Elimination of PD-L1-positive malignant tumors by NK cells expressing the PD-L1 chimeric antigen receptor.

Abstract

To provide an effective cancer therapy that targets both the tumor cells and the cells in the tumor microenvironment.SOLUTION: A recombinant NK-92 cell comprises a recombinant nucleic acid encoding a recombinant chimeric antigen receptor (CAR) that binds to PD-L1, an Fc receptor, and a suicide gene, wherein the recombinant NK-92 cell expresses the CAR and the Fc receptor on its surface.SELECTED DRAWING: Figure 2

Description

[Technical Field]

[0001] This application claims priority to the inventors' concurrently pending U.S. Provisional Patent Application No. 62 / 753,740, filed on 31 October 2018 and incorporated herein by reference.

[0002] Sequence List The contents of the 40kb sequence listing ASCII text file named 104077.0006PCT_ST25_REV006 were created on July 26, 2019, and submitted electronically via EFS-Web with this application, and are incorporated as a whole by reference. [Background technology]

[0003] Cancer cells in solid tumors can form a tumor microenvironment around them to support cancer cell growth and metastasis. The tumor microenvironment is the cellular environment in which a tumor exists, including surrounding blood vessels, immune cells, fibroblasts, other cells, soluble factors, signaling molecules, extracellular matrix, and mechanical cues that can promote oncogenic transformation, support tumor growth and invasion, protect the tumor from host immunity, enhance treatment resistance, and provide a niche for the growth of latent metastases. The tumor and its surrounding microenvironment are closely related and constantly interacting. Tumors can influence their microenvironment by releasing extracellular signals, promoting tumor angiogenesis, and inducing peripheral immune tolerance, while immune cells in the microenvironment can influence the growth and evolution of cancer cells. See Swarts et al. "Tumor Microenvironment Complexity: Emerging Roles in Cancer Therapy," Cancer Res, vol., 72, pages 2473-2480, 2012.

[0004] Natural killer (NK) cells are cytotoxic lymphocytes that constitute the main component of the innate immune system. NK cells generally make up about 10-15% of circulating lymphocytes and bind to and kill target cells, such as virus-infected cells and many malignant tumor cells, nonspecifically with respect to antigens and without prior immune sensitization. (Herberman et al., Science 214:24 (1981)). Killing of target cells occurs by inducing cytolysis. NK cells used for this purpose are isolated from the peripheral blood lymphocyte ("PBL") fraction of the blood from the subject, expanded in cell culture to obtain a sufficient number of cells, and then reinjected into the subject. Such autologous NK cells have shown some efficacy in both ex vivo and in vivo therapies. However, such therapies are limited to autologous situations and are further complicated by the fact that not all NK cells are cytolytic.

[0005] Currently, CAR-T therapy is a common treatment method that targets immune cells in the tumor microenvironment. However, since many target antigens are also expressed on normal precursor cells, these CAR-T therapies often cause cytopenia and a reduction in bone marrow precursors in in vivo models, suggesting that permanently expressed tumor antigen-specific CAR-T cells have unacceptable toxicity to patients. Furthermore, CAR-T technology relies on genetic manipulation of autologous T cells, which leads to significant inter-patient variability and the exclusion of a large number of patients who cannot expand their T cell population. Therefore, there is still a need for effective cancer therapies that target both tumor cells and cells in the tumor microenvironment. [Overview of the project] [Means for solving the problem]

[0006] In some embodiments, this disclosure provides modified NK-92® cells expressing a PD-L1 CAR and an Fc receptor. In some embodiments, the modified NK-92® cells comprise a multicistronic construct encoding a PD-L1 CAR and an Fc receptor. In some embodiments, the Fc receptor is CD16. In some embodiments, the Fc receptor comprises SEQ ID NO: 2. In some embodiments, the multicistronic transgene further comprises a sequence encoding IL-2 or a variant thereof. In some embodiments, the PD-L1 CAR, Fc receptor, and / or IL2 are encoded by a codon-optimized nucleic acid sequence. In some embodiments, the IL-2 variant is erIL-2.

[0007] In some embodiments, one or more coding sequences of PD-L1 CAR, Fc receptor, or erIL-2 are codon-optimized for expression in human systems. In some embodiments, modified NK-92® cells can kill PD-L1 expressing cells. In some embodiments, PD-L1 expressing cells are myeloid-derived immunosuppressive cells (MDSCs) or tumor cells. In some embodiments, the PD-L1 CAR comprises an scFv antibody fragment. In some embodiments, modified NK-92® cells include a sequence encoding a self-cleaving peptide, located between the PD-L1 CAR and CD16, and enabling equimolar expression of PD-L1 CAR and FcR. In some embodiments, modified NK-92® cells include an internal ribosome entry sequence (IRES) between the sequence encoding CD16 and the sequence encoding IL-2 or a variant thereof.

[0008] In some embodiments, the direct cytotoxicity of modified NK-92® cells against PD-L1-expressing cells is 40-100% when the effector-to-target ratio is 10. In some embodiments, the direct cytotoxicity of modified NK-92® cells against PD-L1-expressing cells is higher than that of aNK® cells. In some embodiments, the ADCC activity of modified NK-92® cells is 20-60% when the effector-to-target ratio is 10. In some embodiments, the PD-L1 CAR includes a sequence that shares at least 90% identity with SEQ ID NO: 10 (particularly with the CDR sequence within SEQ ID NO: 10). In some embodiments, the Disclosure provides a kit comprising a pharmaceutical composition comprising the modified NK-92® cells of the above Disclosure. In some embodiments, the Disclosure provides a method for generating modified NK-92® cells, comprising providing a vector encoding the PD-L1 CAR and CD16, and a method for generating modified NK-92® cells by introducing the vector into NK-92® cells.

[0009] In some embodiments, the vector further comprises a sequence encoding IL-2. In some embodiments, the vector comprises a sequence encoding a self-cleaving peptide, the sequence located between CAR and CD16, and the sequence enabling equimolar expression of CAR and CD16. In some embodiments, the vector comprises an internal ribosome entry sequence (IRES) between the CD16 encoding sequence and the IL-2 encoding sequence. In some embodiments, the disclosure provides a method for killing PD-L1 expressing cells, comprising incubating myeloid-derived immunosuppressive cells (MDSCs), tumor-associated macrophages (TAMs), or tumor cells with a plurality of modified NK-92® cells as described in any one of claims 1 to 17, thereby killing the MDSCs, TAMs, or tumor cells.

[0010] In some embodiments, PD-L1-expressing cells are tumor cells or cells in the tumor microenvironment. In some embodiments, cells in the microenvironment are myeloid-derived immunosuppressive cells (MDSCs) or tumor-associated macrophages (TAMs). In some embodiments, MDSC cells express CD14 or CD15. In some embodiments, TAMs express CD68 and one or more of CD206, CD204, or CD163. In some embodiments, the disclosure provides a method for killing myeloid-derived immunosuppressive cells (MDSCs), tumor-associated macrophages, or tumor cells in a subject, comprising administering a therapeutically effective amount of a composition to the subject, wherein the composition comprises the above-described plurality of modified NK-92® cells.

[0011] In some embodiments, the target body surface area is 1 m². 2 Approximately 1 x 10 8 ~Approx. 1×10 11 Individual modified cells are administered to a subject. In some embodiments, the disclosure provides a method for treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a composition comprising any of the above-described modified NK-92® cells. In some embodiments, the cancer is selected from the group consisting of melanoma, breast cancer, ovarian cancer, gastric cancer, prostate cancer, squamous cell carcinoma, head and neck cancer, colon cancer, pancreatic cancer, uterine cancer, renal cell carcinoma, glioblastoma, medulloblastoma, sarcoma, and lung cancer. In some embodiments, the cells are administered intravenously. In some embodiments, the cells are administered intratumorally.

[0012] In some embodiments, the Disclosure provides a method for killing myeloid-derived immunosuppressive cells (MDSCs) or tumor cells in a subject, comprising administering therapeutically effective amounts of a first composition and a second composition to the subject, wherein the first composition comprises a plurality of NK-92® cells and the second composition comprises an anti-PD-L1 antibody.

[0013] In some embodiments, NK-92® cells express the Fc receptor. In some embodiments, NK-92® cells are haNK® cells. In some embodiments, the second composition is avelumab.

[0014] The above general description and the following detailed description are illustrative and explanatory and provide further information about this disclosure. Other purposes, advantages and novel features will be readily apparent to those skilled in the art.

[0015] The purpose, features, and advantages will be more readily apparent when considered in conjunction with the accompanying drawings and when referring to the following disclosure. [Brief explanation of the drawing]

[0016] [Figure 1] This is a schematic representation of the structural domains of the first, second, and third generation CARs. [Figure 2] The components of a tricistronic plasmid containing the CAR coding sequence, P2A sequence, CD16 coding sequence, and erIL-2 coding sequence are shown. [Figure 3] The results of flow cytometry analysis of PD-L1-CAR expression on modified NK-92(registered trademark) cells are shown. [Figure 4] This study demonstrates the cytotoxic effect of PD-L1 t-haNK cells on MDA MB231 cells. Parental aNK(trademark) cells were used as control cells. [Figure 5A-C]Figure 5A shows the cytotoxic effect of PD-L1 t-haNK cells against myeloid-derived immunosuppressive cells (MDSCs). Figure 5B shows the cytotoxic effect of PD-L1 t-haNK cells against aNK™-resistant, PD-L1-positive MDA-MB-231 cell line. XL-48 and XL-49 are two PD-L1 t-haNK populations expressing CARs containing two different scFv domains derived from two different anti-PD-L1 antibodies. Figure 5C shows the antibody-dependent cell-mediated cytotoxicity (ADCC) activity of PD-L1 t-haNK cells in combination with the anti-CD20 antibody rituximab against genetically modified SUP-B15 cells. These genetically modified SUP-B15 cells express CD20 but not CD19. Herceptin was used as a control antibody. [Figure 6A-B] Figure 6A shows in vivo tumor growth of MDA-MB-231-derived tumors in mice treated with vehicle and PD-L1 t-haNK cells using IV administration; Figure 6B shows in vivo tumor growth of HCC827-derived tumors in mice treated with vehicle and PD-L1 t-haNK cells. [Figure 7] This shows in vivo tumor growth of HCC827-derived tumors in mice treated with vehicle and PD-L1 t-haNK cells using it administration. [Figure 8] This shows an exemplary difference between PD-L1 t-haNK cells and haNK® cells. [Figure 9] Exemplary data comparing the cytotoxicity of PD-L1 t-haNK cells and haNK® cells against MDA-MB-231 cells are presented. [Figure 10] Exemplary data comparing the cytotoxicity of PD-L1 t-haNK cells against various tumor cells are presented. [Figure 11] Exemplary data comparing the tracking of PD-L1 t-haNK cells in tumors established from MDA-MB-231 cells and PD-L1 knockout MDA-MB-231 cells are presented. [Figure 12]Exemplary data comparing tumor growth from MDA-MB-231 cells and PD-L1 knockout MDA-MB-231 cells in animals treated with PD-L1 t-haNK cells are presented. [Figure 13] Exemplary data demonstrating the cytotoxicity of PD-L1 t-haNK cells against MDSCs are presented. [Modes for carrying out the invention]

[0017] overview This disclosure provides NK-92® cells expressing a combination of PD-L1 CAR, Fc receptor, and IL2. These cells can target both tumor cells and cells in the tumor microenvironment, effectively treating cancer.

[0018] term Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art.

[0019] In this specification and in the following claims, numerous terms are referenced and defined to have the following meanings.

[0020] The terms used herein are for the purpose of describing specific embodiments only and are not limiting. The singular forms “a,” “an,” and “the” used herein also include the plural form unless otherwise specified by the context. Therefore, for example, a reference to “natural killer cells” includes multiple natural killer cells.

[0021] All numerical specifications, such as pH, temperature, time, concentration, quantity, and molecular weight, including their ranges, are approximations that may vary by only 0.1 or 1.0 increments (+) or (-) as appropriate. While not always explicitly stated, it should be understood that the term "approximately" may precede all numerical specifications.

[0022] As used herein, when used to indicate the presence of a particular cell marker, the "+" sign means that the cell marker is detectably present against an isotype control in fluorescence-activated cell sorting; or detectable beyond the background in quantitative or semi-quantitative RT-PCR.

[0023] As used herein, when used to indicate the presence of a particular cell marker, the cell marker is not detectably present against an isotype control in fluorescence-activated cell sorting; or is not detectable beyond the background in quantitative or semi-quantitative RT-PCR.

[0024] As will be understood by those skilled in the art, for any and all purposes, and especially with regard to the provision of written explanations, all scopes disclosed herein also encompass any and all conceivable subscopes and combinations thereof. Any listed scope can be readily understood and made possible that the same scope may be divided into at least equal 1 / 2, 1 / 3, 1 / 4, 1 / 5, 1 / 10, etc. As a non-limiting example, each scope disclosed herein can be readily divided into a lower third, a middle third, an upper third, etc. Similarly, as will be understood by those skilled in the art, all terms, e.g., “maximum,” “at least,” “greater than,” “less than,” etc., include the number cited and then refer to the scope that can be divided into the above subscopes. Finally, as will be understood by those skilled in the art, a scope includes each individual member. Thus, for example, a group having 1 to 3 cells refers to a group having 1, 2, or 3 cells. Similarly, a group having 1 to 5 cells refers to a group having 1, 2, 3, 4, or 5 cells, and so on.

[0025] As used herein, the term “substantially identical” is used interchangeably with the terms “equivalent” or “substantially similar,” and refers to a quantifiable characteristic of NK-92® cells, such as cytotoxicity, viability, or cell doubling time, where two measurements of that characteristic differ from each other by no more than 15%, no more than 10%, no more than 8%, or no more than 5%.

[0026] It should be understood that, although not always explicitly stated, the reagents described herein are merely illustrative and that equivalents thereof are known in the art.

[0027] For the purposes of this invention, and unless otherwise indicated, the term "NK-92(trademark)" refers to the original NK-92(trademark) cell line, as well as clones of the NK-92(trademark) cell line, NK-92(trademark) cells, and modified NK-92(trademark) cells (e.g., by introduction of exogenous genes). NK-92(trademark) cells and exemplary and non-exclusive modifications thereof are described in U.S. Patent Nos. 7,618,817; 8,034,332; 8,313,943; 9,181,322; 9,150,636; and U.S. Patent Application Publication No. 10 / 008,955, all of which are incorporated herein by reference as a whole, including wild-type NK-92(trademark), NK-92(trademark)-CD16, NK-92(trademark)-CD16-γ, NK-92(trademark)-CD16-ζ, NK-92(trademark)-CD16(F176V), NK-92(trademark)MI, and NK-92(trademark)CI. NK-92(trademark) cells are known to those skilled in the art, and such cells are readily available from NantKwest, Inc.

[0028] As used herein, the term "NK-92(trademark) cells" refers to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights thereto of which are owned by NantKwest (hereinafter, "NK-92(trademark) cells").

[0029] As used herein, the term "aNK(trademark) cells" refers to unmodified natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights thereto of which are owned by NantKwest (hereinafter, "aNK(trademark) cells").

[0030] As used herein, the term "haNK® cells" refers to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), whose rights are held by NantKwest and which have been modified to express CD16 on their cell surface (hereinafter referred to as "CD16+NK-92® cells" or "haNK® cells").

[0031] As used herein, the term "taNK® cells" refers to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), the rights thereto of which are owned by NantKwest, and which have been modified to express a chimeric antigen receptor (hereinafter referred to as "CAR-modified NK-92® cells" or "taNK® cells").

[0032] As used herein, the term “t-haNK®” cells refer to natural killer cells derived from the highly potent unique cell line described by Gong et al. (Leukemia, Apr;8(4):652-8(1994)), which are vested by NantkWest and modified to express CD16 on their cell surface and to express a chimeric antigen receptor (hereinafter referred to as “CAR-modified CD16+NK-92® cells” or “t-haNK cells”). In some embodiments, the tumor-specific antigen is PD-L1, and these NK-92® cells are referred to as PD-L1 t-haNK cells.

[0033] As used herein, the term "multicistronic construct" refers to a recombinant DNA construct that can be transcribed into a single mRNA molecule, which encodes two or more transgenes. A multicistronic construct is referred to as a bicistronic construct if it encodes two transgenes, a tricistronic construct if it encodes three genes, a quadrocistric construct if it encodes four genes, and so on.

[0034] As used herein, the term “chimeric antigen receptor” (CAR) refers to an extracellular antigen-binding domain fused to an intracellular signaling domain. CARs can be expressed in T cells or NK cells to increase cytotoxicity. Generally, the extracellular antigen-binding domain is an scFv specific to the antigen found on the target cell. CAR-expressing NK-92(trademark) cells are targeted to cells that express a particular antigen on their cell surface, based on the specificity of the scFv domain. The scFv domain can be genetically engineered to recognize any antigen, such as tumor-specific and virus-specific antigens. For example, the PD-L1 CAR recognizes PD-L1, a cell surface marker expressed by some cancers.

[0035] As used herein, the term "tumor-specific antigen" refers to an antigen present on cancer or neoplastic cells but undetectable on normal cells originating from the same tissue or lineage as the cancer cells. As used herein, tumor-specific antigen also refers to tumor-associated antigens, i.e., antigens expressed at higher levels on cancer cells compared to normal cells originating from the same tissue or lineage as the cancer cells.

[0036] As used herein, the term “target” refers to the ability of NK-92® cells to recognize and kill tumor cells (i.e., target cells) when referring to tumor targeting. In this context, the term “targeted” refers, for example, to the ability of CARs expressed by NK-92® cells to recognize and bind to cell surface antigens expressed by tumors.

[0037] The term “antibody” refers to any isotype of intact immunoglobulin, or a fragment thereof that can compete with an intact antibody for specific binding to a target antigen, such as chimeric, humanized, fully human, and bispecific antibodies. Intact antibodies generally contain at least two full-length heavy chains and two full-length light chains, but in some examples they may contain fewer chains; for example, antibodies naturally occurring in camels may contain only heavy chains. Antibodies may originate exclusively from a single source, or they may be “chimeric,” where different parts of the antibody originate from two different antibodies. Antigen-binding proteins, antibodies, or binding fragments can be produced in hybridomas by recombinant DNA technology or by enzymatic or chemical cleavage of intact antibodies. Unless otherwise specified, the term “antibody” includes antibodies containing two full-length heavy chains and two full-length light chains, as well as their derivatives, variants, fragments, and mutaines. Furthermore, unless explicitly excluded, antibodies include monoclonal antibodies, bispecific antibodies, minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as “antibody mimes”), chimeric antibodies, humanized antibodies, human antibodies, antibody fusions (sometimes referred to herein as “antibody conjugates”), and fragments thereof. In some embodiments, this term also includes peptide bodies.

[0038] The term "subject" refers to non-human animals, such as mammals, e.g., cats, dogs, cattle, horses, pigs, sheep, and goats, as well as humans. The term "subject" also refers to patients who require treatment for the diseases described herein.

[0039] "Optional" or "depending on circumstances" means that the event or situation described below may or may not occur, and that the description includes examples of when the event or situation occurs and when it does not.

[0040] The term “contains” means that the composition and method described includes the elements, but does not exclude other elements. “Essentially consisting of” means, when used to define a composition and method, to exclude any other elements that are essentially important to the combination. For example, a composition essentially consisting of the elements defined herein does not exclude other elements that do not substantially affect the basic and novel features of the claims. “Consists of” means to exclude other components and substantial method steps in amounts greater than trace amounts. Embodiments defined by each of these transitional terms are within the scope of this disclosure.

[0041] As used herein, the terms “cytotoxicity” and “cytolyticity” are synonymous when used to describe the activity of effector cells, such as NK cells. Generally, cytotoxic activity refers to the killing of target cells by any of the following biological, biochemical, or biophysical mechanisms. More specifically, cytolyticity refers to the activity of an effector that dissolves the plasma membrane of a target cell, thereby destroying its physical integrity. This results in the killing of the target cell. While we do not wish to impose theoretical constraints, the cytotoxic effect of NK cells is thought to be due to cytolyticity.

[0042] The term "kill" in relation to cells / cell populations includes any type of operation that results in the death of those cells / cell populations.

[0043] The term "cytokine" refers to a general class of biomolecules that affect cells of the immune system. Examples of cytokines, though not limited to them, include FLT3 ligands, interferons, and interleukins (ILs), particularly IL-2, IL-12, IL-15, IL-18, and IL-21.

[0044] The terms “patient,” “subject,” and “individual” are used interchangeably herein and refer to any animal, or its cells, whether in vitro or in situ, that is suitable for the methods described herein. In some non-limiting embodiments, the patient, subject, or individual is a human.

[0045] The term “to treat” or “treatment” encompasses the treatment of a disease or disorder described herein in a subject, e.g., a human, and includes (i) inhibiting the disease or disorder, i.e., stopping its onset; (ii) alleviating the disease or disorder, i.e., causing regression of the disorder; (iii) slowing the progression of the disorder; and / or (iv) inhibiting, alleviating, or slowing the progression of one or more symptoms of the disease or disorder. The term “administering” monoclonal antibodies or natural killer cells to a subject, or “administering” them to a subject, includes any route for introducing or delivering the antibodies or cells to perform the desired function. Administration may be carried out by any route suitable for the delivery of cells or monoclonal antibodies. Thus, possible routes of delivery include intravenous, intramuscular, intraperitoneal, or subcutaneous delivery. In some embodiments, modified NK-92® cells are administered directly to a tumor, for example, by injection into the tumor. In some embodiments, the modified NK-92® cells described herein are administered parenterally, for example, by injection, infusion, or transplantation (subcutaneous, intravenous, intramuscular, intravesicular, or intraperitoneal).

[0046] The term "expression" refers to the production of gene products.

[0047] As used herein, the term "cytotoxicity" refers to the killing of target cells by any of the following biological, biochemical, or biophysical mechanisms, when used to describe the activity of effector cells, such as NK cells.

[0048] The terms “reduce,” “reduced,” “reduction,” and “decrease” are all used herein to mean a reduction of at least 10% compared to a reference level, for example, a reduction of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or a reduction of up to 100% including 100% (i.e., a level of absence compared to a reference sample), or any reduction of 10 to 100% compared to a reference level.

[0049] The term "cancer" refers to all types of cancer, neoplasms, or malignant tumors found in mammals, such as leukemia, carcinomas, and sarcomas. Exemplary cancers include cancers of the brain, breast, cervix, colon, head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovarian, sarcoma, stomach, uterus, and medulloblastoma. Additional examples include Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulinoma, malignant carcinoid, bladder cancer, precancerous skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary cancer, malignant hypercalcemia, endometrial cancer, adrenocortical carcinoma, neoplasms of the pancreatic endocrine and exocrine parts, and prostate cancer.

[0050] The term “therapeutic effective dose” or “effective dose” refers to the amount required to improve the symptoms of a disease in an untreated patient. The effective dose of the active compound used to implement this disclosure for the therapeutic treatment of a disease will vary depending on the method of administration, the age, weight, and overall health of the subject. Ultimately, the attending physician or veterinarian will determine the appropriate dose and dosage regimen. Such a dose is referred to as the “effective” dose.

[0051] The term "tumor microenvironment" refers to the cellular environment in which a tumor resides, including surrounding blood vessels, immune cells, fibroblasts, myeloid-derived inflammatory cells, signaling molecules, and the extracellular matrix. Exemplary cell types in the tumor microenvironment include, but are not limited to, myeloid-derived immunosuppressive cells (MDSCs) and tumor-associated macrophages (TAMs).

[0052] The term "immune cells" refers to hematopoietic cells involved in the specific recognition of antigens. Examples of immune cells include antigen-presenting cells (APCs), such as dendritic cells or macrophages, B cells, T cells, natural killer cells, myeloid-derived immunosuppressive cells (MDSCs), and myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes.

[0053] Titles or subtitles may be used herein for the convenience of the reader and do not affect the scope of this disclosure. Furthermore, some terms used herein are defined below.

[0054] MDSC Myeloid-derived immunosuppressive cells (MDSCs) are one of the main immunosuppressive cells in the tumor microenvironment. The tumor microenvironment prevents immune-active cells, such as NK cells, from interacting with tumor cells and attacking and killing them. These negative paralysis effects can be mediated by metabolites and secretions of immunosuppressive cells present in the tumor microenvironment.

[0055] MDSCs are regulators of the immune response in cancer and other pathological conditions, such as myelodysplastic syndrome (MDS) (see, for example, Bronte et al., Nature Communications, 6 Jul 2016, 7:12150, DOI:10.1038 / ncomms12150; Eksioglu et al., “Novel Therapeutic Approach to Improve Hematopoiesis in low risk MDS by Targeting myeloid-derived suppressor cells with The Fc-engineered CD33 Antibody BI 836858,” Leukemia. 2017 October; 31(10):2172-2180. doi:10.1038 / leu.2017.21). Myeloid-derived immunosuppressor cells are a heterogeneous group of immune cells from myeloid lineages, such as early myeloid precursors, immature granulocytes, macrophages, and dendritic cells at different stages of differentiation. Myeloid-derived immunosuppressor cells are potently expanded as a result of altered hematopoiesis in pathological conditions, such as chronic infection and cancer (see, for example, Eksioglu et al., “Novel Therapeutic Approach to Improve Hematopoiesis in low risk MDS by Targeting myeloid-derived suppressor cells with The Fc-engineered CD33 Antibody BI 836858,” Leukemia. 2017 October;31(10):2172-2180. doi:10.1038 / leu.2017.21).

[0056] Myeloid-derived immunosuppressive cells (BEDs) are distinguished from other myeloid cell types by possessing potent immunosuppressive activity rather than immunostimulatory properties. Like other myeloid cells, BEDs interact with other immune cell types, such as T cells, dendritic cells, macrophages, and natural killer cells, to modulate their functions. BEDs can suppress both the cytotoxic activity of natural killer (NK) and NKT cells, as well as the adaptive immune response mediated by CD4+ and CD8+ T cells. While these mechanisms are not fully understood, clinical and experimental evidence suggests that cancer tissue with high invasiveness of BEDs is associated with poor patient prognosis and resistance to treatments.

[0057] The accumulation of MDSCs in peripheral circulation is associated with disease stage and correlates with the stage of the disease. MDSCs are primarily involved in promoting tumor growth by suppressing antitumor immunity. There is also compelling evidence that MDSCs are involved in angiogenesis and metastatic spread.

[0058] Two main subsets of MDSCs have been identified in cancer patients: a monocyte subset characterized by CD14 expression and a granulocyte subset characterized by CD15 expression. Both subsets of MDSCs actively suppress host immunity through various mechanisms, such as the production of reactive oxygen species and arginases. Similar to humans, accumulation of monocyte and granulocyte MDSCs has been noted in the bone marrow, spleen, peripheral circulation, and tumors of tumor-bearing mice. Good targeting of MDSCs in mice is associated with improved immune responses, delayed tumor growth, improved survival rates, and increased efficacy of vaccine therapy. In tumors, monocyte-derived MDSCs rapidly differentiate into tumor-associated macrophages (TAMs).

[0059] Tumor-associated macrophages Tumors are often associated with immune infiltration as part of the reactive stroma where macrophages are concentrated. Typically, macrophages are classified into M1 and M2 macrophages, which have opposing effects on tumor growth: M1 macrophages inhibit tumor cell growth, while M2 macrophages promote tumorigenesis. Tumor cells induce macrophages into an M2-like phenotype via chemokines and polarization cytokines, helping them evade destruction and promoting their development. These M2 macrophages are commonly referred to as tumor-associated macrophages (TAMs). TAMs reside in the tumor microenvironment and play a crucial role in facilitating tumor growth by promoting neovascularization and matrix degradation. Consequently, many tumors with numerous TAMs exhibit increased tumor growth rates, local proliferation, and distal metastasis.

[0060] TAMs express CD68 and other markers; for example, some TAMs express one or more of the following markers: CD206, CD204, or CD163.

[0061] NK-92(TM) cells NK-92® is a cytolytic cancer cell line discovered in the blood of subjects with non-Hodgkin lymphoma and subsequently immortalized in vitro. NK-92® cells are derived from NK cells but lack the major inhibitory receptors displayed by normal NK cells, while retaining the majority of activating receptors. However, NK-92® cells do not attack normal cells, nor do they induce unacceptable immune rejection responses in humans. Characterization of the NK-92® cell line is disclosed in International Publication No. 1998 / 049268 and U.S. Patent Application Publication No. 2002-0068044. NK-92® cells are being evaluated as a therapeutic agent in the treatment of certain cancers.

[0062] vector A vector for transfecting cells to produce the modified cells described herein is described herein. In one embodiment, the vector described herein is a transient expression vector. Exogenous transgenes introduced using such a vector are not integrated into the nuclear genome of the cell; therefore, in the absence of vector replication, the exogenous transgenes are degraded or diluted over time.

[0063] In one embodiment, the vector described herein enables stable translocation of cells. In one embodiment, the vector enables the uptake of a transgene into the cell genome. In one embodiment, the vector has a positive selection marker. The positive selection marker is any gene that allows cells to grow under conditions that kill cells that do not express the gene. Non-limiting examples include antibiotic resistance, for example, Geneticin (the Neo gene from Tn5).

[0064] In one embodiment, the vector is a plasmid vector. In one embodiment, the vector is a viral vector. As will be understood by those skilled in the art, any suitable vector can be used. Suitable vectors are well known in the art.

[0065] In some embodiments, cells are translocated with mRNA encoding a target protein (e.g., CAR). mRNA translocation results in transient expression of the protein. In one embodiment, mRNA translocation into NK-92® cells is performed immediately before cell administration. In one embodiment, "immediately before" cell administration refers to approximately 15 minutes to approximately 48 hours before administration. Preferably, mRNA translocation is performed approximately 5 hours to approximately 24 hours before administration.

[0066] PD-L1 Programmed cell death ligand (PD-L1) is an inhibitory ligand that binds to PD-1 and suppresses T cell activation. PD-L1 is constitutively expressed and induced in tumor cells. PD-L1 is also expressed in MDSCs (medium-dense tumor cells). Studies have reported a significant increase in the number of PD-L1-expressing MDSCs in tumor-bearing mice compared to tumor-free mice, and significantly higher PD-L1 expression in tumor-infiltrating MDSCs compared to lymphoid organs. (See Lu et al., J.Immunol., May 1, 2017, 198 (1 Supplement) 124.9). PD-L1 is also expressed in tumor-associated macrophages (TAMs), and TAM expression of PD-L1 can directly induce T cell apoptosis after receptor binding. (Kuang et al., J.Exp.Med. 2009;206:1327-1337).

[0067] CAR Phenotypic changes that distinguish tumor cells from normal cells derived from the same tissue are often associated with changes in the expression of specific gene products, e.g., loss of normal cell surface components or acquisition of other cell surface components (i.e., antigens undetectable in corresponding normal, non-cancerous tissues). Antigens expressed in neoplasms or tumor cells but not in normal cells, or antigens expressed in neoplasmic cells at levels substantially higher than those found in normal cells, are referred to as “tumor-specific antigens” or “tumor-associated antigens.” Tumor-specific antigens are used as targets for cancer immunotherapy. One such therapy utilizes chimeric antigen receptors (CARs) expressed on the surface of immune cells, e.g., T cells and NK cells, to enhance cytotoxicity against cancer cells. A CAR comprises a single-chain variable fragment (scFv) bound to at least one intracellular signaling domain. The scFv recognizes and binds to an antigen on a target cell (e.g., a cancer cell), triggering effector cell activation. The signaling domain contains an immunoreceptor tyrosine-based activation domain (ITAM), which is important for intracellular signaling by the receptor.

[0068] This disclosure provides NK-92® cells that have been genetically engineered to express at least a chimeric antigen receptor (CAR) on their cell surface. A CAR combines an extracellular antigen-recognition domain (usually derived from the variable domain of a specific antibody) with an intracellular signaling domain (having one or additional co-stimulatory elements) that can trigger a cytolytic response when the specific antigen is recognized. Multiple types of CARs exist, and all of them can be used in this application. First-generation CARs contain one cytoplasmic signaling domain. The signaling domain may be derived, for example, from Fc-epsilon receptor gamma (FcεRIγ) containing one ITAM, or from CD3ζ containing three ITAMs. CD3ζ CARs are thought to be more efficient than FcεRIγ CARs in tumor eradication. See, for example, Haynes, et al. 2001, J. Immunology 166:182-187; Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID See 956304. Second and third-generation CARs combine multiple signaling domains, e.g., the cytoplasmic signaling domain and co-stimulatory signaling domain of CD3ζ, e.g., CD28 / CD134 / CD137 / ICOS and CD28 / CD134, with a single CAR to promote the activation and proliferation of NK-92(trademark) cells. Therefore, in some embodiments, the PD-L1 CAR expressed by PD-L1 t-haNK cells includes a hinge region from CD8 and / or the transmembrane domain of CD28. In some embodiments, the PD-L1 CAR includes the cytoplasmic signaling domain of FcεRIγ. In some embodiments, PD-L1 The CAR includes the cytoplasmic signaling domain of CD3ζ. Examples of the hinge region, the transmembrane domain of CD28, and the cytoplasmic signaling domain of FcεRIγ or CD3ζ are disclosed in U.S. Provisional Patent Application No. 62 / 674,936, which is incorporated herein by reference in its entirety.While previous publications, such as Haynes, et al. 2001, J. Immunology 166:182-187 and Cartellieri, et al. 2010, J. Biomed and Biotech, Vol. 2010, Article ID 956304, have disclosed that CD3ζ CAR may be more effective than FcεRIγ CAR in tumor eradication, in this invention, the inventors have surprisingly and unexpectedly found that such a thing does not apply to the cells, compositions, and methods disclosed herein. In fact, the inventors found that NK-92 cells containing a first-generation CAR with an intracellular domain from FcεRIγ having only one ITAM domain exhibited equivalent or greater cytotoxic activity against cancer cells expressing antigens recognized by the CAR, even when three ITAM domains were combined with other signaling domains (i.e., second or third-generation CARs; data not shown here), compared to NK-92 cells expressing a CAR with a CD3ζ signaling domain having three ITAM domains. An exemplary CAR is schematically illustrated in Figure 1. In particular, the IgE receptor (FcεRI), in its native context, contains two gamma chains linked to each other via disulfide bonds and is typically expressed only in eosinophils, basophils, and epithelial Langerhans cells. The inventors also made the unexpected discovery that CARs containing an intracellular domain from FcεRIγ were expressed on the surface of NK-92 cells at higher levels than other CARs, particularly those containing a CD3ζ signaling domain.

[0069] In some cases, the CAR is specific to PD-L1. In some embodiments, PD-L1 is human PD-L1. In some embodiments, the PD-L1 CAR contains the amino acid sequence described in SEQ ID NO: 10. In some embodiments, the PD-L1 CAR has the amino acid sequence of SEQ ID NO: 14.

[0070] In some embodiments, the PD-L1 CAR polypeptide includes a sequence that shares at least 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% identity with SEQ ID NO: 10 or the CDR sequence portion within SEQ ID NO: 10. In some embodiments, an epitope tag peptide, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of the polypeptide to support cell surface detection using anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0071] In the example, variant polypeptides are produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. CD16 variants are produced by performing site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985), or other known techniques on cloned DNA (Ausubel, 2002; Sambrook and Russell, 2001).

[0072] In some embodiments, the polynucleotide encoding the PD-L1 CAR is mutated to change the amino acid sequence encoding the CAR without altering the CAR's function. For example, a polynucleotide substitution resulting in an amino acid substitution at a "non-essential" amino acid residue can be created in SEQ ID NO: 9, which is a codon-optimized sequence encoding the scFv portion of the PD-L1 CAR.

[0073] Conservative substitutions in Sequence ID No. 9, in which an amino acid of one class is replaced by another amino acid of the same class, fall within the range of disclosed variants, provided that the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, e.g., a β-sheet or α-helical stereostructure, (2) charge, (3) hydrophobicity, or (4) the bulk of the side chain at the target site can alter the polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of one member of one class with another. Substitutions can be introduced at a conservative substitution site or, more preferably, at a non-conservative site.

[0074] In the example, variant polypeptides are produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Variants can be produced by performing site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985), or other known techniques on cloned DNA (Ausubel, 2002; Sambrook and Russell, 2001).

[0075] In some cases, PD-L1 t-haNK cells can be used to treat cancer, particularly cancers that express PD-L1. In some cases, cancers include leukemia (e.g., acute leukemia (e.g., acute lymphoblastic leukemia, acute myeloid leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemia (e.g., chronic myeloid (granulocytic) leukemia and chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenström macroglobulinemia, heavy chain disease, solid tumors, sarcomas and carcinomas, including, but not limited to, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endosarcoma, lymphatic vessel The following are selected from the group consisting of sarcoma, intralymphatic sarcoma, synoviomas, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial cancer, renal cell carcinoma, liver cancer, bile duct cancer, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal glandoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0076] Fc receptor In some embodiments, NK-92® cells are modified to express at least one Fc receptor, resulting in at least one Fc receptor being displayed on the cell surface of the NK-92® cells. The Fc receptor binds to the Fc portion of the antibody. Several Fc receptors are known and differ in their preferred ligand, affinity, expression, and post-binding effect to the antibody.

[0077] [Table 1]

[0078] [Table 2]

[0079] In some embodiments, NK-92® cells are modified to express the Fc receptor protein on their cell surface.

[0080] In some embodiments, the Fc receptor is CD16. For the purposes of this disclosure, specific amino acid residues of CD16 are specified by reference to SEQ ID NO: 2, or SEQ ID NO: 1 which differs by one position relative to SEQ ID NO: 2. Thus, the amino acid residue "at position 158" of the CD16 polypeptide is the amino acid residue corresponding to position 158 of SEQ ID NO: 2 (or SEQ ID NO: 1) when the CD16 polypeptide and SEQ ID NO: 2 are at most aligned. In some embodiments, NK-92® cells are modified to express the mature form of the protein, e.g., human CD16 having phenylalanine at position 158 of SEQ ID NO: 1. In a typical embodiment, NK-92® cells are modified to express the mature form of the protein, e.g., the high-affinity form of human CD16 having valine at position 158 of SEQ ID NO: 2. Position 158 of the mature protein corresponds to position 176 of the CD16 sequence containing the native signal peptide. In some embodiments, the CD16 polypeptide is encoded by a polynucleotide encoding the precursor (i.e., having the native signal peptide) polypeptide sequence of SEQ ID NO: 3 or SEQ ID NO: 4. Therefore, in one embodiment, the Fc receptor comprises FcγRIII-A(CD16). In some embodiments, NK-92(trademark) cells are genetically modified to express an Fc receptor coding polypeptide having at least 90% sequence identity with SEQ ID NO: 1 (FcγRIII-A or CD16 having phenylalanine (F-158) at position 158; or at least 90% identity with SEQ ID NO: 2 (CD16 having valine (F158V) at position 158, a higher affinity form).

[0081] In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with the polynucleotide sequence encoding full-length spontaneously occurring CD16, which includes a signal peptide having phenylalanine at position 176 of full-length CD16 (corresponding to position 158 of the mature CD16 protein). In some embodiments, the polynucleotide encoding the CD16 polypeptide has at least about 70% polynucleotide sequence identity with the polynucleotide sequence encoding full-length spontaneously occurring CD16, which includes a signal peptide having valine at position 176 (corresponding to position 158 of the mature protein). In some embodiments, the polynucleotide encoding CD16 has at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 5 and includes a codon encoding valine at the position of the polynucleotide encoding position 176 of the full-length CD16 polypeptide including the signal peptide. In some embodiments, the polynucleotide encoding CD16 includes SEQ ID NO: 5 but has a codon encoding valine at position 176 of full-length CD16.

[0082] In some embodiments, the CD16 polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, the polynucleotide encodes a polypeptide having at least 70%, 80%, 90%, or 95% identity with SEQ ID NO: 2 and includes valine at position 158 as determined by reference to SEQ ID NO: 2. In some embodiments, the polynucleotide encodes SEQ ID NO: 2. In some embodiments, the CD16 polynucleotide encodes a chimeric receptor comprising at least a partial sequence of CD16 fused to the extracellular domain of CD16 with or without a signal sequence, or any other fragment of full-length CD16, or the amino acid sequence of another protein. In other embodiments, epitope tag peptides, such as FLAG, myc, polyhistidine, or V5, can be added to the amino-terminal domain of a mature polypeptide to support cell surface detection using anti-epitope tag peptide monoclonal or polyclonal antibodies.

[0083] In some embodiments, homologous CD16 polynucleotides may have a polynucleotide length of about 150 to about 700, about 750, or about 800, but CD16 variants having more than 700 to 800 polynucleotides are within the scope of this disclosure.

[0084] Examples of homologous polynucleotide sequences include those encoding polypeptide sequences that encode variants of CD16. Examples of homologous polynucleotide sequences include naturally occurring allele variations relating to SEQ ID NO: 1. Transfusion of NK-92® cells with a polypeptide having the amino acid sequence shown in either SEQ ID NO: 1 or SEQ ID NO: 2, its naturally occurring variant, or any polynucleotide encoding a sequence that is at least 70% identical, or at least 80%, 90%, or 95% identical to SEQ ID NO: 1 or SEQ ID NO: 2, is within the scope of this disclosure. In some embodiments, the homologous polynucleotide sequence encodes a conserved amino acid substitution in SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, NK-92® cells are transfused using a degenerate homologous CD16 polynucleotide sequence that is different from the natural polynucleotide sequence but encodes the same polypeptide.

[0085] In other examples, NK-92® cells are modified using cDNA sequences with polymorphisms that alter the CD16 amino acid sequence, such as inter-individual allele variations exhibiting genetic polymorphisms in the CD16 gene. In other examples, NK-92® cells are modified using CD16 genes from other species that have polynucleotide sequences different from the sequence of Sequence ID No. 1.

[0086] Variant polypeptides can be produced using methods known in the art, such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. CD16 variants can be produced by performing site-directed mutagenesis (Carter, 1986; Zoller and Smith, 1987), cassette mutagenesis, restricted selection mutagenesis (Wells et al., 1985), or other known techniques on cloned DNA (Ausubel, 2002; Sambrook and Russell, 2001).

[0087] In some embodiments, the polynucleotide encoding CD16 is mutated to alter the amino acid sequence encoding CD16 without changing the function of CD16. For example, polynucleotide substitutions resulting in amino acid substitutions at "non-essential" amino acid residues can be created in SEQ ID NO: 1 or SEQ ID NO: 2.

[0088] Conservative substitutions in SEQ ID NO: 1 or SEQ ID NO: 2, which replace an amino acid of one class with another amino acid of the same class, fall within the range of disclosed CD16 variants, provided that the substitution does not substantially alter the activity of the polypeptide. Conservative substitutions are well known to those skilled in the art. Non-conservative substitutions that affect (1) the structure of the polypeptide backbone, e.g., a β-sheet or α-helical stereostructure, (2) charge, (3) hydrophobicity, or (4) the bulkiness of the side chains of the target site may alter the CD16 polypeptide function or immunological identity. Non-conservative substitutions involve the exchange of one member of one class with another. Substitutions can be introduced at a conservative substitution site or, more preferably, at a non-conservative site.

[0089] In some embodiments, the CD16 polypeptide variant has a length of at least 200 amino acids and has at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, or at least 90% identity. In some embodiments, the CD16 polypeptide variant has a length of at least 225 amino acids and has at least 70% amino acid sequence identity with SEQ ID NO: 1 or SEQ ID NO: 2, or at least 80%, or at least 90% identity. In some embodiments, the CD16 polypeptide variant has a valine at position 158, determined by reference to SEQ ID NO: 2.

[0090] In some embodiments, a nucleic acid encoding a CD16 polypeptide may encode a CD16 fusion protein. CD16 fusion polypeptides include any portion of CD16 or the entire CD16 fused with a non-CD16 polypeptide. Fusion polypeptides are readily produced using recombinant methods. For example, a CD16 polypeptide, e.g., a polynucleotide encoding SEQ ID NO: 1 or SEQ ID NO: 2, is fused in-frame with a non-CD16 encoding polynucleotide (e.g., a polynucleotide sequence encoding a signal peptide of a heterologous protein). In some embodiments, the heterologous polypeptide sequence is fused to the C-terminus of CD16, or the fusion polypeptide can be internally located within CD16. Typically, up to approximately 30% of the CD16 cytoplasmic domain can be replaced. Such modifications may improve expression or enhance cytotoxicity (e.g., ADCC responsiveness). In other cases, chimeric proteins, such as domains from other lymphocyte-activating receptors, including but not limited to Ig-α, Ig-B, CD3-e, CD3-d, DAP-12, and DAP-10, replace a portion of the CD16 cytoplasmic domain.

[0091] Fusion genes can be synthesized using conventional techniques, e.g., automated DNA synthesizers and PCR amplification using anchor primers that create a complementary overhang between two consecutive gene fragments (which can then be annealed and re-amplified to generate a chimeric gene sequence) (Ausubel, 2002). Many vectors are commercially available that facilitate in-frame subcloning of CD16 into the fusion region.

[0092] Cytokine The cytotoxicity of NK-92 cells is dependent on the presence of cytokines (e.g., interleukin-2 (IL-2)). The cost of using exogenously added IL-2 required to maintain and expand NK-92 cells in commercially available scale cultures is considerable. Administering sufficient amounts of IL-2 to human subjects to maintain NK92 cell activation causes adverse side effects.

[0093] In one embodiment, NK-92® cells are modified to express at least one cytokine. In particular, at least one cytokine is IL-2 (SEQ ID NO: 6), IL-12, IL-15, IL-18, IL-21, or a variant thereof. In some embodiments, the cytokine is IL-2 or a variant thereof. In some embodiments, IL-2 is a variant targeted to the endoplasmic reticulum. In some embodiments, the cytokine is IL-15 or a variant thereof. In some embodiments, IL-15 is a variant targeted to the endoplasmic reticulum.

[0094] In one embodiment, IL-2 is cloned and expressed along with a signal sequence that directs IL-2 to the endoplasmic reticulum (erIL-2) (SEQ ID NO: 7). This allows for the expression of IL-2 at a level sufficient for autocrine activation without releasing IL-2 extracellularly. Konstantinidis et al. “Targeting IL-2 to the endoplasmic reticulum confines autocrine growth stimulation to NK-92” TM See "cells" Exp Hematol. 2005 Feb;33(2):159-64. Continuous activation of FcR-expressing NK-92 cells can be prevented, for example, by the presence of suicide genes.

[0095] Suicide gene The term "suicide gene" refers to a transgene that enables negative selection of cells expressing a suicide gene. Suicide genes are used as a safety system that allows cells expressing that gene to be killed by the introduction of a selective agent. This is desirable when recombinant genes cause mutations that lead to uncontrolled cell growth, or when the cells themselves are capable of such growth. Numerous suicide gene systems have been identified, e.g., the herpes simplex virus thymidine kinase (TK) gene, the cytosine deaminase gene, the varicella-zoster virus thymidine kinase gene, the nitroreductase gene, the Escherichia coli (Escherichia coli) gpt gene, and the E. coli (E. coli) Deo gene. Typically, suicide genes encode proteins that do not have adverse effects on cells but kill them in the presence of a specific compound. Therefore, suicide genes are typically part of a system.

[0096] In one embodiment, the suicide gene is active in NK-92® cells. In one embodiment, the suicide gene is a thymidine kinase (TK) gene. The TK gene may be a wild-type or mutant TK gene (e.g., tk30, tk75, sr39tk). Cells expressing the TK protein can be killed using ganciclovir.

[0097] In another embodiment, the suicide gene is cytosine deaminase, which is toxic to cells in the presence of 5-fluorocytosine. Garcia-Sanchez et al. "Cytosine deaminase adenoviral vector and 5-fluorocytosine selectively reduce breast cancer cells 1 million-fold when they contaminate hematopoietic cells: a potential purging method for autologous transplantation." Blood. 1998 Jul 15;92(2):672-82.

[0098] In another embodiment, the suicide gene is a cytochrome P450 that is toxic in the presence of ifosfamide or cyclophosphamide. See, for example, Touati et al. “A suicide gene therapy combining the improvement of cyclophosphamide tumor cytotoxicity and the development of an anti-tumor immune response.” Curr Gene Ther. 2014;14(3):236-46.

[0099] In another embodiment, the suicide gene is iCasp9. See also Di Stasi, (2011) “Inducible apoptosis as a safety switch for adoptive cell therapy.” N Engl J Med 365:1673-1683. Morgan, “Live and Let Die: A New Suicide Gene Therapy Moves to the Clinic” Molecular Therapy (2012);20:11-13. iCasp9 induces apoptosis in the presence of the small molecule AP1903. AP1903 is a biologically inactive small molecule that has been shown to be well tolerable in clinical trials and is used in adoptive cell therapy.

[0100] Codon optimization In some embodiments, the construct sequences used to transform aNK cells are codon-optimized to maximize the expression efficiency of PD-L1 CAR, CD16, and / or erIL-2 in the human lineage. Codon optimization is typically carried out by modifying the nucleic acid sequence by replacing at least one, two or more, or a significant number of, codons in the native sequence with codons that are more frequently used or most frequently used in the gene of the expression system. Codon optimization can be used for translation rate, or to produce recombinant RNA transcripts with desired properties, such as a longer half-life compared to transcripts produced using unoptimized sequences. Codon optimization methods are readily available, such as GeneArt® from Thermo Fisher Scientific (Waltham, MA); Optimizer, freely accessible at http: / / genomes.urv.es / OPTIMIZER, and GeneGPS® Expression Optimization Technology from DNA 2.0 (Newark, California). In certain embodiments, the coding sequence of the PD-L1 CAR is codon-optimized and includes the sequence described in SEQ ID NO: 9 (scFv portion) which codes for the protein sequence of SEQ ID NO: 10. In some embodiments, the codon-optimized PD-L1 CAR coding sequence is the sequence described in SEQ ID NO: 14 which codes for the protein sequence of SEQ ID NO: 15.

[0101] Transgene expression Transgenes can be genetically engineered into expression vectors by any mechanism known to those skilled in the art. When multiple transgenes are to be inserted into cells, they can be genetically engineered into the same expression vector or into different expression vectors.

[0102] In some embodiments, cells are transfected with mRNA encoding the transgenic protein to be expressed.

[0103] The transgene and mRNA can be introduced into NK-92® cells using any transtransfer method known in the art, for example, in a non-limiting sense, infection, electroporation, lipofection, nucleofection, or “gene gun.”

[0104] NK-92(trademark) cells expressing PD-L1 CAR This disclosure provides modified NK-92® cells expressing PD-L1 CAR and FcR. Optionally, the modified NK-92® cells further express IL-2.

[0105] In some embodiments, modified NK-92® cells include a multicistronic transgene encoding a chimeric antigen receptor and an Fc receptor, and optionally IL-2.

[0106] In some embodiments, FcR is CD16. In some embodiments, CD16 is a high-affinity CD16 comprising or consisting of SEQ ID NO: 2. In some embodiments, IL-2 is an erIL-2 comprising or consisting of SEQ ID NO: 7.

[0107] In some embodiments, the CAR coding sequence and the CD16 coding sequence are separated by a P2A sequence (SEQ ID NO: 8ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct). This configuration enables equimolar expression of CAR and CD16 from a single mRNA molecule.

[0108] In some embodiments, the CD16 coding sequence and the erIL-2 coding sequence are separated by an internal ribosome entry sequence (IRES) that enables internal translation initiation.

[0109] In some embodiments, modified NK-92® cells include a tricistronic construct expressing CAR, high-affinity CD16, and erIL-2 from a single mRNA. In some embodiments, the tricistronic construct includes the sequence described in SEQ ID NO: 11. CAR integration allows effector cells to specifically engage with and kill target cells expressing targets recognized by the CAR; CD16 integration enables ADCC when combined with a therapeutic monoclonal antibody; and erIL-2 allows cell expansion in the absence of exogenous IL-2 while maintaining selective pressure for transgene expression. One exemplary tricistronic construct is shown in Figure 2, and an exemplary protein sequence for the PD-L1 CAR and CD16 fusion protein is shown in SEQ ID NO: 12.

[0110] To produce modified NK-92® cells expressing CAR and CD16 (e.g., high-affinity CD16), and erIL-2, a multicistronic plasmid is introduced into aNK® cells, for example, by electroporation. Transformed NK-92® cells are grown in IL-2-free medium, and individual clones are selected from the transformed NK-92® cells by limited-dilution cloning and characterized based on criteria, e.g., high levels of CAR and CD16 expression, cytotoxicity, ADCC, growth rate, and / or IL-2 secretion. Suitable clones may also express surface markers, e.g., CD3, CD16, CD54, CD56, NKG2D, and / or NKp30, at levels substantially similar to those of aNK® cells. If necessary, whole-genome sequencing (WGS) is performed to determine the transgene integration site. Clones meeting one or more of these criteria can be selected for further development and used to treat patients in a clinical setting.

[0111] Expression IL-2 expression can be confirmed by the ability of modified NK-92® cells to grow under IL-2-free conditions. CAR and CD16 expression can be measured by flow cytometry. Typically, in NK-92® cells transformed with a tricistronic construct containing the coding sequences for CAR, CD16, and IL-2 (e.g., erIL-2, SEQ ID NO: 13), at least 70%, 80%, and 85% of the transformed cells capable of growing under IL-2-free conditions also exhibit high expression levels of both CAR and CD16.

[0112] In some cases, the IL-2 secretion level of transformed NK-92(trademark) cells can be measured at various time points using methods well known in the art, for example, by ELISA.

[0113] In some embodiments, the level of IL-2 released into the cell culture medium is determined by measuring the IL-2 level in the culture supernatant. In some embodiments, the total intracellular level of IL-2 is evaluated by measuring the IL-2 level in the cell pellet. In some embodiments, the total amount of IL-2 produced by transformed NK-92® cells is determined by measuring both the amount of IL-2 in the supernatant and the amount of IL-2 in the cell pellet.

[0114] In some cases, other surface markers of transformed NK-92® cells can be measured by flow cytometry. These markers include, but are not limited to, CD54, CD56, NKG2D, NKp30, and CD3. Preferred clones are those that demonstrate substantially similar expression levels of these markers to aNK® cells under identical growth conditions.

[0115] cytotoxicity In some cases, the cytotoxicity of NK-92® cells transformed with tricistronic plasmids can also be tested using methods well known in the art. The cytotoxicity of NK-92® cells can be reflected by their direct cytotoxicity or ADCC activity. The direct cytotoxicity of the produced NK-92® cells, their ability to target and kill abnormal cells, such as tumor cells, can be tested using methods well known in the art, for example, the procedure described by Klingemann et al. (Cancer Immunol. Immunother. 33:395-397 (1991)). 51 This can be evaluated by a Cr release assay (Gong et al. (Leukemia, Apr;8(4):652-8(1994))). In some embodiments, target cells express antigens that can be recognized by CARs expressed on the surface of t-haNK cells. Briefly, 51 Cr-labeled target cells are mixed with NK-92(trademark) cells and lysed. The percentage of specific cytotoxicity released is... 51 This can be calculated based on the amount of Cr. See U.S. Patent Application Publication No. 20020068044.

[0116] In some cases, the cytotoxicity of NK-92® cells transformed with a tricistronic plasmid can be evaluated using a flow-based cytotoxicity assay. Effector cells (NK-92® cells) and fluorophore-labeled target cells, such as tumor cells, are mixed in different effector-target ratios. Propidium iodide (PI) can be added to the cells, and the sample can be analyzed by flow cytometry. Preferably, the fluorophore used to label the target cells can be distinguished from the PI in the flow cytometer. In some embodiments, the fluorophore is CFSE. In some embodiments, the fluorophore is PKHGL67. Cytotoxicity can be determined by the percentage of PI-positive cells in the fluorophore-positive target population.

[0117] Alternatively, the direct cytotoxicity of the produced NK-92(trademark) cells can be evaluated using a calcein release assay. For example, NK-92(trademark) cells (referred to as effectors in the assay) can be mixed with calcein-loaded target cells (referred to as targets in the assay) in a certain ratio. After incubation for a certain period, the calcein released from the target cells can be evaluated, for example, by a fluorescence plate reader. The ratio of effectors to targets used in the assay may vary, and depending on the case, the effector:target ratio may be 20:1, 15:1, 10:1, 8:1, or 5:1; preferably, the effector:target ratio is 10:1. Target cells may be any cells that express an antigen molecule that can be recognized by the CAR on NK-92(trademark) cells (t-haNK cells). For example, MDA MB231 cells can be recognized by the PD-L1 CAR and are target cells for PD-L1 t-haNK cells. The cytotoxicity of NK-92® cells may vary depending on the type of target cell used and the effector:target ratio. Generally, NK-92® cells produced using the methods described herein may have cytotoxicity of 60–100%, e.g., 70–100% or 80–100%. In some cases, NK-92® cells may have cytotoxicity of 80–100%, e.g., 82–100%, 85–100%, 87–100%, 88–100%, or 89–100% when using a 1:10 effector:target ratio by calcein release assay.

[0118] In some cases, the cytotoxicity of NK-92® cells, for example t-haNK cells, is antibody-dependent cytotoxicity (ADCC). The method for measuring the ADCC activity of NK-92® cells is similar to the method for measuring direct cytotoxicity described above, except that an antibody capable of recognizing target cells is also added. The Fc receptor on NK cells recognizes cell-binding antibodies, triggering a cell-lysis reaction and killing the target cells. In one exemplary example, t-haNK cells can be incubated with Herceptin (an anti-Her2 antibody) and SKBr3 (target cells), and the killing of SKBr3 cells is due to the internal components of the target cells, for example,51 It can be measured by the release of Cr or calcein.

[0119] Doubling time The growth rate of NK-92® cells, such as t-haNK cells, can be evaluated using the cell doubling time, i.e., the time it takes for cells to proliferate until they reach twice their initial number. The doubling time is inversely proportional to the growth rate of NK-92® cells; the longer the doubling time, the slower the growth rate.

[0120] WGS Depending on the case, whole-genome sequencing (WGS) of modified NK-92® cells may be performed to identify the insertion sites of multicistronic constructs.

[0121] therapeutic use This disclosure also provides a method for treating any type of cancer in a subject at any stage of the disease. Non-limiting examples of suitable cancers include carcinoma, melanoma, or sarcoma. In some embodiments, the present invention is used to treat cancers of hematopoietic origin, such as leukemia or lymphoma. In some embodiments, the cancer is a solid tumor.

[0122] In some embodiments, a method for treating any type of cancer in a subject comprises administering a therapeutically effective amount of the above-mentioned NK-92(trademark) cells to a patient, thereby treating the cancer. In some embodiments, the NK-92(trademark) cells express an Fc receptor, for example, a high-affinity Fc receptor having the sequence described in SEQ ID NO: 2. In some embodiments, the NK-92(trademark) cells express PD-L1 CAR, an Fc receptor, and IL-2. In some embodiments, the modified NK-92(trademark) cells include a multicistronic construct, the multicistronic construct encoding a chimeric antigen receptor and an Fc receptor.

[0123] Also provided is a method of treating a subject in need of treatment with the modified NK-92™ cells described herein. In some embodiments, the subject or patient suffers from cancer or an infectious disease, for example, a viral infection.

[0124] The modified NK-92™ cells can be administered to an individual in an absolute number of cells, for example, from about 1000 cells per injection to up to about 10 billion cells per injection in the individual, for example, about, at least about, or at most about 1×10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×10 4 , 1×10 3 , 5×10 3 NK-92™ cells, or any range between any two numbers, inclusive, can be administered. Accordingly, the present disclosure also provides a composition comprising a plurality of NK-92™ cells, wherein the number of cells is 1×10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×10 4 , 1×10 3 , or 5×10 3 which is a composition provided.

[0125] In other embodiments, the individual is administered from about 1000 cells per injection per m 2 to up to about 10 billion cells per injection per m 2 , for example, about, at least about, or at most about 1×10 8 cells per m 2 , 1×10 7 cells per m 2 , 5×10 7 cells per m 2 , 1×106 pieces / m 2 , 5×10 6 pieces / m 2 , 1 x 10 5 pieces / m 2 , 5×10 5 pieces / m 2 , 1 x 10 4 pieces / m 2 , 5×10 4 pieces / m 2 , 1 x 10 3 pieces / m 2 , 5×10 3 pieces / m 2 NK-92(trademark) cells (such as) or any range (including endpoints) between any two numbers may be administered.

[0126] In other embodiments, NK-92(trademark) cells can be administered to such an individual in only a relative number of cells, for example, about 1,000 cells to a maximum of about 10 billion cells per kilogram of the individual, for example, about, at least about, or at most about 1 × 10¹⁶ cells per kilogram of the individual. 8 , 1 x 10 7 , 5×10 7 , 1 x 10 6 , 5×10 6 , 1 x 10 5 , 5×10 5 , 1 x 10 4 , 5×10 4 , 1 x 10 3 , or 5×10 3 Individual (or similar) NK-92 cells, or any range (including endpoints) between any two numbers, can be administered.

[0127] In another embodiment, the total dose is equal to the m² of the body surface area. 2 It can be calculated by, for example, 1m 2 Approximately 1 x 10 11 , 1 x 10 10 , 1 x 10 9 , 1 x 10 8 , 1 x 10 7 This could be any number, or any range (including endpoints) between any two numbers. The average person is approximately 1.6m 2 ~approximately 1.8m2 . In a preferred embodiment, about 1 billion to about 3 billion NK-92™ cells are administered to a patient. In other embodiments, the amount of NK-92™ cells injected per dose is calculated based on the square meter of body surface area 2 and includes, per 1 m 2 1×10 11 , 1×10 10 , 1×10 9 , 1×10 8 , 1×10 7 cells. The average body surface area for a human is 1.6 to 1.8 m 2 .

[0128] In other embodiments, NK-92™ cells can be administered to such an individual in a relative number of cells, for example, to said individual from about 1,000 cells to up to about 1 billion cells per kilogram of the individual, such as about, at least about, or at most about 1×10 8 , 1×10 7 , 5×10 7 , 1×10 6 , 5×10 6 , 1×10 5 , 5×10 5 , 1×10 4 , 5×10 4 , 1×10 3 , or 5×10 3 (and the like) NK-92™ cells, or any range between any two values, inclusive of the endpoints, can be administered.

[0129] NK-92™ cells can be administered once to a patient having cancer, or they can be administered multiple times, for example, once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours, or once every 1, 2, 3, 4, 5, 6 or 7 days, or once every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 weeks or more during treatment, or once every any range between any two values, inclusive of the endpoints.

[0130] In some embodiments, NK-92® cells are administered in a composition containing NK-92® cells and a medium, such as human serum or its equivalent. In some embodiments, the medium contains human serum albumin. In some embodiments, the medium contains human plasma. In some embodiments, the medium contains about 1% to about 15% human serum or its equivalent. In some embodiments, the medium contains about 1% to about 10% human serum or its equivalent. In some embodiments, the medium contains about 1% to about 5% human serum or its equivalent. In preferred embodiments, the medium contains about 2.5% human serum or its equivalent. In some embodiments, the serum is human AB serum. In some embodiments, a serum substitute acceptable for use in human therapeutics is used instead of human serum. Such serum substitutes are known in the art or may be developed in the future. Human serum at concentrations greater than 15% can be used, but concentrations above about 5% are intended to be too expensive. In some embodiments, NK-92® cells are administered in a composition containing NK-92® cells and an isotonic solution that supports cell survival. In some embodiments, NK-92® cells are administered in a composition reconstituted from cryopreserved samples.

[0131] A pharmaceutically acceptable composition containing NK-92(trademark) cells may include various carriers and excipients. Various aqueous carriers, such as buffered saline, can be used. These solutions are sterile and generally free of undesirable substances. Suitable carriers and excipients, as well as their formulations, are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). A pharmaceutically acceptable carrier means a material that is not biologically or otherwise undesirable, i.e., the material is administered to a subject without causing undesirable biological effects or interacting in a harmful manner with other components of the pharmaceutical composition in which it is contained. When administered to a subject, the carrier is selected, as may be, to minimize the degradation of the active ingredient and to minimize adverse side effects in the subject. As used herein, the term pharmaceutically acceptable is used synonymously with physiologically acceptable and pharmacologically acceptable. Pharmaceutical compositions generally contain agents for buffering and preservation during storage, and may also contain buffers and carriers for appropriate delivery depending on the route of administration.

[0132] These compositions for in vivo or in vitro use can be sterilized by sterilization techniques used for cells. The compositions may contain acceptable auxiliary substances required for the appropriate physiological state, such as pH adjusters and buffers, as well as toxicity modifiers, such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, and sodium lactate. The concentrations of cells and / or other agents in these formulations may vary and are primarily selected based on liquid volume, viscosity, and body weight, according to the requirements of the specific administration method and target.

[0133] In one embodiment, NK-92® cells are administered to a patient in combination with one or more other treatments or agents for the cancer being treated. In some embodiments, one or more other treatments for the cancer being treated may include, for example, antibodies, radiation, chemotherapy, stem cell transplantation, or hormone therapy.

[0134] In some embodiments, NK-92® cells and other cancer drugs / therapies are administered simultaneously or nearly simultaneously (e.g., within approximately 1, 5, 10, 15, 20, or 30 minutes of each other). In some embodiments, NK-92® cells and other cancer drugs / therapies are administered sequentially. In some embodiments, other cancer treatments / drugs are administered 1, 2, or 3 days after the administration of NK-92® cells.

[0135] In one embodiment, the other cancer agent is an antibody. In one embodiment, NK-92® cells are administered in combination with an antibody that targets diseased cells. In one embodiment, NK-92® cells and the antibody may be administered together to the patient, for example, in the same formulation; separately, for example, in separate formulations; or separately, for example, on different administration schedules or at different times on the same day. When administered separately, the antibody may be administered via any preferred route, for example, intravenous or intratumoral injection.

[0136] In some embodiments, the NK-92® cells of this disclosure are used in combination with therapeutic antibodies and / or other anticancer agents. Therapeutic antibodies can be used to target cells expressing cancer-related or tumor-related markers. Examples of cancer therapeutic monoclonal antibodies are shown in Table 4. In some embodiments, the NK-92® cells express an Fc receptor, for example, a high-affinity Fc receptor having the sequence described in SEQ ID NO: 2. In some embodiments, the NK-92® cells are haNK® cells. In one embodiment, the therapeutic antibody is avelumab.

[0137] [Table 3]

[0138] [Table 4]

[0139] Such administration of NK-92® cells can be carried out simultaneously with or in a sequential manner with the administration of monoclonal antibodies. In some embodiments, NK-92® cells are administered to the subject after treatment with the monoclonal antibody. Alternatively, NK-92® cells can be administered simultaneously, for example, within 24 hours of the monoclonal antibody.

[0140] In some embodiments, NK-92® cells are administered intravenously. In some embodiments, NK-92® cells are injected directly into the bone marrow.

[0141] Accordingly, the present disclosure provides a method for treating cancer or a viral infection in a patient requiring treatment for cancer or a viral infection, comprising administering to the patient a therapeutically effective amount of the NK-92® cells disclosed herein, thereby treating the cancer.

[0142] kit Kits for the treatment of cancer or infectious diseases using compositions comprising a plurality of NK-92® cells as described herein are also disclosed. In some embodiments, the kits of this disclosure may also include at least one monoclonal antibody. The NK-92® cells contained in the kit express CAR and Fc receptors. In some embodiments, the NK-92® cells further express IL-2, e.g., erIL-2, or IL-15, e.g., erIL-15. In some embodiments, the NK-92® cells include a multicistronic construct, the multicistronic construct encoding a chimeric antigen receptor, an Fc receptor, and optionally IL-2 or IL-15.

[0143] In one embodiment, the kit may contain additional compounds, such as therapeutic compounds or drugs, to be administered before, concurrently with, or after the administration of NK-92® cells. Examples of such compounds include antibodies, vitamins, minerals, fludrocortisone, ibuprofen, lidocaine, quinidine, and chemotherapeutic agents.

[0144] In various embodiments, the kit instructions include instructions for using the kit components in the treatment of cancer or infectious diseases. The instructions may further include information on how to handle NK-92® cells (e.g., thawing and / or culturing). The instructions may further include guidelines on dosage and frequency of administration.

[0145] In one embodiment, the kit further comprises one or more containers filled with one or more compositions described herein, for example, a composition comprising NK-92® cells as described herein. Optionally, such containers may be accompanied by labels indicating that the kit is for the treatment of cancer, for example, those described herein. Optionally, the labels may also include a notice in the form prescribed by an authority that regulates the manufacture, use, or sale of a pharmaceutical or biological product, the notice reflecting the authority's approval for manufacture, use, or sale for human administration.

[0146] Materials, compositions, and components that can be used in, used in combination with, used in the preparation of, or are products thereof, are disclosed herein. These and other materials are disclosed herein, and where combinations, subsets, interactions, groups, etc., of these materials are described, specific references to various individual and collective combinations and permutations of these compounds may not be explicitly made, but it is understood that each is specifically intended and described herein. For example, where a method is disclosed and discussed, and numerous modifications that can be made to a number of molecules including that method are discussed, each and every combination and permutation of the method, as well as possible modifications, are specifically intended unless it is specifically indicated otherwise. Similarly, any subset or combination of these is also specifically intended and disclosed. This concept applies to all aspects of this disclosure, including, but not limited to, steps in methods using the compositions of the disclosure. Therefore, where various additional steps can be implemented, it is understood that each of those additional steps can be implemented by any combination of method steps of any prescribed method or method of disclosure, and that each such combination or subset of combinations should be considered to be specifically contemplated and disclosed. [Examples]

[0147] The following embodiments are for illustrative purposes only and should not be construed as limiting. There are various alternative techniques and procedures available to those skilled in the art that would similarly enable the following embodiments to be carried out successfully.

[0148] Example 1: Production of PD-1 CAR-modified NK-92(trademark) cells The PD-L1 CAR was cloned into the bicistronic plasmid pNEUKv1 FcR_IL-2 vector, which also contains the CD16 and erIL-2 transgenes. The tricistronic plasmid was electroporated into aNK® cells. Since untransformed aNK® cells, which are IL-2 dependent, could not survive in IL-2 depleted medium, PD-L1 CAR-expressing NK-92® cells were selected using IL-2 depleted medium.

[0149] Limited dilution cloning Aliquots of polyclonal PD-L1 t-haNK pooled cultures were diluted to a density of 1.5 cells / ml in growth medium without IL-2 supplementation. This cell suspension was aliquoted in 96-well plates at a volume of 200 μl per well, corresponding to an average of 0.3 cells per well. The plates were incubated at 37°C for 10 days, and then cell growth was visually confirmed. Currently, growth cultures designated as clones were picked and transferred to larger containers for further enlargement and characterization.

[0150] Example 2: Phenotype of modified NK-92(trademark) cells Flow cytometry was used to measure PD-L1 CAR expression in PD-L1 t-haNK cells, and the results showed that over 86.4% of cells from the PD-L1 t-haNK system exhibited stable CAR expression. Figure 3.

[0151] Example 3: Cytotoxicity of PD-L1 t-haNK cells against a target cell line The cytotoxicity of t-haNK cells was analyzed by incubation with their respective target cells. PD-L1-expressing MDA-MB-231 cells were used as target cells for PD-L1 t-haNK cells. The results show that PD-L1 t-haNK cells effectively killed their respective target cells. See Figure 4.

[0152] The cytotoxicity of PD-L1 t-haNK cells against MDSCs was also tested against MDSCs. The MDSCs used in this experiment were generated from peripheral blood mononuclear cells (PBMCs) obtained from blood and separated on a Ficoll gradient. The MDSCs were further enriched by positive magnetic selection for CD11b and their numbers were increased in culture medium supplemented with recombinant GM-CSF and IL-6 (Goedegebuure et al, 2011, Current Cancer Drug Targets, Vol. 11, issue 6, 2011). The MDSCs were then exposed to PD-L1 t-haNK cells at various effector-to-target ratios (E:T ratio).

[0153] As shown in Figure 5A, PD-L1 t-haNK cells effectively lysed (killed) MDSCs. The cytotoxicity of PD-L1-t-haNK cells was at least 50% higher than that of parental aNK® cells; a significantly higher percentage (at least 50% higher) of target cells were killed by either t-haNK cell lineage. Since MDSCs are one of the main immunosuppressive cells in the tumor microenvironment, these results indicate that solid tumors can be effectively treated using their PD-L1 t-haNK cells. These results also suggest that PD-L1 t-haNK cells function by first eliminating MDSCs from the tumor microenvironment via CAR-mediated cytotoxicity, and then killing tumor cells by the t-haNK cells themselves, or by other immune cells or specific tumor-targeted therapies.

[0154] Figure 5B shows that PD-L1 t-haNK cells improved the specific killing of aNK™-resistant, PD-L1-positive MDA-MB-231 cell lines. XL-48 and XL-49 are two PD-L1 t-haNK populations expressing CARs containing two different scFv domains derived from two different anti-PD-L1 antibodies. Figure 5C shows that PD-L1 t-haNK cells, when combined with the anti-CD20 antibody rituximab, improved the specific killing of genetically modified SUP-B15 cells (CD19 - CD20 +has antibody-dependent cell-mediated cytotoxicity (ADCC) activity against ), and indicates that said ADCC activity was equivalent to that of haNK® cells expressing only the CD16(158V) receptor. The anti-Her2 antibody Herceptin was used as a control antibody in this experiment.

[0155] The present inventors further investigated the activity of PD-L1 t-haNK cells in several in vivo experiments. More specifically, female NSG mice (JAX) aged 9 to 10 weeks were used in the MDA-MB-231 model (24 animals using fresh cells) and the HCC827 model (24 animals using fresh cells and 6 animals using cryopreserved cells). The MDA-MB-231 model was a human breast adenocarcinoma model, while HCC827 was a human lung adenocarcinoma model. Mice were inoculated subcutaneously on both flanks, and the average tumor burden at the start of treatment was 100 mm 3 (MDA-MB-231) and 75 to 80 mm 3 (HCC827). Freshly prepared, irradiated anti-PDL1 t-haNK was administered at a concentration of 5E7 cells / mL, while cryopreserved, irradiated anti-PDL1 t-haNK was administered at a concentration of 2E7 cells / mL. The vehicle control was growth medium alone. Administration was via i.v. and intratumoral routes. Dosages for IV administration: freshly prepared cells: 1E7 cells per dose in 200 μL, and cryopreserved cells: 4E6 cells per dose in 200 μL. Intratumoral administration was 2.5E6 cells per tumor per dose in 50 μL. The frequency of administration was twice weekly for four consecutive weeks. The first day of administration was defined as day 1.

[0156] In particular, as shown in Figures 6A and 6B, freshly prepared PD-L1 t-haNK cells (1E7 cells / dose) demonstrated significant and long-lasting inhibition of tumor growth in both the MDA-MB-231 and HCC827 models when administered intravenously. In the MDA-MB-231 model, tumor stagnation was observed, with a peak TGI of 84% on day 16 and a final TGI of 79% on day 26. In the HCC827 model, tumor regression was observed, with a peak TGI of 120% on day 16 and a TGI of 84% on day 29 (end of study). Cryopreserved PD-L1 t-haNK cells (4E6 cells / dose) also showed statistically significant efficacy in inhibiting tumor growth compared to the vehicle control. In this model, the peak TGI was 60% on day 26 and a final TGI of 40% on day 29.

[0157] Furthermore, freshly prepared PD-L1 t-haNK cells (1E7 cells / dose) also resulted in a significant reduction in metastatic disease burden in the MDA-MB-231 model compared to the vehicle. While 100% of all control animals developed metastatic disease, only 50% of animals treated with PD-L1 t-haNK cells developed metastasis (all findings were in a single organ). See the table below.

[0158] [Table 5]

[0159] When administered intratumorally, significant tumor growth inhibition was observed in the HCC827 model, but not in the MDA-MB-231 model. As shown in Figure 7, the TGI for HCC827 was 70% (peak) at day 20 and 49% (end of study) at day 29.

[0160] Therefore, it should be noted that PDL1 t-haNK cells demonstrated significant efficacy in two subcutaneous tumor models. Specifically, IV administration of freshly prepared PD-L1 t-haNK cells at a dose level of 1E7 cells / dose twice weekly for four weeks showed significant antitumor efficacy in both subcutaneous xenograft models tested. The treatment resulted in tumor stasis in MDA-MB-231 tumor-bearing mice, with a peak TGI of 84% at day 16 and a TGI of 79% at the end of the study (P<0.0001 for both time points by multiple comparisons using two-way ANOVA and subsequent Tukey's test), and tumor regression in the HCC827 model, with a peak TGI of 120% at day 16 and a TGI of 84% at the end of the study (P<0.0001). IV administration of cryopreserved PD-L1 t-haNK cells at a dose level of 4E6 cells / dose twice weekly for 4 weeks also demonstrated significant therapeutic efficacy in the HCC827 tumor model, reaching a peak TGI of 60% (P<0.0001) and a TGI of 40% (P<0.01) at the end of the study.

[0161] IT administration of freshly prepared PD-L1 t-haNK cells twice weekly for four weeks at a dose / tumor level of 2.5E6 cells effectively suppressed the growth of HCC827 tumors, resulting in a peak TGI of 70% at day 20 and a TGI of 49% at the end of the study (P<0.001). However, MDA-MB-231 tumors were not sensitive to intratumoral-administered PD-L1 t-haNK cells.

[0162] In a further embodiment, the inventors compared the expression of various markers in PD-L1 t-haNK cells versus haNK cells, and the selection results are shown in Figure 8. As is readily apparent, PD-L1 t-haNK cells expressed extremely large amounts of PD-L1 CAR, while also expressing a considerable amount of CD16. More specifically, PD-L1 t-haNK cells had increased expression of perforin and granzyme B, which is likely to contribute to the improved cytotoxicity of PD-L1 t-haNK cells, as shown in Figure 9. Here, in the high-PD-L1 cell line (MDA-MB-231), PD-L1 t-haNK was superior to haNK, and anti-PD-L1 CAR-mediated killing by PD-L1 t-haNK was superior to anti-PD-L1 Ab-mediated ADCC using haNK. Furthermore, it was observed that killing was dependent on perforin / granzyme (killing activity was significantly terminated by concanamycin-a (a perforin / granzyme inactivator)), and killing was unaffected by anti-CD16.

[0163] The inventors further investigated whether PD-L1 t-haNK cells are cytotoxic to various tumor cells in vitro. Figure 10 shows exemplary results of co-culturing irradiated PD-L1 t-haNK cells with various tumors, e.g., breast (n=4), lung (n=3), colon (n=2), genitourinary tract (n=2), chordoma, and ovarian cell lines. Variations in cytotoxicity were observed for each cell line, with a decrease in cytotoxicity observed as the E:T ratio decreased. In particular, 13 out of 13 cell lines were killed by PD-L1 t-haNK cells.

[0164] In further experiments, the inventors investigated whether PD-L1 t-haNK cells are transported into tumors in vivo. As can be seen from the results in Figure 11, PD-L1 t-haNK cells tracked PD-L1-expressing MDA-MB-231 TNBC tumors (significantly compared to PD-L1 null cells). Furthermore, the IP administration route of PD-L1 t-haNK cells mediated significantly higher levels of PD-L1 t-haNK cell accumulation than IV-administered cells. Here, mice were inoculated with MDA-MB-231 cells and PD-L1 knockout MDA-MB-231 cells. The flow of PD-L1 t-haNK cells was monitored for both cell lines at 24 and 72 hours. Clearly, PD-L1 t-haNK cells tracked tumors with PD-L1 expression. Further results were shown ex vivo at 21 days, where again PD-L1 t-haNK cells tracked tumors with PD-L1 expression.

[0165] Tumor growth curves were measured in vivo using the same model, and exemplary results are shown in Figure 12. In particular, PD-L1 t-haNK cells mediated significant antitumor activity after only one injection, and this activity was maintained. PD-L1 t-haNK cells also mediated significant antitumor activity against MDA-MB-231PD-L1 KO cells (day 36).

[0166] Human MDSCs were also tested for susceptibility to cytotoxic PD-L1 t-haNK cells. For this purpose, PBMCs were cultured for 7 days in the presence of IL-1b, IL-6, PGE2, TGFb1, TNFa, VEGF, and GM-CSF, and expanded cells were selected using CD33 selection. After confirming the MDSC phenotype (CD11b+, HLA-DR negative, CD33), a functional cytotoxicity assay was performed, and exemplary results are shown in Figure 13. As can be seen from the figure, MDSCs are also effectively killed by PD-L1 t-haNK cells. In this context, it should be noted that M2 macrophages are also considered a suitable target for PD-L1 t-haNK cell-mediated cell killing, as M2 macrophages also express PD-L1 (see, for example, BMC Cancer (2015) 15:577 DOI 10.1186 / s12885-015-1546-9).

Claims

1. (i) a first recombinant nucleic acid encoding a recombinant chimeric antigen receptor (CAR) that binds to PD-L1 and an Fc receptor; and (ii) A second recombinant nucleic acid that codes for at least one suicide gene Recombinant NK-92 cells containing the above, wherein the CAR and Fc receptors are expressed on the surface thereof, and the CAR contains the amino acid sequence of SEQ ID NO:

15.

2. The modified NK-92 cell according to claim 1, wherein the Fc receptor is CD16.

3. The modified NK-92 cell according to claim 2, wherein CD16 contains the amino acid sequence of SEQ ID NO:

2.

4. The modified NK-92 cell according to any one of claims 1 to 3, wherein the suicide gene is selected from the group consisting of a thymidine kinase (TK) gene, a cytosine deaminase gene, a varicella-zoster virus thymidine kinase gene, a nitroreductase gene, an Escherichia coli gpt gene, and an Escherichia coli Deo gene.

5. The modified NK-92 cell according to claim 4, wherein the suicide gene is a thymidine kinase (TK) gene.

6. The modified NK-92 cell according to claim 5, wherein the TK gene is a wild-type TK gene or a mutant TK gene.

7. The modified NK-92 cell according to claim 1, wherein the first recombinant nucleic acid further encodes a cytokine.

8. The modified NK-92 cell according to claim 7, wherein the cytokine is IL-2 or a variant thereof, or IL-15 or a variant thereof.

9. The modified NK-92 cell according to claim 8, wherein the IL-2 variant is erIL-2, or the IL-15 variant is erIL-15.

10. The modified NK-92 cell according to claim 7, wherein the CAR, the Fc receptor, and / or the cytokine are encoded by a codon-optimized nucleic acid sequence.

11. The modified NK-92 cell according to claim 7, wherein the CAR, the Fc receptor, and / or the cytokine are encoded by a multicistronic construct.

12. The modified NK-92 cell according to claim 1, wherein the first and second recombinant nucleic acids are, respectively, a vector, linear DNA, or RNA.

13. A pharmaceutical composition comprising the modified NK-92 cells described in claim 1.

14. The pharmaceutical composition according to claim 13, further comprising an anti-PD-L1 antibody.

15. The pharmaceutical composition according to claim 14, wherein the anti-PD-L1 antibody is avelumab.

16. A method for producing modified NK-92 cells according to claim 1, (i) the first recombinant nucleic acid encoding the anti-PD-L1 CAR, the Fc receptor; and (ii) A second recombinant nucleic acid encoding at least one suicide gene. This includes introducing it into NK-92 cells. The method wherein the CAR contains the amino acid sequence of Sequence ID No.

15.

17. The method according to claim 16, wherein the first recombinant nucleic acid further comprises a sequence encoding a cytokine.

18. The method according to claim 16, wherein the first recombinant nucleic acid is a multicistronic construct.

19. A kit comprising the pharmaceutical composition described in claim 13.

Images