnosed with breast cancer by the method described herein, the present invention This further provides a method for treating such subjects who have been confirmed to have breast cancer. In one embodiment, the present invention is a method for treating breast cancer in a subject, and the subject Determine the level of at least one small non-coding RNA biomarker in the source sample. This involves determining at least one small molecule non-coding by comparing it with an appropriate control. The difference in RNA biomarker levels between normal subjects and breast cancer in subjects To indicate, determine, the presence of, and administer a therapeutically effective dose of breast cancer medication to the subject. Regarding methods including: In another embodiment, the present invention relates to a method for treating a subject having breast cancer. Therefore, in order to determine this by comparing it with an appropriate control, at least one of the samples derived from the subject is The levels of small non-coding RNA biomarkers differ from those in normal subjects. Identifying subjects who have (for example, an increasing) breast cancer, and providing therapeutic options to these subjects The present invention relates to a method including administering an effective dose of a breast cancer drug.

[0117] The term "breast cancer treatment drug" can refer to, for example, USFood and D for the treatment of breast cancer. Contains substances approved by the rug administration. Used to treat breast cancer. Approved drugs for this purpose include abemaciclib and abitrexate (methotrexate). (T), Abraxane (paclitaxel / albumin stabilized small particle formulation), Adtrusts Mab emtansine, Afinitor (everolimus), Anastrozole, Aredia ( Pamidronate disodium), Arimidex (anastrozole), Aromasin (exopropyl alcohol) Cemestan, capecitabine, clafen (cyclophosphamide), cyclophosphamide , cytoxane (cyclophosphamide), docetaxel, doxorubicin hydrochloride, elence (Epirubicin hydrochloride), Epirubicin hydrochloride, Eribulin mesylate, Everolimus, Exemestane, 5-FU (fluorouracil injection), Fareston (toremifene) Faslodex (fulvestrant), Femara (letrozole), Fluoroura Sil injection, FOLEX (methotrexate), Folex PFS (methotrexate) ), fulvestrant, gemcitabine hydrochloride, gemzar (gemcitabine hydrochloride), Gose Relin acetate, Halaven (eribulin mesylate), Herceptin (trastuzumab) Ibrance (parbociclib), Ixabepyrone, Ixempra (Ixabepyrone), Kadcyla (adtrastuzumab emtansine), Kiskari (ribociclib), Lapatin Ditosylate, Letrozole, Megestrol acetate, Methotrexate, Methotrex Cert LPF (methotrexate), Mexate (methotrexate), Mexat e-AQ (methotrexate), Neosar (cyclophosphamide), neratinib male Tamoxifen acid, Nerlynx (neratinib maleate), Nolvadex (tamoxifen) Paclitaxel (incitrate), paclitaxel, paclitaxel-albumin stabilized small particle formulation, Pal Bosiclib, Pamidronate disodium, Perjeta (Pertuzumab), Pertuzuma B, ribociclib, tamoxifen citrate, taxol (paclitaxel), taxo Tail (docetaxel), thiotepa, toremifene, trastuzumab, tykerb (rapa) Tinib tosylate dihydrate), Velban (vinblastine sulfate), Velsar ( Vinblastine sulfate, Verzenio (abemaciclib), vinblastine sulfate Examples include Xeloda (capecitabine) and Zoladex (goserelin acetate), but this It is not limited to them.

[0118] Breast cancer treatment drugs may be administered to subjects using pharmaceutical compositions. Suitable pharmaceutical compositions are pharmacy Contains a moderately effective amount of a breast cancer drug (or a pharmaceutically acceptable salt or ester thereof) (including optionally a pharmaceutically acceptable carrier). In certain embodiments, these compositions This may further include one or more additional therapeutic agents as desired.

[0119] As used herein, the term “pharmaceutically acceptable salt” means within the scope of appropriate medical judgment. Within the tissues of humans and lower animals, without excessive toxicity, irritation, or allergic reactions. It refers to a salt that is suitable for use in contact with and corresponds to a reasonable profit / risk ratio. pharmaceutically acceptable salts of carboxylic acids and other types of compounds are permitted in the art. This is well known. For example, SMBerge et al. have listed pharmaceutically acceptable salts as a reference. More incorporated herein, J. Pharmaceutical Sciences This is described in detail in 66:1-19 (1977). The salt is the most important compound of the present invention. During subsequent isolation and purification, free bases or free acid functional groups may be removed in situ or separately, as appropriate. It can be prepared by reacting with a reagent. For example, a free base functional group can be reacted with a suitable acid. It is possible. Furthermore, if the compound of the present invention has an acidic portion, its appropriate pharmaceutically acceptable properties Examples of salts include alkali metal salts (e.g., sodium or potassium salts) and alkalis. Examples include metal salts such as earth metal salts (e.g., calcium or magnesium salts).

[0120] As used herein, the term “pharmaceutically acceptable ester” means a hydrated ester in vivo. This refers to esters that decompose easily in the human body, leaving behind the parent compound or its salt. Suitable ester groups include, for example, pharmaceutically acceptable aliphatic carboxylic acids. The derived material, particularly the alkyl or alkenyl moiety, preferably has six or fewer carbon atoms. Alkanes, alkenes, cycloalkanoates, and alkanedionic acids (a Examples include chlorofluoromethylacetates.

[0121] As mentioned above, the pharmaceutical composition may additionally include a pharmaceutically acceptable carrier. The term includes any solvent, diluent, or other suitable for preparing a specific dosage form of a desired type. Liquid vehicles, dispersion or suspension aids, surfactants, isotonic agents, thickeners or emulsifiers, preservatives This includes agents, solid binders, lubricants, etc. (Remington's Pharmacy) utical Sciences,Sixteenth Edition,EWMa rtin(Mack Publishing Co., Easton, Pa., 1980 ) refers to various carriers used in the formulation of pharmaceutical compositions and known for their preparation. The technology is disclosed. Examples of materials that can function as pharmaceutically acceptable carriers include: These include sugars such as lactose, glucose, and sucrose; corn starch and Starches such as potato starch; sodium carboxymethylcellulose, ethylcellulose Cellulose and cellulose such as cellulose acetate and its derivatives; tragacanth powder; wheat Buds; gelatin; talc; excipients such as cocoa butter and suppository wax; peanut oil, cottonseed Oils such as safflower oil, sesame oil; olive oil; corn oil and soybean oil; gri Coals; propylene glycol, etc.; ethyl oleate and ethyl laurate, etc. Esters; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; algin Acids; water that does not contain pyrogens; isotonic saline solution; Ringer's solution; ethyl alcohol, and phosphorus Acid buffers are examples, but are not limited to these, and also include sodium lauryl sulfate and Other non-toxic, compatible lubricants such as magnesium stearate, as well as colorants, release agents The formula also contains exudants, coating agents, sweeteners, flavorings and fragrances, preservatives and antioxidants. It may be present in the composition at the discretion of the person making the decision.

[0122] The compositions used in the present invention are formulated to have a desired concentration of breast cancer treatment drug. It can be made into a composition. In a preferred embodiment, the composition contains a therapeutically effective amount of the breast cancer drug. It is formulated into a pharmaceutical product.

[0123] This disclosure generally relates to the diagnosis of subjects with benign, premalignant, or malignant hyperproliferative cells. A method for determining the presence of at least one non-coding RNA or a functional fragment thereof in the sample. The present invention relates to a method comprising the steps of detecting the absence and / or quantity of, The detection step involves taking a sample from the target (e.g., a human target) and processing it into one or more prostitutes. Exposure to a probe, where each probe detects one or more non-coding RNA molecules in the sample. It can bind to its offspring, including exposure. In some embodiments, the probe is At least 70%, 80%, and 85% of any nucleic acid sequence in Tables 1, 2, and / or 3. Sequence homology or sequence identity of %, 90%, 95%, 96%, 97%, 98%, and 99% It contains nucleic acid molecules (DNA, RNA, or hybrids thereof). Several embodiments So, the probes are sequence number: 3, sequence number 19, sequence number 32, sequence number 40, sequence number Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 83, Sequence ID 126, Sequence ID 148 , or at least 70%, 80%, 85%, 90%, 95% of SEQ ID NO: 191, Nucleic acid molecules (DNA) containing 96%, 97%, 98%, or 99% sequence homology or sequence identity. It is RNA or a hybrid thereof. In some embodiments, the probe is each Thymine is substituted with uracil in sequence numbers 3, 19, and 32. Number 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 83, Sequence ID 126, At least 70%, 80%, 85%, 9% of SEQ ID NO: 148 or SEQ ID NO: 191 R containing sequence homology or sequence identity of 0%, 95%, 96%, 97%, 98%, and 99%. These are nucleic acid molecules (DNA, RNA, or hybrids thereof) with an NA sequence. In this embodiment, multiple probes are array sequence numbers: 3, 19, 32, array sequence number Number 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 83, Sequence ID 126 , at least 70%, 80%, 85% of the values ​​for SEQ ID NO: 148 or SEQ ID NO: 191, Includes sequence homology or sequence identity of 90%, 95%, 96%, 97%, 98%, and 99%. It is one or a combination of nucleic acid sequences that are RNA complementary to the nucleic acid sequence. In this embodiment, the multiple probes are one or a set of nucleic acid sequences selected from the following: This combination includes: SEQ ID NO: 3, SEQ ID NO: 19, SEQ ID NO: 32, SEQ ID NO: 40, SEQ ID NO: 4 1, SEQ ID NO: 79, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 126, SEQ ID NO: 148, Or, Sequence ID No. 191. In some embodiments, multiple probes are selected from the following nuclei One or a combination of nucleic acid sequences complementary to the acid sequence: Sequence ID 3, Sequence ID 19, SEQ ID NO: 32, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 79, SEQ ID NO: 82, Array Number 83, Sequence ID 126, Sequence ID 148, or Sequence ID 191.

[0124] In any embodiment of the method of this disclosure, the subject is diagnosed with breast cancer or It could be a person of suspicion. The detection step is after the step of obtaining a sample from the subject. In any embodiment of the method disclosed herein.

[0125] In some embodiments, a probe or multiple probes are represented by SEQ ID NO: 3, SEQ ID NO: 1 9, Sequence ID 32, Sequence ID 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence Number At least 7 for code 83, sequence number 126, sequence number 148, or sequence number 191 0%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 10 Nucleic acid molecules (DNA, RNA, or their respective nucleotides) containing 0% sequence homology or sequence identity It is one or more antibodies or antibody fragments containing a CDR that binds to a hybrid. In that embodiment, each of the probes or a group of probes in the array is sequence number 3, Column number 19, SEQ ID NO: 32, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 79, SEQ ID NO: 82 In each of sequence numbers 83, 126, 148, or 191 The thymine is modified to be replaced with uracil, sequence numbers 3 and 19, sequence number Number 32, Sequence ID 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 83, At least 70% of the values ​​for SEQ ID NO: 126, SEQ ID NO: 148, or SEQ ID NO: 191, 8 Distribution of 0%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% Nucleic acid molecules (DNA, RNA, or hybrids thereof) containing sequence homology or sequence identity One or more antibodies or antibody fragments containing a CDR that binds to (d). Embodiment In some cases, the method of the present invention involves testing before exposing the sample to one or more probes. The method further includes isolating RNA from the sample. In some embodiments, the method of the present invention involves the sample By performing semi-quantitative or quantitative PCR or sequence analysis on the non-coding RNA contained within. To detect or quantify the amount of non-coding RNA, such as small molecule RNA (smRNA), in a sample. This includes the following: The probe contains a single-stranded nucleotide sequence containing non-coding RNA derived from the target. ELISA plate, plastic, glass slide, microphone so that the sample is exposed. It can be immobilized on a solid support such as a lower array, silica chip, or other surface. In the embodiment, the probe may have a length of about 5 to about 100 nucleotides, as shown in Tables 1 and 2. One of the sequences of 3 or / or the sequences listed in Tables 1, 2, and / or 3 The sequence includes any complementary sequence of RNA or DNA in the sequence. Embodiments of the method of the present disclosure In either case, at least one non-coding RNA or one of the non-coding RNAs in the sample. The presence, absence, and / or quantity of that homologous sequence that is at least 70% homologous to one of them. The detection step involves using chemiluminescent probes, fluorescent probes, and / or fluorescence microscopy. By using this method, the signal of a detectable probe can be associated with the presence of non-coding RNA. This includes calculating existence or quantity.

[0126] This disclosure generally relates to detecting the presence of T3p in a sample and the presence of T3p in a sample This disclosure relates to associating the presence of breast cancer with the presence of breast cancer. This disclosure also relates to Sequence ID No. 3, Sequence ID No. 19, Sequence ID 32, Sequence ID 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 8 3. Sequence ID 126, Sequence ID 148, or Sequence ID 191 or sequence identifier In these RNA molecules, one or more of the thymines in any of them are replaced with uracil. In contrast, at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, Consists of, or essentially includes, 99% or 100% sequence homology or sequence identity. This method detects the presence of nucleic acid molecules (DNA, RNA, or hybrids thereof) consisting of these molecules. This also relates to the following. In some embodiments, a probe or a group of probes on a solid support are SEQ ID NOs: 3, 19, 32, and 32, which are approximately 5 to 1000 nucleotides in length. Column number 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 83, Sequence ID 12 6. Including sequence complementarity to sequence number 148 or sequence number 191. Several embodiments So, the probe or multiple probes on the solid support are approximately 5 to 500 nucleotides long. Sequence IDs 3, 19, 32, 40, 41, and sequence number Sequence ID 79, Sequence ID 82, Sequence ID 83, Sequence ID 126, Sequence ID 148 or Sequence ID Includes sequence complementarity to 191. In some embodiments, a probe on a solid support or The multiple probes are approximately 5 to 100 nucleotides long, such as SEQ ID NO: 3, SEQ ID NO: 19. Sequence ID 32, Sequence ID 40, Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 8 3. Includes sequence complementarity to sequence number 126, sequence number 148, or sequence number 191. In some embodiments, the probe or multiple probes on a solid support are approximately 5 to approximately 50 The nucleotide lengths of SEQ ID NOs: 3, 19, 32, 40, and sequence number Sequence ID 41, Sequence ID 79, Sequence ID 82, Sequence ID 83, Sequence ID 126, Sequence ID 148 Or, including sequence complementarity to sequence number 191.

[0127] In some embodiments, any of the methods disclosed herein are shown in Tables 1, 2, and Non-corruptible materials such as those disclosed in and / or 3 or any combination thereof. A step that associates the presence or amount of doRNA with the likelihood of the subject having cancer, such as breast cancer. It also includes.

[0128] Kit for detecting small RNA biomarkers In another embodiment, the present invention is a kit for diagnosing the state of breast cancer in a subject, Table 1, Table 2, or Table 3 and any combination thereof (where the sequences are disclosed if desired) Low molecular weight non-container compounds (containing uracil instead of one, two or more, or all of the thymine compounds) A kit useful for determining the level of one or more of the following RNA biomarkers. Provided. In one embodiment, one or more small non-coding RNAs are provided as listed in Table 1. Selected from omarkers. In one embodiment, two or more small non-coding RNAs are shown in Table 2. Selected from the biomarkers listed below. In one embodiment, three or more small molecule non-corticosteroids are selected. The doRNA is selected from the biomarkers listed in Table 3. The kit is derived from the subject. In the sample, small non-coding RNAs or a group of small non-coding RNs that are useful in diagnosing breast cancer It may include materials and reagents suitable for selectively detecting the presence of A. For example, in one embodiment Therefore, the kit may contain reagents that specifically hybridize to small non-coding RNAs. Such reagents are suitable for detecting nucleic acid molecules in a form suitable for low-molecular-weight non-coding RNA, for example, p This can be a lobe or a primer. The kit detects one or more small non-coding RNAs. Reagents useful for performing assays to do so, for example, one or more low-molecular-weight reagents in a qPCR reaction. It may contain reagents that can be used to detect non-coding RNAs. Similarly, the kit may contain one This may include microarrays useful for detecting the above-mentioned small non-coding RNAs.

[0129] In further embodiments, the kit includes appropriate operating parameters in the form of a label or accompanying document. It may include instructions for use regarding the following. For example, the instructions for use may include how to collect the sample, the sample A method for determining the level of one or more small non-coding RNA biomarkers, or a trial The level of one or more small non-coding RNA biomarkers in the sample is related to the status of the breast cancer in the target patient. This may include information or instructions regarding how to connect them.

[0130] In another embodiment, the kit is an assay for detecting biomarkers in a test sample. Low molecular weight non-coding R is used as a reference standard, a suitable control, or for calibration. It may contain one or more containers holding samples of NA biomarkers.

[0131] Other embodiments are described in the following non-limiting embodiments: patents, published applications, Various publications, including technical and academic papers, are cited throughout this specification. Each of these cited publications is incorporated herein in its entirety by reference. [Examples]

[0132] Example 1. Method Examples 2-6 were carried out by methods including, but not limited to, the following:

[0133] tissue culture MDA-MB-231 and MDA-LM2 cells were incubated with 10% fetal bovine serum and L-glutamic acid. Min, sodium pyruvate, penicillin-streptomycin, and amphotericin The cells were cultured in Dulbecco's medium supplemented with [specific ingredient]. The cell lines were American Type and Obtained from Culture Collection (ATCC) and following the protocol. And I let it grow.

[0134] All cells were cultured in a humidified incubator at 37°C and 5% CO2. MDA-M B-231, MDA-LM2, CN34-par, CN34-Lm1a, MCF7, oyo The MDA-MB-453 cell line was treated with 4.5 g / L glucose, 10% FBS, and 4 mM L-glutamine, 1 mM sodium pyruvate, penicillin (100 units / mL), Supplementation with streptomycin (100 μg / mL) and amphotericin (1 μg / mL) They were grown in a DMEM-based medium with added HCC1395, ZR-75-1, and H CC38 cell line was treated with 10% FBS, 2 mM L-glutamine, and penicillin (100 units). ( / mL), streptomycin (100 μg / mL), and amphotericin (1 μg / The cells were grown in RPMI 1640-based medium supplemented with (mL) of SK-BR-3 cell line. This is combined with 10% FBS, penicillin (100 units / mL), and streptomycin (100 μg / mL). In McCoy's Modified 5a medium supplemented with (g / mL) and amphotericin (1 μg / mL) I propagated them. I obtained HMEC from Thermo Fisher Scientific. And, using commercially available HuMEC medium (Thermo Fisher Scientific), They bred them.

[0135] Extraction and sequencing of small RNA and exosomal RNA from extracellular vesicles Preparation of acclimatization medium for isolation and complete acclimatization medium, 7 × 10 5 Seeding cells The procedure was carried out by [method not specified]. After 24 hours, the cells were washed twice with PBS and 10 mL of exosomes were added. The culture medium from which the contaminants had been removed was added. After 48 hours, the culture medium was centrifuged at 200 × g for 15 minutes, and the supernatant was removed. It was collected by removing the exosomes. FBS was FBS (Thermo By using Fisher Scientific as a substitute, exosomes can be removed. A culture medium was prepared. HMEC medium from which exosomes had been removed was incubated at 4°C for 100,000 minutes. Prepared by centrifuging the culture medium components of bovine pituitary gland extract at ×g for 16 hours.

[0136] Extracellular vesicle RNA, Cell Culture Media Exosome Pu rification and RNA Isolation kit(Norgen Using Biotek, a single 5 mL of conditioned medium prepared as outlined above is used. Released. RNA from the conditioned medium was extracted using miRNeasy serum / plasma ki Isolation was performed from 400 μl of fully conditioned medium using t(Qiagen). Total intracellular low The molecular RNA sample is processed according to the manufacturer's protocol using Norgen Biotek's small molecule RNA was extracted using an RNA purification kit. The RNA sample was then processed according to the manufacturer's protocol. Using Bioo Scientific) NEXTflex Small RNA Prepared for high-throughput sequencing using Sequencing Kit v3 Next, the obtained library is sequenced and processed as recommended by the manufacturer. In summary, I used cutadapt(v1.4) to remove the adapter array. The initial and final degenerate sequences of each read were trimmed. Then, the inventors performed a bowt Using ie2 (v2.3.3), the obtained sequence was converted to the human genome (build hg38). ) and aligned. Next, the obtained BAM files were sorted and further analyzed. It was converted to BED for this purpose. Extracellular vesicle RNA was processed according to the manufacturer's instructions for use with Plasm. a / serum Exosome Purification and RNA iso Isolation was performed from serum samples using a lation kit (Norgen Biotek). .

[0137] Small RNA sequencing data from TCGA-BRCA and TCGA-BRCA pro Identification of oncRNA reads by JECT, Genomic Data Common Download from s(GDC) in BAM format (hg38), and place the sample in GDC A Annotation was done using PI. During BED format conversion, the Piranha package Ji 40 We used this method to identify the loci of the expressed small RNA. Using mergeBed, all samples were merged to identify the development of breast tissue and breast cancer. A comprehensive list of revealed small RNA gene loci was created.

[0138] By listing small RNA sequences obtained from breast cancer cell lines and HMECs, The inventors generated a count table for each small RNA gene locus. Then, the present invention The researchers normalized the tables obtained at library size and analyzed the total data from the three HMEC repeated trials. Only the gene loci in which no leads were observed in the body were retained. The inventors of the following two individuals Using established statistical tests, all cancer cell lines or each subtype individually (TNBC, (i) The inventors compared HER2+ and luminal: (i) The inventors used the DESeq R package (ii) Using the adjusted p-value, the inventors use Fisher's exact test. The presence and absence of each small RNA were then compared. In the former test, the inventors found that The adjusted p-value < 0.05 is either true or the latter test has a p-value across all comparisons. We selected loci with a value of <0.1.

[0139] 437 gene loci (listed in Figure 1A) met these criteria. For visualization The inventors normalize each column to its maximum value and perform k-means clustering (k=3). The inventors have found that the TCGA-BRCA database has subtypes with annotations. Among all samples (based on PAM50 classification) and all small RNA loci A similar count table is generated, and the resulting table is normalized to determine the count per million reads. A table of cpm values ​​was generated. 'Orphan' small RNAs, i.e., odors in normal cells. To identify the small RNA molecules that are almost nonexistent, the inventors first used normal testing In the sample, only the gene loci with 90th percentile expression of less than 0.5 cpm are retained. Of the 437 gene loci mentioned above, 268 passed this step. Next, The inventors performed Fisher's exact test to determine that all tumor samples and normal biopsies are the same. The presence of low-molecular-weight RNA was compared between normal samples and each of the breast cancer subtypes. A similar comparison was performed between them. The inventors then found that the adjusted p-value < 0.05 , retained the 201 loci that were significant in at least one of these tests. Small RNAs go through this final step, and therefore orphan non-coding RNAs They were classified as follows. The inventors have previously classified any of these small RNAs as miRNAs, s We confirmed that it was not annotated as noRNA or tRNA.

[0140] PDX model and low-molecular-weight RNA sequencing of normal epithelial samples All human samples used to generate PDX tumor and human non-tumor samples were previously It was stated 41 Q provides small molecule RNA profiling and data preprocessing. 2 Sol The procedure was performed using utions. The amount of oncRNA present in these samples was determined as described above. The determination was made by comparing oncRNA expression between low-metastatic and high-metastatic cells. To identify oncRNAs that were significantly upregulated in highly metastatic cells, the inventors of this invention... Using the DESeq2 R package, the parent cell lines (MDA231 and CN3) in Figure 1 were used. 4) and highly metastatic derivative strains selected in vivo from them (MDA-MB-231 bucking The inventors compared the expression of oncRNA between the two groups. In this analysis, the inventors found that T3p was the same The inventors also determined that the small RNA dataset previously generated in these cell lines was suitable. T3p was also confirmed. 7 In addition, the inventors have also demonstrated quantitative RT-PCR assays. The inventors have found that MDA-231 parent cells and their highly metastatic MDA - Extracting small RNAs from LM2 (microRNA Purification K Stem-loop qPCR was performed using the following primers (it, Norgen): R:5'-CCAGTGCAGGGTCCGAGGTA and F:5'-CCCAGGA CTCGGCTCACAC. T3p expression and clinical relevance in the TCGA-BRCA dataset The inventors used metadata associated with the TCGA-BRCA dataset to study tumor studies. We performed a survival rate analysis based on T3p expression in the sample. The inventors analyzed the T3p level Based on this, patients were stratified, and Kaplan-Meier curves were generated using all quartiles. The log-rank (Mantel-Cox) test was performed to calculate the associated p-value. The inventors stated that, Using clinical data similarly, T3p expression was compared between early-stage and late-stage tumors (one-sided). Mann Whitney U test). T3p regulation and gene expression profiling: The inventors have identified miR for the following sequences. CURY LNA inhibitor (Exiqon) used: T3p:CAGGACTCGGC TCACACATGC; TERC: TTGTCTAACCCTAACTGAGAAGG; Scrambled sequence: AGACGACAGCTGGATCACACG. Similarly, the present inventors used a T3p mimic (IDT): rC*rArGrGrArCrUrCrG r GrCrUrCrArCrArCrArUrG*rC (T3p mimic) and rA*rG rA rCrGrA rCrArG rCrUrG rGrArU rCrArC rA rC*rG (control). Then, we transfected LNAs into highly metastatic MDA-LM2 cells and the mimics into parental MDA-MB-231 cells, and performed gene expression pro filing as described above 7 . Differential gene expression analysis was also performed as described above 7 . Tough Decoy and in vivo lung colony formation and tumor growth assay y MDA-LM2 cells were transfected with anti-T3p or scrambled LNA (same as above), and 48 hours later, the cells were injected into the vascular system via the tail vein of immunodeficient NOD SCID gamma (NSG) mice (2.5 × 10 4 cells per mouse; n=5 per cohort) In vivo imaging and curve comparison were performed as described above 19 Then , lungs were excised from at least 3 mice per cohort (median signal), fixed, sectioned, stained (H&E), and quantified as described above 19 . To achieve stable inhibition of T3p, the present inventors used a lentiviral backbone under the RNA PolIII promoter (pLKO.1) T for this small RNA We designed uD. Next, we stably transduced MDA-LM2 cells into lungs. A colony formation assay was performed (same as above; 5 × 10 per mouse). 4 (Individual cells) HCC1395 cells were similarly transduced, resulting in 2 × 10⁶ mice. 5 Injected with individual cells The orthotopic tumor growth assay was performed by mixing 50 µl of Matrigel with 50 µl of PBS. Resuspended 2.5 × 10 5 Individual cells are used in female NOD / SCIDγ cells of the same age, 6-8 weeks old. The procedure was performed by injecting into the mammary glands of the Ussian using a 28-gauge needle. Calipus was used. The tumor diameter (L) and width (W) are measured every two days and calculated using the formula πLW² / 6. The tumor volume was determined by this method. Once the tumor was 800 mm 3 Once the volume is reached, the experiment The endpoint was reached. In vitro cell proliferation: cancer cell proliferation assay, 0 Day 5 x 10 4 Individual cells are seeded, and then they are triple-replicated on days 3 and 5. This is done by counting. The logarithm of the number of cells and the day are estimated using a linear model. Record the slope of the best approximation line between the numbers, and the growth rate (day -1 ) . Cell cycle analysis Therefore, the cells were grown in a 6cm plate to an 80% culture density, collected, and then 70% ester. The cells were fixed with tanol. Then, the cells were pelleted and treated with 50 ug / mL propidium iodide. (Thermo Fisher Scientific) and 1 mg / mL RNA Resuspend in enzyme A (Thermo Fisher Scientific), 37 The cells were incubated at °C for 1 hour. Then, BD Aria2 flow cytometry was performed for FACS analysis. Using a router, post-FACS analysis and cell cycle quantification were performed using 'fcsparse'. This was executed using the 'r' python package. FCSparser:https: / / github.com / eyurtsev / fcsparser / tree / mas ter / fcsparser

[0141] Co-expression analysis to discover T3p biosynthesis factors: To identify regulators of T3p biosynthesis. The present inventors have found known nuclease activity (GO:0004540 and GO:000 List the genes that have 4525) and further investigate their interaction with these nucleases. We added a publicly known RNA-binding protein. 42 Next, the inventors of the present invention, TCGA- Co-expression between T3p levels in the BRCA dataset and levels of genes on this list The analysis was performed. The inventors found that in highly metastatic MDA-LM2 cells, upregulated... Similarly, compared to normal biopsies in the TCGA-BRCA dataset, breast cancer samples showed We superimposed genes that have a high correlation with genes that have a strong association with them. Based on these criteria, The inventors identified seven candidates. Two of these have known double-strand binding activity. Therefore, the CR7 domain of TERC is constructed (i.e., it forms a double-stranded region), The inventors believe that these proteins (i.e., DROSHA and TARBP2) track We concluded that it was the best candidate for investigation. The inventors used siRNA for DR OSHA and TARBP2, as well as the proteins that interact with these proteins respectively. DGCR8 and DICER1, which are known to be knocked down (IDT), are the present invention. The researchers used the following target sequence:TARBP2:5'-ACCTGGGATTCTC TACGAAATTCAGT, DROSHA:5'-CCTTGATTGAGGTATA GTTCTTGTCT, DICER1:5'-TGGTGCTTAGTAAACTCTT GGTTCCA, and DGCR8:5'-CTGCAGGAGTAAGGACAGGA AGGTGC. After confirming siRNA gene introduction and knockdown, the inventors of the present invention proceeded to... As noted, sequencing of the small RNA molecules was performed.

[0142] Training and testing of an oncRNA-based classifier: Of 201 oncRNAs, 100 The individual was detected in at least one serum sample. The inventors of these 100 individuals Regarding TCGA-BRCA samples annotated with subtypes using oncRNA GBC was trained (using the scikit-learn module). Next, the inventors trained 35 healthy individuals. The summaries of serum samples from patients and 40 cancer patients were bootstrapped 100 times. Calculate the classifier's performance parameters, namely, mean AUROC, accuracy, and precision score. The inventors trained and tested serum data in contrast to TCGA-BRCA. By performing a specific procedure, we also performed an independent evaluation of oncRNA (5-fold cross-validation). The inventors performed the same analysis as above using the following miRNA: miR-1 0b-5p, miR-10b-3p, miR-148b-3p, miR-148b-5p , miR-155-3p, miR-155-5p, miR-34a-3p, miR-37 6a-3p, miR-652-3p, miR-133a-3p, miR-139-3p, miR-143-3p, miR-145-3p, miR-15a-3p, miR-18a -3p, miR-425-3p, miR-34a-5p, miR-376a-5p, mi R-652-5p, miR-133a-5p, miR-139-5p, miR-143- 5p, miR-145-5p, miR-15a-5p, miR-18a-5p, miR- 425-5p, miR-127-3p, miR-194-5p, miR-205-5p, miR-21-5p, miR-375, miR-376c-3p, miR-382-5p miR-409-3p, and miR-411-5p. All animal tests are conducted by U university of California San Francisco IA Completed in accordance with CUC guidelines. Statistical methods were used to assess the significance of the data. The statistical tests performed are described in the legend. In summary, unless otherwise specified, this invention The researchers performed pairwise comparisons using nonparametric statistical methods. Regarding the mouse experiments, The inventors used a two-way ANOVA with time as a covariate to analyze the growth rate. The inventors used a linear model. The analysis was performed using Python, R, and pri. It was executed in an SM environment.

[0143] Example 2. Systematic search for orphan small non-coding RNAs in breast cancer. A novel class that is expressed in breast cancer cells but undetectable in normal breast tissue. To search for cancer-specific small RNAs, multiple breast cancer subtypes and human breast epithelial cells were used. An unbiased approach based on low-molecular-weight RNA sequencing of cells was used. In particular, in breast cancer cells... Approximately 200 previously unknown small RNA molecules that are expressed heterologously have been discovered. These RNAs were annotated to highlight their cancer-specific biosynthesis. Borrowing terminology from bacterial genetics, it is called 'orphan' non-coding RNA (oncRNA). It is attached.

[0144] First, it is present only in cancer cells, and access to potential regulatory factors in these cells is limited. It was determined whether a set of small RNA molecules exists that could provide a suitable pool. oncRNA is detectable only in cancer cell lines and not in normal cells. It was speculated that this would be the case. To test this hypothesis, sequencing of 9 types of small RNAs was performed. Breast cancer cell lines (all representing major breast cancer subtypes) and human breast epithelial cells as reference. The test was performed on (HMEC). It was significantly detected in all breast cancer strains, but in HMEC samples... 437 unannotated small RNAs that were not detected were identified (Figure 1A).

[0145] To further narrow the search and strengthen these findings, similar analyses were performed on approximately 200 items. We provide small molecule RNA expression profiles for all normal tissue samples and 1200 breast cancer biopsies. Small molecules obtained from The Cancer Genome Atlas (TCGA) This was performed on RNA sequencing data. In this analysis, 268 cancer-specific low-risk factors were identified. Molecular RNAs were identified, and 201 of them were also present in the analysis of breast cancer strains. These two The highly significant overlap between the independent analyses is shown in Table 1 below for 201 high-confidence on The cRNA set was identified (Figure 1B and Figure 2A). [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9] [Table 1-10] [Table 1-11] [Table 1-12] [Table 1-13]

[0146] As a third piece of evidence, 10 patient-derived xenograft (PDX) models and 4 normal epithelial cells A dataset of small molecule RNA profiles from the sample (non-corresponding) was analyzed. (See Figure 1C) As such, these oncRNAs are hardly present in normal samples, but in the PDX model Therefore, it can be frequently detected. The expression of all 201 oncRNAs in all samples is totaled. This allows for a simple classification that perfectly distinguishes between normal profiles and PDX profiles. A rule can be derived (Figure 2B). In summary, these findings suggest that its expression is milk This establishes the existence of a large pool of oncRNAs strongly associated with cancer.

[0147] Example 3. Identification of T3p, an oncRNA associated with breast cancer progression. In addition to the aforementioned cell lines, we selected those with high metastatic potential in vivo in immunodeficient mice. These highly metastatic cell lines were also profiled (1, 15). When comparing the expression of oncRNA in these low-metastatic parental strains, high-metastatic cells showed One oncRNA with a significantly increased level was identified (Figure 3A). This 40 nucleus Otide's oncRNA is the 3' of the TERC gene, which encodes the RNA component of telomerase. It is generated from the terminal end (Figure 3B). Therefore, this previously unknown small molecule RN A was named T3p because it is the 3' RNA of TERC. Analysis of previously published datasets (7) showed that high T3p development in highly metastatic cells This was further confirmed (Figure 3C). This upregulation of T3p expression in metastatic cells is qPCR This was confirmed by (Figure 3C).

[0148] Next, it was investigated whether increased T3p expression contributed to the pathogenesis of the underlying disease. TCGA- Approximately 400 cells from BRCA (The Cancer Genome Atlas, breast cancer) Corresponding normal and breast cancer tumor tissue samples were analyzed, and T3p expression was found to be highly cancer-specific. It was found that there was a certain characteristic (Figure 3D). Next, TCG with approximately 1000 tumor samples The entire A-BRCA dataset was included. As shown in Figure 3E, as oncRNA Consistent with its identity, T3p was not detected in the vast majority of normal samples, It was detected at relatively high levels in tumor biopsies. More importantly, it was detected in highly metastatic cell lines. Consistent with high T3p expression in this case, there is a highly significant association between patient survival and T3p expression. Sex was observed (Figure 3F). Furthermore, as shown in Figure 3G, T3p expression was observed in TCGA-B Normal samples, Stage I, and Stage II or III in the RCA dataset It increases among samples. Detection of any level of T3p in tumor samples is not limited to breast cancer and other cancers. T in clinical breast cancer samples was strongly associated with both shorter overall survival rates (Figures 4A and 4B). Higher expression of 3p was also strongly correlated with advanced breast cancer (Figure 3E). Interestingly, Stratification of these cancer samples by MON receptor and HER2 status is possible at the T3p level. Strong association with the expression of strogen receptors, progesterone receptors, or HER2 receptors. This was not shown (Figure 4C). Consistent with this finding, breast cancer PD compared to normal epithelial tissue. Increased T3p expression was also observed in the X model (Figure 4D). In summary, these results... This establishes oncRNA T3p as a cancer-specific biomarker with a high prognostic value. do.

[0149] Example 4. T3p acts as a broad regulator of gene expression in breast cancer cells. The strong association between T3p expression and breast cancer progression from multiple independent datasets suggests that T3 p increases the likelihood of playing a direct and functional role in breast cancer progression. To elucidate the mechanism, we investigated whether the regulation of T3p expression levels led to the regulation of the result. Therefore, highly metastatic MDA-LM2 cells were subjected to antisense injection targeting T3p. By translocation using scrambled nucleic acid (LNA) or control scrambled LNA... Then, T3p was silenced. Next, gene expression profiling was performed, We measured the genome-wide regulatory effects of T3p silencing. Surprisingly, thousands T3p silencing affects the genes, and highly alters the gene expression distribution in cells. Unexpected changes were observed. This is due to the numerous established transcriptions of small non-coding RNAs and other molecules. The effect is equivalent to that of post-regulatory factors (7, 16). However, LNA targeting T3p This also affects TERC function, which in turn causes the observed changes in gene expression. Therefore, the full-length TERC transcript remains a potential confounding factor. Two independent methods were used to distinguish between sexes. First, the scrambled LNA was used. In addition, an antisense LNA was used for the full-length TERC and the 5' side of T3p. Figure 5 As shown, the gene expression changes caused by anti-T3p LNA are Whether a scrambled LNA or an anti-full-length TERC LNA is used as a reference. Regardless, the effect is similar. This observation suggests that inhibition of full-length TERC is due to T3p inhibition. Furthermore, these findings demonstrate that they do not cause the same dramatic regulatory changes. To further strengthen this, gain-of-function experiments were also conducted. Synthetic oligonucleotides were used as T3p mimics. Using creotide, MDA-MB-231 parental breast cancer cells were scrambled as a control. Translocation was performed using ligonucleotides, followed by gene expression profiling. Similar to the LNA experiment, significant changes were observed in the gene expression distribution of cells. In particular, these changes in gene expression were observed in LNA experiments using a loss-of-function gene. This was generally inversely correlated with anti-T3p LNA and T3p mimicry. This is consistent with the prediction that it should induce the opposite gene expression change. These observations establish T3p as a broad regulator of gene expression in breast cancer cells. do.

[0150] Example 5. T3p promotes breast cancer metastasis. Broad regulatory effects of T3p on gene expression, as well as its association with metastasis and breast cancer Considering the association with poor survival rates, next, this oncRNA is associated with metastasis in vivo. We investigated whether it could have an effect. To test this hypothesis, we used highly metastatic MDA-L M2 cells were transfused using anti-T3p LNA, and these cells were then subjected to immunodeficiency testing. A metastatic lung colony formation assay was performed by injecting the drug into the venous circulation of Uss. Then, using in vivo imaging, we investigated the time-dependent metastatic lung colonization of these cells. The effect of T3p inhibition on the following was measured. As shown in Figure 6B, anti-T3p LNA Cells that were transfused with this gene showed a significantly reduced ability to form lung colonies. Macroscopic histological examination was also performed on the lungs of mice injected with cells genetically modified with T3p-LNA. A significantly smaller number of visible metastatic nodules were identified in this area. As shown in Figure 6C, Visual metastatic nodules were counted in three mice from each cohort. Representative H&E-stained lung sections are also shown, along with the median count. These observations This reveals the previously unknown functional role of T3p, an ncRNA, in driving breast cancer metastasis. I strongly support the role.

[0151] Example 6. Specific oncRNAs are sorted into the exosome compartment. The exosome compartment contains low-molecular-weight non-coding RNAs and tRNA fragments. Previously reported as a biologically relevant destination for progeny RNA (28). Analysis of exosome small RNA-seq data from MDA-MB-231 cells (29 ) indicates that numerous annotated oncRNAs in this study are exogenous secreted from cancer cells. We revealed that it can be detected in osomes (Figure 7A). For comparison, these Only a small number of oncRNAs were detected in exosome samples from HUVEC cells. (30). For example, T3p was derived from MDA-MB-231 cells, not HUVEC cells. These were present in the collected exosomes (Figure 8A). These observations were made using exosome small molecules R. This prompted the following series of experiments aimed at profiling NA. In addition, small RNA molecules are secreted from exosomes from eight types of breast cancer cell lines and HMECs. It was isolated. Small RNA sequencing of this material was performed on 201 annotated oncRNs. Of A, approximately 2 / 3 were due to exosomal RNA from one or more of these breast cancer strains. It was detected in [another location], but not in HMEC, as revealed in Figure 7B. Interestingly, T3p was detected in 5 out of 8 cell lines.

[0152] To evaluate whether oncRNA is also present in the circulating RNA population, we used samples from breast cancer patients. We reanalyzed a collection of RNA-seq data generated from RNA isolated from serum. (31). The evaluation criteria included data collected from the serum of 11 healthy individuals. (32). As shown in Figure 7C, the majority of oncRNA is circulating RNA derived from breast cancer patients. It can be detected in the sample, but generally it was not present in healthy individuals. This observation suggests that the circulating o ncRNAs can be used for cancer fingerprinting via liquid biopsy. To increase the potential, a linear model was developed using cells collected from cell lines. We trained on the exosome oncRNA dataset (Figure 7B) and used it for circular The RNA profile classification was predicted (Figure 7C). The trained model predicted the health of 11 / 11 Common samples and samples from 31 / 40 cancer patients were successfully allocated (AUC: 0.96). (AUPRC: 0.99, and ACC: 0.82). For example, T3p alone is a common indicator of breast cancer patients. Significantly different expression levels were observed between the affected individuals and healthy volunteers (Figures 7C and 8B). ). Considering the success of this simple classifier, a more generalizable machine learning method is TCGA- Train a gradient boosting classifier with 201 oncRNAs from the BRCA dataset. This was investigated by training this model on TCGA data, and the cyclic lows in Figure 7C The study was conducted using a child RNA profile. This classifier was used for 11 / 11 healthy samples and 37 / 4 Patient samples with 0 classification were successfully classified (AUC: 0.976, AUPRC: 0.993, approximately (ACC: 0.948). Based on these results, the inventors of circulating oncRNA The detection is used as reliable information with high specificity regarding the presence of potential cancer. It is presumed that this is possible. A list of the 67 circulating oncRNAs identified is shown in Table 2 below. vinegar. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]

[0153] Finally, from the 201 identified oncRNAs, the following oncRNAs were found, as shown in Table 3: The method with the strongest performance in predicting the presence of breast cancer in a subject through the analysis of serum samples. It was found that this was the case. [Table 3-1] [Table 3-2]

[0154] Current hypotheses regarding breast cancer development and progression suggest that abnormalities lead to an increased selection of oncogenic phenotypes. It emphasizes the malignant transformation of intracellular mechanisms. As a result, the development of cancer treatments and diagnostic agents is These pathways are targeted to reduce the ability of these cancer cells to survive, divide, or spread. The objective is to target the following. In the embodiments of the present invention, cancer cells utilize cancer-specific regulatory pathways. It was proposed that it can evolve in a way that creates. Eight types of breast cancer data combined with clinical breast cancer data. Through a systematic and unbiased discovery step targeting cancer cell lines and HUMECs, 201 cells that are expressed in breast cancer cells but are almost undetectable in normal tissue. A group of RNA species was identified. These were collectively named orphan non-coding RNAs. These RNA molecules can be used by cancer cells to create novel regulatory circuits. It provides a pool of potential regulatory factors. oncRNA plays a role in breast cancer progression. To determine if this was possible, low-metastatic and high-metastatic cells were compared. These cells were named T3p. One of these RNAs was found in both cell line models and clinical datasets. It was found to be strongly associated with metastatic progression in one of these cases. Finally, the implementation described herein For example, oncRNA can be detected in the circulating and exosome compartments. This indicates that.

[0155] These findings reveal how cancer progression and tumors evolve and regulate their path to metastasis and spread. This provides a new paradigm for whether the routes can be rewired. Furthermore, these The results also propose novel methods for breast cancer detection and monitoring that can complement existing methods. Current breast cancer screening methods, including mammography and ultrasound, are low-resolution. This results in limited detection signals, and considering the reliance on the user's interpretation, There is a bias. Other strategies in the development of early cancer detection include circulating tumors from the patient's serum. A "liquid biopsy" attempts to detect biological markers of cancer, including tumor cells and DNA. The focus has been on the high abundance of secreted exosomes in the patient's serum and on The cancer cell specificity of cRNAs is a more reliable method for early detection or screening. This could provide a significant enhancement to our repertoire. In other words, the research described herein Ultimately, oncRNA acts as a digital fingerprint of a potential tumor—that is This supports the idea that each marker may or may not be detected.

[0156] The examples described herein have focused primarily on the role of T3p in breast cancer metastasis. The methods and concepts presented herein are generalizable and applicable to several cancers. This can be applied to the following. In summary, these findings are relevant to further investigation of cancer-specific RNA distribution. Research into oncRNAs is providing alternative treatment and diagnostic methods for numerous cancer types. It opens up the possibilities that can be brought about. References 1.SFTavazoie et al., Endogenous human m icroRNAs that suppress breast cancer met astasis.Nature.451,147-U3(2008). 2. C.J. David, M. Chen, M. Assanah, P. Canoll, J. L.Manley,HnRNP proteins controlled by c- Myc deregulate pyruvate kinase mRNA spli cing in cancer.Nature.463,364-368(2010). 3. S. Vanharanta et al., Loss of the multif unctional RNA-binding protein RBM47 as a source of selectable metastatic traits in breast cancer.eLife.3(2014),doi:10.75 54 / eLife.02734. 4. L. Fish et al., Muscleblind-like 1 suppr esses breast cancer metastatic colonizat ion and stabilizes metastasis suppressor transcripts.Genes Dev.30,386-398(2016). 5.L.-Y.Chen,J.Lingner,AUF1 / HnRNP D RNA b inding protein functions in telomere mai ntenance.Mol.Cell.47,1-2(2012). 6.H.Goodarzi et al.,Modulated expression of specific tRNAs drives gene expressio n and cancer progression.Cell.165,1416-1 427(2016). 7.H.Goodarzi et al.,Endogenous tRNA-Deri ved Fragments Suppress Breast Cancer Pro gression via YBX1 Displacement.Cell.161, 790-802(2015). 8.D.K.Simanshu,D.V.Nissley,F.McCormick,R AS Proteins and Their Regulators in Huma n Disease.Cell.170,17-33(2017). 9.R.Ren,Mechanisms of BCR-ABL in the pat hogenesis of chronic myelogenous leukaem ia.Nat.Rev.Cancer.5,172-183(2005). 10.R.-K.Lin,Y.-C.Wang,Dysregulated trans criptional and post-translational contro l of DNA methyltransferases in cancer.Ce ll Biosci.4,46(2014). 11.A.A.Alizadeh et al.,Toward understand ing and exploiting tumor heterogeneity.N at.Med.21,846-853(2015). 12.A.Nguyen,M.Yoshida,H.Goodarzi,S.F.Tav azoie,Highly variable cancer subpopulati ons that exhibit enhanced transcriptome variability and metastatic fitness.Nat.C ommun.7,11246(2016). 13.R.J.Taft,K.C.Pang,T.R.Mercer,M.Dinger ,J.S.Mattick,Non-coding RNAs:Regulators of disease.J.Pathol.220(2010),pp.126-139 . 14.M.Esteller,Non-coding RNAs in human d isease.Nat.Rev.Genet.12,861-874(2011). 15.A.J.Minn et al.,Distinct organ-specif ic metastatic potential of individual br east cancer cells and primary tumors.J.C lin.Invest.115,44-55(2005). 16.J.M.Loo et al.,Extracellular Metaboli c Energetics Can Promote Cancer Progress ion.Cell.160,393-406(2015). 17.D.N.Cooper,L.P.Berg,V.V Kakkar,J.Reis s,Ectopic(illegitimate)transcription:new possibilities for the analysis and diag nosis of human genetic disease.Ann.Med.2 6,9-14(1994). 18.A.A.Margolin et al.,ARACNE:An Algorit hm for the Reconstruction of Gene Regula tory Networks in a Mammalian Cellular Co ntext.BMC Bioinformatics.7,S7(2006). 19.H.Goodarzi et al.,Metastasis-suppress or transcript destabilization through TA RBP2 binding of mRNA hairpins.Nature(201 4),doi:10.1038 / nature13466. 20.B.Kim,K.Jeong,V.N.Kim,Genome-wide Map ping of DROSHA Cleavage Sites on Primary MicroRNAs and Noncanonical Substrates.M ol.Cell.66,258-269.e5(2017). 21.D.Ray et al.,A compendium of RNA-bind ing motifs for decoding gene regulation. Nature.499,172-177(2013). 22.Y.-C.T.Yang et al.,CLIPdb:a CLIP-seq database for protein-RNA interactions.BM C Genomics.16,51(2015). 23.E.L.Van Nostrand et al.,Robust transc riptome-wide discovery of RNA-binding pr otein binding sites with enhanced CLIP(e CLIP).Nat.Methods.13,508-514(2016). 24.H.Goodarzi et al.,Systematic discover y of structural elements governing stabi lity of mammalian messenger RNAs.Nature. 485,264-268(2012). 25.S.Memczak et al.,Circular RNAs are a large class of animal RNAs with regulato ry potency.Nature.495,333-8(2013). 26.P.Sumazin et al.,An extensive microRN A-mediated network of RNA-RNA interactio ns regulates established oncogenic pathw ays in glioblastoma.Cell.147,370-381(201 1). 27.A.Helwak,G.Kudla,T.Dudnakova,D.Toller vey,Mapping the human small non-coding R NA interactome by CLASH reveals frequent noncanonical binding.Cell.153,654-65(20 13). 28.T.Fiskaa et al.,Distinct Small RNA Si gnatures in Extracellular Vesicles Deriv ed from Breast Cancer Cell Lines.PLoS ON E.11(2016),doi:10.1371 / journal.pone.0161 824. 29.W.Zhou et al.,Cancer-secreted miR-105 destroys vascular endothelial barriers to promote metastasis.Cancer Cell.25,501 -515(2014). 30.S.K.Chakrabortty,A.Prakash,G.Nechoosh tan,S.Hearn,T.R.Gingeras,Extracellular v esicle-mediated transfer of processed an d functional RNY5 RNA.RNA N.Y.N.21,1966- 1979(2015). 31.X.Wu et al.,De novo sequencing of cir culating small non-coding RNAs identifie s novel markers predicting clinical outc ome of locally advanced breast cancer.J. Transl.Med.10,42-42(2012). 32.M.D.Giraldez et al.,Accuracy,Reproduc ibility And Bias Of Next Generation Sequ encing For Quantitative Small RNA Profil ing:A Multiple Protocol Study Across Mul tiple Laboratories.bioRxiv,113050(2017). 33.O.Elemento,N.Slonim,S.Tavazoie,A univ ersal framework for regulatory element d iscovery across all Genomes and data typ es.Mol.Cell.28,337-350(2007).

Claims

1. A method for sequencing non-coding ribonucleic acid (RNA) molecules from a cell-free sample obtained from a human female subject, wherein the cell-free sample comprises a first set of non-coding RNA molecules. (a) The step of subjecting the first set of non-coding RNA molecules to reverse transcription to produce one or more complementary deoxyribonucleic acid (cDNA) molecules; (b) the step of sequencing one or more cDNA molecules or derivatives thereof; and (c) A step of determining, based on the sequencing of step (b), whether the first set of non-coding RNA molecules includes one or more non-coding RNA molecules of the second set of non-coding RNA molecules, wherein the second set of non-coding RNA molecules is present in the breast tumor sample and the second set of non-coding RNA molecules has a 90th percentile expression of less than 0.5 cpm (counts per million) reads in a normal sample. Methods that include...

2. The method according to claim 1, wherein the non-coding RNA molecule has a nucleotide length of less than 200.

3. The method according to claim 1, wherein the non-coding RNA molecule has a nucleotide length of 50 to 100.

4. The method according to claim 1, further comprising the step of amplifying one or more cDNA molecules after step (a).

5. The method according to claim 1, further comprising the step of isolating the first set of non-coding RNA molecules from the other components of the cell-free sample prior to step (a).

6. The method according to claim 5, wherein the isolation includes filtration.

7. The method according to claim 1, further comprising the step of determining the amount of non-coding sequences of the first set of non-coding RNA molecules in the cell-free sample using the results of the sequencing.

8. The method according to claim 1, wherein the cell-free sample contains serum.

9. The method according to claim 1, wherein the cell-free sample includes plasma.

10. The method according to claim 1, wherein the cell-free sample includes urine.

11. The method according to claim 1, wherein the cell-free sample includes lymph fluid.

12. The method according to claim 1, wherein the cell-free sample includes saliva.

13. The method according to claim 1, wherein the total volume of the cell-free sample is between 20 microliters and 2 milliliters.

14. The method according to claim 1, wherein the total volume of the cell-free sample is between 100 microliters and 500 microliters.

15. The method according to claim 1, wherein the cell-free sample contains plasma and the total volume of the cell-free sample is between 100 microliters and 1 milliliter.

16. The method according to claim 1, wherein the sequencing in step (b) generates sequencing reads, and the sequencing reads are processed to identify non-coding sequences of the non-coding RNA molecules of a first set of the non-coding RNA molecules.

17. The method according to claim 1, wherein the sequence determination in step (b) includes Sequencing-By-Synthesis.

18. The method according to claim 1, wherein the normal sample is derived from a subject that does not have breast cancer.

19. The method according to claim 4, wherein the amplification step includes performing a polymerase chain reaction (PCR).

20. The method according to claim 4, wherein the amplification step includes rolling circle amplification.

Citation Information

Patent Citations

  • Novel oligonucleotide compositions and probe sequences useful for detection and analysis of non coding RNAs associated with cancer

    US20080076674A1