Hydrogel beads for nucleotide sequencing
Patent Information
- Application Number
- JP2024210882
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-08-01
- Filing Date
- 2024-12-04
- Publication Date
- 2026-09-09
- Estimated Expiration
- 2038-08-01
Smart Images

Figure 0007918242000001 
Figure 0007918242000002 
Figure 0007918242000003
Abstract
Description
[Technical Field]
[0001] (Related Application) This application claims priority to U.S. Provisional Patent Application No. 62 / 539,956, filed August 1, 2017, entitled "Hydrogel Beads for Nucleotide Sequencing", the entire content of which is incorporated herein by reference.
[0002] The systems, methods, and compositions provided herein relate to hydrogel beads and methods for encapsulating materials within hydrogel beads for use in spatial indexed sequencing and nucleic acid library preparation. [Background Art]
[0003] Next-generation sequencers are powerful tools that generate large amounts of genomic data per sequencing run. Interpreting and analyzing this large volume of data is challenging. Single-cell DNA sequencing has emerged as a tool for studying genomic heterogeneity. Specifically, by obtaining DNA sequences from a single cell, it is possible to sequence microbiomes carrying multiple repetitive genomic regions, which can greatly simplify downstream sequencing data alignment methods. [Summary of the Invention]
[0004] Some embodiments provided herein relate to beads for carrying out nucleic acid reactions. In some embodiments, the beads comprise a hydrogel polymer and genetic material disposed within the hydrogel polymer. In some embodiments, the beads include pores that allow the diffusion of reagents through the beads while retaining the genetic material. In some embodiments, the beads have a diameter of about 2 μm to about 120 μm, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, or 120 μm, or a diameter within a range defined by any two of the above values. In some embodiments, the hydrogel polymer is polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), lactic acid-glycolic acid copolymer (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), poly(L-Li) Examples include din, agar, agarose, alginate, heparin, sulfated alginate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, acrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethyl glycol diacrylate, polyethylene glycol diacrylate, trimethyl oleate trimethacrylate, ethoxylated trimethylolpropane triacrylate, or ethoxylated pentaerythritol tetra(meth)acrylate, or combinations thereof. In some embodiments, the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate. In some embodiments, the hydrogel polymer comprises acrylamide / N,N'-bis(acryloyl)cystamine (BACy).In some embodiments, the hydrogel polymer comprises PEG / polypropylene oxide (PPO). In some embodiments, the genetic material is cells, nucleic acids, or a microbiome. In some embodiments, the cells are mammalian cells or bacterial cells. In some embodiments, the cells are Escherichia coli cells, Bacillus subtilis cells, Aeromonas hydrophila cells, or fibroblasts. In some embodiments, the nucleic acids are DNA or RNA of 300 base pairs or more. In some embodiments, the reagent comprises enzymes, chemicals, and primers having a size of less than 50 base pairs. In some embodiments, the reagent comprises lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primers (P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation.
[0005] Several embodiments provided herein relate to methods for encapsulating genetic material within hydrogel beads. In some embodiments, the method includes the steps of mixing a hydrogel polymer and genetic material in a solution, and mixing this solution with an immiscible fluid to form hydrogel beads that encapsulate the genetic material. In some embodiments, the hydrogel beads contain pores that allow the diffusion of reagents through the hydrogel beads while retaining the genetic material. In some embodiments, the hydrogel beads have a diameter of about 2 μm to about 120 μm, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, or 120 μm, or within a range defined by any two of the above values. In some embodiments, the hydrogel polymer is polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), lactic acid-glycolic acid copolymer (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), Examples include lysine, agar, agarose, alginate, heparin, sulfated alginate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations thereof. In some embodiments, the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate.In some embodiments, the hydrogel polymer comprises acrylamide / N,N'-bis(acryloyl)cystamine (BACy). In some embodiments, the hydrogel polymer comprises PEG / polypropylene oxide (PPO). In some embodiments, the genetic material is cells, nucleic acids, or a microbiome. In some embodiments, the cells are mammalian cells or bacterial cells. In some embodiments, the cells are Escherichia coli cells, Bacillus subtilis cells, Aeromonas hydrophila cells, or fibroblasts. In some embodiments, the nucleic acids are DNA or RNA with 300 base pairs or more. In some embodiments, the reagents comprise enzymes, chemicals, and primers having a size of less than 50 base pairs. In some embodiments, the reagent comprises lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primer (P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation.
[0006] Several embodiments provided herein relate to methods for encapsulating genetic material within hydrogel beads. In some embodiments, the method includes the steps of mixing an aqueous solution containing a hydrogel polymer and genetic material with an immiscible fluid, introducing the aqueous solution into a droplet generator, and producing hydrogel beads that encapsulate the genetic material. In some embodiments, the hydrogel beads contain pores that allow the diffusion of reagents through the hydrogel beads while retaining the genetic material. In some embodiments, the hydrogel beads have a diameter of about 2 μm to about 120 μm, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, or 120 μm, or within a range defined by any two of the above values. In some embodiments, the hydrogel polymer is polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), lactic acid-glycolic acid copolymer (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), polylysine, agar. This includes agarose, alginate, heparin, sulfated alginate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or a combination thereof.In some embodiments, the hydrogel polymer comprises polyethylene glycol (PEG)-thiol / PEG-acrylate. In some embodiments, the hydrogel polymer comprises acrylamide / N,N'-bis(acryloyl)cystamine (BACy). In some embodiments, the hydrogel polymer comprises PEG / polypropylene oxide (PPO). In some embodiments, the genetic material is cells, nucleic acids, or a microbiome. In some embodiments, the cells are mammalian cells or bacterial cells. In some embodiments, the cells are Escherichia coli cells, Bacillus subtilis cells, Aeromonas hydrophila cells, or fibroblasts. In some embodiments, the nucleic acids are DNA or RNA with 300 or more base pairs. In some embodiments, the reagent comprises an enzyme, a chemical, and a primer having a size of less than 50 base pairs. In some embodiments, the reagent comprises lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primer (P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation.
[0007] Several embodiments provided herein relate to methods for preparing nucleic acid libraries from genetic material encapsulated in beads. In some embodiments, the method includes the steps of obtaining beads having genetic material disposed therein, amplifying the genetic material encapsulated in the beads, performing a tagmentation reaction on the genetic material encapsulated in the beads, and sequencing the genetic material to thereby produce a nucleic acid library encapsulated in beads. In some embodiments, the genetic material is cells, and the method further includes lysing the cells and extracting the nucleic acid. In some embodiments, the cells are lysed with lysozyme and treated with proteinase K to extract the nucleic acid. In some embodiments, the tagmentation reaction includes contacting the genetic material with a transposase mixture containing an adapter sequence and transposomes. In some embodiments, the method further includes seeding the nucleic acid library onto a solid support. In some embodiments, seeding includes degrading the beads to release the nucleic acid library from the beads. In some embodiments, the beads are degraded by contacting the beads with a cleavage mixture or by heating the beads to about 90°C to release the nucleic acid library. In some embodiments, the cleavage mixture comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (THP). In some embodiments, the solid support is a flow cell device. [Brief explanation of the drawing]
[0008] [Figure 1A] This is a schematic diagram illustrating an embodiment of the preparation of hydrogel beads by manual stirring. [Figure 1B] This is a microscopic image showing beads formed by this method, and it was found that the beads have a diameter ranging from approximately 2 μm to approximately 100 μm. [Figure 2A] This is a schematic diagram illustrating an embodiment for preparing hydrogel beads using a microfluidic droplet generator. [Figure 2B]This is a micrograph image showing beads formed by this method, which have a uniform size based on the dimensions of the microfluidic droplet generator. [Figure 3] Figure 2A includes a line graph showing the effect of adding various concentrations of isopropyl alcohol to hydrogel polymers using a similar microfluidic droplet generator, and also shows some micrographs of hydrogel polymers of different sizes. [Figure 4] These are micrographs of fluorescently stained bacterial cells captured in hydrogels of different sizes. Figure 4A shows hydrogel beads approximately 100 μm in diameter encapsulating a large number of bacterial cells, while Figure 4B shows hydrogel beads approximately 10 μm in diameter encapsulating one or two bacterial cells. [Figure 5A] This document describes an embodiment for functionalizing hydrogel beads using oligonucleotides. [Figure 5B] Microscopic images of oligonucleotide-functionalized hydrogel beads, with and without azidation, are shown. [Figure 5C] Micrographs of poly-T functionalized hydrogel beads that capture SeqB sequences are shown. [Figure 5D] The electrochromatograms of DNA after second strand synthesis (right curve) and after tagmentation (left curve) are shown. [Figure 6] These are micrographs showing mouse fibroblasts (NIH-3T3) encapsulated within hydrogel beads. Figure 6A demonstrates encapsulation of a single cell under rapid gelation conditions, while Figure 6B demonstrates encapsulation of multiple cells by hydrogel under slow gelation conditions. [Figure 7A] This document describes an embodiment of a method for producing a hydrogel polymer having disulfide bonds that can be cleaved in the presence of a reducing agent such as dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (TUP). [Figure 7B]Microscopic images of chemically cleaved hydrogel beads, which enable the release of encapsulated genetic material, are shown. [Figure 7C] This is a microscopic image illustrating the release of encapsulated genetic material from hydrogel beads. [Figure 8A] The process for one embodiment using combinatorial indexing to utilize encapsulated genetic material for in-gel barcoding is described. [Figure 8B] The procedure for one embodiment using encapsulated genetic material for sequencing a single bacterial cell encapsulated within hydrogel beads is described. [Figure 8C] The process for one embodiment using encapsulated genetic material for in-gel barcoding, which involves a polymerase chain reaction (PCR) to assemble a barcoded transposome complex on which the material is assembled, or beads containing barcoded oligonucleotides inserted into tagged fragmented DNA, is described. [Figure 9] This diagram illustrates the process for DNA amplification within hydrogel beads. Bacterial cells are encapsulated within hydrogel beads, the captured cells are lysed with lysozyme, and proteins are denatured using proteinase K. In panel a), the gDNA within the encapsulated beads is amplified using multiple substitution amplification (MDA). In panel b), the DNA is tagged and fragmented and amplified by PCR. In panel c), the tagged and fragmented DNA is eluted from the hydrogel beads by heating them to 90°C. The image shows the fluorescence intensity of the DNA stained with SYTOX intercalator dye. [Figure 10]The figure shows micrographs illustrating the release of a DNA library on a solid surface for seeding and clustering treatment; panel a) shows a single hydrogel bead containing tagged fragmented bacterial genome, which is packed onto a solid surface with P5 and P7 primers immobilized on it; panel b) shows eluted, seeded, and isothermally bridged single-stranded DNA; and panel c) shows the gradient cluster density of seeded amplified DNA, where the DNA is stained with SYTOX intercalator dye. [Figure 11A] This line graph shows the bioanalyzer trace of a DNA library obtained from a 12-cycle PCR of the supernatant containing genetic material released from hydrogel beads by heating to 90°C. [Figure 11B] The hydrogel beads are not heated, and therefore the DNA library is not released from the hydrogel beads, and the library is not observed. [Figure 12] This diagram illustrates the spatial confinement of DNA sequencing clusters. Panel (a) shows the readout of the first base sequence from two independently indexed DNA libraries arising from two separate hydrogel beads, panel (b) shows the spatial separation of the two libraries, and as shown in the micrograph image in panel (c), the separated libraries are spatially distinct and originate from different hydrogel beads. [Figure 13] Micrographs of the first sequencing data from a barcoded hydrogel bead library from three different bacterial cell species (Bsubtilis, E. coli, and A. hydrophila) with spatial separation are shown. [Figure 14A] This document presents sequencing criteria for spatially indexed Bsubtilis, E. coli, and A. hydrophila libraries released from hydrogel beads onto a Lauscell surface. [Figure 14B] This document presents sequencing criteria for spatially indexed Bsubtilis, E. coli, and A. hydrophila libraries released from hydrogel beads onto the flow cell surface. [Figure 15] Figures 15A to 15C are diagrams showing the MiSeq sequencing results of flow cell seeding using hydrogel beads containing B. subtilis, E. coli, or A. hydrophila bacteria. Figure 15A is an image showing raw data from a MiSeq microscope, Figure 15B is an image showing different microbial clusters aligned to a specific genome, for example, the dots are clusters aligned to the E. coli genome showing a group distribution pattern, and Figure 15C is a summary table of pass filters for three different bacterial species. MODE FOR CARRYING OUT THE INVENTION
[0009] In the following detailed description, reference is made to the accompanying drawings which form a part of the present specification. In the drawings, similar reference characters typically identify similar components unless otherwise specified. The illustrative embodiments described in the detailed description, the drawings and the claims are not intended to be limiting. Other embodiments may be utilized, and other changes may be made without departing from the spirit or scope of the subject matter presented herein. Aspects of the present disclosure, as generally described herein and illustrated in the drawings, can be arranged, substituted, combined, separated, and designed in a wide variety of different forms, all of which are readily understood to be explicitly contemplated herein.
[0010] Embodiments of the compositions, systems and methods provided herein relate to beads encapsulating genetic material. The beads can comprise a hydrogel polymer and a cross-linking agent that are mixed in the presence of genetic material to form hydrogel beads that encapsulate the genetic material. In some embodiments, the genetic material comprises nucleic acids, cells, a microbiome, or a genome. The hydrogel beads can comprise pores that allow diffusion of reagents through the hydrogel beads while retaining the genetic material within the beads, thereby allowing reactions to occur within the beads. Also provided are methods of performing nucleic acid reactions using beads encapsulating genetic material.
[0011] Some embodiments relate to a method for preparing hydrogel beads that encapsulate whole single cells. In some embodiments, hydrogel beads encapsulating a single cell can be used to process the cell genome and prepare a whole DNA library within the beads. In some embodiments, hydrogel beads encapsulating a single cell can be used to simultaneously process cellular genomic DNA and mRNA to prepare a whole DNA library within the beads. The pore size of the hydrogel can be designed to allow diffusion of enzymes, chemicals, and smaller-sized primers (300 bps), such that intact whole genomic DNA, mRNA, and generated DNA libraries can be retained within the hydrogel beads throughout the entire method. In some embodiments, specific primers can be chemically conjugated within the hydrogel bead matrix to hybridize and process specific genomic DNA or mRNA. The DNA library from a single cell can then be released to a specific region on a flow cell surface for, e.g., library seeding. Subsequently, a spatial distribution of "DNA clusters" on the flow cell derived from individual cells is obtained, which simplifies read alignment during post-processing.
[0012] The hydrogel encapsulation method can be used for other complex library preparation procedures, such as single-cell genome / transcriptome applications. This is because the method enables retention of nucleic acid molecules within the hydrogel while allowing exchange of reagents for performing various enzymatic / chemical manipulations on DNA molecules. Compared with current techniques of FACS sorting of microorganisms into microwells, this method has been found to improve the utility of single-cell genomics for microbial species, enables implementation of various lysis and library preparation workflows, and is low-throughput (96 or 384 cells per plate). The method described herein enables conversion of hundreds of thousands of microorganisms into barcoded libraries in an efficient manner.
[0013] As used herein, the term “reagent” refers to an agent or mixture of two or more agents useful for reacting with, interacting with, diluting, or adding to a sample, and may include agents used in nucleic acid amplification reactions, such as buffers, chemicals, enzymes, polymerases, primers having a size of less than 50 base pairs, template nucleic acids, nucleotides, labels, dyes, or nucleases. In some embodiments, reagents include lysozyme, proteinase K, random hexamer, polymerases (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposases (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, deoxynucleotide triphosphates, buffers, or divalent cations.
[0014] Hydrogel beads containing encapsulated genetic material One embodiment includes beads containing a hydrogel polymer and genetic material. As used herein, the term “hydrogel” means a substance formed when an organic polymer (natural or synthetic) is crosslinked by covalent, ionic, or hydrogen bonds to form a three-dimensional open lattice structure that traps water molecules to form a gel. In some embodiments, the hydrogel may be a biocompatible hydrogel. As used herein, the term “biocompatible hydrogel” means a polymer that forms a gel that is non-toxic to living cells and allows for sufficient diffusion of oxygen and nutrients to the ingested cells, thereby maintaining their viability. In some embodiments, the hydrogel polymer comprises 60–90% fluid, such as water, and 10–30% polymer. In some embodiments, the water content of the hydrogel is about 70–80%.
[0015] Hydrogels may be prepared by crosslinking hydrophilic biopolymers or synthetic polymers. Therefore, in some embodiments, the hydrogel may contain a crosslinking agent. As used herein, the term “crosslinking agent” means a molecule that, when reacted with a suitable basic monomer, can form a three-dimensional network structure. Examples of hydrogel polymers that may contain one or more crosslinking agents include, but are not limited to, hyaluronan, chitosan, agar, heparin, sulfates, cellulose, alginates (including sulfated alginates), collagen, dextran (including sulfated dextran), pectin, carrageenan, polylysine, gelatin (including gelatin type A), agarose, (meth)acrylic acid-oligoto-PEO-oligoto-(meth)acrylate, PEO-PPO-PEO copolymer (Pluronics), poly(phosphazene), poly(methacrylate), poly(N-vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymer, poly (Ethyleneimine), polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine, PEG, polypropylene oxide (PPO), polyacrylic acid, poly(hydroxyethyl methacrylate) (PHEMA), poly(methyl methacrylate) (PMMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid) (PLA), lactic acid-glycolic acid copolymer (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), bisacrylamide, diacrylate Examples include diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethyl glycol diacrylate, polyethylene glycol diacrylate, trimethyl octadecane trimethacrylate, ethoxylated trimethylolpropane triacrylate, or ethoxylated pentaerythritol tetraacrylate, or combinations thereof.Therefore, for example, the combination may include a polymer and a crosslinking agent, such as polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / polypropylene oxide (PPO).
[0016] In some embodiments, the crosslinking agent forms disulfide bonds in the hydrogel polymer. As shown in Figure 7A, the crosslinking agent can form disulfide bonds, thereby linking the hydrogel polymers. In some embodiments, the hydrogel polymer forms a hydrogel matrix with pores (e.g., a porous hydrogel matrix). These pores can hold sufficiently large genetic material within the hydrogel beads, but allow small substances, such as reagents, to pass through the pores and thereby through the inlet and outlet of the hydrogel beads. In some embodiments, the pore size is fine-tuned by varying the ratio of the polymer concentration to the crosslinking agent concentration. In some embodiments, the ratio of polymer to crosslinker is 30:1, 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:30, or within the range defined by any two of the above ratios. In some embodiments, additional functions such as DNA primers or charged chemical groups can be grafted onto the polymer matrix to meet the requirements of different applications.
[0017] As used herein, the term “porosity” means the volume fraction (dimensionless) of a hydrogel composed of open spaces, such as pores or other openings. Thus, porosity is the volume fraction of voids relative to the total volume, measured as a percentage from 0 to 100% (or 0 to 1) of the material. The porosity of a hydrogel may range from 0.5 to 0.99, about 0.75 to about 0.99, or about 0.8 to about 0.95.
[0018] Hydrogels can have any pore size. As used herein, the term “pore size” means the diameter or effective diameter of the cross-section of a pore. The term “pore size” may also mean the average diameter or average effective diameter of the cross-section of a pore based on measurements of multiple pores. The effective diameter of a non-circular cross-section is equal to the diameter of a circular cross-section having the same cross-sectional area as the non-circular cross-section. In some embodiments, the hydrogel can swell when the hydrogel is hydrated. The size of the pores can then vary depending on the water content in the hydrogel. In some embodiments, the pores of the hydrogel may be large enough to hold genetic material within the hydrogel, but also allow reagents to pass through.
[0019] In some embodiments, the crosslinking agent is a reversible crosslinking agent. In some embodiments, the reversible crosslinking agent can reversibly crosslink a hydrogel polymer and can not crosslink in the presence of a cleaver. In some embodiments, the crosslinking agent can be cleaved in the presence of a reducing agent, high temperature, or electric field. In some embodiments, the reversible crosslinking agent may be an N,N'-bis(acryloyl)cystamine, a reversible crosslinking agent for polyacrylamide gels, where the disulfide bonds can be decomposed in the presence of a suitable reducing agent. As shown in Figures 6A and 6B, contact between the crosslinking agent and a reducing agent cleaves the disulfide bonds of the crosslinking agent and destroys the hydrogel beads. The hydrogel beads decompose and release their contents, such as nucleic acids, as shown in Figure 7C. In some embodiments, the crosslinking agent is cleaved by raising the temperature to above 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100°C. In some embodiments, the crosslinking agent is cleaved by contacting the hydrogel beads with a reducing agent. In some embodiments, the reducing agent may be a phosphine compound, a water-soluble phosphine, a nitrogen-containing phosphine and its salts and derivatives, dithioerythritol (DTE), dithiothreitol (DTT) (cis and trans isomers of 2,3-dihydroxy-l,4-dithiobutane, respectively), 2-mercaptoethanol or β-mercaptoethanol (BME), 2-mercaptoethanol or aminoethanethiol, glutathione, thioglycolate or thioglycolic acid, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP), or p-[tris(hydroxymethyl)phosphine]propionic acid (THPP).
[0020] In some embodiments, the crosslinking agent is decomposed by increasing the temperature to increase diffusion or by contact with a reducing agent, thereby releasing the encapsulated genetic material from the hydrogel beads.
[0021] In some embodiments, crosslinking of a crosslinking agent forms pores within the hydrogel beads. In some embodiments, the pore size in the hydrogel beads is adjustable and formulated to encapsulate genetic material such as cells or nucleic acids with a size of more than approximately 300 base pairs, but to allow smaller particles such as reagents, or nucleic acids smaller than approximately 50 base pairs, such as primers, to pass through the pores. In some embodiments, the reagents include reagents for processing genetic material, such as reagents for isolating nucleic acids from cells, reagents for amplifying or sequencing nucleic acids, or reagents for preparing nucleic acid libraries. In some embodiments, the reagents include, for example, lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primer (e.g., P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation.
[0022] In some embodiments, the hydrogel beads contain genetic material. As used herein, genetic material means cells, microbiomes, or nucleic acids. In some embodiments, cells are single cells, including prokaryotic or eukaryotic cells. In some embodiments, cells are mammalian cells. In some embodiments, cells are human cells. In some embodiments, cells are bacterial cells. In some embodiments, genetic material is viral particles. In some embodiments, nucleic acids are long-chain DNA molecules, genomic DNA, viral nucleic acids, bacterial nucleic acids, or mammalian nucleic acids. Any genetic material may be encapsulated within the hydrogel beads.
[0023] Bead manufacturing method Several embodiments provided herein relate to methods for producing beads that encapsulate genetic material. In some embodiments, hydrogel beads are prepared by vortex-assisted emulsion. As used herein, vortex-assisted emulsion means stirring of genetic material and a hydrogel polymer in a container such as a tube, vial, or reaction vessel, as shown in Figures 1A and 1B. These components can be mixed, for example, by manual or mechanical stirring or vibration. In some embodiments, manual mixing yields hydrogel beads that encapsulate genetic material, having a diameter of 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or a size within the range defined by any two of the above values. In some embodiments, the bead sizes are heterogeneous, and therefore the bead sizes include beads of various diameters.
[0024] In some embodiments, the beads are prepared by microfluidic flow technology. Microfluidic flow includes the use of a microfluidic device 200 for assisted gel emulsion generation, as shown in Figure 2A. In some embodiments, the microfluidic device 200 includes microchannels configured to produce hydrogel beads 210 of a desired size and to encapsulate a selected amount of genetic material in each bead. In some embodiments, the microfluidic device 200 has a height of 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 μm, or a height within a range defined by any two of the above values. In some embodiments, the microfluidic device 200 includes one or more channels. In some embodiments, the microfluidic device 200 includes a channel 215 for an aqueous stream and a channel 220 for an immiscible fluid. In some embodiments, one or more channels have the same width. In some embodiments, one or more channels have different widths. In some embodiments, the width of one or more channels is 20, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 μm, or within the range defined by any two of the above values. In some embodiments, the width of the aqueous channel is 75 μm. In some embodiments, the width of the immiscible fluid channel is 78 μm. Those skilled in the art will recognize that the width can be varied to fine-tune the size of the beads 210. In addition to the size of the microfluidic device 200 and the channel widths, the flow rates of the aqueous and immiscible fluid channels may also affect the size of the hydrogel beads.
[0025] In some embodiments, the flow rate of the solution in the aqueous phase channel is 1, 2, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 μL / min, or within the range defined by any two of the above values. In some embodiments, the flow rate of the immiscible fluid in the immiscible fluid channel is 20, 30, 50, 80, 100, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, or 400 μL / min, or within the range defined by any two of the above values. In some embodiments, the solution in the aqueous phase comprises a hydrogel polymer, a crosslinking agent, and genetic material, which flows through the aqueous channel 215 into an immiscible fluid such as a carrier oil at a flow rate less than the flow rate of the immiscible fluid, thereby forming droplets. In some embodiments, the immiscible fluid is an oil such as mineral oil, hydrocarbon oil, silicone oil, or polydimethylsiloxane oil, or a mixture thereof. In some embodiments, the hydrogel droplets containing the genetic material are formulated with a uniform size distribution. In some embodiments, the size of the hydrogel beads is fine-tuned by adjusting the size of the microfluidic device, the size of one or more channels, or the flow rate of either or both the aqueous solution and / or the immiscible fluid. In some embodiments, the resulting hydrogel beads have a diameter in the range of 2 to 150 μm, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, or 150 μm, or a diameter within the range defined by any two of the above values.
[0026] In some embodiments, the size and uniformity of the hydrogel beads encapsulating the genetic material can be further controlled by contacting the hydrogel polymer with a fluid modifier, such as an alcohol containing isopropyl alcohol, before bead formation. As shown in Figure 3, in the absence of isopropyl alcohol, beads with a larger diameter are formed than those formed in the presence of isopropyl alcohol. Isopropyl alcohol affects the fluid properties of the hydrogel polymer, allowing for the control of the hydrogel beads.
[0027] In some embodiments, the hydrogel beads encapsulate single or distinct genetic material, whether prepared by a vortex-assisted emulsion or a microfluidic inertial flow-assisted emulsion. For example, in some embodiments, the beads encapsulate a single cell. In some embodiments, the amount of genetic material in the beads can be controlled by diluting or concentrating the genetic material in the introduced sample. The sample containing genetic material is mixed with a hydrogel polymer, and the hydrogel polymer containing genetic material is subjected to a vortex-assisted emulsion or a microfluidic flow-assisted emulsion as described herein.
[0028] In some embodiments, the hydrogel beads are functionalized with nucleotides. In some embodiments, the nucleotides are oligonucleotides or poly-T nucleotides. In some embodiments, the nucleotides are bound to the hydrogel beads, and the functionalized beads can be used for targeted capture of the nucleotide of interest.
[0029] Method for processing genetic material in hydrogel beads Several embodiments provided herein relate to methods for processing genetic material in beads. In some embodiments, genetic material encapsulated within hydrogel beads is contacted with one or more reagents for nucleic acid processing. In some embodiments, the genetic material is retained within the hydrogel beads, and the reagents can pass through the pores of the hydrogel beads. In some embodiments, the reagents may include solvents, nucleic acid purifiers, DNA amplifiers, labeling agents, PCR agents, or other agents used for processing the genetic material. Thus, the hydrogel beads provide a microenvironment for controlled reactions of genetic material within the hydrogel beads by allowing a barrier of reagents to pass through the inside and outside of the hydrogel beads while retaining the genetic material itself within the hydrogel beads.
[0030] As used herein, the term “tagmentation” refers to the denaturation of DNA by a transpososome complex containing a transposase enzyme compounded with an adapter containing a transposon terminal sequence. Tagmentation results in the simultaneous fragmentation of DNA and the ligation of the adapter to the 5' ends of both strands of the two-strand fragments. Following a purification step to remove the transposase enzyme, additional sequences can be added to the ends of the adapted fragments, for example, by PCR, ligation, or any other suitable method known to those skilled in the art. In some embodiments, the entire DNA library preparation can be seamlessly achieved in hydrogel beads using multiple reagent exchanges by passing the gDNA and its library product through a porous hydrogel while retaining it in a hydrogel matrix. The hydrogel may be tolerant to temperatures below 95°C for several hours to support different biochemical reactions.
[0031] In some embodiments, hydrogel beads encapsulating cells or viral particles are processed to purify and isolate nucleic acids from the cells or particles. For example, the hydrogel beads are brought into contact with a lysis buffer. As used herein, “lysis” means perturbation or alteration of the cell wall or viral particle, facilitating access to or release to cellular RNA or DNA. Complete destruction or breakage of the cell wall is not a necessary requirement for lysis. The term “lysis buffer” means a buffer containing at least one lysis agent. Typical enzymatic lysis agents include, but are not limited to, lysozyme, glucolase, zymolose, lithicase, proteinase K, proteinase E, and viral endolysin and exolysin. Therefore, for example, lysis of cells in the beads may be carried out by introducing lysis agents such as lysozyme and proteinase K into the hydrogel beads. gDNA from the cells is here contained within the beads. In some embodiments, after the lysis treatment, the isolated nucleic acids may be retained within the hydrogel beads and used for further processing.
[0032] As used herein, “isolated,” “to isolate,” “isolation,” “purified,” “to purify,” “purification,” and grammatically equivalent terms used herein mean, unless otherwise specified, a reduction in the amount of at least one contaminant (protein and / or nucleic acid sequence) from a sample or source (e.g., cells) from which a substance is isolated. Thus, purification results in “enrichment,” e.g., an increase in the amount of a desired protein and / or nucleic acid sequence in the sample.
[0033] Following the lysis and isolation of nucleic acids, amplification may be performed, such as multiple substitution amplification (MDA), which is a widely used technique, particularly for amplifying small amounts of DNA from single cells. In some embodiments, the encapsulated nucleic acids are amplified, sequenced, or used for the preparation of nucleic acid libraries. As used herein, the terms “amplify” or “amplified” and “amplify” mean, when used in relation to nucleic acids or nucleic acid reactions, an in vitro method for producing, for example, copies of a particular nucleic acid, such as a target nucleic acid or nucleic acid encapsulated in beads, according to embodiments of the present invention. Numerous methods for amplifying nucleic acids are known in the art, and amplification reactions include polymerase chain reactions, ligase chain reactions, strand substitution amplification reactions, rolling circle amplification reactions, multiple annealing and looping based amplification cycles (MALBAC), transcription-mediated amplification methods such as NASBA, and loop-mediated amplification methods (e.g., “LAMP” amplification using loop-forming sequences). The nucleic acid to be amplified may consist of, or be derived from, DNA or RNA or a mixture of DNA and RNA, including denatured DNA and / or denatured RNA. The products obtained from the amplification of the nucleic acid molecule (e.g., “amplification products”) may be nucleosides or nucleotides of either DNA or RNA, or a mixture of both DNA and RNA, regardless of whether the starting nucleic acid is DNA, RNA, or both, or they may include nucleosides or nucleotides of denatured DNA or RNA. “Copy” does not necessarily mean perfect sequence complementarity or sequence identity with respect to the target sequence. For example, a copy may include nucleotide analogs such as deoxyinosine or deoxyuridine, intentional sequence alterations (e.g., sequence alterations introduced via primers containing sequences that are not complementary to the target sequence), and / or sequence errors that occur during amplification.
[0034] Encapsulated nucleic acids isolated within hydrogel beads can be amplified according to any preferred amplification method known in the art. In some embodiments, the encapsulated nucleic acids are amplified within the beads. In some embodiments, the beads are captured and degraded on a solid support, the encapsulated nucleic acids are released onto the solid support, and the nucleic acids are amplified on the solid support.
[0035] In some embodiments, the encapsulated nucleic acid is amplified within hydrogel beads. For example, in some embodiments, amplification primers and enzymes pass through the pores of the hydrogel beads and hybridize with the encapsulated nucleic acid.
[0036] It is understood that any amplification method described herein or commonly known in the art can be used with general-purpose primers or target-specific primers to amplify encapsulated nucleic acids. Preferred amplification methods, but not limited to, include polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and nucleic acid sequence-based amplification (NASBA), as described in U.S. Patent No. 8,003,354 (which is incorporated herein by reference in its entirety). These amplification methods can be used to amplify one or more nucleic acids of interest. For example, encapsulated nucleic acids can be amplified using PCR, including multiplex PCR, SDA, TMA, and NASBA. In some embodiments, primers specifically directed to the nucleic acid of interest are included in the amplification reaction.
[0037] Other preferred methods for nucleic acid amplification include oligonucleotide extension and ligation, rolling circle amplification (RCA) (Lizardi et al., Nat. Genet. 19:225-232 (1998), incorporated herein by reference), and oligonucleotide ligation assay (OLA) techniques (see, generally, U.S. Patents Nos. 7,582,420, 5,185,243, 5,679,524, and 5,573,907; European Patent No. 0320308B1, and the same; International Publication Nos. 90 / 01069, 89 / 12696, and 89 / 09835 (all incorporated herein by reference)). It is understood that these amplification methods can be designed to amplify encapsulated nucleic acids. For example, in some embodiments, the amplification method may include a ligation probe amplification or oligonucleotide ligation assay (OLA) reaction that includes a primer specifically directed to the nucleic acid of interest. In some embodiments, the amplification method may include a primer extension ligation reaction that includes a primer specifically directed to the nucleic acid of interest and can pass through the hydrogel pores. As non-limiting examples of primer extension and ligation primers that can be specifically designed to amplify the nucleic acid of interest, the amplification may include primers used in the GoldenGate assay (Illumina, Inc., San Diego, California), as exemplified in U.S. Patents 7,582,420 and 7,611,869, each of which is incorporated herein by reference in whole. In each of the methods described, the reagents and components involved in the nucleic acid reaction can pass through the pores of the hydrogel beads while retaining the nucleic acid itself within the hydrogel beads.
[0038] In some embodiments, encapsulated nucleic acids are amplified using cluster amplification methods, as illustrated by the disclosures of U.S. Patents 7,985,565 and 7,115,400, the contents of which are incorporated herein by reference in whole. U.S. Patents 7,985,565 and 7,115,400 describe methods for nucleic acid amplification that enable the immobilization of amplification products onto a solid support to form an array consisting of clusters or “colonies” of immobilized nucleic acid molecules. Each cluster or colony on such an array is formed from multiple identical immobilized polynucleotide chains and multiple identical immobilized complementary polynucleotide chains. The array thus formed is generally referred herein to as a “clustered array.” The products of solid-phase amplification reactions, such as those described in U.S. Patents 7,985,565 and 7,115,400, are so-called "bridged" structures formed by the annealing of a pair of immobilized polynucleotide chains and an immobilized complementary chain, both chains being immobilized on a solid support at their 5' ends, preferably via covalent bonds. An example of a method for producing an immobilized amplicon using an immobilized nucleic acid template is provided. Other suitable methods can also be used to produce an immobilized amplicon from an immobilized DNA fragment prepared according to the methods provided herein. For example, one or more clusters or colonies can be formed by solid-phase PCR, regardless of whether one or both primers of each pair of amplification primers are immobilized. In some embodiments, encapsulated nucleic acids are amplified in beads and then deposited on a solid support in an array or cluster. For example, as shown in Figure 12, hydrogel beads encapsulating nucleic acids were processed, and the nucleic acids contained therein were used to form two different indexed DNA libraries. Two types of hydrogel beads containing the ΦX library were prepared, one with index 2 (CGATGT) and the other with index 4 (TGACCA). Hydrogel beads having indices 2 and 4 are mixed and packed into a flow cell. The beads are brought into contact with a surface, decomposed, and a library is attached to the surface.Microscopic images show nucleic acid imaging that reveals clusters formed based on distinct environments within separate beads. The image above shows spatial separation between the index 2 library and the index 4 library, indicating that these libraries originate from different hydrogel beads. Scale bar = 50 μm.
[0039] Further amplification methods include isothermal amplification. Examples of isothermal amplification methods that may be used include, but are not limited to, multi-substitution amplification (MDA), as exemplified by Dean et al., Proc. Natl. Acad. Sci. USA, 99:5261-66 (2002), or isothermal chain substitution nucleic acid amplification, as exemplified in, for example, U.S. Patent No. 6,214,587, each of which is incorporated herein by reference in whole. Other non-PCR-based methods that can be used in this disclosure include, for example, Walker et al., Molecular Methods for Virus Detection, Academic Press, Inc., 1995; U.S. Patent Nos. 5,455,166 and 5,130,238; and the strand displacement amplification (SDA) described by Walker et al., Nucl. Acids Res. 20:1691-96 (1992); or, for example, the highly branched strand displacement amplification described by Lage et al., Genome Research 13:294-307 (2003), each of which is incorporated herein by reference in whole. The isothermal amplification method may be used with strand displacement φ29 polymerase or BstDNA polymerase large fragment, 5'->3'exo- for random primer amplification of genomic DNA. The use of these polymerases takes advantage of their high processability and strand displacement activity. The high processability allows the polymerase to produce fragments with a length of 10–20 kb. As described above, smaller fragments can be produced under isothermal conditions using polymerases with low processability and strand displacement activity, such as Klenow polymerase. Further descriptions of amplification reactions, conditions, and components are described in detail in the disclosure of U.S. Patent No. 7,670,810, which is incorporated herein by reference in its entirety. In some embodiments, the polymerases, reagents, and components required to carry out these amplification reactions can pass through the pores of hydrogel beads and interact with encapsulated nucleic acids, thereby amplifying the nucleic acids within the hydrogel beads. In some embodiments, random hexamers are annealed to denatured DNA and then subjected to strand displacement synthesis at a constant temperature in the presence of a catalytic enzyme, Φ29.This results in DNA amplification within the beads, as confirmed by the increase in fluorescence intensity (DNA stained with SYTOX) after MDA (Figure 9, panel a)). Independently, subsequent gDNA amplification may be performed by tagmentation, washing, and PCR based on lysated Nextera, as indicated by a substantial increase in fluorescence intensity within the beads after Nextera tagmentation and PCR (Figure 9, panel b)). After this Nextera library preparation, the gel beads may be heated at 80°C for 3 minutes to release the contents of the beads, i.e., the single-cell sequencing-compatible library product as shown in Figure 9, panel c).
[0040] Another nucleic acid amplification method useful in this disclosure is tagged fragmented PCR using a population of two-domain primers having a fixed 5' region followed by a random 3' region, as described, for example, by Grothues et al. in Nucl. Acids Res. 21(5):1321-2 (1993) (the entire work is incorporated herein by reference). The first round of amplification is performed to allow for the reprogramming of numerous thermally denatured DNAs based on individual hybridization from randomly synthesized 3' regions. Due to the nature of the 3' region, the start sites are considered to be random across the genome. Subsequently, unbound primers can be removed, and further replication can be performed using primers complementary to the fixed 5' region.
[0041] In some embodiments, the encapsulated nucleic acids are fully or partially sequenced within the hydrogel beads. The encapsulated nucleic acids can be sequenced according to any preferred sequencing method, such as direct sequencing, including synthetic sequencing, ligation sequencing, hybridization sequencing, and nanopore sequencing. As schematically shown in Figure 8B, the single cells encapsulated within the hydrogel beads may be processed for single-cell sequencing.
[0042] One sequencing method is synthetic sequencing (SBS). In SBS, the sequence of nucleotides in a nucleic acid template is determined by monitoring the extension of nucleic acid primers along a nucleic acid template (e.g., a target nucleic acid or its amplicon). The underlying chemical process can be polymerization (e.g., catalyzed by a polymerase enzyme). In certain polymerase-based SBS embodiments, fluorescently labeled nucleotides are attached to the primers in a template-dependent manner (thus extending the primers) so that the sequence of the template can be determined by detecting the order and type of nucleotides attached to the primers.
[0043] One or more amplified encapsulated nucleic acids can be subjected to SBS or other detection techniques involving repeated delivery of reagents in a cycle. For example, to initiate a first SBS cycle, one or more labeled nucleotides, DNA polymerase, etc., can be flowed through / into hydrogel beads containing one or more amplified nucleic acid molecules. The site where the labeled nucleotide is incorporated can be detected by primer extension. Optionally, the nucleotide may further include reversible termination properties, which terminate further primer extension when the nucleotide is added to the primer. For example, a nucleotide analog with a reversible terminator moiety can be added to the primer so that further extension cannot occur until a deprotecting agent is delivered to remove the moiety. Thus, in embodiments using reversible termination, a deblocking reagent can be delivered to the flow cell (before or after detection occurs). Washing can be performed between the various delivery steps. This cycle can then be repeated n times to extend the primer with n nucleotides, thereby enabling the detection of a sequence of length n. Exemplary SBS procedures, fluid systems, and detection platforms that can be readily adapted for use with amplicons manufactured by the methods of the present disclosure are described, for example, in Bentley et al., Nature, 456:53-59 (2008), International Publication No. 04 / 018497; U.S. Patent No. 7,057,026; International Publication No. 91 / 06678; International Publication No. 07 / 123744; U.S. Patent Nos. 7,329,492; 7,211,414; 7,315,019; 7,405,281 and U.S. Patent Application Publication No. 2008 / 0108082.
[0044] Other sequencing procedures using periodic reactions, such as pyrosequencing, can be used. Since specific nucleotides are incorporated into the nascent nucleic acid chain, pyrosequencing can detect the release of inorganic pyrophosphate (PPi) (Ronaghi et al., Analytical Biochemistry 242(1), 84-9 (1996); Ronaghi, Genome Res. 11(1), 3-11 (2001); Ronaghi et al., Science 281(5375), 363 (1998); U.S. Patent No. 6,210,891; U.S. Patents No. 6,258,568 and 6,274,320, each incorporated herein by reference). In pyrosequencing, the released PPi can be detected by immediate conversion to adenosine triphosphate (ATP) by ATP sulfurylase, and the level of the generated ATP can be detected by photons produced by luciferase. Thus, the sequencing reaction can be monitored by a luminescence detection system. The excitation radiation source used in the fluorescence-based detection system is not required for the pyrosequencing procedure. Useful fluid systems, detectors, and procedures that can be adapted for application of pyrosequencing to amplicons manufactured according to this disclosure are described, for example, in International Application No. PCT / US11 / 57111, U.S. Patent Application Publication No. 2005 / 0191698A1, U.S. Patent No. 7,595,883, and U.S. Patent No. 7,244,559, each of which is incorporated herein by reference.
[0045] Some embodiments can utilize methods that include real-time monitoring of DNA polymerase activity. For example, nucleotide incorporation can be detected using fluorescence resonance energy transfer (FRET) interactions between a phosphor-containing polymerase and a γ-phosphate-labeled nucleotide, or using zero-mode waveguides (ZMWs). Techniques and reagents for FRET-based sequencing are described, for example, in Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett. 33, 1026-1028 (2008); and Korlach et al., Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the disclosures of which are incorporated herein by reference.
[0046] Some embodiments of SBS include the detection of protons released when nucleotides are incorporated into the extension product. For example, sequencing based on the detection of released protons can use commercially available electrodetectors and related techniques. Examples of such sequencing systems include pyrosequencing (e.g., a commercially available platform from 454 Life Sciences, a subsidiary of Roche), sequencing using γ-phosphate-labeled nucleotides (e.g., a commercially available platform from Pacific Biosciences), sequencing using proton detection (e.g., a commercially available platform from Ion Torrent, a subsidiary of Life Technologies), or sequencing methods and sequencing systems described in U.S. Patent Application Publications 2009 / 0026082; 2009 / 0127589; 2010 / 0137143; or 2010 / 0282617, each of which is incorporated herein by reference. Methods for amplifying target nucleic acids using dynamic exclusion as described herein can be readily applied to substrates used for proton detection. More specifically, the methods described herein can be used to generate a clonal population of amplicons used for proton detection.
[0047] Another sequencing technique is nanopore sequencing (see, for example, Deamer et al., Trends Biotechnol. 18, 147-151 (2000); Deamer et al., Acc. Chem. Res. 35:817-825 (2002); Li et al., Nat. Mater. 2:611-615 (2003), these disclosures are incorporated herein by reference). In some nanopore embodiments, the target nucleic acid or individual nucleotides removed from the target nucleic acid pass through the nanopore. Since nucleic acids or nucleotides pass through nanopores, each type of nucleotide can be identified by measuring the variation in the electrical conductivity of the pores (U.S. Patent No. 7,001,792; Soni et al., Clin. Chem. 53, 1996–2001 (2007); Healy, Nanomed. 2, 459–481 (2007); Cockroft et al., Am. Chem. Soc. 130, 818–820 (2008); these disclosures are incorporated herein by reference).
[0048] Exemplary methods for array-based expression and genotyping analysis that can be applied to the detections described herein are described in U.S. Patent Nos. 7,582,420, 6,890,741, 6,913,884, or 6,355,431, or U.S. Patent Application Publication Nos. 2005 / 0053980; 2009 / 0186349, or 2005 / 0181440, each of which is incorporated herein by reference.
[0049] In the methods for isolating, amplifying, and sequencing nucleic acids described herein, various reagents are used for the isolation and preparation of nucleic acids. Such reagents include, for example, lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primer (e.g., P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation. These reagents pass through the pores of the hydrogel beads, while the genetic material is retained within the hydrogel beads. An advantage of the methods described herein is the provision of an encapsulated microenvironment for the processing of nucleic acids within the hydrogel beads. This enables single-cell processing for rapid and efficient processing of target nucleic acids.
[0050] The adapter may include sequencing primer sites, amplification primer sites, and an index. As used herein, “index” may include a sequence of nucleotides that can be used as a molecular identifier and / or barcode for tagging nucleic acids and / or identifying the source of nucleic acids. In some embodiments, the index may be used to identify a single nucleic acid or a subpopulation of nucleic acids. In some embodiments, the nucleic acid library may be prepared in hydrogel beads. As schematically shown in Figure 8A, a single cell encapsulated in hydrogel beads may be used for combinatorial indexing of the single cell, for example, using a contiguity-preserving transposition (CPTSeq) method. In some embodiments, as schematically shown in Figure 8C, for example, DNA from a single cell may be barcoded by encapsulating the single cell after WGA amplification using another bead that carries a barcoded transposon and dissolves the gel matrix by contacting it with a reducing agent, in order to release genomic DNA for barcoding.
[0051] The embodiments of the “spatial indexing” methods and techniques described herein shorten data analysis and simplify methods for preparing libraries from single cells and long DNA molecules. Existing protocols for single-cell sequencing require efficient physical isolation of cells, uniquely barcoding each isolated cell, and pooling them all together for sequencing. Current protocols for synthetic long reads also require a cumbersome barcoding process, and pooling each barcoded fragment together for sequencing, performing data analysis, and distinguishing genetic information from each barcoded cell. During these lengthy methods, there is also loss of genetic material that causes dropouts during sequencing. The embodiments described herein can not only shorten the methods but also increase data resolution for single cells. Furthermore, the embodiments provided herein simplify the assembly of genomes of novel organisms. The embodiments described herein can be used to reveal the co-occurrence of rare genetic variations and mutations. In some embodiments, the DNA library is confined within hydrogel beads until release provides an opportunity to control the size of the fragments released onto the surface by controlling the release method and hydrogel formulation.
[0052] In some embodiments, the library may be amplified using primer sites in the adapter sequence and sequenced using sequencing primer sites in the adapter sequence. In some embodiments, the adapter sequence may include an index for identifying the source of nucleic acids. The efficiency of the subsequent amplification step can be reduced by primer-dimer formation. To improve the efficiency of the subsequent amplification step, unbound single-stranded adapters can be removed from the recombination product.
[0053] Preparation of nucleic acid libraries using hydrogel beads Some embodiments of the systems, methods, and compositions provided herein include a method by which an adapter is ligated to a target nucleic acid. The adapter may include a sequencing primer binding site, an amplification primer binding site, and an index. For example, the adapter may include a P5 sequence, a P7 sequence, or their complements. As used herein, the P5 sequence includes the sequence defined by SEQ ID NO: 1 (AATGATACGGCGACCACCGA), and the P7 sequence includes the sequence defined by SEQ ID NO: 2 (CAAGCAGAAGACGGCATACGA). In some embodiments, the P5 or P7 sequence may further include a spacer polynucleotide, which may consist of 1 to 20 nucleotides, e.g., 1 to 15 or 1 to 10 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer includes 10 nucleotides. In some embodiments, the spacer is a poly-T spacer, such as a 10T spacer. The spacer nucleotide may be contained at the 5' end of the polynucleotide or may be bound to a preferred carrier by binding to the 5' end of the polynucleotide. Binding can be achieved by a sulfur-containing nucleophile, such as a phosphorothioate, present at the 5' end of the polynucleotide. In some embodiments, the polynucleotide comprises a poly-T spacer and a 5' phosphorothioate group. Thus, in some embodiments, the P5 sequence is 5'phosphorothioate-TTTTTTTTTTAATGGCGACCACCGA-3', SEQ ID NO: 3, and in some embodiments, the P7 sequence is 5'phosphorothioate-TTTTTTTTTTAATGGCGACCACCGA-3', SEQ ID NO: 4.
[0054] The index is useful for identifying the source of nucleic acid molecules. In some embodiments, the adapter can be modified to prevent concatemer formation, for example, by adding blocking groups that prevent extension of the adapter at one or both ends. Examples of 3' blocking groups include 3'-spacer C3, dideoxynucleotides, and binding to substrates. Examples of 5' blocking groups include dephosphorylated 5' nucleotides and binding to substrates.
[0055] The adapter contains nucleic acids, such as single-stranded nucleic acids. The adapter may contain short nucleic acids having lengths in the range of approximately 5 nucleotides, 10 nucleotides, 20 nucleotides, 30 nucleotides, 40 nucleotides, 50 nucleotides, 60 nucleotides, 70 nucleotides, 80 nucleotides, 90 nucleotides, 100 nucleotides, less than, greater than, equal to, or between any two of these sizes. In some embodiments, the adapter is large enough to pass through the pores of the hydrogel beads. The target nucleic acid includes DNA such as genome or cDNA; RNA such as mRNA, sRNA or rRNA; or a hybrid of DNA and RNA. The nucleic acid may be isolated from a single cell encapsulated within the hydrogel beads. The nucleic acid may contain phosphodiester bonds and may contain other types of skeletons, such as phosphoramides, phosphorothioates, phosphorodithioates, O-methylphosphoramidites and peptide nucleic acid skeletons and bonds. Nucleic acids can include any combination of deoxyribonucleotides and ribonucleotides, as well as any combination of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthanine, hypoxanthanine, isocytosine, isoguanine, and base analogs such as nitropyrrole (including 3-nitropyrrole) and nitroindole (including 5-nitroindole). In some embodiments, nucleic acids can include at least one promiscuous base. Promiscuous bases can include base pairs having two or more different types of bases and are useful, for example, when included in oligonucleotide primers or inserts used for random hybridization in complex nucleic acid samples such as genomic DNA samples. Examples of promiscuous bases include inosine paired with adenine, thymine, or cytosine. Other examples include hypoxanthine, 5-nitroindole, acyl 5-nitroindole, 4-nitropyrazole, 4-nitroimidazole, and 3-nitropyrrole. Promiscuous bases can be used that can be base-paired with at least two, three, or four or more bases.
[0056] The target nucleic acid may include samples in which the average size of the nucleic acid in the sample is approximately 2kb, 1kb, 500bp, 400bp, 200bp, 100bp, 50bp, less than, greater than, or equal to any two of the above sizes. In some embodiments, the average size of the nucleic acid in the sample is approximately 2000 nucleotides, 1000 nucleotides, 500 nucleotides, 400 nucleotides, 200 nucleotides, 100 nucleotides, 50 nucleotides, less than, greater than, or equal to any two of the above sizes. In some embodiments, the nucleic acid is large enough to be trapped within the hydrogel beads so that it cannot pass through the pores of the hydrogel beads.
[0057] Exemplary methods include the steps of: dephosphorylating the 5' end of a target nucleic acid to prevent concatemer formation in a subsequent recombination step; recombining the first adapter to the dephosphorylated 3' end of the target using a ligase in which the 3' end of the first adapter is blocked; rephosphorylating the 5' end of the recombined target; and recombining the second adapter to the dephosphorylated 5' end of the target using a single-stranded ligase in which the 5' end of the second adapter is not phosphorylated.
[0058] Another example involves partial digestion of a nucleic acid by a 5' exonuclease to form a double-stranded nucleic acid with a single-stranded 3' overhang. An adapter containing a 3' blocking group can be reattached to the 3' end of the double-stranded nucleic acid with the 3' overhang. The reattached adapter can be used to dehybridize the double-stranded nucleic acid with the 3' overhang to form a single-stranded nucleic acid. An adapter containing a non-phosphorylated 5' end can be reattached to the 5' end of the single-stranded nucleic acid.
[0059] Methods for dephosphorylating nucleic acids, such as the 5' nucleotide, involve contacting the nucleic acid with a phosphatase. Examples of phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, antarctic phosphatase, and APEX alkaline phosphatase (Epicentre).
[0060] Methods for rejoining nucleic acids include contacting the nucleic acid with a ligase. Examples of ligases include T4RNA ligase 1, T4RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126RNA ligase (CIRCLIGASE).
[0061] Methods for phosphorylating nucleic acids, such as the 5' nucleotide, involve contacting the nucleic acid with a kinase. Examples of kinases include T4 polynucleotide kinase.
[0062] Embodiments provided herein relate to preparing nucleic acid libraries in hydrogel beads such that the nucleic acid library is prepared in a single reaction volume.
[0063] Embodiments of systems and methods provided herein include one or more hydrogel polymers, crosslinkers, or microfluidic devices for preparing hydrogel beads that encapsulate genetic material, and further include kits containing components useful for processing genetic material, such as lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primer (e.g., P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphate, buffer, or divalent cation, and reagents for cell lysis and nucleic acid amplification and sequencing, or for nucleic acid library preparation. [Examples]
[0064] Example 1: Preparation of hydrogel beads The following examples demonstrate embodiments for preparing hydrogel beads that encapsulate microbial cells using manual stirring and a microfluidic droplet generator.
[0065] Samples containing one or more E. coli, Bsubtilis, and A. hydrophila, stored at -80°C, were thawed at room temperature. 100 μL of each bacterial solution was transferred to a sterile 1.7 mL test tube, and the sample was washed once with 1 mL of 0.85% NaCl. The sample was pelletized, and the washing solution was removed. The bacterial pellets were stored for mixing with the hydrogel solutions described below.
[0066] A 12% hydrogel solution was prepared from 40% acrylamide / bis-19:1 (BioRad#161-0144) diluted with deionized water. A 40% (w / v) acrylamide / N,N'-bis(acryloyl)cystamine (BACy) (19:1) monomer starting material solution (3.8 g acrylamide, 0.2 g BACy, and 6 mL of double-distilled (dd) H2O) was prepared. The mixture was brought to a final volume of 10 mL. To prepare the solution, the above acrylamide was dissolved in 6 mL of double-distilled H2O, and the BACy was dissolved in the resulting solution. Since monomer dissolution is endothermic, slightly heating the mixture helps the monomer to dissolve completely. The hydrogel solution was maintained at 4°C until use. 35 μg of saturated potassium persulfate solution (KPS; Sigma) was added to 200 μL of the 12% hydrogel solution and mixed thoroughly. 235 μL of hydrogel-KPS solution was added to each test tube containing the bacterial cell pellet to resuspend the cells. The hydrogel-bacterial solution was then filled into 600 μL of mineral oil containing surfactants (4.5% Span 80, 0.4% Tween 20, and 0.05% Triton X-100). The solution was stirred for 30 seconds to form a droplet emulsion, and 25 μL of tetramethylethylenediamine (TEMED; Sigma) was immediately added, followed by stirring for another 30 seconds.
[0067] To prepare a 10% gel (2 mL) with an acrylamide / BACy ratio of 19:1, 0.96 mL of double-distilled H2O, 0.5 mL of 40% acrylamide / BACy (19:1), 0.5 mL of 10x Tris / borate / EDTA buffer (TBE), 20 μL of TEMED, and 20 μL of KPS (saturated) were mixed.
[0068] To prepare a 5% gel (2 mL) with an acrylamide / BACy ratio of 19:1, 1.21 mL of double-distilled H2O, 0.25 mL of 40% acrylamide / BACy (19:1), 0.5 mL of 10x TBE, 20 μL of TEMED, and 20 μL of KPS (saturated) were mixed. The reaction was polymerized until gelation occurred (3-6 minutes or less).
[0069] Next, hydrogel beads were generated to encapsulate bacterial cells. After incubation for 15 minutes to fully crosslink the hydrogel beads, approximately 900 μL of petroleum ether was added to each test tube. The test tubes were stirred to wash away the oil, and the supernatant was removed. 1 mL of PR2 was added to each test tube, then stirred, and the beads were centrifuged to precipitate. The supernatant was removed, and the beads were washed three times with 1 mL of PR2. The beads were resuspended in 1 mL of PR2. The hydrogel beads in PR2 can be stored at 4°C for at least 3 weeks.
[0070] Using the aforementioned method that employs manual emulsion, hydrogel beads with a size distribution of approximately 2 μm to 100 μm in diameter can be produced.
[0071] To produce hydrogel beads with a uniform size distribution, a microfluidic droplet generator, such as the one illustrated in Figure 2, may be used. To form hydrogel beads with a uniform size distribution, an aqueous solution containing a hydrogel polymer and bacterial cells was introduced into mineral oil within the microfluidic droplet generator. The microfluidic device had a height of 120 μm, with a water channel width of 75 μm and a carrier oil channel width of 78 μm. In this chip, a flow rate of 60 μL / min for the water channel and 300 μL / min for the carrier oil channel were used. Using this device, hydrogel beads with a diameter of approximately 90 μm were produced. The bead size can be fine-tuned by adjusting the channel width, the size of the microfluidic device, and the flow rate.
[0072] Furthermore, the bead diameter can be finely adjusted by adding isopropyl alcohol. As shown in Figure 3, by adding a specific amount of isopropyl alcohol (in the range of 0% to approximately 30% v / v) to the hydrogel solution, hydrogel beads of a specific diameter can be formed. As shown in Figure 3, increasing the amount of isopropyl alcohol reduces the diameter of the hydrogel beads from 130 μm (0% isopropyl alcohol) to approximately 75 μm (28% isopropyl alcohol).
[0073] Hydrogel beads can also be fine-tuned to encapsulate a desired amount of cells. As shown in Figures 4A and 4B, numerous stained bacterial cells were found in each hydrogel bead approximately 100 μm in size (Figure 4A), while only a single cell or a small number of cells were filled in each hydrogel bead approximately 100 μm in size (Figure 4B).
[0074] Furthermore, the gelation rate of the hydrogel beads can also determine the amount of cells in each hydrogel bead. Hydrogel beads were prepared in the presence of NIH-3T3 mouse fibroblasts. As shown in Figures 6A and 6B, rapid gelation of the hydrogel beads resulted in a single cell per bead (Figure 6A), while slow gelation resulted in several cells per bead (Figure 6B).
[0075] Example 2: Nucleotide-functionalized hydrogel beads The following examples demonstrate a method for functionalizing hydrogel beads from Example 1 with nucleotides.
[0076] DNA-functionalized hydrogel beads were obtained by reacting azide-functionalized hydrogel beads with alkyne-functionalized DNA using a copper-catalyzed azide-alkyne cycloaddition (CuAAC) compound (Figure 5A). For the synthesis of azide-functionalized hydrogel beads, a hydrogel precursor mixture containing monomers, crosslinking agents, and radical generators was mixed, and monodisperse hydrogel beads were produced using a microfluidic. The hydrogel beads were doped with BrAPA at concentrations ranging from 0% to 8%. The bromide was then azidated to convert the Br group to an azide group (N3). Next, the azidated hydrogel was reacted with alkyne-modified oligonucleotides using a CuAAC compound. Hydrogel beads without azidation did not have any oligonucleotides grafted onto the beads (Figure 5B, "Original"). On the other hand, azidated hydrogel beads had oligonucleotides grafted onto the hydrogel beads (Figure 5B, "Azidated (N3)"). The density of grafted oligonucleotides directly correlated with the percentage of BrAPA added to the hydrogel precursor mixture.
[0077] These oligonucleotide-functionalized beads were used to capture mRNA from cells. The above hydrogel beads were functionalized with poly-T oligonucleotides (Figure 5C). The poly-T functionalized hydrogel beads were mixed with cells. The cells were then lysed, the beads were collected, and washed. Second-strand synthesis was performed to produce cDNA from the captured mRNA. As shown in Figure 5D, the electrochromatogram shows the trace of the cDNA with its complement (right curve), and the cDNA double helix was then tagged and fragmented with Nextera. The tagged and fragmented DNA (left curve) shifted to a lower molecular weight as expected from tagged fragmentation.
[0078] Example 3: Release of genetic material from hydrogel beads The following examples demonstrate the ability of a crosslinking agent to release the contents of hydrogel beads containing encapsulated genetic material upon reversible cleavage.
[0079] Hydrogel beads were prepared to encapsulate bacterial cells according to Example 1. The hydrogel beads contained a bisacrylamide crosslinking agent containing disulfide bonds. The beads were stained with a dye for visualization of bacterial cells. As shown in Figure 7C, hydrogel beads without a reducing agent were able to retain bacterial cells. However, upon contact with a reducing agent, in this case THP, the bacteria were released from the hydrogel beads.
[0080] Example 4: Preparation of a nucleic acid library in hydrogel beads The following examples demonstrate a method for sequencing nucleic acids from genetic material encapsulated in hydrogel beads.
[0081] Hydrogel beads prepared in Example 1 were obtained, and nucleic acids were isolated as follows. 50 μL of the hydrogel bead solution encapsulating E. coli was transferred to a 200 μL test tube (containing approximately 50 beads / μL). The beads were centrifuged and the supernatant was removed. 100 μL of bacterial lysis reagent (0.5 mg lysozyme in 100 μL of resuspension buffer from Thermo Fisher Scientific, Charge Switch kit) was added to the test tube and incubated at 37°C for 10 minutes. Then, 500 μL of proteinase K reagent was added, and incubated at 55°C for 20 minutes to completely digest the protein. At this stage, the E. coli gDNA was exposed but immobilized within the hydrogel matrix. The beads holding the bacterial gDNA were washed with PR2, and the hydrogel beads were recovered. Then, Tn5 transposome reagent (Nextera, Illumina, Inc.) was added to the test tube and incubated at 55°C for 5 minutes. After this step, adapters containing P5 and P7 ends were inserted into the DNA. Next, 50 μL of stop buffer was packed to prepare the Tn5 enzyme. Bsu polymerase and a nucleotide extension mixture were added for gap filling. After this step, the nucleic acid library was prepared and immobilized in the hydrogel bead matrix. These same steps were repeated for B. subtilis hydrogel beads and A. hydrophila, respectively, to lyse the bacterial cells and complete the library preparation for each hydrogel bead. As shown in Figure 10, the hydrogel beads containing the prepared DNA library were seeded on the surface to release the DNA library. In Figure 10, panel a) shows the hydrogel with tagged fragmented genome packed on the P5 / P7 graft surface. In Figure 10, panel b) shows eluted, seeded, isothermally bridged amplified, and stained single-stranded DNA. In Figure 10, panel c) shows the cluster density gradient from high density to low density (left to right), where higher densities indicate the position on the surface of the hydrogel where it first arrived.
[0082] This embodiment demonstrates the preparation of hydrogel beads that encapsulate a single bacterial cell, which can then be used to process bacterial genomes and construct a whole DNA library within the beads. The pore size of the hydrogel was designed to allow diffusion of enzymes, chemicals, and smaller-sized primers (<50 bps), but to hold larger-sized DNA (>300 bps) so that the complete whole-genomic DNA and the resulting DNA library are retained within the gel microbeads throughout the process. The DNA library from a single bacterium can then be released, for example, onto a specific region on the surface of a flow cell for library seeding. This results in a spatial distribution of "DNA clusters" on the flow cell derived from individual bacterial cells, thereby simplifying read alignment during post-processing.
[0083] Example 5: Nucleic acid sequencing from hydrogel beads The following examples demonstrate sequencing of DNA libraries from hydrogel beads that encapsulate genetic material.
[0084] The DNA library prepared in Example 4 was released from the hydrogel and allowed to adhere to the surface. Fragmented DNA was eluted from the hydrogel. A control sample was stored without heat treatment. Both samples were concentrated by 12-cycle PCR and analyzed with a bioanalyzer to determine the fragment distribution. After double ampure washing, E. coli fragments were sequenced on a MiSeq platform (Illumina, Inc., San Diego, California). As shown in Figure 11A, the DNA fragments eluted from the hydrogel had a fragment size distribution with an average size of approximately 350 bp. In contrast, the unheat-treated sample shown in Figure 11B showed no fragments even after 12-cycle PCR, indicating that fragments were not released from the hydrogel beads. The fragments were sequenced, and 98% of the sequences aligned with Enterobacteriaceae, and 39% aligned with E. coli.
[0085] Example 6: Spatial indexing The following examples demonstrate spatial indexing of DNA libraries prepared in hydrogel beads.
[0086] To demonstrate spatial separation between different bacterial species types, E. coli, B. subtilis, and A. hydrophila were selected as model organisms. Each microorganism was embedded in its own group of hydrogel beads. Each bead species containing a single microorganism was treated separately by lysis, and each species had its own unique index added during the library preparation protocol. Three different hydrogel beads carrying DNA libraries from E. coli, B. subtilis, and A. hydrophila were then mixed in the same test tube. The hydrogel beads were centrifuged and the supernatant was removed. 100 μL of mineral oil containing surfactants (4.5% Span 80, 0.4% Tween 20, 0.05% Triton X-100) was added to the beads and stirred for 30 seconds to resuspend the beads in the oil. Then, 25 μL of the oil-re-emulsified bead solution was packed into a MiSeq flow cell. The DNA library was denatured by raising the temperature of the MiSeq flow cell to 90°C over 3 minutes, and the denatured library was diffused from the hydrogel beads. Subsequently, the single-stranded DNA library was hybridized to surface P5 / P7 primers for cluster amplification by processing at 60°C for 6 minutes, 40°C for 2 minutes, and 20°C for 2 minutes. The seeded libraries were clustered, linearized, and first-nucleotide sequenced, and the results are shown in Figure 13. As shown in Figure 13, the DNA library in the hydrogel beads could diffuse from the beads and bind to the MiSeq flow cell, and amplification occurred on the flow cell in separate clusters for each organism.
[0087] MiSeq flow cells seeded with libraries generated in hydrogel beads containing these three different microorganisms were further sequenced using MiSeq (2 × 150 cycle runs). As shown in Figures 14A–14B, sequencing analysis indicates that the experiment was completed with reasonable quality. Each of the three different species was detected. The read lengths generated from the hydrogel-released libraries had a very similar size range, demonstrating that the size of the library fragments released from the hydrogel can be controlled by the hydrogel composition and DNA release protocol. A ΦX control library was also fixed to check experimental quality. Figures 15A–15C show the MiSeq sequencing results of flow cell seeding using hydrogel beads containing E. coli, Bsubtilis, or A. hydrophila, and include raw data from MiSeq images (Figure 15A), clusters aligned to specific genomes (Figure 15B), and a summary table of path filters for the three different bacterial species (Figure 15C).
[0088] The embodiments, examples, and figures described herein provide compositions, methods, and systems for retaining genetic material in a physically confined space during the process from lysis to library generation. Some embodiments provide a single long DNA molecule or a library derived from a single cell that is released onto the surface of a flow cell in a confined space. Once the single DNA molecules or libraries from single cells within individual compartments are released onto the surface of the flow cell, the libraries from each compartment are seeded in close proximity to one another.
[0089] As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by," and may be comprehensive or open-ended, and does not exclude additional, unlisted elements or steps of method.
[0090] The above description discloses some methods and materials of the present invention. The present invention allows for changes in methods and materials, as well as modifications to manufacturing methods and apparatus. Such changes will become apparent to those skilled in the art by considering the disclosures or practices of the present invention disclosed herein. Accordingly, the present invention is not intended to be limited to some embodiments disclosed herein, nor is it intended to encompass all changes and modifications that fall within the true scope and intent of the present invention.
[0091] All references cited herein, including but not limited to published and unpublished applications, patents, and documents, are incorporated herein by reference in their entirety and constitute part of this Specified. In the event of any publication or patent or patent application being incorporated in a manner inconsistent with the disclosures contained herein, this Specified is intended to take precedence over any such conflicting material. [Explanation of Symbols]
[0092] 200… Microfluidic devices 210… Hydrogel beads 215 ... Channel for aqueous stream 220 ... Channel for immiscible fluids
Claims
1. A process of encapsulating a single cell within a hydrogel polymer bead. A step of tagging and fragmenting nucleic acids from a single cell using barcodes and adapter sequences within the hydrogel polymer beads to perform a tagmentation reaction, thereby generating a nucleic acid library within the hydrogel polymer beads. A step of sowing hydrogel polymer beads onto a surface containing an oligonucleotide fixed thereon, wherein the fixed oligonucleotide binds to the adapter array, A step of releasing a nucleic acid library from hydrogel polymer beads, wherein the nucleic acid library is bound to the surface, and A step of sequencing the nucleic acid library on the surface and identifying the single cell by referring to the barcode. A method for sequencing nucleic acids from a single cell, including [specific example].
2. The method according to claim 1, wherein the nucleic acid is DNA.
3. The method according to claim 1, wherein the single cell is a mammalian cell or a bacterial cell.
4. The method according to claim 1, wherein the single cell is an Escherichia coli cell, a Bacillus subtilis cell, an Aeromonas hydrophylla cell, or a fibroblast.
5. The method according to claim 1, wherein the hydrogel polymer beads include polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / polypropylene oxide (PPO).
6. The method according to claim 1, wherein the adapter array is a P5 or P7 adapter array.
7. The method according to claim 1, wherein the oligonucleotide is a P5 or P7 primer.
8. The method according to claim 1, wherein the step of releasing the nucleic acid library includes raising the temperature of the hydrogel polymer beads, bringing the hydrogel polymer beads into contact with a reducing agent, or applying an electric field to the hydrogel polymer beads.
9. The method according to claim 8, wherein the temperature is raised to a temperature exceeding 50°C.
10. The method according to claim 8, wherein the reducing agent is dithioerythritol (DTE), dithiothreitol (DTT), 2-mercaptoethanol, glutathione, thioglycolate, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP), or p-[tris(hydroxymethyl)phosphine]propionic acid (THPP).
11. The method according to claim 1, wherein each hydrogel polymer bead has a diameter of 2 to 120 μm.
12. The method according to claim 1, wherein the surface is a solid support.
13. The method according to claim 1, wherein the tagmentation reaction comprises contacting a nucleic acid with a transposase mixture comprising an adapter sequence and a transposome.
Citation Information
Patent Citations
Polynucleotide barcode generation
JP2016511243A
Microfluidic method for handling DNA
JP2016517281A
Compositions and methods for sample processing
US20140378349A1
Methods of Analyzing Nucleic Acids from Individual Cells or Cell Populations
US20150376609A1
Methods of analyzing nucleic acids from individual cells or cell populations
WO2015200893A2