siRNA having a vinyl phosphonate at the 5' end of the antisense chain

Abstract

To provide means for improving the in vivo stability and activity of oligonucleotides, especially double-stranded siRNA.SOLUTION: The present invention relates to nucleic acids for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein the first strand is at least partially complementary to at least a portion of RNA transcribed from the target gene to be inhibited. The first strand of the nucleic acid has a terminal 5'(E)-vinylphosphonate nucleotide that is linked to the second nucleotide in the first strand by a phosphodiester linkage.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] Field of the present invention This invention relates to an siRNA having a vinyl phosphonate at the 5' end of the antisense chain. The invention further relates to therapeutic uses of such siRNA for the treatment of diseases, disorders, and syndromes. [Background technology]

[0002] background Double-stranded RNAs (dsRNAs), which can bind complementaryally to expressed mRNA, have been shown to inhibit gene expression through a mechanism called RNA interference (RNAi) (Fire et al., 1998, and Elbashir et al., 2001). Short dsRNAs direct gene-specific post-transcriptional silencing in many organisms, including vertebrates, and have become a useful tool for studying gene function. RNAi is mediated by the RNA-induced silencing complex (RISC), a sequence-specific multicomponent nuclease that disrupts messenger RNA homologous to a silencing trigger loaded onto the RISC. Interfering RNAs (iRNAs), such as siRNA, antisense RNA, and microRNAs, are oligonucleotides that prevent protein formation through gene silencing, that is, they inhibit gene translation of proteins by degrading mRNA molecules. Gene silencing agents are becoming increasingly important for therapeutic applications in medicine.

[0003] However, maintaining the stability and activity of nucleic acids such as RNA in vivo is known to be difficult for those skilled in the art, particularly in the development of nucleic acid molecules for therapeutic applications, due to cellular metabolic enzymes that degrade nucleic acids and limit their activity.

[0004] siRNA-mediated gene silencing requires siRNA loading onto the RNA-induced silencing complex (RISC). The 5'-phosphate on siRNA is known to be crucial for efficient RISC loading. Enzymes such as phosphatases remove the 5'-phosphate from siRNA, resulting in dephosphorylated siRNA that is not efficiently incorporated into RISC and therefore has reduced silencing activity.

[0005] Therefore, means of improving the stability and activity of oligonucleotides, particularly double-stranded siRNAs, in vivo are becoming increasingly important. Unexpectedly, in this invention, it was found that the nucleic acids according to the present invention exhibited increased activity. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] U.S. Patent No. 5,885,968 [Patent Document 2] International Publication No. 2017 / 174657 [Non-patent literature]

[0007] [Non-Patent Document 1] Hoevelmann et al., Chem. Sci., 2016, Vol. 7, pp. 128-135. [Non-Patent Document 2] Prakash, Nucleic Acids Res., 2015, 43(6), pp. 2993-3011. [Non-Patent Document 3] Haraszti, Nucleic Acids Res., 2017, 45(13), pp. 7581-7592. [Non-Patent Document 4] Nair et al., J. Am. Chem. Soc., 2014, 136(49), pp. 16958-16961 [Overview of the project]

[0008] Summary of the present invention The present invention relates to a nucleic acid for inhibiting the expression of a target gene in a cell, comprising at least one duplex region including at least a portion of a first strand and at least a portion of a second strand at least partially complementary to the first strand, wherein the first strand is at least partially complementary to at least a portion of the RNA transcribed from the target gene to be inhibited, and the first strand has a terminal 5'(E)-vinylphosphonate nucleotide. The present invention provides a nucleic acid characterized in that the terminal 5'(E)-vinylphosphonate nucleotide is linked to the second nucleotide in the first chain by a phosphodiester bond.

[0009] In the nucleic acid of the present invention, the first chain may contain more than one phosphodiester bond.

[0010] In the nucleic acid of the present invention, the first chain may include phosphodiester bonds between at least three terminal 5' nucleotides.

[0011] In the nucleic acid of the present invention, the first chain may include phosphodiester bonds between at least four terminal 5' nucleotides.

[0012] In the nucleic acid of the present invention, the first chain may contain at least one phosphorothioate (ps) bond.

[0013] In the nucleic acid of the present invention, the first chain may further include a phosphorothioate bond between two terminal 3' nucleotides or a phosphorothioate bond between three terminal 3' nucleotides. The bonds between other nucleotides in the first chain may be phosphodiester bonds.

[0014] In the nucleic acid of the present invention, the first chain may contain more than one phosphorothioate bond.

[0015] In the nucleic acid of the present invention, the second chain may include a phosphorothioate bond between two terminal 3' nucleotides or a phosphorothioate bond between three terminal 3' nucleotides.

[0016] In the nucleic acid of the present invention, the second chain may include a phosphorothioate bond between two terminal 5' nucleotides or a phosphorothioate bond between three terminal 5' nucleotides.

[0017] In the nucleic acid of the present invention, the terminal 5'(E)-vinylphosphonate nucleotide may be an RNA nucleotide.

[0018] Preferably, the terminal 5'(E)-vinylphosphonate nucleotide is an RNA nucleotide, more preferably (vp)-U.

[0019] In the nucleic acid of the present invention, the first strand of the nucleic acid may have a length in the range of 15 to 30 nucleotides. Preferably, the first strand of the nucleic acid has a length in the range of 19 to 25 nucleotides.

[0020] In the nucleic acid of the present invention, the second strand of the nucleic acid may have a length in the range of 15 to 30 nucleotides. Preferably, the second strand of the nucleic acid has a length in the range of 19 to 25 nucleotides.

[0021] The nucleic acids of the present invention may have blunt ends at both ends.

[0022] The present invention further provides a conjugate for inhibiting the expression of a target gene in a cell, comprising a nucleic acid portion and a ligand portion, wherein the nucleic acid portion comprises a nucleic acid as defined in any of the foregoing.

[0023] In the conjugate of the present invention, the second chain of nucleic acid can be conjugated to the ligand portion.

[0024] In the conjugate of the present invention, the ligand portion may include one or more GalNAc ligands and derivatives thereof, for example, each containing a GalNAc moiety at the 5' end of the second strand of a nucleic acid.

[0025] In the conjugate of the present invention, the ligand portion may include a linker portion and a targeting ligand, wherein the linker portion links the targeting ligand to the nucleic acid portion.

[0026] The present invention further provides a conjugate for inhibiting the expression of the TMPRSS6 gene in cells.

[0027] The present invention further provides compositions comprising nucleic acids as defined herein and physiologically acceptable additives.

[0028] The present invention further provides compositions comprising a conjugate as defined herein and a physiologically acceptable additive.

[0029] The present invention further provides nucleic acids as defined herein for use in the treatment of diseases or disorders.

[0030] The present invention further provides conjugates as defined herein for use in the treatment of diseases or disorders.

[0031] The present invention further provides compositions as defined herein for use in the treatment of diseases or disorders. Brief explanation of the drawing [Brief explanation of the drawing]

[0032] [Figure 1] A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide-nucleotide bond at the 5' end of the first strand results in improved reduction of TTR target mRNA levels in vitro. [Figure 2]A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide-nucleotide bond at the 5' end of the first strand results in improved reduction of TMPRSS6 target mRNA levels in vitro. [Figure 3] A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in a reduction of ALDH2 target mRNA levels in vitro. [Figure 4] A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in improved reduction of ALDH2 target mRNA levels in vitro. [Figure 5] The GalNAc siRNA conjugate, having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain, is stable in acidic tritosome lysates. [Figure 6] The GalNAc siRNA conjugate, having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain, is stable in acidic tritosome lysates. [Figure 7] The GalNAc siRNA conjugate, having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain, is stable in acidic tritosome lysates. [Figure 8] The GalNAc siRNA conjugate, having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain, is stable in acidic tritosome lysates. [Figure 9]A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide-nucleotide bond at the 5' end of the first strand results in improved reduction of TMPRSS6 target mRNA levels in vivo. [Figure 10] A GalNAc siRNA conjugate with a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in improved reduction of TMPRSS6 target mRNA levels in vivo over 6 weeks. [Figure 11] A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in a reduction of ALDH2 target mRNA levels in vitro. [Figure 12] This diagram shows the oligonucleotide synthesis of an oligonucleotide precursor in which GalNAc is conjugated at 3' and 5'. [Figure 13a] This is a diagram of the structure of a GalNAc ligand, referred to herein as GN, conjugated with an oligonucleotide. [Figure 13b] This is a diagram of the structure of a GalNAc ligand, referred to herein as GN2, conjugated with an oligonucleotide. [Figure 13c] This is a diagram of the structure of a GalNAc ligand, referred to herein as GN3, conjugated with an oligonucleotide. [Figure 14]This figure shows the inhibition of TMPRSS6 gene expression in primary (UT) mouse hepatocytes 24 hours after treatment at the indicated concentrations, or in the untreated state, with TMPRSS6-siRNA (X0204) possessing vinyl-(E)-phosphonate 2'-OMe-uracil at the 5' position of the antisense strand and two phosphorothioate bonds between the first three nucleotides, TMPRSS6-siRNA possessing vinyl-(E)-phosphonate 2'-OMe-uracil at the 5' position of the antisense strand and phosphodiester bonds between the first three nucleotides (X0205), (X0139), or a tetramer (X0140) or a dendritic trimer GalNAc cluster (X0004), or non-targeting GalNAc-siRNA (X028). [Figure 15] This figure shows the serum stability of siRNA-conjugates versus less stabilized positive controls against nuclease degradation. [Figure 16] This figure shows the synthesis of A0268, a single-chain oligonucleotide conjugated with 3'-mono-GalNAc, and the starting material for the second chain in the synthesis of an exemplary conjugate of the present invention. [Figure 17] This figure shows the synthesis of A0006, a single-chain oligonucleotide conjugated with a 5' tri-antennary GalNAc, and which serves as the starting material for the second chain in the synthesis of an exemplary conjugate of the present invention. [Modes for carrying out the invention]

[0033] Detailed description of the present invention This invention relates to double-stranded nucleic acids and compositions thereof that are induced to RNA transcripts expressing target genes. These nucleic acids can be used in the treatment of various diseases and disorders in which reduction of the expression of target gene products is desirable.

[0034] A first aspect of the present invention relates to a nucleic acid for inhibiting the expression of a target gene in a cell, comprising at least one double-stranded region including at least a portion of a first strand and at least a portion of a second strand at least partially complementary to the first strand, wherein the first strand is at least partially complementary to at least a portion of the RNA transcribed from the target gene to be inhibited, and the first strand has a terminal 5'(E)-vinylphosphonate nucleotide, the terminal 5'(E)-vinylphosphonate nucleotide being linked to the second nucleotide in the first strand by a phosphodiester bond.

[0035] Vinylphosphonate Terminal 5'-(E)-vinylphosphonate nucleotides are nucleotides in which the native phosphate group at the 5' end is replaced with (E)-vinylphosphonate. 5'-(E)-vinylphosphonate is the phosphate at the 5' end of a nucleotide chain, where the crosslinkable 5'-oxygen atom is replaced with a methynyl (-CH=) group. [ka]

[0036] 5'-(E)-vinylphosphonate is a 5'-phosphate mimic. A biomimetic is a molecule that is capable of performing the same function as the original molecule it mimics and is structurally very similar to the original molecule it mimics. In the context of this invention, 5'-(E)-vinylphosphonate mimics the function of a normal 5'-phosphate, for example, enabling efficient RISC loading. Furthermore, due to its slightly modified structure, 5'-(E)-vinylphosphonate can stabilize its 5'-terminal nucleotide by protecting it from dephosphorylation by enzymes such as phosphatases.

[0037] To our surprise, we found that siRNA having a terminal 5'-(E)-vinylphosphonate nucleotide linked to the second nucleotide in the first strand by a phosphodiester bond exhibits better gene silencing activity, specifically, it reduces target mRNA expression compared to siRNA having a terminal 5'-(E)-vinylphosphonate nucleotide linked to the second nucleotide in the first strand by a phosphorothioate bond. The activity was also compared to siRNA that does not contain a terminal 5'-(E)-vinylphosphonate nucleotide at the 5' end of the first strand and does not contain a phosphorothioate bond (i.e., it contains a phosphodiester bond at the 5' end), and siRNA that does not contain a terminal 5'-(E)-vinylphosphonate nucleotide at the 5' end of the first strand but does contain a phosphorothioate bond (see Figures 1-4, 9-11, and 14).

[0038] nucleic acid A nucleic acid is a nucleic acid that contains two strands of nucleotides and is capable of interfering with gene expression. Inhibition may be complete or partial and results in targeted downregulation of gene expression. A nucleic acid contains two separate polynucleotide strands, namely a first strand which may be a guide strand or antisense strand, and a second strand which may be a passenger strand or sense strand. The first and second strands may be part of the same self-complementary polynucleotide molecule that "folds" to form a double-stranded molecule. A nucleic acid may be an siRNA molecule.

[0039] Nucleic acids may include ribonucleotides, modified ribonucleotides, deoxynucleotides, deoxyribonucleotides, or nucleotide analogs. Nucleic acids may further include a double-stranded nucleic acid region or double-stranded region formed by all or part of a first strand (also known in the art as a guide strand or antisense strand) and all or part of a second strand (also known in the art as a passenger strand or sense strand). A double-stranded region is defined as including both ends, beginning with the first base pair formed between the first and second strands and ending with the last base pair formed between the first and second strands.

[0040] In the present invention, the 5'-(E)-vinylphosphonate nucleotide may be a 5'-(E)-vinylphosphonate RNA nucleotide.

[0041] Double chain A double-stranded region refers to a region in two complementary or substantially complementary oligonucleotides that forms base pairs with each other by Watson-Crick base pairing, or by any other means that enables the formation of a double helix between complementary or substantially complementary oligonucleotide chains. Furthermore, 100% complementarity is not required within a double-stranded region; substantial complementarity is acceptable. Substantial complementarity refers to the complementarity between chains that allows for annealing under biological conditions. Techniques for empirically determining whether two chains can anneal under biological conditions are well known in the art. Alternatively, two chains can be synthesized and added together under biological conditions to determine whether they anneal to each other.

[0042] The first and second chains, which form at least one double-stranded region, may be fully complementary to each other, or at least partially complementary.

[0043] Complementarity Depending on the length of the nucleic acid, a perfect match in terms of base complementarity between the first and second strands is not always necessary. However, the first and second strands must be able to hybridize under physiological conditions.

[0044] The complementarity between the first and second strands in at least one double-stranded region can be perfect in that there are no nucleotide mismatches or nucleotide additions / deletions in either strand. Alternatively, the complementarity does not have to be perfect. The complementarity can be at least 70%, 75%, 80%, 85%, 90%, or 95%.

[0045] The first and second strands may each include a complementary region containing at least 15, preferably at least 16, more preferably at least 17, even more preferably at least 18, and most preferably at least 19 adjacent nucleotides.

[0046] Nucleic acids are involved in the formation of a double-stranded region between all or part of the first strand and part of the target nucleic acid. The part of the target nucleic acid that forms the double-stranded region with the first strand is the target nucleic acid sequence, or simply the target sequence, defined as beginning with the first base pair formed between the first strand and the target sequence and ending with the last base pair formed between the first strand and the target sequence, and including both ends. The double-stranded region formed between the first strand and the second strand does not have to be the same as the double-stranded region formed between the first strand and the target sequence; that is, the second strand may have a different sequence from the target sequence. However, the first strand must be capable of forming a double-stranded structure with both the second strand and the target sequence, at least under physiological conditions.

[0047] The complementarity between the first strand and the target sequence may be perfect (no nucleotide mismatches or additions / deletions in any nucleic acid).

[0048] The complementarity between the first strand and the target sequence does not need to be perfect. The complementarity can be approximately 70% to 100%. More specifically, the complementarity can be at least 70%, 80%, 85%, 90%, or 95%, or an intermediate value.

[0049] The identity between the first strand and the complementary sequence of the target sequence can be approximately 75% to 100%. More specifically, if the nucleic acid can reduce or inhibit the expression of the target gene, preferably by RNAi, the complementarity can be at least 75%, 80%, 85%, 90%, or 95%, or an intermediate value.

[0050] Nucleic acids with less than 100% complementarity between the first strand and the target sequence may be able to reduce the expression of the target gene to the same level as nucleic acids with perfect complementarity between the first strand and the target sequence. Alternatively, nucleic acids with less than 100% complementarity between the first strand and the target sequence may be able to reduce the expression of the target gene to a level of 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the expression level achieved by nucleic acids with perfect complementarity.

[0051] In a further embodiment, the nucleic acids described herein can reduce the expression of target genes in cells by at least 10% compared to the level observed in the absence of the inhibitor, which may be a nucleic acid. All preferred features of any of the embodiments described above also apply to this embodiment. In particular, the expression of target genes in cells can be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, and intermediate levels compared to the level observed in the absence of the inhibitor (which may be a nucleic acid).

[0052] length A nucleic acid may contain a first strand and a second strand, each having a length of 19 to 25 nucleotides. The first and second strands may be the same length or may be of different lengths.

[0053] In one embodiment, the nucleic acid may comprise a first and second chain having lengths of 15-30 nucleotides, 15-25 nucleotides, 17-25 nucleotides, 17-23 nucleotides, 23-24 nucleotides, 19-21 nucleotides, and 21-23 nucleotides, respectively. Preferably, the nucleic acid may comprise a first and second chain having lengths of 19-21 nucleotides, respectively. The first and second chains may be the same length or different lengths within these ranges.

[0054] In one embodiment, the nucleic acid may include a first chain and a second chain, each having a length of 19 nucleotides.

[0055] In another embodiment, the nucleic acid may comprise a first chain and a second chain, each having a length of 20 nucleotides.

[0056] In further embodiments, the nucleic acid may comprise a first chain and a second chain, each having a length of 21 nucleotides.

[0057] Nucleic acids may contain a double-stranded region consisting of 19 to 25 nucleotide base pairs. The double-stranded region may consist of 17, 18, 19, 20, 21, 22, 23, 24, or 25 adjacent base pairs.

[0058] The 5'-(E)-vinylphosphonate nucleotide at the end of the first chain can be any nucleotide (i.e., A, G, C, or U). Preferably, the 5'-(E)-vinylphosphonate nucleotide at the end of the first chain can be U.

[0059] Nucleic acids can have blunt ends at both ends.

[0060] The nucleic acid may have, at the end of the nucleic acid including the 5' end of the first strand, a) be a blunt end, or b) have a 3' overhang of at least one nucleotide.

[0061] PO and PS binding In the nucleic acid of the present invention, the terminal 5'-(E)-vinylphosphonate nucleotide is linked to the second nucleotide in the first chain by a phosphodiester bond. The first chain may contain more than one phosphodiester nucleotide (i.e., more than one internucleotide phosphodiester bond).

[0062] In one embodiment, the first chain includes a phosphodiester bond between at least three terminal 5' nucleotides. In another embodiment, the first chain includes a phosphodiester bond between at least four terminal 5' nucleotides.

[0063] In one embodiment, the first chain comprises formula (Ia): (vp)-N(po)[N(po)] n - (Ia) (In the formula, "(vp)" is 5'-(E)-vinylphosphonate, "N" is a nucleotide, "po" is a phosphodiester bond, and n is 1 to (total number of nucleotides in the first chain - 2), preferably n is 1 to (total number of nucleotides in the first chain - 3), and more preferably n is 1 to (total number of nucleotides in the first chain - 4)).

[0064] Therefore, in one embodiment, if the nucleic acid includes a first chain having a length of 19 nucleotides, then n is 1 to (19-2), preferably (19-3), more preferably (19-4), i.e., n is 1 to 17, preferably 1 to 16, more preferably 1 to 15.

[0065] Therefore, in another embodiment, if the nucleic acid includes a first chain that is 20 nucleotides long, then n is 1 to (20-2), preferably (20-3), more preferably (20-4), i.e., n is 1 to 18, preferably 1 to 17, more preferably 1 to 16.

[0066] Therefore, in a further embodiment, if the nucleic acid includes a first chain having a length of 21 nucleotides, then n is 1 to (21-2), preferably (21-3), more preferably (21-4), i.e., n is 1 to 19, preferably 1 to 18, more preferably 1 to 17.

[0067] In one embodiment, the first chain comprises formula (Ib): (vp)-N(po)[N(po)] n [N(x)] m (Ib) (In the formula, "(vp)" is 5'-(E)-vinylphosphonate, "N" is independently any nucleotide such as a natural or modified ribonucleotide, "po" is a phosphodiester bond, n is at least 1, n+m+1 is the total number of nucleotides in the chain, and x is independently any bond between two nucleotides such as a phosphodiester bond, a phosphorothioate bond, and a phosphodithioate bond).

[0068] The nucleic acids of the present invention may also contain at least one phosphorothioate bond in the first chain.

[0069] Phosphothioates are generally considered necessary at both ends of the siRNA chain to protect siRNA from degradation, especially when siRNA is to be used therapeutically. Surprisingly, the inventors have found that the activity of siRNA is better when a 5' vinyl phosphonate is present at the 5' end of the chain than when no phosphorothioate is present at the 5' end. This is surprising, as it is generally believed in the art that such phosphorothioate binding increases stability. Therefore, it is possible to replace the phosphorothioate binding at the 5' end of the antisense chain with a 5' vinyl phosphonate, thereby increasing activity. This is desirable because the phosphorothioate binding is a chiral center compared to phosphodiester binding.

[0070] The nucleic acid of the present invention may contain more than one phosphorothioate bond in the first chain.

[0071] In one embodiment, the first chain includes a phosphorothioate bond between the two terminal 3' nucleotides. In another embodiment, the first chain includes a phosphorothioate bond between the three terminal 3' nucleotides (i.e., defining two phosphorothioate bonds). In these embodiments, the bonds between other nucleotides in the first chain are preferably phosphodiester bonds.

[0072] The second strand of the nucleic acid of the present invention may also include phosphorothioate bonds between two, three, or four terminal 3' nucleotides.

[0073] In one embodiment, the second chain includes phosphorothioate bonds between two, three, or four terminal 5' nucleotides.

[0074] In one embodiment, the second chain includes a phosphorothioate bond between the three 3' nucleotides at the end and a phosphodiester bond between the three 5' nucleotides at the end.

[0075] In one embodiment, the second chain includes phosphorothioate bonds between the four 3' nucleotides at the end and between the four 5' nucleotides at the end.

[0076] In one embodiment, the second chain includes phosphorothioate bonds between the three 3' nucleotides at the end and between the three 5' nucleotides at the end.

[0077] In one embodiment, the first chain includes phosphorothioate bonds between the three terminal 3' nucleotides, and the second chain includes phosphorothioate bonds between the three terminal 3' nucleotides. In this embodiment, the bonds between other nucleotides in the first and second chains are preferably phosphodiester bonds.

[0078] In one embodiment, the first chain includes phosphorothioate bonds between the three 3' nucleotides at its terminal, and the second chain includes phosphorothioate bonds between the four 3' nucleotides at its terminal and between the four 5' nucleotides at its terminal. In this embodiment, the bonds between other nucleotides in the first and second chains are preferably phosphodiester bonds.

[0079] In one embodiment, the first chain includes phosphorothioate bonds between the three 3' nucleotides at its terminal, and the second chain includes phosphorothioate bonds between the three 3' nucleotides at its terminal and between the three 5' nucleotides at its terminal. In this embodiment, the bonds between other nucleotides in the first and second chains are preferably phosphodiester bonds.

[0080] In one embodiment, nucleic acids are (i) Having a terminal 5'(E)-vinylphosphonate nucleotide at the 5' end of the first strand, (ii) Having phosphorothioate bonds between the three 3' nucleotides at the end of the first and second strands and between the three 5' nucleotides at the end of the second strand, (iii) All remaining bonds between nucleotides in the first and / or second chain are phosphodiester bonds.

[0081] In one embodiment, the nucleic acid is an siRNA that inhibits the expression of a target gene via RNAi.

[0082] 2' modification Unmodified polynucleotides, particularly ribonucleotides, can be susceptible to degradation by intracellular nucleases; therefore, modified nucleotides may be included in the nucleic acids of the present invention.

[0083] In addition to the (E)-vinylphosphonate on the nucleotide at the 5' end of the first chain, the nucleic acid modification of the present invention is also referred to.

[0084] The nucleic acid modifications of the present invention generally provide a powerful tool for overcoming potential limitations inherent in natural RNA molecules, including but not limited to in vitro and in vivo stability and bioavailability. Nucleic acids according to the present invention can be modified by chemical modification. Modified nucleic acids can also minimize the possibility of inducing interferon activity in humans. Modification can further enhance the functional delivery of nucleic acids to target cells. Modified nucleic acids of the present invention may comprise one or more chemically modified ribonucleotides in either or both of the first or second strands. Ribonucleotides may comprise chemical modifications of bases, sugars, or phosphate moieties. Ribonucleic acids can be modified by substitution or insertion of nucleotides or base analogs.

[0085] One or more nucleotides on the second and / or first strand of the nucleic acid of the present invention may be modified. Modified nucleotides may include modifications of sugar groups, particularly 2'-hydroxyl (OH) groups. The 2'-OH group may be modified or replaced with a number of different "oxy" or "deoxy" substituents.

[0086] Examples of "oxy"-2'hydroxyl group modifications include alkoxy or aryloxy (OR, e.g., R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH2CH2O) n CH2CH2OR; a "locked" nucleic acid (LNA) in which the 2' hydroxyl group is bonded to the 4' carbon of the same ribose sugar, for example, by a methylene crosslink; O-AMINE (AMINE=NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) and aminoalkoxy, O(CH2) n AMINEs (for example, AMINE = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino) are examples.

[0087] Deoxy modifications include hydrogen, halo; amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CH2CH2NH) n CH2CH2-AMINE (AMINE=NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino), -NHC(O)R (R=alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl compounds that can be optionally substituted with, for example, amino functional groups. Other substituents in certain embodiments include 2'-methoxyethyl, 2'-OCH3, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro compounds.

[0088] In the nucleic acid of the present invention, the first chain may be modified to form modified nucleotides. In particular, one or more nucleotides on the second chain may be modified to form modified nucleotides. In the nucleic acid of the present invention, the modification may be optionally performed with a 2'-OH group of a ribose sugar selected from 2'-O-methyl (2'-OMe) or 2'-F-modification.

[0089] In the nucleic acids of the present invention, one or more, or all, of the odd-numbered nucleotides in the first chain, numbered from the 5' end, may be modified nucleotides having a first modification with a 2'-OH group such as ribose, and similarly, one or more, or all, of the even-numbered nucleotides in the first chain, numbered from the 5' end, may be differently modified nucleotides having a second modification with a 2'-OH group of ribose sugar, where the first and second modifications are different. Preferably, the first modification is 2'-OMe and the second modification is 2'-F, or vice versa.

[0090] Preferably, in the nucleic acid of the present invention, 2'-methoxymethyl-modified nucleotides are not present in the first chain.

[0091] The nucleic acid of the present invention may have one modified nucleotide, or may have about two to four modified nucleotides, or may have about four to six modified nucleotides, about six to eight modified nucleotides, about eight to ten modified nucleotides, about ten to twelve modified nucleotides, about twelve to fourteen modified nucleotides, about fourteen to sixteen modified nucleotides, about sixteen to eighteen modified nucleotides, about eighteen to twenty modified nucleotides, about twenty to twenty-two modified nucleotides, about twenty-two to twenty-four modified nucleotides, twenty-four to twenty-four modified nucleotides, twenty-four to twenty-six modified nucleotides, or about twenty-six to twenty-eight modified nucleotides. In each case, the nucleic acid containing the modified nucleotides retains at least 50% of the activity of the same nucleic acid, except that it does not contain the modified nucleotides. Nucleic acids, except for those that do not contain the modified nucleotides, may retain 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the activity of the same nucleic acid, or may have more than 100% of the activity of the same nucleotide that does not contain the modified nucleotides.

[0092] The modified nucleotide may be a purine or a pyrimidine. At least half of the purine may be modified. At least half of the pyrimidine may be modified. The entire purine may be modified. The entire pyrimidine may be modified. The modified nucleotide may be selected from the group consisting of 2'-OMe modified nucleotides, 2' modified nucleotides, 2'-deoxy modified nucleotides, 2'-amino modified nucleotides, or 2'-alkyl modified nucleotides.

[0093] Nucleic acids may include nucleotides containing modified bases, where the bases are 2-aminoadenosine, 2,6-diaminopurine, inosine, pyridine-4-one, pyridine-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine), 6-azapyrimidine, 6-alkylpyrimidine (e.g., 6-methyluridine), propine, quesosine, 2-thiouridine, 4-thiouridine, weibtoxin, weibtoxosin, 4-acetylcytidine, 5-(carb Selected from oxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, beta-D-galactosyl osin, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, beta-D-mannosyl osin, uridine-5-oxyacetic acid, and 2-thiocytidine.

[0094] At least one modification may be 2'-OMe, and / or at least one modification may be 2'-F. Further modifications as described herein may be present on the first and / or second chain.

[0095] Throughout this description, “the same or common modification” means the same modification as that applied to any nucleotide, whether A, G, C, or U, modified with a group such as a methyl group or a fluoro group. It is not interpreted as meaning the same addition on the same nucleotide. For example, 2'-F-dU, 2'-F-dA, 2'-F-dC, and 2'-F-dG are all considered the same or common modification, as are 2'-OMe-rU, 2'-OMe-rA, 2'-OMe-rC, and 2'-OMe-rG. The 2'-F modification is a different modification from the 2'-OMe modification.

[0096] Preferably, the nucleic acid may independently include a modification and a second or further modification, each selected from the group including 2'-OMe modifications and 2'-F modifications. The nucleic acid may include a modification which may be a first modification, which is 2'-OMe, and a second modification which is 2'-F.

[0097] As used herein, the terms “inhibit,” “downregulate,” or “reduce” gene expression mean that the level of gene expression, or the level of an RNA molecule or equivalent RNA molecule (e.g., mRNA) encoding one or more proteins or protein subunits, or the activity of one or more proteins or protein subunits or peptides, is reduced to less than that observed in the absence of the nucleic acid of the present invention or in relation to an siRNA molecule that has no known homology to human transcripts (hereinafter referred to herein as a non-silencing control). Such controls may be conjugated and modified in a manner similar to the molecules of the present invention and delivered to target cells via the same pathway. For example, expression may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, or less than that observed in the absence of the inhibitor (which may be a nucleic acid) or in the presence of a non-silencing control (which may be a nucleic acid non-complementary to the target sequence).

[0098] Modification patterns The nucleic acid may contain one or more nucleotides on the second and / or first strand that are modified to form a modified nucleotide, where specifically the modification is modification of the 2'-OH group of the ribose sugar. Alternating nucleotides may be modified to form a modified nucleotide.

[0099] In this specification, "alternating" means that modifications occur regularly, one after the other. In other words, alternating means that modifications occur in a repeating sequence. For example, if one nucleotide is modified, the next adjacent nucleotide may not be modified, and the next adjacent nucleotide after that may be modified. One nucleotide may be modified by the first modification, the next adjacent nucleotide may be modified by the second modification, and the next adjacent nucleotide after that may be modified by the first modification, and so on, where the first and second modifications are different.

[0100] One or more odd-numbered nucleotides in the first strand of the nucleic acid of the present invention may be modified, where the first strand is numbered from 5' to 3'. The term "odd" as used herein means a number not divisible by 2. Examples of odd numbers include 1, 3, 5, 7, 9, 11, etc. One or more even-numbered nucleotides in the first strand of the nucleic acid of the present invention may be modified, where the first strand is numbered from 5' to 3'. The term "even" as used herein means a number divisible by 2. Examples of even numbers include 2, 4, 6, 8, 10, 12, 14, etc. One or more odd-numbered nucleotides in the second strand of the nucleic acid of the present invention may be modified, where the second strand is numbered from 3' to 5'. One or more even-numbered nucleotides in the second strand of the nucleic acid of the present invention may be modified, where the second strand is numbered from 3' to 5'.

[0101] One or more nucleotides on the first and / or second strands may be modified to form modified nucleotides. One or more odd nucleotides on the first strand may be modified. One or more even nucleotides on the first strand may be modified by at least a second modification, which is different from modifications to one or more odd nucleotides. At least one of the one or more modified even nucleotides may be adjacent to at least one of the one or more modified odd nucleotides.

[0102] Multiple odd-numbered nucleotides in the first strand may be modified in the nucleic acid of the present invention. Multiple even-numbered nucleotides in the first strand may be modified by a second modification. The first strand may contain adjacent nucleotides modified by a common modification. The first strand may also contain adjacent nucleotides modified by a second, different modification.

[0103] One or more odd nucleotides in the second strand may be modified by a modification different from that of the odd nucleotides on the first strand, and / or one or more even nucleotides in the second strand may be modified by the same modification as the odd nucleotides on the first strand. At least one of the one or more modified even nucleotides in the second strand may be adjacent to one or more modified odd nucleotides. Multiple odd nucleotides in the second strand may be modified by a common modification, and / or multiple even nucleotides may be modified by the same modification present on the odd nucleotides on the first strand. Multiple odd nucleotides in the second strand may be modified by a second modification, which is different from that of the odd nucleotides on the first strand.

[0104] The second strand may contain adjacent nucleotides modified by a common modification, which may be a second modification different from the modifications of the odd-numbered nucleotides in the first strand.

[0105] In the nucleic acid of the present invention, each odd-numbered nucleotide in the first strand and each even-numbered nucleotide in the second strand may be modified with a common modification, each even-numbered nucleotide in the first strand may be modified with a second modification, and each odd-numbered nucleotide in the second strand may be modified with a second modification.

[0106] The nucleic acids of the present invention may have modified nucleotides in the first chain that are shifted by at least one nucleotide relative to the unmodified or differently modified nucleotides in the second chain.

[0107] One or more odd-numbered nucleotides, or each of them, may be modified in the first chain, and one or more even-numbered nucleotides, or each of them, may be modified in the second chain. One or more alternating nucleotides on one or both chains, or each of them, may be modified by the second modification. One or more even-numbered nucleotides, or each of them, may be modified in the first chain, and one or more even-numbered nucleotides, or each of them, may be modified in the second chain. One or more alternating nucleotides on one or both chains, or each of them, may be modified by the second modification. One or more odd-numbered nucleotides, or each of them, may be modified in the first chain, and one or more odd-numbered nucleotides, or each of them, may be modified by a common modification in the second chain. One or more alternating nucleotides on one or both chains, or each of them, may be modified by the second modification. One or more even-numbered nucleotides, or each of them, may be modified in the first strand, and one or more odd-numbered nucleotides, or each of them, may be modified by a common modification in the second strand. One or more alternating nucleotides, or each of them, on one or both strands may be modified by a second modification.

[0108] The nucleic acids of the present invention may contain at least two alternating modification regions on one or both of the strands. These alternating regions may contain up to about 12 nucleotides, but preferably about 3 to about 10 nucleotides. The alternating nucleotide regions may be located at the ends of one or both strands of the nucleic acids of the present invention. The nucleic acids may contain 4 to about 10 alternating nucleotides at each end (3' and 5'), and these regions may be separated by about 5 to about 12 adjacent unmodified nucleotides or nucleotides that are differently or commonly modified.

[0109] The odd-numbered nucleotides of the first chain may be modified, and the even-numbered nucleotides may be modified with a second modification. The second chain may contain adjacent nucleotides modified with a common modification, which may be the same as the modification of the odd-numbered nucleotides of the first chain. One or more nucleotides of the second chain may also be modified with a second modification. One or more nucleotides having the second modification may be adjacent to each other, and to nucleotides having the same modification as the modification of the odd-numbered nucleotides of the first chain.

[0110] The nucleic acid of the present invention may comprise a first chain containing adjacent nucleotides modified with a common modification. One or more such nucleotides may be adjacent to one or more nucleotides that may be modified with a second modification. One or more nucleotides having the second modification may be adjacent. The second chain may comprise adjacent nucleotides modified with a common modification, which may be the same as one of the modifications of one or more nucleotides in the first chain. One or more nucleotides in the second chain may also be modified with the second modification. One or more nucleotides having the second modification may be adjacent.

[0111] Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, and 25 (from 5' to 3' on the first strand and from 3' to 5' on the second strand) may be modified by modifications on the first strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 may be modified by second modifications on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23 may be modified by modifications on the second strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 may be modified by second modifications on the second strand.

[0112] Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 may be modified by modifications on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23 may be modified by second modifications on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, and 23 may be modified by modifications on the second strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24 may be modified by second modifications on the second strand.

[0113] Clearly, if the first and / or second strands are 19 nucleotides long, shorter than the 25 nucleotide length of the first strand, then there are no numbered nucleotides 20, 21, 22, 23, 24, and 25 to be modified. Therefore, those skilled in the art will understand that the above description applies appropriately to shorter strands.

[0114] One or more modified nucleotides on the first strand may pair with modified nucleotides on the second strand that have a common modification. One or more modified nucleotides on the first strand may pair with modified nucleotides on the second strand that have a different modification. One or more modified nucleotides on the first strand may pair with an unmodified nucleotide on the second strand. One or more modified nucleotides on the second strand may pair with an unmodified nucleotide on the first strand. In other words, for example, alternating nucleotides may be aligned on the two strands such that all modifications in the alternating region of the second strand are paired with the same modifications in the first strand, or alternatively, the modifications may be offset by a nucleotide having a common modification in the alternating region of one strand that pairs with a different modification (i.e., a second or further modification) in the other strand. Another option is to have different modifications in each strand.

[0115] Modifications on the first strand can be shifted by only one nucleotide relative to the modified nucleotides on the second strand, so that no common modified nucleotides pair with each other.

[0116] In this embodiment, the nucleotides at positions 2 and 14 from the 5' end of the first chain may be modified.

[0117] In one embodiment of this design, the nucleotides at positions 2 and 14 from the 5' end of the first nucleic acid are preferably not modified by 2'-OMe modification, and the nucleotide on the second chain corresponding to position 13 of the first chain is preferably not modified by 2'-OMe modification.

[0118] In another embodiment of this design, the nucleotides at positions 2 and 14 from the 5' end of the first chain are preferably not modified with 2'-OMe, and the nucleotide on the second chain corresponding to position 11 of the first chain is preferably not modified with 2'-OMe.

[0119] In a further embodiment of this design, the nucleotides at positions 2 and 14 from the 5' end of the first chain are preferably not modified with 2'-OMe, and the nucleotides on the second chain corresponding to positions 11 and 13 of the first chain are preferably not modified with 2'-OMe.

[0120] In one embodiment of this design, the nucleotides on the second strand corresponding to the 11th and / or 13th positions from the 5' end of the first strand may be modified.

[0121] In a further embodiment of this design, the nucleotides at positions 2 and 14 from the 5' end of the first chain are preferably not modified by 2'-OMe modification, and the nucleotides on the second chain corresponding to positions 11, 13, 11 and 13, or 11-13 of the first chain are preferably modified by 2'-fluoro modification.

[0122] In a further embodiment of this design, the nucleotides at positions 2 and 14 from the 5' end of the first chain are preferably modified with a 2'-fluoropolymer, and the nucleotides on the second chain corresponding to positions 11, 13, 11 and 13, or 11-13 of the first chain are preferably not modified with a 2'-OMe polymer.

[0123] In a further embodiment of this design, the nucleotides at positions 2 and 14 from the 5' end of the first chain are preferably modified with a 2' fluoropolymer, and the nucleotides on the second chain corresponding to positions 11, 13, 11 and 13, or 11 to 13 of the first chain are preferably modified with a 2' fluoropolymer.

[0124] In the nucleic acid or conjugate of the present invention, more than 50% of the nucleotides of the first and / or second chain may contain 2'-OMe modifications, for example, more than 55%, 60%, 65%, 70%, 75%, 80%, or 85% or more of the nucleotides of the first and / or second chain, preferably measured as a percentage of the total nucleotides of both the first and second chains.

[0125] The nucleic acids or conjugates of the present invention may contain 20% or less (e.g., 15% or less or 10% or less) of 2' fluoromodifications on the first and / or second chains as a percentage of the total nucleotides of both chains.

[0126] In one embodiment of a nucleic acid, the nucleotides of the second chain at positions corresponding to nucleotide 11 or nucleotide 13 or nucleotides 11 and 13 or nucleotides 11-13 of the first nucleic acid are modified by a fourth modification. Preferably, all nucleotides of the second chain other than the nucleotides at positions corresponding to nucleotide 11 or nucleotide 13 or nucleotides 11 and 13 or nucleotides 11-13 of the first nucleic acid are modified by a third modification. Preferably, nucleotides 2 and 14 or all even-numbered nucleotides of the first chain are modified by a first modification in the same nucleic acid. Furthermore, or alternatively, the odd-numbered nucleotides of the first chain are modified by a second modification. The fourth modification is preferably different from the second modification and also preferably different from the third modification, and the fourth modification is preferably the same as the first modification. The second and third modifications are preferably the same. The first and fourth modifications are preferably 2'-OMe modifications, and the second and third modifications are preferably 2'-F modifications. The nucleotides on the first strand are numbered sequentially, starting with nucleotide number 1 at the 5' end of the first strand.

[0127] In one embodiment of nucleic acid, all even-numbered nucleotides in the first strand are modified by a first modification, all odd-numbered nucleotides in the first strand are modified by a second modification, all nucleotides in the second strand at positions corresponding to the even-numbered nucleotides in the first strand are modified by a third modification, and all nucleotides in the second strand at positions corresponding to the odd-numbered nucleotides in the first strand are modified by a fourth modification, where the first and fourth modifications are 2'-F, and the second and third modifications are 2'-OMe.

[0128] In one embodiment of the nucleic acid, all even-numbered nucleotides of the first strand are modified by a first modification, all odd-numbered nucleotides of the first strand are modified by a second modification, all nucleotides of the second strand at positions corresponding to nucleotides 11-13 of the first strand are modified by a fourth modification, and all nucleotides of the second strand other than those corresponding to nucleotides 11-13 of the first strand are modified by a third modification, where the first and fourth modifications are 2'-F, and the second and third modifications are 2'-OMe. Preferably, in this embodiment, the nucleotide at the 3' end of the second strand is an inverted RNA nucleotide (i.e., the nucleotide is linked to the 3' end of the strand via its 3' carbon rather than via its 5' carbon as it would normally be). If the nucleotide at the 3' end of the second strand is an inverted RNA nucleotide, it is preferable that the inverted RNA nucleotide is an unmodified nucleotide in the sense that it contains no modifications compared to its natural nucleotide counterpart. Specifically, the inverted RNA nucleotide is preferably a 2'-OH nucleotide.

[0129] In one embodiment, nucleic acids are: (i) Having a terminal 5'(E)-vinylphosphonate nucleotide at the 5' end of the first strand, (ii) Having phosphorothioate bonds between the three 3' nucleotides at the end of the first and second strands and between the three 5' nucleotides at the end of the second strand, (iii) All remaining bonds between nucleotides in the first and / or second chains are phosphodiester bonds, (iv) All even-numbered nucleotides in the first chain are modified by the first modification; all odd-numbered nucleotides in the first chain are modified by the second modification; all nucleotides in the second chain at positions corresponding to even-numbered nucleotides in the first chain are modified by the third modification; and all nucleotides in the second chain at positions corresponding to odd-numbered nucleotides in the first chain are modified by the fourth modification, where preferably the first and fourth modifications are 2'-F and the second and third modifications are 2'-OMe.

[0130] In one embodiment, nucleic acids are: (i) Having a terminal 5'(E)-vinylphosphonate nucleotide at the 5' end of the first strand, (ii) Having phosphorothioate bonds between the three 3' nucleotides at the end of the first and second strands and between the three 5' nucleotides at the end of the second strand, (iii) All remaining bonds between nucleotides in the first and / or second chains are phosphodiester bonds, (iv) All even-numbered nucleotides of the first chain are modified by the first modification; all odd-numbered nucleotides of the first chain are modified by the second modification; all nucleotides of the second chain at positions corresponding to nucleotides 11-13 of the first chain are modified by the fourth modification; and all nucleotides of the second chain other than those corresponding to nucleotides 11-13 of the first chain are modified by the third modification, where preferably the first and fourth modifications are 2'-F and the second and third modifications are 2'-OMe.

[0131] terminal modification The 3' end and 5' end of an oligonucleotide can be modified. Such modification may be present at the 3' end, the 5' end, or both ends of the molecule. Such modification may include modification or replacement of the entire terminal phosphate, or modification or replacement of one or more atoms of the phosphate group. For example, the 3' end and 5' end of an oligonucleotide can be conjugated to a labeling moiety, for example a fluorophore (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes) or another functional molecular entity such as a protecting group (e.g., those based on sulfur, silicon, boron or esters). The functional molecular entity can be bound to the sugar via a phosphate group and / or a linker. The terminal atom of the linker can bind to a linking atom of the phosphate group, or the O, N, S or C group of C-3' or C-5' of the sugar, or can replace any of these. Alternatively, the linker can bind to or replace a terminal atom of a nucleotide substitute (e.g., PNA). These spacers or linkers include, for example, -(CH2) n -, -(CH2) n N-, -(CH2) n O-, -(CH2) n S-, O(CH2CH2O) n CH2CH2OH (e.g., n=3 or 6), abasic sugars, amides, carboxy, amines, oxyamines, oxyimines, thioethers, disulfides, thioureas, sulfonamides, or morpholinos, or biotin and fluorescein reagents. The 3' end can be an -OH group.

[0132] Other examples of terminal modifications include dyes, intercalating agents (e.g., acridines), crosslinking agents (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphylline, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases, EDTA, lipophilic carriers (e.g., cholesterol, cholic acid, adamantane acetate, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3 Examples include (oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine) and peptide conjugates (e.g., Antennapedia peptide, Tat peptide), alkylating agents, phosphates, amino acids, mercaptos, PEG (e.g., PEG-40K), MPEG, [MPEG]2, polyamino acids, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, folic acid), and synthetic ribonucleases (e.g., imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of the tetraazamacrocycle).

[0133] Alternative or further terminal modifications may be added for a number of reasons, including to modulate activity or resistance to degradation. Useful terminal modifications for modulating activity include 5' terminal modifications with phosphates or phosphate analogs. The nucleic acids of the present invention may be 5'-phosphorylated on the first or second strand, or may contain phosphoryl analogs at the 5' prime terminus. 5'-phosphate modifications include those compatible with RISC-mediated gene silencing. Appropriate modifications include 5'-monophosphate ((HO)2(O)PO-5'); 5'-diphosphate ((HO)2(O)POP(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)PO-(HO)(O)POP(HO)(O)-O-5'); 5'-guanosine cap (7-methylated or unmethylated) (7m-GO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O- 5'); 5'-adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (NO-5'-(HO)(O)PO-(HO)(O)POP(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)PO-5'); 5'-monoditithiophosphate (phosphorodithioate; (HO)(HS)(S)PO-5'), 5'-phosphorothiolate ((HO)2(O)PS-5'); Examples include any further combinations of oxygen / sulfur-substituted monophosphates, diphosphates, and tripphosphates (e.g., 5'-alpha-thiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoramides ((HO)2(O)P-NH-5', (HO)(NH2)(O)PO-5'), 5'-alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g., RP(OH)(O)-O-5'-, (OH)2(O)P-5'-CH2-), 5'-alkyletherphosphonates, and 5'-vinylphosphonates (R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g., RP(OH)(O)-O-5'-).

[0134] The nucleic acid of the present invention contains at least one terminal 5'(E)-vinylphosphonate nucleotide at the 5' end of the first strand.

[0135] Terminal modifications can also be useful for monitoring distribution, in which case the added group may be a fluorophore, such as fluorescein or Alexa dye. Terminal modifications can also be useful for increasing uptake, with cholesterol being a useful modification in this regard. Terminal modifications can also be useful for crosslinking RNA agents to other parts.

[0136] Adenine, guanine, cytosine, and uracil are the most common bases found in RNA. These bases can be modified or replaced to provide RNA with improved properties. For example, nuclease-resistant oligoribonucleotides can be prepared using these bases, or synthetic and natural nucleic acid bases (e.g., inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine) and any one of the above modifications. Alternatively, substitutions or modified analogues of any of the above bases and “universal bases” can be used.Examples include 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2-aminopropyl)uracil, 5-aminoallyluracil, 8-halo, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, such as 2-aminopropyladenine, 5-prop Pinyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza-5-azacytosine, 2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, N6,N6-dimethyladenine, 2,6-diaminopurine, 5-amino-allyl-uracil, N3-methyluracil, substituted 1,2,4-triazoles, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-oxyacetic acid, 5-methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5-methylaminomethyl-2-thiouracil, 3-(3-amino-3-carboxypropyl)uracil, 3-methylcytosine, 5-methylcytosine, N <4> Examples include acetylcytosine, 2-thiocytosine, N6-methyladenine, N6-isopentyladenine, 2-methylthio-N6-isopentenyladenine, N-methylguanine, or O-alkylated bases.

[0137] As used herein, the term “non-pairing nucleotide analog” means a nucleotide analog encompassing a non-base-pairing moiety, including but not limited to 6-desaminoadenosine (nebularin), 4-Me-indole, 3-nitropyrrole, 5-nitroindole, Ds, Pa, N3-Me-ribo-U, N3-Me-ribo-T, N3-Me-dC, N3-Me-dT, N1-Me-dG, N1-Me-dA, N3-ethyl-dC, and N3-Me-dC. In some embodiments, the non-base-pairing nucleotide analog is a ribonucleotide. In other embodiments, the non-base-pairing nucleotide analog is a deoxyribonucleotide.

[0138] As used herein, the term “terminal functional group” includes, but is not limited to, halogen groups, alcohol groups, amine groups, carboxyl groups, ester groups, amide groups, aldehyde groups, ketone groups, and ether groups.

[0139] Certain parts may be ligated to the 5' end of the first or second strand, and include debasalized ribose moieties, debasalized deoxyribose moieties, modified debasalized ribose and debasalized deoxyribose moieties including 2'O alkyl modifications; inverted debasalized ribose and debasalized deoxyribose moieties and their modifications; C6-imino-Pi; mirror nucleotides including L-DNA and L-RNA; 5'-OMe nucleotides; and nucleotide analogs including 4',5'-methylene nucleotides; 1-(β-D-erythrofuranosyl) nucleotides; 4'-thionucleotides, carbocyclic nucleotides; and 5'-amino-alkyl phosphates. This includes 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; 12-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; alpha-nucleotide; threo-pentofuranosyl nucleotide; acyclic 3',4'-seconucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5'-5'-reverse debase moiety; 1,4-butanediol phosphate; 5'-amino; and crosslinked or uncrosslinked methyl phosphonates and 5'-mercapto moieties.

[0140] Other modifications In addition to 5'(E)-vinyl phosphate, modification of ribose sugar at the 2'-OH group, and other terminal modifications as described above, the nucleic acids of the present invention may include further modifications selected from the group consisting of 3'-terminal deoxythymine, morpholino modification, phosphoramide modification, 5'-phosphorothioate group modification, 5'-phosphate modification or 5'-phosphate mimetic modification, and cholesteryl derivative or dodecanoic acid bisdecylamide group modification, and / or the modified nucleotide may be any one of locked nucleotides, debasalized nucleotides, or nucleotides containing a non-natural base.

[0141] Nucleic acids have the following bases: 2-aminoadenosine, 2,6-diaminopurine, inosine, pyridine-4-one, pyridine-2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3-methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5-methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine), 6-azapyrimidine, 6-alkylpyrimidine (e.g., 6-methyluridine), propyne, cuosin, 2-thiouridine, 4-thiouridine, weibtosin, weibtoxosin, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethylamino The nucleotides may include modified nucleotides selected from methyl-2-thiouridine, 5-carboxymethylaminomethyluridine, beta-D-galactosylquosin, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7-methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6-isopentenyladenosine, beta-D-mannosylquosin, uridine-5-oxyacetic acid, and 2-thiocytidine.

[0142] Examples of moieties that can replace the phosphate group include siloxanes, carbonates, carboxymethyl groups, carbamates, amides, thioethers, ethylene oxide linkers, sulfonates, sulfonamides, thioformacetals, formacetals, oximes, methyleneiminos, methylenemethyliminos, methylenehydrazos, methylenedimethylhydrazos, and methyleneoxymethyliminos. In certain embodiments, the substitution may include methylenecarbonylamino groups and methylenemethylimino groups.

[0143] Phosphate linkers and ribose sugars can be replaced by nuclease-resistant nucleotides.

[0144] Examples include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside substitutes. In certain embodiments, PNA substitutes may be used.

[0145] A sugar group may also contain one or more carbon atoms that have the opposite stereochemical configuration to the corresponding carbon in ribose. Therefore, modified nucleotides may contain sugars such as arabinose.

[0146] Modified nucleotides can also include "debased" sugars, which lack a nucleic acid base at C-1'. These debased sugars may contain further modifications to one or more of their constituent sugar atoms.

[0147] The nucleic acids of the present invention may include debasalized nucleotides. As used herein, the term "debasalized" refers to a moiety at the 1' position that lacks a base or has another chemical group in place of the base, for example, a 3',3'-linked or 5',5'-linked deoxydebasalized ribose derivative.

[0148] Further modifications described herein may be present on the first and / or second chain.

[0149] Some representative modified nucleic acid sequences of the present invention are shown in the examples. These examples are representative and not limiting.

[0150] Ligand The nucleic acid of the present invention can be conjugated with a targeting ligand to form a conjugate.

[0151] The present invention further provides a conjugate for inhibiting the expression of a target gene in a cell, comprising a nucleic acid portion and a ligand portion, wherein the nucleic acid portion comprises a nucleic acid as defined anywhere in this specification.

[0152] In the conjugate of the present invention, the second chain of nucleic acid can be conjugated to the ligand portion.

[0153] In the conjugate of the present invention, the ligand portion may include one or more GalNAc ligands and derivatives thereof, for example, one which includes a GalNAc moiety or several GalNAc moieties at the 5' end of the second strand of a nucleic acid.

[0154] Some ligands may possess endosomal lysis properties. Endosomal lysis ligands promote the lysis of endosomes and / or the transport of the composition or components thereof from endosomes to the cytoplasm of cells. Endosomal lysis ligands may be polyanionic peptides or peptide mimes that exhibit pH-dependent membrane activity and membrane fusion properties. Endosomal lysis components may contain chemical groups that undergo a change in charge or protonation in response to changes in pH. Endosomal lysis components may be linear or branched.

[0155] Ligands can include, for example, therapeutic modifiers to enhance uptake; for example, diagnostic compounds or reporter groups to monitor distribution; crosslinking agents; and nuclease resistance-constituting moieties. Common examples include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide mimetic compounds. Ligands can be naturally occurring substances such as proteins, carbohydrates, or lipids. Ligands can be recombinant or synthetic molecules.

[0156] Ligands include targeting groups, such as cell targeting agents or tissue targeting agents. Targeting ligands can be lectins, glycoproteins, lipids, or proteins.

[0157] Other examples of ligands include dyes, intercalators, crosslinkers, porphyrins, polycyclic aromatic hydrocarbons, artificial endonucleases or chelating agents, lipophilic molecules, alkylating agents, phosphates, aminos, mercaptos, PEGs, MPEGs, alkyls, substituted alkyls, radiolabeled markers, enzymes, haptens, transport / absorption enhancers, synthetic ribonucleases, or imidazole clusters.

[0158] Ligands can be proteins, such as glycoproteins or peptides. Ligands can also be hormones or hormone receptors. These may also include non-peptide species such as lipids, lectins, carbohydrates, vitamins, or cofactors.

[0159] Ligands can be substances such as drugs that can increase the uptake of nucleic acids into cells by disrupting the cytoskeleton of a cell.

[0160] Ligands can increase the uptake of nucleic acids into cells by activating the inflammatory response. Examples of such ligands include tumor necrosis factor alpha (TNF-alpha), interleukin-1 beta, or gamma interferon.

[0161] Ligands can be lipids or lipid-based molecules. Lipids or lipid-based molecules preferably bind to serum proteins. Preferably, lipid-based ligands bind to human serum albumin (HSA). Lipids or lipid-based molecules can increase the resistance of the conjugate to degradation, increase targeting or transport to target cells, and / or modulate binding to serum proteins. Lipid-based ligands can be used to modulate the binding of the conjugate to target tissues.

[0162] The ligand can be a steroid. Preferably, the ligand is cholesterol or a cholesterol derivative.

[0163] The ligand can be a portion taken up by the target cell, such as a vitamin. Exemplary vitamins include vitamin A, vitamin E, vitamin K, and the B vitamins. Vitamins may be taken up by proliferating cells, which can be useful for delivering nucleic acids to cells such as malignant or non-malignant tumor cells.

[0164] The ligand can be a cell permeabilizing agent, such as a helical cell permeabilizing agent. Preferably, such an agent is amphiphilic.

[0165] The ligand may be a peptide or a peptide mimetic. A peptide mimetic is a molecule capable of folding into a defined three-dimensional structure similar to a natural peptide. Peptide or peptide mimetic ligands may include naturally occurring peptides, modified peptides, or both. Peptides or peptide mimetics may be cell-permeable peptides, cationic peptides, amphiphilic peptides, or hydrophobic peptides. The peptide moiety may be a dendrimer peptide, a restrictive peptide, or a cross-linked peptide. The peptide moiety may include a hydrophobic membrane-transport sequence. The peptide moiety may be a peptide capable of transporting large polar molecules such as peptides, oligonucleotides, and proteins across the cell membrane, for example, the sequence of the HIV Tat protein (GRKKRRQRRRPPQ) and the sequence derived from the Drosophila Antennapedia protein (RQIKIWFQNRRMKWKK). Preferably, the peptide or peptide mimetic is a cell-targeting peptide, for example, an arginine-glycine-aspartic acid (RGD)-peptide.

[0166] The ligand may be, for example, a cell-permeable peptide capable of passing through microbial cells or mammalian cells.

[0167] Ligands can be pharmacokinetic modifiers. These modifiers may include lipophiles, bile acids, steroids, phospholipid analogs, peptides, protein binders, PEG, vitamins, etc.

[0168] When two or more ligands are present, the ligands may all have the same properties, all have different properties, or some ligands may have the same properties while others have different properties. For example, a ligand may have targeting properties, endosomal lysis activity, or PK modulating properties. In a preferred embodiment, all ligands have different properties.

[0169] Ligands can be coupled to nucleic acids at their 3' end, 5' end, and / or internal positions. Preferably, ligands are coupled to nucleic acids by an intervening tether or linker.

[0170] In some embodiments, the nucleic acid is a double-stranded nucleic acid. In a double-stranded nucleic acid, the ligand may be bound to one or both strands. In some embodiments, the double-stranded nucleic acid contains a ligand conjugated to the sense strand. In other embodiments, the double-stranded nucleic acid contains a ligand conjugated to the antisense strand.

[0171] Ligands can be conjugated to nucleic acid bases, sugar moieties, or nucleoside bonds of nucleic acid molecules. Conjugation to purine nucleic acid bases or their derivatives can occur at any position, including intra-ring and extra-ring atoms. Conjugation to pyrimidine nucleotides or their derivatives can also occur at any position. Conjugation to the sugar moiety of a nucleoside can occur at any carbon atom. Conjugation to nucleoside bonds can occur at the phosphorus atom of a phosphorus-containing bond, or at an oxygen, nitrogen, or sulfur atom bonded to a phosphorus atom. With respect to nucleoside bonds containing amines or amides, conjugation can occur at the nitrogen atom of the amine or amide, or at an adjacent carbon atom.

[0172] Ligands are typically carbohydrates, such as monosaccharides, disaccharides, trisaccharides, tetrasaccharides, or polysaccharides. Ligands can be conjugated to nucleic acids via a linker moiety. The linker moiety can be a monovalent, divalent, or trivalent branched structure.

[0173] The efficient delivery of oligonucleotides, particularly the double-stranded nucleic acids of the present invention, to cells in vivo is crucial and requires specific targeting and substantial protection from the extracellular environment, especially serum proteins. One way to achieve specific targeting is to conjugate a targeting moiety or ligand to the nucleic acid. The targeting moiety helps to target the nucleic acid to the required target site, and it is necessary to conjugate the appropriate targeting moiety to the desired receptor site so that the conjugated molecule is taken up by the cell, for example, by endocytosis. The targeting moiety or ligand can be any moiety or ligand capable of targeting a specific receptor.

[0174] For example, the asialoglycoprotein receptor (ASGP-R) is a very abundant, high-volume receptor in hepatocytes. One of the first disclosures of a triantennary cluster glycoside was in U.S. Patent No. 5,885,968. Conjugates having three GalNAc ligands and containing a phosphate group are known and described by Dubber et al. (2003). ASGP-R shows 50-fold higher affinity for N-acetyl-D-galactosylamine (GalNAc) than for D-Gal.

[0175] Hepatocytes expressing lectins (asialoglycoprotein receptors; ASGPRs) that specifically recognize the β-galactosyl subunit at the terminal end of glycosylated proteins or other oligosaccharides (PH. Weigel et al., 2002) can be used to target drugs to the liver through covalent coupling of galactose or galactoseamines to drug substances (S. Ishibashi, S et al., 1994). Furthermore, binding affinity can be significantly increased by the pluripotency effect achieved through the repetition of targeting units (E. Al Biessen et al., 1995).

[0176] ASGPR is a mediator of active endosomal transport of terminal β-galactosyl-containing glycoproteins, and therefore ASGPR is well-suited for targeted delivery of drug candidates such as nucleic acids that need to be delivered into cells (Akinc et al.).

[0177] Sugars, which may be called ligands, can be selected to have affinity for at least one type of receptor on target cells. In particular, receptors are found on the surface of mammalian liver cells, such as the hepatic asialoglycoprotein receptor (ASGP-R).

[0178] The sugar can be selected from N-acetylgalactoseamine, mannose, galactose, glucose, glucosamine, and fucose. The sugar may be N-acetylgalactoseamine (GalNAc).

[0179] Accordingly, ligands for use in the present invention may comprise (i) one or more N-acetylgalactosamine (GalNAc) moieties and derivatives thereof, and (ii) a linker that conjugates the GalNAc moieties to nucleic acids or sequences as defined in any of the following embodiments. The linker may be a monovalent, divalent, trivalent, or tetravalent branched structure. Nucleotides may be modified as defined herein.

[0180] "GalNAc" refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, commonly known as N-acetylgalactosamine in the literature. References to "GalNAc" or "N-acetylgalactoseamine" encompass both β-type: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and α-type: 2-(acetylamino)-2-deoxy-α-D-galactopyranose. Both β-type: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and α-type: 2-(acetylamino)-2-deoxy-α-D-galactopyranose can be used interchangeably. Preferably, the compounds of the present invention contain β-type 2-(acetylamino)-2-deoxy-β-D-galactopyranose.

[0181] The ligand may include GalNAc.

[0182] The ligand is given by formula (II): [SX 1 -PX 2 ]3-AX 3 - (II) (In the formula, S represents a sugar, and preferably the sugar is N-acetylgalactosamine. X 1 These are C3-C6 alkylenes or (-CH2-CH2-O) m (-CH2)2-(where m is 1, 2, or 3), P is a phosphate or modified phosphate (preferably a thiophosphate), X 2 This is an alkylene, or an alkylene ether of the formula (-CH2)nO-CH2- (where n=1 to 6). A is a branching unit, X 3 (This represents a bridge unit.) The nucleic acid according to the present invention may contain the compound X 3 The sense chain is conjugated via a phosphate or modified phosphate, preferably a thiophosphate, preferably at the 5' end of the sense chain.

[0183] In formula (II), the branched unit "A" is preferably branched into three parts to accommodate three sugar ligands. The branched unit is covalently bonded to the ligand and the nucleic acid. The branched unit may contain a branched aliphatic group, which is selected from alkyl groups, amide groups, disulfide groups, polyethylene glycol groups, ether groups, thioether groups, and hydroxyamino groups. The branched unit may contain a group selected from alkyl groups and ether groups.

[0184] Branching unit A is, [ka] (wherein each A1 independently represents O, S, C=O or NH, and each n independently represents an integer of 1 to 20) may have a structure selected from

[0185] The branching unit is

Chemical Formula

[0186] The branching unit is

Chemical Formula

[0187] The branching unit has the structure:

Chemical Formula

[0188] The branching unit has the structure:

Chemical Formula

[0189] The branching unit has the structure:

Chemical Formula

[0190] Optionally, the branching unit consists only of carbon atoms.

[0191] “X 3The "" section is a crosslinking unit. The crosslinking unit is linear and is covalently bonded to the branching unit and nucleic acid.

[0192] X 3 is -C1~C 20 Alkylene-, -C2~C 20 Alkenylene -, formula - (C1~C 20 Alkylene)-O-(C1~C 20 Alkylene)- Alkylene ether, -C(O)-C1~C 20 Alkylene-, -C0~C4alkylene(Cy)C0~C4alkylene- (wherein Cy represents a substituted or unsubstituted 5-membered or 6-membered cycloalkylene ring, arylene ring, heterocyclylene ring, or heteroarylene ring), -C1~C4alkylene-NHC(O)-C1~C4alkylene-, -C1~C4alkylene-C(O)NH-C1~C4alkylene The following can be selected: -C1~C4 alkylene-SC(O)-C1~C4 alkylene-, -C1~C4 alkylene-C(O)S-C1~C4 alkylene-, -C1~C4 alkylene-OC(O)-C1~C4 alkylene-, -C1~C4 alkylene-C(O)O-C1~C4 alkylene-, and -C1~C6 alkylene-SS-C1~C6 alkylene-.

[0193] X 3 is, formula - (C1~C 20 Alkylene)-O-(C1~C 20 It can be an alkylene ether of (alkylene)-. 3 is, formula - (C1~C 20 Alkylene)-O-(C4~C 20 Alkylene)-(wherein the formula, the above (C4~C 20 Alkylene can be an alkylene ether linked to Z. 3 -CH2-O-C3H6-, -CH2-O-C4H8-, -CH2-O-C6H 12 -, and -CH2-O-C8H 16 -, especially -CH2-O-C4H8-, -CH2-O-C6H 12 -and-CH2-O-C8H 16The following can be selected from the group consisting of -(wherein the formula, in each case, the -CH2- group is linked to A).

[0194] The ligand is given by formula (III): [SX 1 -PX 2 ] n3 -AX 3 - (III) (In the formula, S represents sugars, preferably GalNAc. X 1 This is a C3-C6 alkylene or ethylene glycol base (-CH2-CH2-O) m This represents (-CH2)2- (where m is 1, 2, or 3), P is a phosphate or modified phosphate, preferably a thiophosphate. X 2 These are C1-C8 alkylenes, A is [ka] A branching unit selected from, X 3 (This is a bridge-bridging unit.) The nucleic acid according to the present invention may contain the compound X 3 It is conjugated via a phosphate or modified phosphate, preferably a thiophosphate.

[0195] Branching unit A has the following structure: [ka] It may have.

[0196] Branching unit A has the following structure: [ka] (In the formula, X 3 (It is bonded to the nitrogen atom.) It may have.

[0197] X 3 may be C1~C 20 alkylene. Preferably, X 3 is selected from the group consisting of -C3H6-, -C4H8-, -C6H 12 - and -C8H 16 -, particularly -C4H8-, -C6H 12 -, and -C8H 16 -.

[0198] The ligand has formula (IV): [S-X 1 -P-X 2 3-A-X 3 - (IV) (wherein, S represents a saccharide, preferably GalNAc, X 1 represents C3~C6 alkylene or an ethylene glycol group (-CH2-CH2-O) m (-CH2)2- (wherein m is 1, 2, or 3), P is phosphate or modified phosphate, preferably thiophosphate, X 2 is an alkylene ether of formula -C3H6-O-CH2-, A is a branching unit, X 3 is an alkylene ether of a formula selected from the group consisting of -CH2-O-CH2-, -CH2-O-C2H4-, -CH2-O-C3H6-, -CH2-O-C4H8-, -CH2-O-C5H 10 -, -CH2-O-C6H 12 -, -CH2-O-C7H 14 -, and -CH2-O-C8H 16 - (wherein in each case, the -CH2- group is linked to A)) may comprise a compound of, wherein the nucleic acid according to the present invention is conjugated to X 3 via phosphate or modified phosphate, preferably thiophosphate.

[0199] The branching unit may comprise carbon. Preferably, the branching unit is carbon.

[0200] X 2 This represents the -C3H6-O-CH2-, i.e., C3 alkoxymethyl, or an alkylene ether of the formula -CH2CH2CH2OCH2-.

[0201] In any of the above embodiments of the ligand, P represents a modified phosphate group. [ka] (In the formula, Y 1 and Y 2 These are independently =O, =S, and -O. - , -OH, -SH, -BH3, -OCH2CO2, -OCH2CO2R x , -OCH2C(S)OR x , and -OR X (In the formula, R x (represents C1-C6 alkyl) [ka] (This indicates binding to the remainder of the compound.) It can be represented by:

[0202] A modified phosphate refers to a phosphate group in which one or more oxygen atoms are replaced. Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotryesters. Phosphorothioates both have uncoupled oxygen atoms replaced by sulfur. One, each, or both uncoupled oxygen atoms in the phosphate group can independently be any one of S, Se, B, C, H, N, or OR (where R is alkyl or aryl).

[0203] The phosphate linker may also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidate), with sulfur (bridged phosphorothioate), and with carbon (bridged methylenephosphonate). The replacement may be carried out at a terminal oxygen. Replacement of a non-linking oxygen with nitrogen is possible.

[0204] For example, Y 1 may represent -OH, and Y 2 may represent =O or =S, or Y 1 may be -O - and Y 2 may represent =O or =S, Y 1 may represent =O, and Y 2 may represent -CH3, -SH, -OR X or -BH3, Y 1 may represent =S, and Y 2 may represent -CH3, OR X or -SH.

[0205] Those skilled in the art will understand that in certain specific cases, delocalization exists between Y 1 and Y 2 .

[0206] Preferably, the modified phosphate group is a thiophosphate group. Thiophosphate groups include dithiophosphate (i.e., where Y 1 represents =S and Y 2 is -S - ) and monothiophosphate (i.e., where Y 1 is -O - and Y 2 represents =S, or Y 1 represents =O and Y 2 is -S -Examples include cases where P represents [a specific group]. Preferably, P is a monothiophosphate. The inventors have found that conjugates having a thiophosphate group instead of a phosphate group have improved efficacy and duration of action in vivo.

[0207] P is also ethyl phosphate (i.e., Y 1 ga = O, Y 2 (This can be the case when OCH2CH3 is represented.)

[0208] Sugars, also known as ligands, can be selected to have affinity for at least one type of receptor on target cells. In particular, receptors are found on the surface of mammalian liver cells, such as the hepatic asialoglycoprotein receptor (ASGP-R).

[0209] In any of the above embodiments, the sugars may be selected from N-acetyl having one or more of galactosamine, mannose, galactose, glucose, glucosamine, and fructose. Preferably, the sugars are two molecules of N-acetylgalactosamine (GalNAc). The compounds of the present invention may have three ligands, each preferably N-acetylgalactosamine.

[0210] "GalNAc" refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, commonly known as N-acetylgalactosamine in the literature. References to "GalNAc" or "N-acetylgalactoseamine" encompass both β-type: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and α-type: 2-(acetylamino)-2-deoxy-α-D-galactopyranose. In certain embodiments, both β-type: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and α-type: 2-(acetylamino)-2-deoxy-α-D-galactopyranose can be used interchangeably. Preferably, the compounds of the present invention contain β-type 2-(acetylamino)-2-deoxy-β-D-galactopyranose.

[0211] [ka] 2-(acetylamino)-2-deoxy-D-galactopyranose

[0212] [ka] 2-(acetylamino)-2-deoxy-β-D-galactopyranose

[0213] [ka] 2-(acetylamino)-2-deoxy-α-D-galactopyranose

[0214] With respect to any of the above compounds of formula (IV), X 1 This is the ethylene glycol base (-CH2-CH2-O) m (-CH2)2-(where m is 1, 2, or 3) is possible. 1 It can be (-CH2-CH2-O)(-CH2)2-. 1 It can be (-CH2-CH2-O)2(-CH2)2-. Preferably, X 1 It is (-CH2-CH2-O)2(-CH2)2-. Alternatively, X 1 This represents C3-C6 alkylenes. 1 It could be propylene. 1 It could be butylene. 1 It could be pentylene. 1 can be hexylene. Preferably, the alkyl is a linear alkylene. In particular, X 1 It could be butylene.

[0215] Regarding the compound of formula (IV), X 2 This represents the formula -C3H6-O-CH2-, i.e., C3 alkoxymethylene, or an alkylene ether of the -CH2CH2CH2OCH2- type.

[0216] Therefore, the present invention has the following structure: [ka] [ka] [ka] [ka] [ka] (In the formula, Z represents nucleic acid as defined herein.) The present invention further provides a conjugated nucleic acid having one of the following:

[0217] Preferably, the nucleic acid is a conjugated nucleic acid, where the nucleic acid has the following structure: [ka] (In the formula, Z represents nucleic acid as defined herein.) It is conjugated to a tribranched ligand having [a specific characteristic].

[0218] In one embodiment, nucleic acids have the following structure: [ka] The nucleic acid is conjugated to a tribranched ligand having the phosphonate group of the ligand, where the nucleic acid is conjugated to the ligand via the ligand's phosphonate group to a) the last nucleotide at the 5' end of the second strand, b) the last nucleotide at the 3' end of the second strand, or c) the last nucleotide at the 3' end of the first strand.

[0219] Ligands of formula (II), (III), or (IV), or the tribranched ligands disclosed herein, may be bound at the 3' end of the first (antisense) strand and / or at either the 3' and / or 5' end of the second (sense) strand. The nucleic acid may contain more than one ligand of formula (II), (III), or (IV), or any of the tribranched ligands disclosed herein. However, a single ligand of formula (II), (III), or (IV), or any of the tribranched ligands disclosed herein, is preferred because such a single ligand is sufficient for efficient targeting of the nucleic acid to target cells. Preferably, in such cases, at least two, preferably at least the last three, and more preferably at least the last four nucleotides at the ends of the nucleic acid to which the ligand is bound are linked by a phosphodiester bond.

[0220] Preferably, the 5' end of the first (antisense) strand is not bound to any ligand of formula (II), (III), or (IV) or any of the tribranched ligands disclosed herein, because the ligand at this position may potentially interfere with the biological activity of the nucleic acid.

[0221] Nucleic acids having a single ligand of formula (II), (III), or (IV) or one of the tribranched ligands disclosed herein at the 5' end of the strand are easier to manufacture and therefore less expensive than the same nucleic acid having the same ligand at the 3' end. Therefore, preferably, a single ligand of formula (II), (III), or (IV) or one of the tribranched ligands disclosed herein is covalently bonded (and conjugated) to the 5' end of the second strand of the nucleic acid.

[0222] One embodiment is a nucleic acid for inhibiting the expression of a target gene in a cell, comprising at least one double-stranded region including at least a portion of a first strand and a portion of a second strand at least partially complementary to the first strand, wherein the first strand is at least partially complementary to at least a portion of the RNA transcribed from the target gene to be inhibited, and the first strand has a terminal 5'(E)-vinylphosphonate nucleotide. i) The terminal 5'(E)-vinylphosphonate nucleotide is linked to the second nucleotide in the first chain by a phosphodiester bond, preferably the first chain contains phosphodiester bonds between at least three terminal 5' nucleotides. ii) The first chain comprises at least one phosphorothioate bond, preferably the first chain comprises a phosphorothioate bond between the two terminal 3' nucleotides, more preferably between the three terminal 3' nucleotides. iii) The second chain is conjugated at its 5' end to a ligand of formula (II), (III), or (IV), preferably as shown in Figure 13a, Figure 13b, or Figure 13c, more preferably as shown in Figure 13c, and the second chain preferably contains phosphorothioate bonds only between the two, three, or four terminal 3' nucleotides, preferably only between the three 3' terminal nucleotides. iv) At least one, some or all of the nucleotides of the nucleic acid are 2' modified nucleotides, v) The nucleic acid is characterized in that the internucleotide bonds between the two chains, which are not phosphorothioate bonds, are preferably phosphodiester bonds.

[0223] In a further aspect, the present invention provides a nucleic acid for inhibiting the expression of a target gene in a cell, comprising at least one double-stranded region including at least a portion of a first strand and a portion of a second strand at least partially complementary to the first strand, wherein the first strand is at least partially complementary to at least a portion of the RNA transcribed from the target gene to be inhibited, the first strand has a terminal 5'-(E)-vinylphosphonate nucleotide, the terminal 5'-(E)-vinylphosphonate nucleotide is linked to the second nucleotide in the first strand by a phosphodiester bond, and the nucleic acid molecule is conjugated to a ligand.

[0224] Nucleic acids may be conjugated with ligands as described herein. Nucleotides of the first and / or second strands may be modified as described herein.

[0225] The ligand may contain GalNAc and may have the structure shown in Figure 13a, Figure 13b, or Figure 13c, preferably Figure 13c.

[0226] In the conjugate of the present invention, the ligand portion may include a linker portion and a targeting ligand, wherein the linker portion links the targeting ligand to the nucleic acid portion.

[0227] The present invention also relates to a conjugate for inhibiting the expression of a target gene in a cell, comprising a nucleic acid portion and a ligand portion, wherein the nucleic acid portion comprises a nucleic acid according to the present invention as defined in any of the foregoing, and the ligand portion comprises a linker portion derived from serinol and a targeting ligand for in vivo targeting of cells, which is conjugated exclusively to one or both 3' and / or 5' ends of an RNA strand, wherein the 5' end of the first RNA strand is not conjugated. (i) The second RNA strand is conjugated with a targeting ligand at its 5' end, (a) The second RNA strand is also conjugated with a targeting ligand at its 3' end, and the 3' end of the first RNA strand is not conjugated, or (b) The first RNA strand is conjugated with a targeting ligand at its 3' end, and the 3' end of the second RNA strand is not conjugated, or (c) Both the second RNA strand and the first strand are also conjugated with a targeting ligand at their 3' ends, or (ii) Both the second RNA strand and the first RNA strand are conjugated to a targeting ligand at their 3' ends, and the 5' end of the first RNA strand is not conjugated. Regarding conjugates.

[0228] The present invention relates to a conjugate for inhibiting the expression of the TMPRSS6 gene in a cell, comprising a nucleic acid portion and a ligand portion, wherein the nucleic acid portion comprises the nucleic acid according to the present invention as defined in any of the foregoing, the first strand of the nucleic acid being at least partially complementary to at least a portion of the RNA transcribed from the TMPRSS6 gene, and the ligand portion comprises a serinol-derived linker portion and a targeting ligand for in vivo targeting of cells, which is conjugated exclusively to one or both of the 3' and / or 5' ends of the RNA strand, the 5' end of the first RNA strand being unconjugated. (i) The second RNA strand is conjugated with a targeting ligand at its 5' end, (a) The second RNA strand is also conjugated with a targeting ligand at its 3' end, and the 3' end of the first RNA strand is conjugated, or (ii) The first chain contains modified nucleotides at multiple positions, the nucleotides at positions 2 and 14 from the 5' end of the first chain are not modified by 2'-OMe modification, and the positions on the opposite side of the second chain from positions 11, 12, and 13 of the first chain (corresponding to positions 7, 8, and 9 of the second chain from the 5' end in the 19-mer) are not modified by 2'-OMe modification. It includes conjugate.

[0229] By choice, the first strand has the following nucleotide sequence: (vp)- mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA (SEQ ID NO: 9), and / or (preferably, and) the second chain is a nucleotide sequence: Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA (ps) Ser(GN) (Sequence ID 10) may be included.

[0230] The linker portion may be, for example, a serinol-derived linker portion or one of the other linker types described herein.

[0231] In one embodiment of the present invention, a second RNA strand (i.e., sense strand) is conjugated at its 5' end to a targeting ligand, and a first RNA strand (i.e., antisense strand) is conjugated at its 3' end to a targeting ligand, while the 3' end of the second RNA strand (i.e., sense strand) is not conjugated, such that a conjugate having the following schematic structure is formed: [ka]

[0232] In one embodiment of the present invention, a second RNA strand (i.e., a sense strand) is conjugated at its 5' end to a targeting ligand, and the second RNA strand (i.e., a sense strand) is also conjugated at its 3' end to a targeting ligand, while the 3' end of the first RNA strand (i.e., an antisense strand) is not conjugated, such that a conjugate having the following schematic structure is formed: [ka]

[0233] In one embodiment of the present invention, both the second RNA strand (i.e., sense strand) and the first RNA strand (i.e., antisense strand) are conjugated at their 3' ends to a targeting ligand, while the 5' end of the second RNA strand (i.e., sense strand) is not conjugated, so that a conjugate having the following schematic structure is formed: [ka]

[0234] In one embodiment of the present invention, a second RNA strand (i.e., a sense strand) is conjugated to a targeting ligand at its 5' end, and both the second RNA strand (i.e., a sense strand) and the first RNA strand (i.e., an antisense strand) are conjugated to a targeting ligand at their 3' ends, such that a conjugate having the following schematic structure is formed: [ka]

[0235] In any one of the above embodiments, [ka] This represents a linker that conjugates ligands to both ends of a nucleic acid moiety, and the ligand may be a GalNAc moiety such as GalNAc, where, [ka] This represents the nucleic acid portion.

[0236] These schematic diagrams are not intended to limit the number of nucleotides in the first or second strand, nor do the diagrams represent any kind of limitation or any other limitation on base complementarity.

[0237] Ligands can be monomers or polymers (e.g., dimers, trimers, etc.).

[0238] Ideally, the ligand is a monomer and therefore contains a single targeting ligand moiety, such as a single GalNA moiety.

[0239] Alternatively, the ligand may contain two linker moieties, such as a serinol-derived linker moiety, each linked to a single targeting ligand moiety.

[0240] The ligand may be a trimer ligand, where a portion of the ligand includes three linker moieties, such as serinol-derived linker moieties, each of which is linked to a single targeting ligand moiety.

[0241] Two or three linker segments, such as those derived from serinol, can be sequentially linked, for example, as shown below: [ka] (In the formula, n is either 1 or 2, and Y is either S or O).

[0242] Preferably, the ligand is a monomer.

[0243] Ideally, the conjugated RNA strand is conjugated to the targeting portion via a linker portion containing a further linker, preferably a serinol-derived linker portion, where the further linker is saturated unbranched or branched C 1~15 Alkyl chains, or saturated unbranched or branched C 1~15 The alkyl chain contains, optionally, one or more carbon atoms (e.g., one, two, or three carbon atoms, preferably one or two, especially one) which are O, N, S(O) p The chain is replaced by a heteroatom selected from (wherein p is 0, 1, or 2) (for example, a CH2 group is replaced with O, or NH, or S, or SO2, or a -CH3 group at the end of a chain or on a branch is replaced with OH, or NH2), where the chain is optionally replaced by one or more oxo groups (for example, one to three groups such as one group).

[0244] More precisely, the linker portion is the selinol-derived linker portion. The term "selinol-derived linker portion" includes the following structure: [ka]

[0245] The oxygen atom in the aforementioned structure is typically linked to the RNA chain, and the nitrogen atom is typically linked to the targeting ligand.

[0246] More precisely, the further linker comprises a saturated unbranched C1-C15 alkyl chain, where one or more carbon atoms (e.g., one, two, or three carbons, preferably one or two, especially one) are replaced by oxygen atoms.

[0247] More precisely, the additional linker includes a PEG chain.

[0248] More precisely, the additional linker is the saturated unbranched C 1~15 Contains alkyl chains.

[0249] More precisely, the additional linker is the saturated unbranched C 1~6 Contains alkyl chains.

[0250] More precisely, the additional linker includes saturated, unbranched C4 or C6 alkyl chains, such as a C4 alkyl chain.

[0251] In one embodiment, [ka] Equation (V): [ka] (In the formula, n, Y, and L1 are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0252] Therefore, in one embodiment, the targeting ligand portion is formula (VI): [ka] (In the formula, n, Y, and L1 are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0253] Appropriately, [ka] Equation (VII): [ka] (In the formula, n, Y, R1, and L are defined below, where L is bound to a targeting ligand, such as GalNAc, and the phosphor group O is bound to an oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0254] Appropriately, the targeting ligand portion is formula (VIII): [ka] (In the formula, n, Y, R1, and L are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0255] Appropriately, [ka] This is expressed by the following formula (IX): [ka] (In the formula, n, Y, and L2 are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0256] Appropriately, the targeting ligand part is formula (X): [ka] (In the formula, n, Y, and L2 are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0257] Appropriately, [ka] Equation (XI): [ka] (In the formula, F, Y, and L are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0258] Appropriately, the targeting ligand portion is formula (XII): [ka] (In the formula, F, Y, and L are defined below, and the phosphorus O is bound to the oligonucleotide at the end of the RNA chain.) This is the connecting part.

[0259] In any of the above structures, the ligand is appropriately selected from the GalNAc and galactose moieties, particularly the GalNAc moiety. Alternatively, GalNAc may be replaced with another targeting ligand, such as a sugar.

[0260] In one embodiment of the present invention, the first RNA strand is given by formula (XIII): [ka] (In the formula, b is preferably 0 or 1) It is a compound of, The second RNA strand is given by formula (XIV): [ka] (In the formula, c and d are independently preferably 0 or 1. Z1 and Z2 are the RNA portions of the first and second RNA strands, respectively. Y is either O or S, n is 0, 1, 2, or 3. L1 is the linker to which the ligand is bound. b+c+d is preferably 2 or 3. It is a compound of [the compound].

[0261] Preferably, L1 in formulas (XIII) and (XIV) is the same as in formula (XV): [ka] (In the formula, L is -(CH2) r -C(0)- (where r=2~12), -(CH2-CH2-0) s -CH2-C(0)-(where s=1~5), -(CH2) t -C0-NH-(CH2) t -NH-C(0)-(where t is independently 1-5), -(CH2) u -C0-NH-(CH2) u -C(0)-(wherein u is independently 1 to 5), and -(CH2) v -NH-C(0)-(where v is between 2 and 12) (In the formula, terminal C(O), if present, is bonded to X in formula (XV).) A group including, or preferably a group consisting of, Alternatively, if X does not exist, it is combined with W1 in equation (XV), or if W1 also does not exist, it is combined with V in equation (XV). W1, W3, and W5 either do not exist independently, or -(CH2) r -(In the equation, r = 1 to 7), -(CH2) s -0-(CH2) s -(In the formula, s is independently between 0 and 5), -(CH2) t -S-(CH2) t -(In the formula, t is independently between 0 and 5) A group including, or preferably a group consisting of, X is either absent, or selected from the group containing NH, NCH3, or NC2H5, or preferably from the group consisting of these. V is [ka] (In the formula, B, if present, is a modified nucleic acid base or a native nucleic acid base.) (A group including these, or preferably selected from the group consisting of these) It holds.

[0262] Appropriately, the first RNA strand is given by formula (XVI): [ka] (In the formula, b is either 0 or 1) It is a compound of, The second RNA strand is given by formula (XVII): [ka] (In the formula, c and d are independently either 0 or 1. Z1 and Z2 are the RNA portions of the first and second RNA strands, respectively. Y is either O or S, R1 is either H or methyl. n is 0, 1, 2, or 3. L is the same or different in equations (XVI) and (XVII). -(CH2)r -C(0)- (where r=2~12), -(CH2-CH2-0) s -CH2-C(0)-(where s=1~5), -(CH2) t -C0-NH-(CH2) t -NH-C(0)-(where t is independently 1-5), -(CH2) u -C0-NH-(CH2) u -C(0)-(wherein u is independently 1 to 5), and -(CH2) v -NH-C(0)-(where v is between 2 and 12) (In the formula, the terminal C(O) is bonded to the NH group (if present).) Selected from the group consisting of, b+c+d is either 2 or 3. It is a compound of [the compound].

[0263] In one example, b is 0, c is 1, and d is 1. In another example, b is 1, c is 0, and d is 1. In yet another example, b is 1, c is 1, and d is 0. In yet another example, b is 1, c is 1, and d is 1.

[0264] In one example, Y is O. In another example, Y is S.

[0265] In one example, R1 is H. In another example, R1 is methyl.

[0266] In one example, n is 0.

[0267] In one example, L is -(CH2) r -C(O)- (where r = 2 to 12). Preferably, r = 2 to 6. More preferably, r = 4 or 6, for example, 4.

[0268] In one embodiment, the first chain is given by formula (XVIII) [ka] (In the formula, b is preferably 0 or 1. It is a compound of which the second chain is of formula (XIX): [ka] (In the formula, c and d are independently preferably 0 or 1. It is a compound of, Z1 and Z2 are the RNA portions of the first and second RNA strands, respectively. Y is independently either O or S. R1 is either H or methyl. n is independently preferably 0, 1, 2, or 3. If L is the same or different in equation (XVIII) and equation (XIX), and L appears more than once in the same equation, then L is the same or different in equation (XVIII) and equation (XIX). -(CH2) r -C(0)- (where r=2~12), -(CH2-CH2-0) s -CH2-C(0)-(where s=1~5), -(CH2) t -C0-NH-(CH2) t -NH-C(0)-(where t is independently 1-5), -(CH2) u -C0-NH-(CH2) u -C(0)-(wherein u is independently 1 to 5), and -(CH2) v -NH-C(0)-(where v is between 2 and 12) (In the formula, the terminal C(O), if present, is bound to the NH group (of the linker, not the targeting ligand).) A group including, or preferably a group consisting of, b+c+d is preferably 2 or 3. It is a compound of [the compound].

[0269] Appropriately, the first RNA strand is given by formula (XX): [ka] (In the formula, b is preferably 0 or 1. It is a compound of, The second chain is given by equation (XXI): [ka] (In the formula, c and d are independently preferably 0 or 1. Z1 and Z2 are the RNA portions of the first and second RNA strands, respectively. Y is either O or S, n is 0, 1, 2, or 3. L2 is either the same or different in equations (XX) and (XXI), and the same or different in the parts enclosed by b, c, and d. [ka] Selected from the group consisting of, n is 0, L2 is [ka] And the terminal OH group is in the following part: [ka] (In the formula, F is a saturated branched or unbranched (for example, unbranched) C 1~8 Alkyl (for example, C 1~6 The alkyl chain is such that one of the carbon atoms is optionally replaced by an oxygen atom, provided that the oxygen atom is separated from another heteroatom (e.g., an O or N atom) by at least two carbon atoms. L is the same or different in equations (XX) and (XXI). -(CH2) r-C(0)- (where r=2~12), -(CH2-CH2-0) s -CH2-C(0)-(where s=1~5), -(CH2) t -C0-NH-(CH2) t -NH-C(0)-(where t is independently 1-5), -(CH2) u -C0-NH-(CH2) u -C(0)-(wherein u is independently 1 to 5), and -(CH2) v -NH-C(0)-(where v is between 2 and 12) (In the formula, the terminal C(O) (if present) is bonded to the NH group.) Selected from the group consisting of, b+c+d is preferably 2 or 3. (Does not exist in such a way that it is formed) It is a compound of [the compound].

[0270] If GalNAc is present in any of the above formulas, GalNAc may be substituted for any other targeting ligand, such as those described herein.

[0271] Appropriately, b is 0, c is 1, and d is 1; b is 1, c is 0, and d is 1; b is 1, c is 1, and d is 0; or b is 1, c is 1, and d is 1.

[0272] More precisely, b is 0, c is 1, and d is 1, or b is 1, c is 0, and d is 1, or b is 1, c is 1, and d is 1.

[0273] Most appropriately, b is 0, c is 1, and d is 1.

[0274] In one embodiment, Y is O. In another embodiment, Y is S.

[0275] In one embodiment, R1 is H or methyl. In another embodiment, R1 is methyl.

[0276] In one embodiment, n is 0, 1, 2, or 3. Preferably, n is 0.

[0277] In one embodiment, L is -(CH2) r -C(0)- (where r=2~12), -(CH2-CH2-0) s -CH2-C(0)-(where s=1~5), -(CH2) t -C0-NH-(CH2) t -NH-C(0)-(where t is independently 1-5), -(CH2) u -C0-NH-(CH2) u -C(0)-(wherein u is independently 1 to 5), and -(CH2) v -NH-C(0)-(where v is between 2 and 12) (In the formula, the terminal C(O) is bonded to the NH group.) It is selected from the group consisting of the following.

[0278] Appropriately, L is -(CH2) r -C(O)- (where r = 2 to 12). More appropriately, r = 2 to 6. Even more appropriately, r = 4 or 6, for example, 4.

[0279] Appropriately, L is, [ka] That is the case.

[0280] An example of section F is (CH2) 1~6 For example, (CH2) 1~4 For example, CH2, (CH2)4, (CH2)5 or (CH2)6, or CH20(CH2) 2~3For example, CH20(CH2)CH3 is one such example.

[0281] Ideally, L2 is, [ka] That is the case.

[0282] Ideally, L2 is, [ka] That is the case.

[0283] Ideally, L2 is, [ka] That is the case.

[0284] Ideally, L2 is, [ka] That is the case.

[0285] Ideally, n is 0, and L2 is, [ka] And the terminal OH group is in the following part: [ka] (wherein Y is as defined elsewhere in this specification) It does not exist in such a way that it can be formed.

[0286] Within the parts enclosed by b, c, and d, L2 is usually the same. Between the parts enclosed by b, c, and d, L2 may be the same or may be different. In one embodiment, L2 in the part enclosed by c is the same as L2 in the part enclosed by d. In one embodiment, L2 in the part enclosed by c is not the same as L2 in the part enclosed by d. In one embodiment, L2 in the parts enclosed by b, c, and d is the same, for example, when the linker part is a serinol-derived linker part.

[0287] The linker moiety derived from selinol may be based on selinol of any stereochemistry derived from L-serine isomer, D-serine isomer, racemicerine, or other combinations of isomers. In a preferred embodiment of the present invention, the selinol-GalNAc moiety (SerGN) has the following stereochemistry: [ka] It has, that is, it is based on a solid supported component of (S)-serinol-amidite or succinic acid (S)-serinol derived from an L-serine isomer.

[0288] In a preferred embodiment, the first strand of the nucleic acid is a compound of formula (XVIII), and the second strand of the nucleic acid is a compound of formula (XIX), where, b is 0, c and d are 1, n is 0, Z1 and Z2 are the first and second strands of the nucleic acid, respectively. Y is S, R1 is H, L is -(CH2)4-C(O)- (wherein the formula, the terminal C(O) of L is bonded to the N atom of the linker (i.e., not to any possible N atom of the targeting ligand)).

[0289] In another preferred embodiment, the first strand of the nucleic acid is a compound of formula (XIII), and the second strand of the nucleic acid is a compound of formula (XIV), where, b is 0, c and d are 1, n is 0, Z1 and Z2 are the first and second strands of the nucleic acid, respectively. Y is S, L1 is given by equation (XV): (In the formula, W1 is -CH2-O-(CH2)3-, W3 is -CH2-, W5 does not exist. V is CH, X is NH, L has -(CH2)4-C(O)- (wherein the formula, the terminal C(O) of L is bonded to the N atom of X in formula (XV)).

[0290] In another preferred embodiment, the first strand of the nucleic acid is a compound of formula (XIII), and the second strand of the nucleic acid is a compound of formula (XIV), where, b is 0, c and d are 1, n is 0, Z1 and Z2 are the first and second strands of the nucleic acid, respectively. Y is S, L1 is given by equation (XV): (In the formula, W1, W3, and W5 do not exist. V is [ka] And, X is an existence hazard, L has -(CH2)4-C(O)-NH-(CH2)5-CO- (wherein the formula, the terminal C(O) of L is bonded to the N atom of V in formula (XV)).

[0291] In one embodiment, the targeted cells are hepatocytes.

[0292] In one embodiment, the linker portion is a serinol-derived linker portion, and the targeting ligand is conjugated exclusively to the 3' and / or 5' ends of one or both of the first and second strands of the nucleic acid, where the 5' end of the first RNA strand is not conjugated. (i) The second RNA strand is conjugated to a targeting ligand at its 5' end, (a) the second RNA strand is also conjugated to a targeting ligand at its 3' end and the 3' end of the first RNA strand is not conjugated, or (b) the first RNA strand is conjugated to a targeting ligand at its 3' end and the 3' end of the second RNA strand is not conjugated, or (c) both the second RNA strand and the first strand are also conjugated to a targeting ligand at their 3' ends, or (ii) Both the second RNA strand and the first RNA strand are conjugated to a targeting ligand at their 3' ends, and the 5' end of the second RNA strand is not conjugated. (iii) The first strand contains modified nucleotides at multiple positions, and the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with 2'-OMe modification (i.e., they have modifications other than 2'-0Me or are unmodified).

[0293] In one embodiment of the conjugate of the present invention, the second chain is conjugated to a targeting ligand at its 5' end, the second chain is also conjugated to a targeting ligand at its 3' end, and the 3' end of the first chain is not conjugated.

[0294] In one embodiment of the conjugate of the present invention, the second chain is conjugated to a targeting ligand at its 5' end, the first chain is conjugated to a targeting ligand at its 3' end, and the 3' end of the second chain is not conjugated.

[0295] In one embodiment of the conjugate of the present invention, the second chain is conjugated to a targeting ligand at its 5' end, and both the second chain and the first chain are conjugated to a targeting ligand at their 3' ends.

[0296] In one embodiment of the conjugate of the present invention, both the second chain and the first chain are conjugated to a targeting ligand at their 3' ends, while the 5' end of the second chain is not conjugated.

[0297] Inverted nucleotide In one embodiment of the nucleic acid or conjugate of the present invention, the terminal nucleotide at at least one 3' end of the first and second strands is an inverted nucleotide, bonded to an adjacent nucleotide via the 3' carbon of the terminal nucleotide and the 3' end of the adjacent nucleotide, and / or the terminal nucleotide at at least one 5' end of the first and second strands is an inverted nucleotide, bonded to an adjacent nucleotide via the 5' carbon of the terminal nucleotide and the 5' end of the adjacent nucleotide, or the nucleic acid contains a phosphorodithioate bond.

[0298] The nucleic acids of the present invention may contain inverted RNA nucleotides at one or more of the ends of the strand. Such inverted nucleotides provide stability to the nucleic acid. Preferably, the nucleic acid contains at least an inverted nucleotide at the 3' end of the first and / or second strand, and / or at the 5' end of the second strand. More preferably, the nucleic acid contains an inverted nucleotide at the 3' end of the second strand. Most preferably, the nucleic acid contains an inverted RNA nucleotide at the 3' end of the second strand, and this nucleotide is preferably inverted A. The inverted nucleotide is ligated to the 3' end of the nucleic acid by its 3' carbon, rather than by its 5' carbon, as would normally be, or ligated to the 5' end of the nucleic acid by its 5' carbon, rather than by its 3' carbon, as would normally be. The inverted nucleotide is preferably located at the end of the strand, opposite the corresponding nucleotide on the other strand, rather than as an overhang. Thus, the nucleic acid is preferably blunt-ended at the end containing the inverted RNA nucleotide. The presence of an inverted RNA nucleotide at the end of the chain preferably means that the final nucleotide at this end of the chain is the inverted RNA nucleotide. Nucleic acids having such a nucleotide are stable and easy to synthesize. The inverted RNA nucleotide is preferably an unmodified nucleotide, meaning that it contains no modifications compared to its natural nucleotide counterpart. Specifically, the inverted RNA nucleotide is preferably a 2'-OH nucleotide.

[0299] Cuttable linker A cleavable linker is a linker that is stable outside the cell but is cleaved upon entering the target cell. Cleavage releases the two parts of the linker that are currently linked together.

[0300] In a preferred embodiment, the nucleic acid of the present invention comprises a cleavable linking group that is cleaved at least 10 times or more, preferably at least 100 times faster, in target cells or under first reference conditions (which may be selected to mimic or represent, for example, intracellular conditions) than in the blood of the subject or under second reference conditions (which may be selected to mimic or represent, for example, conditions found in blood or serum).

[0301] Cleavable linking groups are susceptible to cleavage factors, such as pH, redox potential, or the presence of degradable molecules. Degradable molecules include oxidative or reducing enzymes, reducing agents (e.g., mercaptans), esterases, endosomes, or factors that can create an acidic environment, enzymes, peptidases, and phosphatases that can hydrolyze or degrade acid-cleavable linking groups by acting as general acids.

[0302] The cleavable linking group can be a disulfide bond, which is susceptible to pH changes.

[0303] The linker may contain cleavable linking groups that can be cleaved by specific enzymes. The type of cleavable linking group incorporated into the linker may depend on the target cell. For example, if liver cells are the target, a linker containing an ester group is preferred. If peptidase-rich cells, such as liver cells and synovial cells, are targeted, a linker containing a peptide bond may be used.

[0304] Generally, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradation factor (or condition) to cleave the candidate linking group. It is also desirable to test the candidate cleavable linking group for its ability to resist cleavage in blood or in contact with other non-target tissues. In a preferred embodiment, a useful candidate compound is cleaved at least 2, 4, 10, or 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0305] In one embodiment, the cleavable linking group may be a redox cleavable linking group. The redox cleavable linking group may be a disulfide linking group.

[0306] In one embodiment, the linking group may be a phosphate-based cleavable linking group. Preferred embodiments are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S-. A preferred embodiment is -OP(O)(OH)-O-.

[0307] In one embodiment, the cleavable linking group may be an acid-cleavable linking group. Preferably, the acid-cleavable linking group is cleaved in an environment with a pH of 6.5 or less, or by a factor such as an enzyme that can act as a general acid. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and amino acid esters. The acid-cleavable group may have the general formula -C=NN-, C(O)O, or -OC(O). A preferred embodiment is a linking group in which the carbon bonded to the oxygen of the ester (alkoxy group) is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethylpentyl or t-butyl.

[0308] In one embodiment, the cleavable linking group may be an ester-based cleavable linking group. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups.

[0309] In one embodiment, the cleavable linking group may be a peptide-based cleavable linking group. A peptide-based cleavable linking group is a peptide bond formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleaving groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids to yield peptides and proteins, and do not include the entire amide functional group. A peptide-based cleavable linking group may have the general formula -NHCHR A C(O)NHCHR B C(O)-(wherein, R A and R B It has the R group of two adjacent amino acids.

[0310] lipid formulation The nucleic acids described herein may be formulated in the form of liposomes using lipids. Such formulations may be described in the art as lipoplexes. Compositions having lipids / liposomes may be used to assist in the delivery of the nucleic acids of the present invention to target cells. The lipid delivery systems described herein may be used as substitutes for conjugated ligands. When the nucleic acids of the present invention are used with a lipid delivery system or a ligand-conjugated delivery system, the modifications described herein may be present.

[0311] Such lipoplex, i) Cationic lipids, or pharmaceutically acceptable salts thereof ii) Steroids, iii) Phosphatidylethanolamine phospholipids, iv) PEGylated lipids It may contain a lipid composition that includes the following:

[0312] Cationic lipids can be aminocationic lipids.

[0313] Cationic lipids are given by formula (XXII): [ka] or its pharmaceutically acceptable salt (In the formula, X represents O, S, or NH. R 1 and R 2 These are, independently, C4~C 22 Linear or branched alkyl chains or C4-C having one or more double bonds 22 Represents a linear or branched alkenyl chain, and the alkyl or alkenyl chain optionally contains an intervening ester, amide, or disulfide. If X represents S or NH, then R 3 and R 4 Each of these independently represents a hydrogen, methyl, ethyl, monoamine, or polyamine moiety, or R 3 and R 4 They form a heterocyclyl ring together, If X represents O, then R 3 and R 4 Each of these independently represents a hydrogen, methyl, ethyl, monoamine, or polyamine moiety, or R 3 and R 4 They either form a heterocyclyl ring together, or R 3 represents hydrogen, R 4 (This represents C(NH)(NH2)) It may have.

[0314] Cationic lipids are given by formula (XXIII): [ka] Or it may have a pharmaceutically acceptable salt thereof.

[0315] Cationic lipids are given by formula (XXIV): [ka] Or it may have a pharmaceutically acceptable salt thereof.

[0316] The content of cationic lipid components can be approximately 55 mol% to 65 mol% of the total lipid content of the formulation. In particular, cationic lipid components account for approximately 59 mol% of the total lipid content of the formulation.

[0317] The formulation further contains steroids, which may be cholesterol. The steroid content may be approximately 26 mol% to 35 mol% of the total lipid content of the lipid formulation. More specifically, the steroid content may be approximately 30 mol% of the total lipid content of the lipid formulation.

[0318] Phosphatidylethanolamine phospholipids include 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE), 1,2-dimiristoyl-sn-glycero-3-phosphoethanolamine (DMPE), and 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine. The phospholipids may be selected from the group consisting of phosphoethanolamine (DPPE), 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine (DLoPE), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE), 1,2-dielcoyl-sn-glycero-3-phosphoethanolamine (DEPE), 1,2-disquareoyl-sn-glycero-3-phosphoethanolamine (DSQPE), and 1-stearoyl-2-linoleoyl-sn-glycero-3-phosphoethanolamine (SLPE). The phospholipid content may be about 10 mol% of the total lipid content of the composition.

[0319] PEGylated lipids can be selected from the group consisting of 1,2-dimiristoyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG), and C16-ceramide-PEG. The content of PEGylated lipids may be approximately 1 mol% to 5 mol% of the total lipid content of the formulation.

[0320] The content of cationic lipid components in the composition may be about 55 mol% to about 65 mol% of the total lipid content of the lipid compound, preferably about 59 mol% of the total lipid content of the lipid compound.

[0321] The composition may have the molar ratios of components i):ii):iii):iv) which can be selected from 55:34:10:1, 56:33:10:1, 57:32:10:1, 58:31:10:1, 59:30:10:1, 60:29:10:1, 61:28:10:1, 62:27:10:1, 63:26:10:1, 64:25:10:1, and 65:24:10:1.

[0322] Composition, structure [ka] Cationic lipids having structure [ka] Steroids having structure [ka] Phosphatidylethanolamine phospholipid having, and structure [ka] It may contain PEGylated lipids having the following properties.

[0323] Neutral liposome compositions can be formed from, for example, dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions can be formed from dimyristoyl phosphatidylglycerol, while anionic membrane-fused liposomes can be formed mainly from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposome composition can be formed from phosphatidylcholine (PC), such as soy PC and egg PC. Another type can be formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0324] Using the positively charged synthetic cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), it is possible to form small liposomes that spontaneously interact with nucleic acids to form lipid-nucleic acid complexes capable of fusing with the negatively charged lipids of the cell membrane of tissue culture cells. Alternatively, liposomes can be formed using DOTMA analogs.

[0325] Liposomes can be formed using the lipid derivatives and analogs described herein.

[0326] Liposomes containing nucleic acids can be prepared by various methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed using the lipid component. For example, the lipid component may be an amphiphilic cationic lipid or a lipid conjugate. The detergent may have a high critical micelle concentration and may be nonionic. Exemplary detergents include cholates, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. Next, the nucleic acid preparation is added to the micelles containing the lipid component. The cationic groups on the lipid interact with the nucleic acid and condense around the nucleic acid to form liposomes. After condensation, the detergent is removed, for example by dialysis, to obtain the nucleic acid liposome preparation.

[0327] If necessary, a support compound to assist in condensation may be added during the condensation reaction, for example, by controlled addition. For example, the support compound may be a polymer other than nucleic acid (e.g., spermine or spermidine). The pH can be adjusted to favor condensation.

[0328] surfactants Nucleic acid formulations may contain surfactants. In one embodiment, the nucleic acid is formulated as an emulsion containing a surfactant.

[0329] Non-ionized surfactants are nonionic surfactants. Examples include nonionic esters such as ethylene glycol esters, propylene glycol esters, and glyceryl esters, nonionic alkanolamides, and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers.

[0330] Surfactants that acquire a negative charge when dissolved or dispersed in water are anionic surfactants. Examples include carboxylates, such as soaps, acyl acrylates, acylamides of amino acids, sulfuric acid esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkylbenzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.

[0331] Surfactants that acquire a positive charge when dissolved or dispersed in water are called cationic surfactants. Examples include quaternary ammonium salts and ethoxylated amines.

[0332] Surfactants that have the ability to acquire either a positive or negative charge are called amphoteric surfactants. Examples include acrylic acid derivatives, substituted alkylamides, N-alkyl betaines, and phosphatides.

[0333] The term "micelle" is defined herein as a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure such that all of the hydrophobic parts of the molecules face inward and the hydrophilic parts are in contact with the surrounding aqueous phase. The reverse arrangement exists when the environment is hydrophobic. Micelles can be formed by mixing aqueous solutions of nucleic acids, alkali metal alkyl sulfates, and at least one micelle-forming compound.

[0334] Exemplary micelle-forming compounds include lecithin, hyaluronic acid, pharmaceutically acceptable salts of hyaluronic acid, glycolic acid, lactic acid, chamomile extract, cucumber extract, oleic acid, linoleic acid, linolenic acid, monoolein, monooleate, monolaurate, borage oil, evening primrose oil, menthol, trihydroxyoxocolanyglycine and its pharmaceutically acceptable salts, glycerin, polyglycerin, lysine, polylysine, triolein, polyoxyethylene ethers and their analogues, polydocanol alkyl ethers and their analogues, chenodeoxycholates, deoxycholates, and mixtures thereof.

[0335] Phenol and / or m-cresol may be added to the mixed micelle composition to act as stabilizers and preservatives. Isotonic agents such as glycerin may also be added.

[0336] Nucleic acid preparations may be incorporated into particles such as microparticles. Microparticles can be produced by spray drying, freeze-drying, evaporation, fluidized bed drying, vacuum drying, or a combination of these methods.

[0337] Pharmaceutical composition The present invention also provides pharmaceutical compositions comprising nucleic acids or conjugated nucleic acids. These pharmaceutical compositions may be used alone or in combination with other active agents as pharmaceuticals or diagnostic agents. For example, the nucleic acids or conjugated nucleic acids of the present invention can be combined with delivery vehicles (e.g., liposomes) and additives such as carriers and diluents. Other active agents such as preservatives and stabilizers may also be added. Methods relating to the delivery of nucleic acids or conjugated nucleic acids are known in the art and are within the scope of the knowledge of those skilled in the art.

[0338] The nucleic acids or conjugated nucleic acids of the present invention can also be administered in combination with other therapeutic compounds, separately or simultaneously, for example, as a combined unit dose. The present invention also encompasses pharmaceutical compositions comprising the nucleic acids or conjugated nucleic acids of the present invention in physiologically / pharmaceutically acceptable additives, such as stabilizers, preservatives, diluents, buffers, etc.

[0339] Pharmaceutical compositions may be specially formulated for administration in solid or liquid form. Compositions may be formulated for oral administration, parenteral administration (including, for example, subcutaneous, intramuscular, intravenous, or epidural injection), topical application, vaginal or rectal administration, sublingual administration, ophthalmic administration, transdermal administration, or nasal administration. Subcutaneous or intravenous delivery is preferred.

[0340] Dosage The dosage levels of the agents and pharmaceutical compositions of the present invention can be determined by routine experiments by those skilled in the art. In one embodiment, the unit dose may contain nucleic acid in amounts ranging from about 0.01 mg / kg(body weight) to about 100 mg / kg(body weight). Alternatively, the dose may be 10 mg / kg(body weight) to 25 mg / kg(body weight), or 1 mg / kg(body weight) to 10 mg / kg(body weight), or 0.05 mg / kg(body weight) to 5 mg / kg(body weight), or 0.1 mg / kg(body weight) to 5 mg / kg(body weight), or 0.1 mg / kg(body weight) to 1 mg / kg(body weight), or 0.1 mg / kg(body weight) to 0.5 mg / kg(body weight), or 0.5 mg / kg(body weight) to 1 mg / kg(body weight). The dosage level may also be calculated using other parameters, such as body surface area.

[0341] The pharmaceutical composition may be a sterile aqueous suspension or aqueous solution for injection, or it may exist in a lyophilized form. In one embodiment, the pharmaceutical composition may comprise a lyophilized lipoplex or an aqueous suspension of lipoplex. The lipoplex preferably comprises the nucleic acid of the present invention. Using such a lipoplex, the nucleic acid of the present invention can be delivered to target cells either in vitro or in vivo.

[0342] The pharmaceutical compositions and agents of the present invention can be administered to mammals in pharmaceutically effective doses. Mammals may be selected from humans, dogs, cats, horses, cattle, pigs, goats, sheep, mice, rats, hamsters, and guinea pigs.

[0343] medical use Further aspects of the present invention relate to nucleic acids or conjugated nucleic acids of the present invention, or pharmaceutical compositions comprising nucleic acids or conjugated nucleic acids of the present invention, for use in the treatment or prevention of diseases or disorders. The present invention encompasses pharmaceutical compositions comprising one or more RNAi molecules according to the present invention in physiologically / pharmaceutically acceptable additives, such as stabilizers, preservatives, diluents, buffers, etc. Nucleic acids or conjugated nucleic acids of the present invention, or pharmaceutical compositions comprising nucleic acids or conjugated nucleic acids of the present invention, are preferably for use in the treatment or prevention of diseases or disorders in which it is desirable to reduce the expression level of target genes targeted by the nucleic acids of the present invention.

[0344] The pharmaceutical composition may be a sterile aqueous suspension or aqueous solution for injection, or it may exist in a lyophilized form.

[0345] Pharmaceutical combinations A pharmaceutically acceptable composition may contain one or more nucleic acids in therapeutically effective amounts in any embodiment of the present invention, either alone or in combination with one or more pharmaceutically acceptable carriers, additives, and / or diluents.

[0346] Examples of materials that can function as pharmaceutically acceptable carriers include: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) tragacanth powder; (5) malt; (6) gelatin; (7) lubricants such as magnesium stearate, sodium lauryl sulfate, and talc; (8) additives such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols such as propylene glycol; (11 (12) Polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; (13) Esters such as ethyl oleate and ethyl laurate; (14) Buffers such as magnesium hydroxide and aluminum hydroxide; (15) Alginic acid; (16) Pyrogen-free water; (17) Isotonic saline; (18) Ringer's solution; (19) Ethyl alcohol; (20) pH buffer solution; (21) Polyesters, polycarbonates, and / or polyacid anhydrides; (22) Expanders such as polypeptides and amino acids; (23) Serum components such as serum albumin, HDL, and LDL; and (22) Other non-toxic, suitable substances used in pharmaceutical formulations.

[0347] Stabilizers may be substances that stabilize nucleic acid agents, such as proteins that can form complexes with nucleic acids, chelating agents (e.g., EDTA), salts, RNA-degrading enzyme inhibitors, and DNA-degrading enzyme inhibitors.

[0348] In some cases, it is desirable to slow down the absorption of a drug from subcutaneous or intramuscular injection in order to prolong its effects. This can be achieved by using a liquid suspension of a crystalline or amorphous material that is poorly water-soluble. Thus, the absorption rate of a drug depends on its dissolution rate, which in turn may depend on the crystal size and morphology. Alternatively, delayed absorption of parenterally administered drug forms can be achieved by dissolving or suspending the drug in an oil vehicle.

[0349] Inhibition The nucleic acids described herein may be capable of inhibiting the expression of target genes in cells. The nucleic acids described herein may be capable of partially inhibiting the expression of target genes in cells. The inhibition may be complete, i.e., 0% of the expression level of the target gene in the absence of the nucleic acid of the present invention. The inhibition of target gene expression may be partial, i.e., 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% of the expression of the target gene in the absence of the nucleic acid of the present invention. When used in subjects such as human subjects, the inhibition may last for 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, or up to 3 months. Compositions containing the nucleic acid or nucleic acid composition of the present invention may be for use once a week, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, or every 8 weeks. Nucleic acids may be used subcutaneously, intravenously, or via any other route of application, such as orally, rectally, or intraperitoneally.

[0350] Expression can be measured in cells to which the nucleic acid is applied. Alternatively, especially when the nucleic acid is administered in a specific manner, levels can be measured in tissues or various groups of tissues or organs, or in bodily fluids such as blood, plasma, or lymph. The level of inhibition is preferably measured under conditions selected for showing the maximum effect of the nucleic acid on target mRNA levels in cells treated with the nucleic acid in vitro. The level of inhibition can be measured, for example, 24 or 48 hours after treatment with the nucleic acid of the present invention at concentrations of 0.038 nM to 10 μM, preferably 1 nm, 10 nm, or 100 nm. These conditions may vary depending on different nucleic acid sequences or different types of nucleic acids, for example, whether they are unmodified or modified, or whether they are conjugated or unconjugated to a ligand. Examples of suitable conditions for determining the level of inhibition are described in the examples.

[0351] In cells and / or subjects treated with the nucleic acids of the present invention, or receiving the nucleic acids of the present invention, target gene expression may be inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% compared to untreated cells and / or subjects. The level of inhibition may enable the treatment of diseases associated with target gene expression or overexpression, or enable further research into the function of the target gene product.

[0352] target genes The target genes are TMPRSS6, ALDH2, LPA, factor VII, Eg5, PCSK9, TPX2, apoB, SAA, TTR, RSV, PDGF beta gene, Erb-B gene, Src gene, CRK gene, GRB2 gene, RAS gene, MEKK gene, JNK gene, RAF gene, Erkl / 2 gene, PCNA(p21) gene, MYB gene, JU gene, FOS gene, BCL-2, hepcidin, activated protein C, cyclin D gene, VEGF gene, EGFR gene, cyclin A gene, cyclin E gene, WNT-1 gene, beta-catenin gene, c-MET gene, PKC gene, NFKB gene, STAT3 gene, survivor gene, Her2 / Neu gene, topoisomerase I gene, topoisomerase II alpha gene, mutations in the p73 gene, and p21(WAF These mutations may be in the l / CIPI gene, the p27(KIPI) gene, the PPM ID gene, the RAS gene, the caveolin I gene, the MIB I gene, the MTAI gene, the M68 gene, tumor suppressor genes, and the p53 tumor suppressor gene.

[0353] In one embodiment, the target gene is TMPRSS6.

[0354] In one embodiment, the target gene is TMPRSS6, and the first strand is (vp)-UACCAGAAGAAGCAGGUGA(Sequence No. 68) This includes and / or (preferably, and) the second chain is UCACCUGCUUCUUCUGGUA (Sequence ID 69) Includes.

[0355] In another embodiment, the target gene is TMPRSS6, and the first strand is (vp)-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA (Sequence ID 9) This includes and / or (preferably, and) the second chain is fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA (SEQ ID NO: 70) Includes, In the formula, mA, mU, mC, and mG represent 2'-OMe RNA, fA, fU, fC, and fG represent 2'-deoxy-2'-F RNA, (ps) represents a phosphorothioate bond, and (vp)-mU represents (E)-vinylphosphonate mU.

[0356] In another embodiment, the target gene is not TMPRSS6.

[0357] In one embodiment, the target gene is TTR.

[0358] In one embodiment, the target gene is TTR, and the first strand is (vp)-UUAUAGAGCAAGAACACUGUU(Sequence ID 71) This includes and / or (preferably, and) the second chain is AACAGUGUUCUUGCUCUAUAA (Sequence ID 72) Includes.

[0359] In another embodiment, the target gene is TTR, and the first strand is (vp)-mUfU mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU(Sequence ID 3) This includes and / or (preferably, and) the second chain is fA(ps)mA(ps)fCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU(ps)mA(ps)fA(Sequence ID 73) Includes, In the formula, mA, mU, mC, and mG represent 2'-OMe RNA, fA, fU, fC, and fG represent 2'-deoxy-2'-F RNA, (ps) represents a phosphorothioate bond, and (vp)-mU represents (E)-vinylphosphonate mU.

[0360] In one embodiment, the target gene is ALDH2.

[0361] In one embodiment, the target gene is ALDH2, and the first strand is (vp)-UCUUCUUAAACUGAGUUUC(Sequence ID 74) This includes and / or (preferably, and) the second chain is GAAACUCAGUUUAAGAAGA (Sequence No. 75) Includes.

[0362] In another embodiment, the target gene is ALDH2, and the first strand is (vp)-mUfCmUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC(Sequence ID 19) This includes and / or (preferably, and) the second chain is mG(ps)mA(ps)mAmAmCmUfCfAfGmUmUmUmAmAmGmAmA(ps)mG(ps)mA(Sequence ID 76) Includes, In the formula, mA, mU, mC, and mG represent 2'-OMe RNA, fA, fU, fC, and fG represent 2'-deoxy-2'-F RNA, (ps) represents a phosphorothioate bond, and (vp)-mU represents (E)-vinylphosphonate mU.

[0363] In another embodiment, the target gene is ALDH2, and the first strand is (vp)-mUfCmUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(psmC(Sequence ID 19) This includes and / or (preferably, and) the second chain is fG(ps)mA(ps)fAmAfCmUfCmAfGmUfUmUfAmAfGmAfA(ps)mG(ps)fA(Sequence ID 77) Includes, In the formula, mA, mU, mC, and mG represent 2'-OMe RNA, fA, fU, fC, and fG represent 2'-deoxy-2'-F RNA, (ps) represents a phosphorothioate bond, and (vp)-mU represents (E)-vinylphosphonate mU.

[0364] In one embodiment, the target gene is a gene other than LPA and / or complement component gene (a gene encoding a protein of the complement system or pathway of the immune system) and / or ALDH2 and / or TMPRSS6 and / or TTR.

[0365] Swiss A further aspect of the present invention relates to nucleic acids in the manufacture of agents for treating or preventing diseases or disorders.

[0366] Treatment method Furthermore, the present invention encompasses methods for treating or preventing diseases or disorders, including the administration of a pharmaceutical composition containing nucleic acids or conjugated nucleic acids as described herein to an individual in need of treatment. The nucleic acid composition may be administered twice weekly, weekly, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks, or every eight weeks. The nucleic acids or conjugated nucleic acids may be administered to the subject subcutaneously, intravenously, or by any other route of application, such as orally, rectally, or intraperitoneally.

[0367] In one embodiment, the subject is administered an initial dose and one or more maintenance doses of a nucleic acid agent. The maintenance dose(s) may be the same as or less than the initial dose, for example, less than half of the initial dose. The maintenance dose is administered, for example, once or less every 2 days, 5 days, 10 days, or 30 days. The treatment regimen may be continued for a variety of periods depending on the nature of the specific disease, its severity, and the patient's overall condition.

[0368] combination In one embodiment, the composition comprises a plurality of nucleic acid species. In another embodiment, the nucleic acid species have sequences that do not overlap with or are not adjacent to other species with respect to naturally occurring target sequences. In another embodiment, the plurality of nucleic acid species are specific to different naturally occurring target genes. In another embodiment, the nucleic acid species are allele-specific.

[0369] The nucleic acids or conjugated nucleic acids of the present invention may also be administered in combination with other therapeutic compounds, or may be intended for use in combination with other therapeutic compounds, and may be administered separately or simultaneously, for example, as a compound unit dose.

[0370] Manufacturing method The nucleic acids or conjugated nucleic acids of the present invention can be produced using methods routine in the art, including chemical synthesis or in vitro (e.g., run-off transcription) or in vivo expression of nucleic acids, for example, by using solid-phase chemical synthesis or by using expression vectors. In one embodiment, an expression vector can produce the nucleic acids of the present invention in target cells. Methods relating to the synthesis of nucleic acids described herein are known to those skilled in the art.

[0371] presentation Some aspects of the present invention are defined by the following presentation:

[0372] 1. A nucleic acid for inhibiting the expression of a target gene in a cell, comprising at least one double-stranded region including at least a portion of a first strand and a portion of a second strand at least partially complementary to the first strand, wherein the first strand is at least partially complementary to at least a portion of the RNA transcribed from the target gene to be inhibited, and the first strand has a terminal 5'(E)-vinylphosphonate nucleotide, the terminal 5'(E)-vinylphosphonate nucleotide being linked to the second nucleotide in the first strand by a phosphodiester bond.

[0373] 2. The nucleic acid described in Presentation 1, wherein the first chain contains more than one phosphodiester bond.

[0374] 3. The nucleic acid according to Presentation 2, wherein the first chain contains phosphodiester bonds between at least three terminal 5' nucleotides.

[0375] 4. The nucleic acid according to Presentation 3, wherein the first chain includes phosphodiester bonds between at least four terminal 5' nucleotides.

[0376] 5. The first chain is given by equation (Ia): (vp)-N(po)[N(po)] n - (Ia) (In the formula, "(vp)" is 5'(E)-vinylphosphonate, "N" is a nucleotide, "po" is a phosphodiester bond, and n is 1 to (total number of nucleotides in the first chain - 2), preferably n is 1 to (total number of nucleotides in the first chain - 3), and more preferably n is 1 to (total number of nucleotides in the first chain - 4)) The nucleic acids described in Presentation 3, including the nucleic acids described in Presentation 3.

[0377] 6. A nucleic acid according to any one of presentations 1 to 5, wherein the first chain contains at least one phosphorothioate (ps) bond.

[0378] 7. The nucleic acid according to Presentation 6, wherein the first chain further comprises a phosphorothioate bond between two terminal 3' nucleotides or a phosphorothioate bond between three terminal 3' nucleotides.

[0379] 8. The nucleic acid described in Presentation 7, wherein the bonds between other nucleotides in the first chain are phosphodiester bonds.

[0380] 9. The nucleic acid described in Presentation 6, wherein the first chain contains more than one phosphorothioate bond.

[0381] 10. The nucleic acid according to Presentations 1 to 9, wherein the second strand includes a phosphorothioate bond between two terminal 3' nucleotides or a phosphorothioate bond between three terminal 3' nucleotides.

[0382] 11. The nucleic acid according to Presentations 1 to 10, wherein the second strand includes a phosphorothioate bond between two terminal 5' nucleotides or a phosphorothioate bond between three terminal 5' nucleotides.

[0383] 12. A nucleic acid as described in any one of the above presentations, wherein the terminal 5'(E)-vinylphosphonate nucleotide is an RNA nucleotide.

[0384] 13. A nucleic acid as described in any of the above presentations, wherein the first strand of the nucleic acid has a length in the range of 15 to 30 nucleotides.

[0385] 14. The nucleic acid described in Presentation 13, wherein the first strand of the nucleic acid has a length in the range of 19 to 25 nucleotides.

[0386] 15. A nucleic acid as described in any of the above presentations, wherein the second strand of the nucleic acid has a length in the range of 15 to 30 nucleotides.

[0387] 16. The nucleic acid according to Presentation 15, wherein the second strand of the nucleic acid has a length in the range of 19 to 25 nucleotides.

[0388] 17. A nucleic acid described in any of the above presentations, having blunt ends at both ends.

[0389] 18. A nucleic acid according to any of the above presentations, wherein one or more nucleotides on the first chain are modified to form a modified nucleotide.

[0390] 19. The nucleic acid according to Presentation 18, wherein one or more nucleotides on the second strand are modified to form a modified nucleotide.

[0391] 20. The nucleic acid according to presentation 18 or 19, wherein the modification is a modification of the 2'-OH group of a ribose sugar, which is optionally selected from 2'-OMe or 2'-F modification.

[0392] 21. The nucleic acid according to Presentations 18 to 20, wherein one or more odd-numbered nucleotides of the first chain are modified nucleotides having a first modification with the 2'OH group of a ribose sugar, and one or more even-numbered nucleotides of the first chain are differently modified nucleotides having a second modification with the 2'OH group of a ribose sugar, and the first and second modifications are different.

[0393] 22. The nucleic acid described in Presentation 21, wherein the first modification is 2'-OMe and the second modification is 2'-F, or vice versa.

[0394] 23. A nucleic acid as described in any of the above presentations, wherein no 2'-methoxyethyl modified nucleotides are present in the first chain.

[0395] 24. A nucleic acid described in any of the above presentations, the target gene being TMPRSS6.

[0396] 25. The first chain, (vp)-UACCAGAAGAAGCAGGUGA(Sequence No. 68) It includes and / or (preferably, and) a second chain, UCACCUGCUUCUUCUGGUA (Sequence ID 69) The nucleic acids described in Presentation 24, including the nucleic acids described in Presentation 24.

[0397] 26. The first chain, (vp)-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA (Sequence ID 9) It includes and / or (preferably, and) a second chain, fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA (SEQ ID NO: 70) Includes, The nucleic acid described in Presentation 25, wherein mA, mU, mC, and mG each represent 2'-OMe RNA, fA, fU, fC, and fG each represent 2'-deoxy-2'-F RNA, (ps) represents a phosphorothioate bond, and (vp)-mU represents (E)-vinylphosphonate mU.

[0398] 27. A conjugate for inhibiting the expression of a target gene in a cell, comprising a nucleic acid portion and a ligand portion, wherein the nucleic acid portion comprises a nucleic acid as defined in any one of presentations 1 to 26.

[0399] 28. The conjugate described in Presentation 27, wherein the second chain of the nucleic acid is conjugated to the ligand.

[0400] 29. The conjugate according to Presentation 27 or 28, comprising one or more GalNAc ligands and derivatives thereof, wherein the ligand portion includes, for example, a GalNAc moiety at the 5' end of the second strand of a nucleic acid.

[0401] 30. The conjugate according to any one of presentations 27 to 29, wherein the ligand portion comprises a linker portion and a targeting ligand, and the linker portion links the targeting ligand to the nucleic acid portion.

[0402] 31. The ligand portion is a serinol-derived linker portion, and the targeting ligand is conjugated exclusively to the 3' and / or 5' ends of one or both of the first and second strands of the nucleic acid, with the 5' end of the first RNA strand not being conjugated. (i) The second RNA strand is conjugated with a targeting ligand at its 5' end, (a) The second RNA strand is also conjugated with a targeting ligand at its 3' end, and the 3' end of the first RNA strand is not conjugated, or (b) The first strand is conjugated with a targeting ligand at its 3' end, and the 3' end of the second strand is not conjugated, or (c) Both the second and first strands are also conjugated with a targeting ligand at their 3' ends, or (ii) Both the second and first chains are conjugated with a targeting ligand at their 3' ends, and the 5' end of the second chain is not conjugated, (iii) The conjugate according to Presentation 30, wherein the first nucleic acid contains modified nucleotides at multiple positions, and the nucleotides at positions 2 and 14 from the 5' end of the first chain are not modified with 2'-OMe modification.

[0403] 32. The conjugate described in Presentation 31, wherein the nucleotides at positions 2 and 14 from the 5' end of the first chain are modified.

[0404] 33. The conjugate described in Presentation 32, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified by 2'-OMe modification, and the nucleotide on the second strand corresponding to position 13 of the first strand is not modified by 2'-OMe modification.

[0405] 34. The conjugate described in Presentation 32, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified by 2'-OMe modification, and the nucleotide on the second strand corresponding to position 11 of the first strand is not modified by 2'-OMe modification.

[0406] 35. The conjugate described in Presentations 32 to 34, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with 2'-OMe modification, and the nucleotides on the second strand corresponding to positions 11 and 13 of the first strand are not modified with 2'-OMe modification.

[0407] 36. A conjugate according to any one of presentations 31 to 35, wherein a nucleotide on the second strand corresponding to the 11th and / or 13th positions from the 5' end of the first strand is modified.

[0408] 37. The conjugates according to presentations 32 to 36, wherein the nucleotides at positions 2 and 14 from the 5' end of the first chain are not modified by 2'-OMe modification, and the nucleotides on the second chain corresponding to positions 11, 13, 11 and 13, or 11-13 of the first chain are modified by 2'-fluoro modification.

[0409] 38. The conjugate according to any one of presentations 32 to 37, wherein the nucleotides at positions 2 and 14 from the 5' end of the first chain are modified with a 2'-fluoro compound, and the nucleotide on the second chain corresponding to position 11, or 13, or positions 11 and 13, or positions 11 to 13 of the first chain is not modified with a 2'-OMe compound.

[0410] 39. A conjugate according to any one of presentations 32 to 38, wherein the nucleotides at positions 2 and 14 from the 5' end of the first chain are modified with a 2' fluoropolymer, and the nucleotides on the second chain corresponding to positions 11, 13, 11 and 13, or 11 to 13 of the first chain are modified with a 2' fluoropolymer.

[0411] 40. A conjugate according to any one of presentations 31 to 39, wherein more than 50% of the nucleotides of the first and / or second chains contain 2'-OMe modifications, for example, more than 55%, 60%, 65%, 70%, 75%, 80%, or 85% or more of the nucleotides of the first and / or second chains contain 2'-OMe modifications, preferably measured as a percentage of the total nucleotides of both the first and second chains.

[0412] 41. A conjugate according to any one of presentations 31 to 40, comprising 20% ​​or less (e.g., 15% or less or 10% or less) of 2' fluoromodifications on the first and / or second strands as a percentage of the total nucleotides of both strands.

[0413] 42. A conjugate according to any one of presentations 31 to 42, wherein the terminal nucleotide at at least one 3' end of the first and second strands is an inverted nucleotide and is bonded to an adjacent nucleotide via the 3' carbon of the terminal nucleotide and the 3' carbon of the adjacent nucleotide, and / or the terminal nucleotide at at least one 5' end of the first and second strands is an inverted nucleotide and is bonded to an adjacent nucleotide via the 5' carbon of the terminal nucleotide and the 5' carbon of the adjacent nucleotide, or the nucleic acid comprises a phosphorodithioate bond.

[0414] 43. The conjugates described in Presentations 31 to 42, wherein the second chain is conjugated with a targeting ligand at its 5' end, the second chain is also conjugated with a targeting ligand at its 3' end, and the 3' end of the first chain is not conjugated.

[0415] 44. The conjugate described in Presentations 31 to 42, wherein the second chain is conjugated to a targeting ligand at its 5' end, the first chain is conjugated to a targeting ligand at its 3' end, and the 3' end of the second chain is not conjugated.

[0416] 45. The conjugates described in presentations 31 to 42, wherein the second chain is conjugated to a targeting ligand at its 5' end, and both the second chain and the first chain are conjugated to a targeting ligand at their 3' ends.

[0417] 46. ​​The conjugates described in presentations 31 to 42, wherein both the second and first chains are conjugated to a targeting ligand at their 3' ends, and the 5' end of the second chain is not conjugated.

[0418] 47. A conjugate according to any one of presentations 31 to 46, wherein the ligand is a monomeric ligand.

[0419] 48. The conjugated chain is conjugated to the targeting portion via a linker portion containing further linkers, preferably a selinol-derived linker portion, the further linkers being saturated unbranched or branched C 1~15 Alkyl chains, or saturated unbranched or branched C 1~15 The alkyl chain contains, optionally, one or more carbon atoms (e.g., one, two, or three carbon atoms, preferably one or two, especially one) which are O, N, S(O) p The conjugate according to any one of presentations 31 to 47, wherein the chain is replaced by a heteroatom selected from (wherein p is 0, 1, or 2) (for example, a CH2 group is replaced with O, or NH, or S, or SO2, or a -CH3 group at the end of the chain or on a branch is replaced with OH, or NH2), and the chain is optionally replaced by one or more oxo groups (for example, one to three groups such as one group).

[0420] 49. Further linkers form saturated, unbranched C1~15 The conjugate according to Presentation 48, comprising an alkyl chain, wherein one or more carbon atoms (e.g., one, two, or three carbon atoms, preferably one or two, particularly one) are replaced by oxygen atoms.

[0421] 50. The conjugate described in Presentation 49, further comprising a PEG chain, with additional linkers.

[0422] 51. Further linkers form saturated, unbranched C 1~15 A conjugate containing an alkyl chain, as described in Presentation 48.

[0423] 52. Further linkers, saturated unbranched C 1~6 A conjugate containing an alkyl chain, as described in Presentation 51.

[0424] 53. The conjugate according to Presentation 52, wherein the further linker comprises a saturated unbranched C4 or C6 alkyl chain, for example, a C4 alkyl chain.

[0425] 54. The first chain is given by equation (XXV): [ka] (In the formula, b is either 0 or 1) It is a compound of, The second chain is given by equation (XXVI): [ka] (In the formula, c and d are independently either 0 or 1. Z1 and Z2 are the first and second strands, respectively. Y is either O or S, R1 is either H or methyl. n is 0, 1, 2, or 3. L is the same or different in equations (XVI) and (XVII). -(CH2) q -(In the equation, q = 2 to 12), -(CH2) r-C(0)- (where r=2~12), -(CH2-CH2-0) s -CH2-C(0)-(where s=1~5), -(CH2) t -C0-NH-(CH2) t -NH-C(0)-(where t is independently 1-5), -(CH2) u -C0-NH-(CH2) u -C(0)-(wherein u is independently 1 to 5), and -(CH2) v -NH-C(0)-(where v is between 2 and 12) (In the formula, the terminal C(O) is bonded to the NH group (if present).) Selected from the group consisting of, b+c+d is either 2 or 3. The conjugate described in presentations 31 to 42, which is a compound of the above.

[0426] 55. The conjugate described in Presentation 54, where b is 0, c is 1, and d is 1.

[0427] 56. The conjugate described in Presentation 54, where b is 1, c is 0, and d is 1.

[0428] 57. The conjugate described in Presentation 54, where b is 1, c is 1, and d is 0.

[0429] 58. The conjugate described in Presentation 54, where b is 1, c is 1, and d is 1.

[0430] 59. A conjugate described in any one of the suggestions 54 to 58, where Y is O.

[0431] 60. A conjugate described in any one of the presentations 54 to 58, where Y is S.

[0432] 61. A conjugate described in any one of presentations 54 to 60, wherein R1 is H.

[0433] 62. A conjugate according to any one of presentations 54 to 60, wherein R1 is methyl.

[0434] 63. A conjugate described in any one of presentations 54 to 62, where n is 1.

[0435] 64. A conjugate described in any one of the suggestions 51 to 63, wherein L is -(CH2)rC(O)- (where r=2 to 12).

[0436] 65. The conjugate described in Presentation 64, where r = 2 to 6.

[0437] 66. The conjugate described in Presentation 65, where r = 4 or 6, for example, 4.

[0438] 67. A conjugate for inhibiting the expression of the TMPRSS6 gene in cells, wherein the first strand is (vp)-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA (Sequence ID 9) It includes and / or (preferably, and) a second chain, Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA (ps) Ser(GN) (Sequence number 10) Includes, In the formula, mA, mU, mC, and mG each represent 2'-OMe RNA, fA, fU, fC, and fG each represent 2'-deoxy-2'-F RNA, (ps) represents a phosphorothioate bond, (vp)-mU represents (E)-vinylphosphonate mU, and Ser(GN) represents a conjugate of a GalNAc-C4 targeting ligand bound to a serinol-derived linker portion.

[0439] 68. A composition comprising a nucleic acid from any of Presentation 1 to 26 or a conjugate from any of Presentation 27 to 67, and a physiologically acceptable additive.

[0440] 69. Any nucleic acid from Presentation 1 to 26 or any conjugate from Presentation 27 to 67 or the composition according to Presentation 68 for use in the treatment of a disease or disorder. [Examples]

[0441] In this specification, the inventors present examples of GalNAc siRNA conjugates modified with (E)-vinylphosphonate (VP) at the 5' end of the first strand, and further containing either phosphorothioate (PS) internucleotide links or phosphodiester internucleotide links between the first, second, and third nucleotides at the 5' end of the first strand. In the case of siRNA conjugates having one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand, siRNA conjugates having either (I)PS, (II) PS-less VP, or (III) PS-containing VP at the 5' end of the first strand are equally stable when incubated with acidic tritosome lysates. However, the inventors demonstrate a better dose response for target gene knockdown with GalNAc siRNA conjugates having VP at the 5' end of the first strand but without PS.

[0442] Materials and methods Primer: fw TGGACACCAAATCGTACTGGAA TTR rev CAGAGTCGTTGGCTGTGAAAAC Probe BHQ1-ACTTGGCATTTCCCCGTTCCATGAATT-FAM fw CCGCCAAAGCCCAGAAG TMPRSS6 rev GGTCCCTCCCCAAAGGAATAG Probe BHQ1-CAGCACCCGCCTGGGAACTTACTACAAC-FAM fw GGCAAGCCTTATGTCATCTCGT ALDH2 rev GGAATGGTTTTCCCATGGTACTT Probe BHQ1-TGAAATGTCTCCGCTATTACGCTGGCTG-FAM fw AAAG AGGCCAGTCAAGCTGTTC ApoB rev GGTGGGATCACTTCTGTTTTGG Probe BHQ1-CAGCAACACACTGCATCTGGTCTCTACCA-VIC fw CACCGCCAAATTTAACTGCAGA PTEN rev AAGGGTTTGATAAGTTCTAGCTGT Probe BHQ1 -TGCACAGTATCCTTTTGAAGACCATAACCCA-VIC

[0443] cell culture Primary mouse hepatocytes (Thermo Scientific: GIBCO Lot: #MC798) were thawed, and the cryopreserved medium was replaced with 5% FBS, 1 mM dexamethasone, 2 mM GlutaMax, 1% PenStrep, 4 mg / ml human recombinant insulin, and 15 mM Hepes. The cell density was adjusted to 250,000 cells per ml. 100 ml of this cell suspension per well was seeded into a 96-well plate pre-coated with collagen. The test substance was pre-diluted in the same medium (5-fold concentrate) for each concentration, and 25 ml of either the pre-diluted siRNA or the medium alone was added to the cells. The cells were cultured at 37°C and 5% CO2, and RNA-lysis buffer S (Stratec) was added. After incubation at room temperature for 15 minutes, the cells were stored at -80°C until RNA isolation, according to the manufacturer's protocol.

[0444] TaqMan analysis For mTTR and ApoB MultiPlex TaqMan analysis, 10 μl of isolated RNA from each treatment group was mixed with 10 ml of PCR master mix (TAKYON low Rox) containing a 600 nM mTTR primer, a 400 nM ApoB primer, 200 nM probes, and 0.5 units of Euroscript II RT polymerase along with 0.2 units of an RNA-degrading enzyme inhibitor. TaqMan analysis was performed in a 384-well plate with an RT cycle of 10 minutes at 48°C, initial denaturation at 95°C for 3 minutes, and 40 cycles of 10 seconds at 95°C and 1 minute at 60°C.

[0445] For TMPRSS6&ApoB MultiPlex TaqMan analysis, 10 ml of isolated RNA from each treatment group was mixed with 10 ml of PCR master mix (TAKYON low Rox) containing 800 nM TMPRSSR6 primer, 100 nM ApoB primer, and 200 M probes, along with 0.5 units of Euroscript II RT polymerase and 0.2 units of RNA-degrading enzyme inhibitor. TaqMan analysis was performed in 384-well plates with a reverse transcription cycle of 10 minutes at 48°C, initial denaturation of 3 minutes at 95°C, and 40 cycles of 10 seconds at 95°C and 1 minute at 60°C.

[0446] Tritosome stability assay To track the stability of RNA-degrading enzymes in the endosomal / lysosomal compartment of hepatocytes in vitro, siRNA was incubated in Sprague-Dolly rat liver tritosomes (Tebu-Bio, CatN.: R0610.LT, lot: 1610405, pH: 7.4, 2.827 units / ml) for 0, 4, 24, or 72 hours. To mimic an acidified environment, the tritosomes were mixed with a low pH buffer (1.5 M acetic acid, 1.5 M sodium acetate, pH 4.75) at a 1:10 ratio. After adding 10 μl of siRNA (20 μM), this acidified tritosome was mixed with 30 μl and incubated at 37°C for the indicated time. Following incubation, RNA was isolated using Clarity OTX Starter Kit-Cartridges (Phenomenex, CatNo: KSO-8494) according to the manufacturer's protocol for biological fluids. For separation, quantitative, and semi-quantitative analysis, lyophilized RNA was reconstituted in 30 μl of H2O, mixed with 4× loading buffer, and 5 μl was loaded onto a 20% TBE-polyacrylamide gel electrophoresis (PAGE). PAGE was performed at 120 V for 2 hours, and RNA was visualized by ethidium bromide staining followed by digital imaging using a Biorad imaging system.

[0447] [Table 1A] [Table 1B]

[0448] (Example 1) A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain results in improved reduction of TTR target mRNA levels in vitro.

[0449] All tested conjugates contain a single serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate nucleotide links at their 5' and 3' ends. X0181 contains two phosphorothioate nucleotide links at the 5' end of the first strand. X0430 contains vinyl phosphate modification at the first nucleotide and two phosphorothioate nucleotide links at the 5' end of the first strand. X0349 contains vinyl phosphate modification at the first nucleotide and does not contain phosphorothioate nucleotide links at the 5' end of the first strand. Compared to X0181 and X0430, X0349 shows improved reduction of TTR target gene levels in vitro. "ut" indicates an untreated sample against which other samples are standardized. "Luc" indicates siRNA targeting luciferase (X0028), which is used as a non-targeting control and does not reduce the target mRNA level.

[0450] Experiments were conducted using primary mouse hepatocytes. 25,000 cells were seeded per 96 wells and immediately treated with siRNA conjugated with 0.001 nM–10 nM GalNAc after plate culture. Cells were lysed for 24 hours, total RNA was extracted, and TTR and APoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents the mean ± SD from three technical replicates.

[0451] The data is shown in Figure 1.

[0452] (Example 2) A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide-nucleotide bond at the 5' end of the first strand results in improved reduction of TMPRSS6 target mRNA levels in vitro.

[0453] All tested conjugates contain a single serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate nucleotide interlinks at their 5' and 3' ends. X0322 contains two phosphorothioate nucleotide interlinks at the 5' end of the first strand. X0431 contains vinyl phosphonate modification at the first nucleotide and two phosphorothioate nucleotide interlinks at the 5' end of the first strand. X0365 contains vinyl phosphate modification at the first nucleotide and does not contain phosphorothioate nucleotide interlinks at the 5' end of the first strand. Compared to X0322 and X0431, X0365 shows improved reduction of TMPRSS6 target gene levels in vitro. "ut" indicates an untreated sample against which other samples are standardized. "Luc" indicates siRNA targeting luciferase (X0028), which is used as a non-targeting control and does not reduce the target mRNA level.

[0454] Experiments were conducted using primary mouse hepatocytes. 25,000 cells were seeded per 96 wells and immediately treated with siRNA conjugated with 0.01 nM–100 nM GalNAc after plate culture. Cells were lysed for 24 hours, total RNA was extracted, and TMPRSS6 and APoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents the mean ± SD from three technical replicates.

[0455] The data is shown in Figure 2.

[0456] Examples 1 and 2 clearly demonstrate that the presence of a vinyl phosphonate at the 5' end of the antisense strand increases the activity of the siRNA. This activity is further increased when the bond between the first three nucleotides at the 5' end of the first strand is a phosphodiester bond rather than a phosphorothioate bond.

[0457] (Example 3) A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in a reduction of ALDH2 target mRNA levels in vitro.

[0458] All tested conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand, respectively. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate internucleotide links at their 5' and 3' ends, respectively. X0319 contains two phosphorothioate internucleotide links at the 5' end of the first strand. X0362 contains a vinyl phosphonate modification at the first nucleotide and does not contain a phosphorothioate internucleotide link at the 5' end of the first strand. Both siRNA conjugates reduce the ALDH2 target gene in vitro. "ut" indicates the untreated sample against which other samples are standardized. "Luc" indicates siRNA targeting luciferase (X0028), which is used as a non-targeting control and does not reduce the target mRNA level.

[0459] Experiments were conducted using primary mouse hepatocytes. 25,000 cells were seeded per 96 wells and immediately treated with siRNA conjugated with 0.1 nM–100 nM GalNAc after plate culture. Cells were lysed for 24 hours, total RNA was extracted, and ALDH2 and APoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents the mean ± SD from three technical replicates.

[0460] The data is shown in Figure 3.

[0461] (Example 4) A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in a reduction of ALDH2 target mRNA levels in vitro.

[0462] All tested conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand, respectively. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be mentioned in other words, contain two phosphorothioate internucleotide bonds at their 5' and 3' ends, respectively. X0320 contains two phosphorothioate internucleotide bonds at the 5' end of the first strand. X0363 contains a vinyl phosphonate modification at the first nucleotide and does not contain a phosphorothioate internucleotide bond at the 5' end of the first strand. Compared to X0320, X0363 shows improved reduction of ALDH2 target gene levels in vitro. "ut" indicates the untreated sample against which other samples are standardized. "Luc" indicates siRNA targeting luciferase (X0028), which is used as a non-targeting control and does not reduce target mRNA levels.

[0463] Experiments were conducted using primary mouse hepatocytes. 25,000 cells were seeded per 96 wells and immediately treated with siRNA conjugated with 0.1 nM–100 nM GalNAc after plate culture. Cells were lysed for 24 hours, total RNA was extracted, and ALDH2 and APoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents the mean ± SD from three technical replicates.

[0464] The data is shown in Figure 4.

[0465] The anti-ALDH2 siRNAs of Examples 3 and 4 have different sequences. These examples demonstrate that the presence of vinyl phosphonate and phosphorothioate bonds at the 5' end of the first chain improves the activity of the siRNA, regardless of the sequence.

[0466] (Example 5) GalNAc siRNA conjugate tp, which has a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain, is stable in acidic tritosome lysates.

[0467] All tested conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate nucleotide links at their 5' and 3' ends. X0181 contains two phosphorothioate nucleotide links at the 5' end of the first strand. X0430 contains a vinyl phosphonate modification ("vp-mU") on the first nucleotide and two phosphorothioate ("PS") nucleotide links at the 5' end of the first strand. X0349 contains a vinyl phosphonate modification on the first nucleotide and does not contain a phosphorothioate nucleotide link at the 5' end of the first strand. All GalNAc siRNA conjugates are stable for at least 72 hours. This is surprising, as it is generally believed in the art that phosphorothioate nucleotide bonds must be located at the terminals of siRNA for it to be stable. Surprisingly, the inventors have found that in the presence of vinyl phosphonate, phosphorothioate nucleotide bonds are not required at the terminal where the vinyl phosphonate is located. Therefore, the number of phosphorothioate nucleotide bonds can be unexpectedly reduced without resulting in an unstable molecule. This is preferable because such molecules have few chiral centers (phosphorothioates are stereocenters (stereogenic)).

[0468] To evaluate stability, 5 μM siRNA conjugates were incubated with acidic rat tritosome extract (pH 5) at 37°C for 0, 4, 24, and 72 hours. After incubation, RNA was purified, separated on a 20% TBE polyacrylamide gel, and visualized by ethidium bromide staining.

[0469] The data is shown in Figure 5.

[0470] (Example 6) GalNAc siRNA conjugates having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain are stable in acidic tritosome lysates.

[0471] All tested conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate nucleotide links at their 5' and 3' ends. X0322 contains two phosphorothioate nucleotide links at the 5' end of the first strand. X0431 contains vinyl phosphonate modification ("vp-mU") at the first nucleotide and two phosphorothioate ("PS") nucleotide links at the 5' end of the first strand. X0365 contains vinyl phosphonate modification at the first nucleotide and does not contain phosphorothioate nucleotide links at the 5' end of the first strand. All GalNAc siRNA conjugates are stable for at least 72 hours.

[0472] To evaluate stability, 5 μM siRNA conjugates were incubated with acidic rat tritosome extract (pH 5) at 37°C for 0, 4, 24, and 72 hours. After incubation, RNA was purified, separated on a 20% TBE polyacrylamide gel, and visualized by ethidium bromide staining.

[0473] The data is shown in Figure 6.

[0474] (Example 7) GalNAc siRNA conjugates having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain are stable in acidic tritosome lysates.

[0475] Both tested siRNA conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand, respectively. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate internucleotide links at their 5' and 3' ends, respectively. X0319 contains two phosphorothioate internucleotide links at the 5' end of the first strand. X0362 contains vinyl phosphonate modification at the first nucleotide and does not contain phosphorothioate internucleotide links at the 5' end of the first strand. Both GalNAc siRNA conjugates are stable for at least 72 hours.

[0476] To evaluate stability, 5 μM siRNA conjugates were incubated with acidic rat tritosome extract (pH 5) at 37°C for 0, 4, and 72 hours. After incubation, RNA was purified, separated on a 20% TBE polyacrylamide gel, and visualized by ethidium bromide staining.

[0477] The data is shown in Figure 7.

[0478] (Example 8) GalNAc siRNA conjugates having a vinyl phosphonate at the 5' end of the first chain and a phosphodiester nucleotide linkage at the 5' end of the first chain are stable in acidic tritosome lysates.

[0479] Both tested siRNA conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand, respectively. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate internucleotide links at their 5' and 3' ends, respectively. X0320 contains two phosphorothioate internucleotide links at the 5' end of the first strand. X0363 contains vinyl phosphonate modification at the first nucleotide and does not contain phosphorothioate internucleotide links at the 5' end of the first strand. Both GalNAc siRNA conjugates are stable for at least 72 hours.

[0480] To evaluate stability, 5 μM siRNA conjugates were incubated with acidic rat tritosome extract (pH 5) at 37°C for 0, 4, and 72 hours. After incubation, RNA was purified, separated on a 20% TBE polyacrylamide gel, and visualized by ethidium bromide staining.

[0481] The data is shown in Figure 8.

[0482] In summary, Examples 5 to 8 demonstrate that the stability of siRNA lacking phosphorothioate nucleotide binding at the 5' end of the sense strand is independent of the siRNA sequence, as the same results were obtained using siRNAs with four completely different sequences.

[0483] (Example 9) A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in improved reduction of TMPRSS6 target mRNA levels in vivo.

[0484] All tested conjugates contain a tribranched GalNAc moiety at the 5' end of the second strand. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be mentioned in other words, contain two phosphorothioate nucleotide interlinks at each of the unconjugated ends. X0027 and X0207 contain two phosphorothioate nucleotide interlinks at the 5' end of the first strand. X0204 contains vinyl phosphonate modification at the first nucleotide and two phosphorothioate nucleotide interlinks at the 5' end of the first strand. X0205 contains vinyl phosphonate modification at the first nucleotide and does not contain phosphorothioate nucleotide interlinks at the 5' end of the first strand. X0205 shows improved reduction of TMPRSS6 transcript levels in vivo compared to X0027, X0207, and X0204. "PBS" refers to a group of animals treated with PBS.

[0485] Six C57BL / 6 male mice were subcutaneously treated with 0.3 mg / kg and 1 mg / kg of GalNAc conjugate. Seven days after treatment, liver sections were prepared, total RNA was extracted from the tissue, and TMPRSS6 and PTEN mRNA levels were determined by TaqMan qRT-PCR.

[0486] The data is shown in Figure 9.

[0487] (Example 10) A GalNAc siRNA conjugate with a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand resulted in improved reduction of TMPRSS6 target mRNA levels in vivo over a 6-week period.

[0488] The tested conjugates contain a tribranched GalNAc moiety at the 5' end of the second strand. The siRNAs are modified with alternating 2'-OMe / 2'-F and, not to be rephrased, contain two phosphorothioate nucleotide bonds at each of the unconjugated ends. X0027 contains two phosphorothioate nucleotide bonds at the 5' end of the first strand. X0205 contains a vinyl phosphonate modification at the first nucleotide and does not contain a phosphorothioate nucleotide bond at the 5' end of the first strand. X0027 and X0205 have identical nucleic acid base sequences, while containing different nucleic acid bases at position 1 of the first strand and position 19 of the second strand. Compared to X0027, X0205 shows improved initial reduction of TMPRSS6 target gene levels in vivo and improved duration of action in vivo. "PBS" refers to a group of animals treated with PBS.

[0489] Six C57BL / 6 male mice were subcutaneously treated with 1 mg / kg of GalNAc conjugate. Liver sections were prepared 10, 20, and 41 days after treatment, and total RNA was extracted from the tissue. TMPRSS6 and ACTB mRNA levels were determined by TaqMan qRT-PCR.

[0490] The data is shown in Figure 10.

[0491] (Example 11) A GalNAc siRNA conjugate having a vinyl phosphonate at the 5' end of the first strand and a phosphodiester nucleotide linkage at the 5' end of the first strand results in a reduction of ALDH2 target mRNA levels in vitro.

[0492] All tested conjugates contain one serinol-linked GalNAc moiety at the 5' and 3' ends of the second strand. siRNAs, not to be mentioned in other words, contain two phosphorothioate nucleotide linkages at their 5' and 3' ends. X0320 and X0363 are modified with alternating 2'-OMe / 2'-F. X0477 and X0478 are modified with alternating 2'-OMe / 2'-F in the first strand, 2'-OMe at positions 1-6 and 10-19 of the second strand, and 2'-F at positions 7-9 of the second strand. X0320 and X0477 contain two phosphorothioate nucleotide linkages at the 5' end of their first strand. X0363 and X0478 contain vinyl phosphonate modification at the first nucleotide and do not contain phosphorothioate internucleotide binding at the 5' end of the first strand. Compared to X0320, X0363 reduced ALDH2 mRNA levels more significantly. Compared to X0477, X0478 reduced ALDH2 mRNA levels more significantly. "ut" indicates an untreated sample against which other samples are standardized. "Luc" indicates siRNA targeting luciferase (X0028), which is used as a non-targeting control and does not reduce target mRNA levels.

[0493] Experiments were conducted using primary mouse hepatocytes. 20,000 cells were seeded per 96 wells and immediately treated with siRNA conjugated with 1 nM–100 nM GalNAc after plate culture. Cells were lysed for 24 hours, total RNA was extracted, and ALDH2 and ACTB mRNA levels were determined by Taqman qRT-PCR. Each bar represents the mean ± SD from three technical replicates.

[0494] The data is shown in Figure 11.

[0495] Example 11 demonstrates that the combination of vinyl phosphonate at the 5' end of the antisense strand of X0478 and the 2' nucleotide modification pattern of the second strand unexpectedly resulted in greater downregulation of the target gene.

[0496] (Example 12) - Synthesis General synthesis scheme Example compounds can be synthesized according to the methods described below and methods known to those skilled in the art. While the schemes illustrate the synthesis of specific conjugates, it will be understood that other claimed conjugates may be prepared by similar methods. Construction of oligonucleotide chains and linker components can be carried out, for example, by solid-phase synthesis applying the phosphoramidite methodology. Solid-phase synthesis may begin with a base or modified component loaded with lcaa CPG. The phosphoramidite synthesis coupling cycle consists of 1) DMT removal, 2) chain elongation using the required DMT-shielded phosphoramidite and an activator which may be benzylthiotetrazole (BTT), 3) capping of the unelongated oligonucleotide chain, followed by oxidation of P(III) to P(V) with either iodine (if a phosphodiester bond is desired) or EDITH (if a phosphorothioate bond is desired), and then capping again (Cap / Ox / Cap or Cap / Thio / Cap). GalNAc conjugation can be achieved by peptide bond formation of the GalNAc-carboxylic acid component to a pre-constructed and purified oligonucleotide to which the required number of amino-modified linker components are attached. The required components are commercially available or synthesized as described below. All final single-chain products were analyzed by AEX-HPLC to verify their purity. Purity is given as FLP% (percentage of full-length product), which is the percentage of UV area under the assigned product signal in UV tracking of the AEX-HPLC analysis of the final product. The identity of each single-chain product was verified by LC-MS analysis.

[0497] Synthon synthesis Scheme 1: Synthesis of DMT-Serinol (TFA) Linker Synthon [ka] i) Trifluoroethyl acetate, NET3, MeOH, 0°C, 16 hours, 2:86%, 5:90%, ii) DMTCl, pyridine, 0°C, 16 hours, 74%, iii) LiBH4, EtOH / THF(1 / 1, v / v), 0°C, 1 hour, 76%, iv) 2-Cyanoethyl-N,N-diisopyrropyrchlorophosphoramidite, EtN / Pr2, CH2Cl2, 56%, v) Succinic anhydride, DMAP, pyridine, RT, 16 hours, 38%, vi) HBTU, DIEA, amino-ICAA CPG(500A), RT, 18 hours, 29% (loaded at 26 μmol / g).

[0498] (S)-DMT-serinol(TFA)-phosphoramidite 7 can be synthesized from (L)-serine methyl ester derivative 1 according to a method published in the literature (Hoevelmann et al., Chem. Sci., 2016, 7, pp. 128-135).

[0499] (S)-DMT-serinol(TFA)-succinate 6 can be prepared by converting intermediate 5 with succinic anhydride in the presence of a catalyst such as DMAP.

[0500] The loading of (S)-DMT-serinol (TFA)-succinate 6 onto solid supports such as controlled porous glass (CPG) supports can be achieved by peptide bond formation onto solid supports such as amino-modified native CPG supports (500A) using coupling reagents such as HBTU. Dissolve (S)-DMT-serinol (TFA)-succinate 6 and a coupling reagent such as HBTU in a solvent such as CH3CN. Add a base such as diisopropylethylamine to the solution and stir the reaction mixture for 2 minutes. Add a solid support such as native amino-ICAA-CPG support (500A, 3g, amine content: 136 μmol / g) to the reaction mixture to form a suspension. Gently shake the suspension in a wrist-action shaker at room temperature for 16 hours, then filter and wash with solvents such as DCM and EtOH. Dry the support under vacuum for 2 hours. Unreacted amines on the support can be capped by stirring with acetic anhydride / lutidine / N-methylimidazole at room temperature. The washing of the carrier may be repeated as described above. The solid carrier is dried under vacuum to obtain the solid carrier 10.

[0501] Scheme 2: Synthesis of GalNAc Synthon 9 [ka] (vii) TMSOTf, DCM, hexanol, viiii) RuCl3, NaIO4, DCM, CH3CN, H2O, 46% over two steps. The synthesis of GalNAc synthon 9 can be prepared starting from commercially available per-acetylated galactoseamine 8 according to a method such as that described by Nair et al. (2014).

[0502] Synthesis of GalNAc conjugates derived from single-chain selinol Scheme 3: General procedure for oligonucleotide synthesis of serinol-derived linkers [ka]

[0503] The oligonucleotide synthesis of nucleotides conjugated with 3'-mono-GalNAc (e.g., compound A2064) is outlined in Figure 16 and summarized in Scheme 3. Synthesis is initiated using (S)-DMT-serinol(TFA)-succinate-lcaa-CPG 10, as with example compound A0264. If further selinol components are required, (S)-DMT-serinol(TFA) amidite (7) is used in an appropriate solid-phase synthesis cycle. For example, to produce compound A0329, chain construction is terminated by further selinol amidite coupling after the base sequence has been fully constructed. Furthermore, oligonucleotide synthesis of oligonucleotides conjugated with 5'-mono-GalNAc can be initiated from a solid support loaded with the appropriate nucleoside of its well-known sequence. In example compound A0220, this could be 2'fA. The oligonucleotide chain is constructed according to its sequence, and the component (S)-DMT-serinol(TFA)-amidite (7) is used as needed. Upon completion of chain elongation, the protective DMT group of the final coupled amidite component is removed as seen in step 1) of the phosphoramidite synthesis cycle.

[0504] Upon completion of the final synthesis step, the single chains can be cleaved from the solid support by amine treatment, such as a 40% methylamine aqueous treatment. Any remaining protecting groups are also removed in this step, and the methylamine treatment also liberates the selinolamino functional group. Subsequently, the crude products were purified by AEX-HPLC and SEC, respectively, to obtain precursor oligonucleotides for further GalNAc conjugation.

[0505] Scheme 4: GalNAc conjugation synthesis of serinol-derived precursor oligonucleotides [ka]

[0506] After solid-phase synthesis, GalNAc-conjugation was achieved by pre-activation of GalN(Ac4)-C4-acid (9) with a peptide coupling reagent such as HBTU. Next, the pre-activated acid 9 was reacted with the amino group in 11 (e.g., A0264) to form the intermediate GalN(Ac4)-conjugate. Methylamine treatment cleaved the acetyl group protecting the hydroxyl group in the GalNAc- moiety to obtain compound 12 (e.g., A0268), a desired example compound, which was further purified by AEX-HPLC and SEC.

[0507] Synthesis of GalNAc conjugates derived from single-chain non-serinol Amino-modified components other than selinol are commercially available from various suppliers and can be used in place of selinol to provide reactive amino groups that enable GalNAc conjugation. For example, using commercially available components shown in Table 1 (Table 2) below, a non-serinol-derived amino-modified precursor oligonucleotide 14 (Scheme 5A) can be provided by using CPGs loaded with amino-modifying factors such as 10-1 to 10-3, followed by the sequence construction described above, and finally coupling with amino-modifying phosphoramidites such as 13-1, 13-2, or 13-4.

[0508] For example, to produce 14(A0653), GlyC3Am-CPG(10-2) was used in combination with GlyC3Am-amidite 13-2. 14 can be produced using structurally different modifying factors; for example, for A0651, C7Am-CPG was used in combination with C6Am-amidite as a second amino modification. In a similar manner, the amino-modified precursor molecule 14(A0655) can be synthesized using commercially available amino-modifying CPG 10-5 and amino-modified phosphoramidite 13-5.

[0509] [Table 2]

[0510] Scheme 5: General Procedure for Oligonucleotide Synthesis [ka]

[0511] Next, the obtained precursor oligonucleotide 14 is conjugated with GalN(Ac4)-C4-acid (9) to obtain the desired example compound 15 (Scheme 6).

[0512] Scheme 6: GalNAc conjugation synthesis of precursor oligonucleotides [ka]

[0513] Synthesis of single-chain tribranched GalNAc conjugates Figure 17 outlines the oligonucleotide synthesis of siRNA conjugated with a trivalent tribranched GalNAc cluster. Oligonucleotide chain construction is initiated using a base-loaded support, e.g., 5'DMT-2'FdA(bz)-succinate-lcaa-CPG, as seen in example compound A0006. A phosphoramidite synthesis coupling cycle consisting of 1) DMT removal, 2) chain extension using the required DMT-shielded phosphoramidite, 3) capping of the unextended oligonucleotide chain, followed by oxidation of P(III) to P(V) with either iodine or EDITH (if a phosphorothioate bond is desired), and then capping again (Cap / Ox / Cap or Cap / Thio / Cap) is repeated until the full length of the product is reached. For conjugation of the trivalent tribranched GalNAc cluster on the column, the required trivalent branched amidite C4XLT-phos is used. The same synthesis cycle was applied, followed by another synthesis cycle using GalNAc amidite ST23-phos. Upon completion of this final synthesis step, the oligonucleotides could be cleaved from the solid support and further protecting groups removed by methylamine treatment. The crude products were then purified by AEX-HPLC and SEC, respectively.

[0514] General procedure for double-strand formation To obtain a double-stranded conjugate, individual single chains are dissolved in H2O at a concentration of 60 OD / mL. The individual oligonucleotide solutions can be added together to the reaction vessel. Titration can be performed to monitor the reaction. The first chain is added in a 25% excess compared to the second chain, as determined by UV absorption at 260 nm. The reaction mixture is heated, for example, to 80°C for 5 minutes, and then gradually cooled to RT. Double-strand formation can be monitored by ion-pair formation reverse-phase HPLC. The required amount of the second chain can be calculated from the UV area of ​​the residual single chain and added to the reaction mixture. The reaction mixture is again heated, for example, to 80°C, and then gradually cooled to RT. This procedure can be repeated until less than 10% residual single chains are detected.

[0515] The above process (including schemes 1 to 6) can be readily adapted to replace GalNAc with another targeting ligand, such as a sugar.

[0516] In any of the above embodiments, instead of conjugation after solid-phase synthesis, it is possible to prepare a pre-formed selinol (GN)-phosphoramidite and use it for conjugation on the column.

[0517] The example compounds were synthesized according to the methods described below and methods known to those skilled in the art. The construction of oligonucleotide chains and linker components was carried out by solid-phase synthesis using the phosphoramidite methodology. GalNAc conjugation was achieved by peptide bond formation of the GalNAc-carboxylic acid component to pre-constructed and purified oligonucleotides to which the required number of amino-modified linker components were attached.

[0518] Oligonucleotide synthesis, deprotection and purification, followed by standard procedures known in the art. All oligonucleotides were synthesized using standard phosphoramidite chemistry in an AKTA oligopilot synthesizer. Commercially available solid supports and 2'-O-methylRNA phosphoramidites, 2'-fluoroRNA phosphoramidites, and 2'-deoxyRNA phosphoramidites (all with standard protection, ChemGenes and LinkTech) were used, along with the commercially available 3'-amino modification factor TFA-amino C-6 lcaa CPG 500 Å (Chemgenes). Hyperacetylated galactoseamine 8 is commercially available.

[0519] Auxiliary reagents were purchased from EMP Biotech. A 0.1 M solution of phosphoramidite in dried acetonitrile and benzylthiotetrazole (BTT) was used as the activator (0.3 M in acetonitrile). The coupling time was 15 minutes. A Cap / Ox / Cap or Cap / Thio / Cap cycle was applied (Cap: Ac20 / NMI / lutidine / acetonitrile, oxidizing agent: pyridine / 0.1 M I2 in H2O). Phosphothioates were introduced using a standard commercially available thiolation reagent (EDITH, Link Technologies). DMT cleavage was achieved by treatment with 3% dichloroacetic acid in toluene. Diethylamine (DEA) washing was performed upon completion of the programmed synthesis cycle. All oligonucleotides were synthesized in DMT-off mode.

[0520] The linker moiety derived from selinol was attached using either (S)-DMT-serinol(TFA)-succinate-lcaa-CPG 10 or (S)-DMT-serinol(TFA)phosphoramidite 7 in an appropriate synthetic cycle (synthesis was carried out as described in Hoevelmann et al., Chem. Sci., 2016, 7, pp. 128-135). The trebler GalNAc clusters (ST23 / C4XLT or ST23 / C6XLT) were introduced by sequential coupling of their respective trebler amidite derivatives (C4XLT-phos or C6XLT-phos) followed by the GalNAc amidite (ST23-phos).

[0521] The synthesis of phosphoramidite derivatives of C4XLT(C4XLT-phos), C6XLT(C6XLT-phos), and ST23(ST23-phos) can be carried out as described in International Publication No. 2017 / 174657. The synthesis of (vp)-mU-phos is described in Prakash, Nucleic Acids Res., 2015, 43(6), pp. 2993-3011 and Haraszti, Nucleic Acids Res., 2017, 45(13), pp. 7581-7592.

[0522] The coupling of the vinylphosphonate-mU moiety was achieved by the use of (vp)-mU-phos in the final synthetic cycle (synthesis carried out as described in Prakash, Nucleic Acids Res., 2015, 43(6), pp. 2993-3011 and Nucleic Acids Res., 2017, 45(13), pp. 7581-7592). (vp)-mU-phos does not provide a hydroxyl group suitable for further synthetic extension and therefore does not possess a DMT group. Thus, the coupling of (vp)-mU-phos leads to the termination of the synthesis. To remove the methyl ester that shields the phosphonate, the CPG containing the fully constructed oligonucleotide was dried under reduced pressure and transferred to a 20 mL PP syringe reactor (Carl Roth GmbH) for solid-phase peptide synthesis equipped with disc frit. Next, the CPG was brought into contact with 10 mL of a solution of 250 μL of TMSBr and 177 μL of pyridine in CH2Cl2 at room temperature, and the reactor was sealed with a Luer cap. The reaction vessel was gently stirred for 30 minutes, excess reagent was discarded, and the residual CPG was washed twice with 10 mL of acetonitrile. Further downstream processing was not modified from any other example compound.

[0523] Single chains were excised from CPG by treatment with 40% methylamine aqueous solution. The resulting crude oligonucleotides were purified by ion exchange chromatography (Resource Q, 6 ml, GE Healthcare) using an AKTA Pure HPLC System with a sodium chloride gradient. The product containing the fractions was pooled, desalted using a size exclusion column (Zetadex, EMP Biotech), and lyophilized.

[0524] Each single chain was dissolved in H2O at a concentration of 60 OD / mL. Both individual oligonucleotide solutions were added together to the reaction vessel. Titration was performed for simpler reaction monitoring. The first chain was added in a 25% excess compared to the second chain, as determined by UV absorption at 260 nm. The reaction mixture was heated to 80°C for 5 minutes and then gradually cooled to RT. Double-chain formation was monitored by ion-pair formation reverse-phase HPLC. The required amount of the second chain was calculated from the UV area of ​​the residual single chain and added to the reaction mixture. The reaction mixture was again heated to 80°C and gradually cooled to RT. This procedure was repeated until less than 10% residual single chain was detected.

[0525] Synthesis of Compounds 2 to 10 Compounds 2 to 5 and (S)-DMT-serinol(TFA)-phosphoramidite 7 were synthesized according to a method published in the literature (Hoevelmann et al., Chem. Sci., 2016, 7, pp. 128-135).

[0526] (S)-4-(3-bis(4-methoxyphenyl)(phenyl)methoxy)-2-(2,2,2-trifluoroacetamide)propoxy)-4-oxobutanoic acid (6) To a solution of 5 in pyridine, succinic anhydride was added, followed by DMAP. The resulting mixture was stirred overnight at room temperature. As determined by TLC, all starting material was consumed. The reaction mixture was concentrated. The crude material was chromatographed in silica gel using a 0%-5% gradient (+1% triethylamine) in DCM to obtain 1.33 g of 6 (yield = 38%). m / z (ESI-): 588.2 (100%), (C30H29F3NO8[MH] -Calculated value for this is 588.6). ¹H-NMR: (400 MHz, CDCl3) δ[ppm]=7.94(d, 1H, NH), 7.39~7.36(m, 2H, CH aryl), 7.29~7.25(m, 7H, CH aryl), 6.82~6.79(m, 4H, CH aryl), 4.51~4.47(m, 1H), 4.31~4.24(m, 2H), 3.77(s, 6H, 2xDMTr-OMe), 3.66~3.60(m, 16H, HNEt3) + ), 3.26~3.25(m, 2H), 2.97~2.81(m, 20H, NEt3), 2.50~2.41(4H, m), 1.48~1.45(m, 26H, HNEt3) + ), 1.24~1.18 (m, 29H, NEt3).

[0527] (S)-DMT-Serinol(TFA)-Succinate-lacc-CPG(10) (S)-DMT-serinol(TFA)-succinate (159 mg, 270 μmol) and HBTU (113 mg, 229 μmol) were dissolved in CH3CN (10 ml). Diisopyrropylethylamine (DIPEA, 94 mL, 540 μmol) was added to the solution, and the mixture was swirled for 2 minutes. Then, native amino-ICAA-CPG (500A, 3 g, amine content: 136 μmol / g) was added. The suspension was gently shaken in a wrist-action shaker at room temperature for 16 hours, filtered, and washed with DCM and EtOH. The solid support was dried under vacuum for 2 hours. Unreacted amine on the support was capped by stirring with acetic anhydride / lutidine / N-methylimidazole at room temperature. The washing of the support was repeated as described above. The solid was dried under vacuum to obtain solid support 10 (3 g, 26 μmol / g load).

[0528] GalNAc Shinton (9) The synthesis of GalNAc synthon 9 was carried out in two steps with a yield of 46%, as described by Nair et al., J. Am. Chem. Soc., 2014, 136(49), pp. 16958-16961.

[0529] The key data points matched those found in publicly available data.

[0530] Synthesis of oligonucleotides All single-chain oligonucleotides were synthesized according to the reaction conditions shown in Figures 12, 16, and 17 above.

[0531] All final single-chain products were analyzed by AEX-HPLC to verify their purity. Purity is assigned as FLP% (percentage of full-length product), which is the percentage of UV area under the assigned product signal in the UV tracking of the AEX-HPLC analysis of the final product. The identity of each single-chain product (unmodified, amino-modified precursor, or oligonucleotide conjugated with C4XLT / ST23 or C6XLT / ST23 GalNAc) was verified by LC-MS analysis.

[0532] [Table 3]

[0533] Synthesis of conjugates having a selinol-derived linker Conjugation of GalNAc synthon (9) was achieved by coupling each oligonucleotide chain 11 to the selinol-amino functional group using a peptide coupling reagent. Therefore, each amino-modified precursor molecule 11 was dissolved in H2O (500 OD / mL), followed by DMSO (DMSO / H2O, 2 / 1, v / v), and then DIPEA (2.5% of total volume). Pre-activation of GalNAc(Ac4)-C4-acid (9) was performed in separate reaction vessels by reacting 2 equivalents of the carboxylic acid component (per amino functional group in the amino-modified precursor oligonucleotide 11) with 2 equivalents of HBTU in DMSO in the presence of 8 equivalents of DIPEA. After 2 minutes, the pre-activated compound 9 was added to the solution of each amino-modified precursor molecule. After 30 minutes, the progress of the reaction was monitored by LC-MS or AEX-HPLC. Upon completion of the conjugation reaction, the crude product was precipitated by adding 10×iPrOH and 0.1×2M NaCl, and collected by centrifugation and decantation. To liberate the acetylated hydroxyl group in the GalNAc moiety, the resulting pellet was dissolved in 40% MeNH2 (1 ml per 500 OD), diluted with H2O (1:10) after 15 minutes at RT, and finally purified again by anion exchange and size exclusion chromatography, then lyophilized to obtain the final product 12.

[0534] [Table 4]

[0535] double strand formation Double-strand formation was carried out according to the method described above. Double-strand purity is assigned as double-strand %, which is the percentage of UV area under the assigned product signal in UV tracking in IP-RP-HPLC.

[0536] [Table 5]

[0537] (Example 13) Reduction of TMPRSS6 expression in primary mouse hepatocytes by a GalNAc siRNA conjugate having 2'-OMe-uridine or 5'-(E)-vinylphosphonate-2'-OMe-uridine replacing 2'-OMe-adenine at the 5' position of the first chain.

[0538] Primary mouse hepatocytes were seeded at a cell density of 30,000 cells per well in 96-well plates (Thermo Fisher Scientific, #A1142803) pre-coated with collagen, and treated with siRNA conjugates at concentrations ranging from 100 nM to 0.1 nM. 24 hours after treatment, the cells were lysed, and RNA was extracted using the InviTrap® RNA Cell HTS 96 Kit / C24×96 Prep (Stratec, #7061300400) according to the manufacturer's protocol. Transcript levels of TMPRSS6 and housekeeping mRNA (PtenII) were quantified by TaqMan analysis.

[0539] [Table 6]

[0540] [Table 7]

[0541] In vitro dose response TMPRSS6-siRNA (STS12209V4L4) possesses vinyl-(E)-phosphonate 2'OMe-uracil at the 5' position of the antisense strand and two phosphorothioate bonds between the first three nucleotides, TMPRSS6-siRNA (STS12209V5L4) possesses vinyl-(E)-phosphonate 2'OMe-uracil at the 5' position of the antisense strand and two phosphodiester bonds between the first three nucleotides, 2'-O-methyluracil and two phosphorothioate bonds between the first three nucleotides at the 5' position Target gene expression in primary mouse hepatocytes (UT) 24 hours after treatment with TMPRSS6-siRNA (STS12209L4) possessing a thioate bond, or TMPRSS6-siRNA (STS12209V1L4 and STS122009L4) or non-targeting GalNAc-siRNA (STS18001) possessing 2'-O-methyluracil or 2'-OMe-adenine between the first three nucleotides at the 5' position as a reference and two phosphodiester bonds, at the indicated concentrations, or in untreated cells.

[0542] The results are shown in Figure 14. This figure confirms that the vinyl phosphonate at the 5' end of the first strand, preferably in combination with a phosphodiester bond at the 5' end of the first strand, leads to an increased reduction in the expression of the target gene.

[0543] Serum stability Serum stability of siRNA conjugates incubated in 50% FCS at 37°C for 4 hours (4h) or 3 days (3d), or left untreated (0h), was assessed. RNA was then extracted by phenol / chloroform / isoamyl alcohol extraction. Degradation was visualized by TBE-polyacrylamide gel electrophoresis and by staining the RNA with SybrGold.

[0544] The results are shown in Figure 15: Serum stability of siRNA-conjugate versus less stabilized positive control against nuclease degradation.

[0545] [Table 8A] [Table 8B] [Table 8C] [Table 8D] [Table 8E]

[0546] The sequences listed above may be disclosed together with linkers or ligands, such as GalNAc or (ps) binding. These are optional but preferred to form part of the sequence listing.

[0547] [Table 9A] [Table 9B] [Table 9C]

[0548] Abbreviations such as those shown in this table may be used in this specification. The list of abbreviations may not be complete, and further abbreviations and their meanings may be found throughout this document.

Claims

1. A nucleic acid for inhibiting the expression of a target gene in a cell, comprising a double-stranded region of 19 to 25 nucleotides in length, comprising at least a portion of a first strand and at least a portion of a second strand at least partially complementary to the first strand, wherein the second strand is 19 to 25 nucleotides in length, the first strand is 19 to 25 nucleotides in length and at least partially complementary to at least a portion of the RNA transcribed from the target gene to be inhibited, and the first strand has a terminal 5'(E)-vinylphosphonate nucleotide linked to the second nucleotide of the first strand by a phosphodiester bond, The second chain of the nucleic acid is given by formula 1: [S-X 1 -P-X 2 ] 3 -A-X 3 - (1) (In the formula, S stands for N-acetylgalactosamine (GalNAc), X 1 represents C 3 to C 6 alkylene or (-CH 2 -CH 2 -O) m (-CH 2 ) 2 -, m is 1, 2 or 3, P is a phosphorothioate, X 2 is alkylene, or formula (-CH 2 ) n -O-CH 2 - is an alkylene ether, and n=1 to 6, A is as follows: 【Chemistry 1】 (Here, A 1 (where n represents O, and each n independently represents an integer from 1 to 20), or 【Chemistry 2】 (Here, A 1 (This is O, where each n independently represents an integer between 1 and 20.) A branching unit selected from, X 3 teeth, (I C 1 ~C 20 Alkylene-,-C 2 ~C 20 Alkenylene-, formula-(C 1 ~C 20 Alkylene)-O-(C 1 ~C 20 Alkylene)- Alkylene ether, -C(O)-C 1 ~C 20 Alkylene-,-C 0 ~C 4 Alkylene (Cy)C 0 ~C 4 Alkylene-(where Cy represents a substituted or unsubstituted 5-membered or 6-membered cycloalkylene, arylene, heterocyclylene, or heteroarylene ring),-C 1 ~C 4 Alkylene-NHC(O)-C 1 ~C 4 Alkylene-,-C 1 ~C 4 Alkylene-C(O)NH-C 1 ~C 4 Alkylene-,-C 1 ~C 4 Alkylene-SC(O)-C 1 ~C 4 Alkylene-,-C 1 ~C 4 Alkylene-C(O)SC 1 ~C 4 Alkylene-,-C 1 ~C 4 Alkylene-OC(O)-C 1 ~C 4 Alkylene-,-C 1 ~C 4 Alkylene-C(O)OC 1 ~C 4 Alkylene-, and -C 1 ~C 6 Alkylene-SSC 1 ~C 6 Alkilen-; (ii) Formula -(C 1 ~C 20 Alkylene)-O-(C 1 ~C 20 Alkylene ethers of (C)- and formula-(C) 1 ~C 20 Alkylene)-O-(C 4 ~C 20 Alkylene)-alkylene ether; or (iii)-CH 2 -OC 3 H 6 -, -CH 2 -OC 4 H 8 -, -CH 2 -OC 6 H 12 -, and -CH 2 -OC 8 H 16 -(Here, in each case, -CH 2 - A group consisting of (a base that is connected to A) (Selected from) Conjugated to at least one ligand moiety containing the compound, The nucleic acid is X 3 It is conjugated via a phosphate or a modified phosphate, or The second chain of the nucleic acid is given by formula 2: [S-X 1 -P-X 2 ] 3 -A-X 3 - (2) (In the formula, S stands for GalNAc, X 1 represents C 3 to C 6 alkylene or an ethylene glycol group (-CH 2 -CH 2 -O) m (-CH 2 ) 2 -, and m is 1, 2, or 3, P is a phosphorothioate, X 2 is C 1 to C 8 alkylene, A is as follows: 【Transformation 3】 In the formula, A1 = O, A2 = NH, CH2, or O, and n = 1 to 4; A branching unit selected from, X 3 C 1 ~C 20 (It is alkylene) Conjugated to at least one ligand moiety containing the compound, The nucleic acid is X 3 to be conjugated via a phosphate or modified phosphate, Nucleic acid.

2. The nucleic acid according to claim 1, wherein the modified phosphate is a thiophosphate.

3. The nucleic acid according to claim 1 or 2, wherein the first chain comprises more than one phosphodiester bond.

4. The first chain, i) At least the first three nucleotides at the 5' end of the chain, or ii) At least the first four nucleotides at the 5' end of the chain The nucleic acid according to any one of claims 1 to 3, comprising a phosphodiester bond between them.

5. The nucleic acid according to any one of claims 1 to 4, wherein the first chain comprises at least one phosphorothioate (ps) bond.

6. The first chain, i) A phosphorothioate bond between the last two nucleotides at the 3' end of the chain, or ii) Phosphothioate bonds between the last three nucleotides at the 3' end of the chain. The nucleic acid according to any one of claims 1 to 5, comprising:

7. The nucleic acid according to claim 6, wherein the bonds between other nucleotides in the first chain are phosphodiester bonds.

8. The second chain, i) A phosphorothioate bond between the last two nucleotides or between the last three nucleotides at the 3' end of the chain, and / or ii) A phosphorothioate bond between the last two nucleotides or between the last three nucleotides at the 3' end of the chain. The nucleic acid according to any one of claims 1 to 7, comprising:

9. The nucleic acid according to any one of claims 1 to 8, wherein the terminal 5'(E)-vinylphosphonate nucleotide is DNA or RNA nucleotide.

10. The nucleic acid according to any one of claims 1 to 9, wherein the terminal 5'(E)-vinylphosphonate nucleotide is an RNA nucleotide.

11. The nucleic acid according to any one of claims 1 to 10, wherein one or more nucleotides on the first and / or second strands are modified to form a modified nucleotide.

12. The above modification is a) Modifications of ribose sugars at the 2'-OH group, including locked nucleotides, debasalized nucleotides, nucleotides containing non-natural bases, 2'-O-methyl modifications, or 2'-fluoro modifications, or b) 2'-Methoxyethyl, 2'-OCH 3 Modifications at the 2' position of deoxyribose sugars, including 2'-O-allyl, 2'-C-allyl, and 2'-fluoro. The nucleic acid according to claim 11.

13. The following structure: 【Chemistry 4】 【Transformation 5】 【Transformation 6】 【Transformation 7】 【Transformation 8】 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】 The nucleic acid according to any one of claims 1 to 12, wherein Z is the nucleic acid.

14. A composition comprising a nucleic acid according to any one of claims 1 to 13 and a physiologically acceptable additive.

15. A pharmaceutical composition comprising a nucleic acid according to any one of claims 1 to 13, for use in the prevention or treatment of a disease or disorder.

Images