Benzimidazole compounds, their preparation methods, and use

Abstract

The present application provides a benzimidazole compound having the effect of treating chronic heart failure and having broad application prospects, as well as its preparation method and use. The benzimidazole compound has the structure shown in Formula A: JPEG2025529992000039.jpg78170

Description

[Technical Field]

[0001] This application relates to the field of chemical pharmaceuticals, specifically to benzimidazole compounds, methods for preparing them, and their use. [Background technology]

[0002] Chronic heart failure is a clinical syndrome characterized by its typical symptoms (e.g., dyspnea, ankle joint swelling, fatigue) and may be accompanied by vital signs due to structural and / or functional cardiac abnormalities (e.g., elevated jugular venous pressure, lung crackling, peripheral edema), leading to decreased resting or pressure-induced cardiac output and / or increased intracardiac pressure. Chronic heart failure develops only when symptoms are severe.

[0003] Existing medications primarily alleviate symptoms by triggering compensatory mechanisms based on the sympathetic-adrenergic system during the heart failure process. The sympathetic-adrenergic system, the RAA (renin-angiotensin-aldosterone) system, and the release of vasoactive peptides (natriuretic peptides) are stimulated, regulated, and controlled by myocardial damage, compensating for some myocardial functions through mechanisms such as increased preload (edema), reperfusion of afterload (vasoconstriction), and calcium regulation of cardiomyocytes (hypertrophic cardiomyopathy). In short, even first-line treatment protocols still cannot halt the progression of heart failure.

[0004] Therefore, in this field, the development of drugs that effectively treat chronic heart failure, including heart failure with retained ejection fraction and heart failure with reduced ejection fraction, will be a focus of research. [Overview of the Initiative] [Problems that the invention aims to solve]

[0005] This application provides benzimidazole compounds, methods for preparing them, and uses thereof. [Means for solving the problem]

[0006] In Embodiment 1, the present application is: The structure is represented by the following formula A: [ka] (However, R is a hydroxyl group or [ka] And, R1, R2, R3, and R5 are independently hydrogen, halogen, nitro group, amino group, hydroxyl group, cyano group, carboxyl group, C1-C4 linear or branched alkoxyformyl group, carbamoyl group, carbamoyl group with N substituted with a C1-C4 linear or branched alkyl group, C1-C4 linear or branched alkyl group, C1-C4 alkoxy group, and C1-C4 alkylamino group, respectively. R4 is fluorine, bromine, nitro group, hydroxyl group, cyano group, carboxyl group, alkoxyformyl group, carbamoyl group, N-substituted carbamoyl group, C1-C4 linear or branched alkyl group, non-halogenated C1-C4 alkoxy group, or C1-C4 alkylamino group. R6 is a C1-C4 linear or branched alkylene group. We provide benzimidazole compounds.

[0007] The benzimidazole compound having the structure shown by formula A in this application has an effect of treating chronic heart failure.

[0008] In some preferred embodiments, the benzimidazole compound has a structure represented by formula I or formula II. [ka] (However, the limitations of R1, R2, R3, R4, and R5 are the same as in equation A.)

[0009] In some preferred embodiments, R1, R2, R3, and R5 are each independently one of the following: hydrogen, fluorine, chlorine, bromine, amino group, hydroxyl group, cyano group, methoxyformyl group, ethoxyformyl group, dimethylcarbamoyl group, diethylcarbamoyl group, trifluoromethyl group, methyl group, ethyl group, n-propyl group, isopropyl group, allyl group, cyanomethyl group, methoxy group, trifluoromethoxy group, ethoxy group, methylamino group, dimethylamino group, ethylamino group, or diethylamino group.

[0010] In some preferred embodiments, R4 is one of the following: fluorine, bromine, amino group, hydroxyl group, cyano group, carboxyl group, methoxyformyl group, ethoxyformyl group, carbamoyl group, dimethylcarbamoyl group, diethylcarbamoyl group, trifluoromethyl group, methyl group, ethyl group, n-propyl group, isopropyl group, allyl group, cyanomethyl group, methoxy group, ethoxy group, methylamino group, dimethylamino group, ethylamino group, or diethylamino group.

[0011] In some more preferred embodiments, R1 and R2 are hydrogen or methyl groups.

[0012] In some more preferred embodiments, R3 is a cyano group, fluorine, or hydrogen.

[0013] In some more preferred embodiments, R4 is fluorine, an allyl group, an n-propyl group, a cyanomethyl group, a carboxyl group, a methoxyformyl group, a carbamoyl group, or a dimethylcarbamoyl group.

[0014] In some more preferred embodiments, R5 is a hydrogen or methyl group.

[0015] In this application, when defining a group, the number of carbon atoms is limited, for example, a C1-C4 linear or branched alkyl group, a C1-C4 alkoxy group, etc., and the limited number of carbon atoms means all integer values ​​within the limited range, for example, C1-C4 means that the number of carbon atoms may be 1, 2, 3 or 4.

[0016] In some preferred embodiments, the benzimidazole compound comprises one of the compounds of formulas I-1 to I-47 and II-1 to II-144. [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]

[0017] In aspect 2, the present application is, The process includes the step of reacting a brominated compound represented by formula B and a boric acid compound represented by formula V in a Suzuki reaction using a catalyst to obtain a benzimidazole compound represented by formula A, and the reaction formula is as follows: [ka] (However, the limitations of R, R1, R2, R3, R4, and R5 are the same as above, and the explanation is omitted here.) This invention provides a method for preparing the benzimidazole compounds described above.

[0018] Preferably, the molar ratio of the brominated compound represented by formula B to the boric acid compound represented by formula V is 1:0.8 to 1:3, for example, 0.8:3, 0.85:3, 0.88:3, 0.9:3, 0.95:3, or 1:3.

[0019] Preferably, the catalyst is one or at least two of the following: tetrakis(triphenylphosphine)palladium, 1,1-bis(diphenylphosphine)ferrocenedichloropalladium, or palladium acetate.

[0020] Preferably, the molar ratio of the catalyst to the boric acid compound represented by formula V is 0.001:1 to 0.5:1, for example, 0.001:1, 0.005:1, 0.008:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, or 0.5:1.

[0021] Preferably, the Suzuki reaction is carried out in the presence of an alkaline substance.

[0022] Preferably, the alkaline substance is one or at least two of the following: potassium fluoride, potassium acetate, sodium carbonate, potassium carbonate, or potassium phosphate.

[0023] Preferably, the Suzuki reaction is carried out in an organic solvent, which is one or at least two of the following: DMF, toluene, ethanol, 1,4-dioxane, water, or THF.

[0024] Preferably, the temperature of the Suzuki reaction is 70°C to 150°C (for example, 70°C, 75°C, 80°C, 90°C, 100°C, 110°C, 120°C, 130°C, 140°C, or 150°C), and the duration is 0.25h to 48h (for example, 0.25h, 0.5h, 1h, 3h, 8h, 10h, 13h, 15h, 18h, 20h, 24h, 28h, 33h, 38h, 40h, 42h, 45h, or 48h).

[0025] In embodiment 3, the present application provides a pharmaceutically acceptable salt of the benzimidazole compound described above.

[0026] In this application, the pharmaceutically acceptable salt is an organic or inorganic salt of the benzimidazole compound.

[0027] Preferably, the organic acid salt is one selected from tartrate, stearate, oxalate, citrate, lactate, sorbate, fumarate, formate, acetate, benzoate, benzenesulfonate, ethanesulfonate, resinate, trifluoroacetate, maleate, malate, L-malate, methanesulfonate, fumarate, amino acid salt, or nicotinate.

[0028] Preferably, the organic acid salt is one selected from tartrate, acetate, maleate, malate, L-malate, or fumarate.

[0029] Preferably, the inorganic salt is one selected from phosphate, sulfate, nitrate, iodate, bromate, hydroiodide, hydrobromide, or hydrochloride.

[0030] Preferably, the inorganic salt is one selected from phosphate, sulfate, or hydrochloride.

[0031] In embodiment 4, the present application provides a solvate of the benzimidazole compound described above.

[0032] Preferably, the solvate is a hydrate and / or alcoholic dihydrate of a benzimidazole compound. In this application, the solvate of the benzimidazole compound corresponds to the benzimidazole compound in terms of its effects.

[0033] In embodiment 5, the present application provides a prodrug of the benzimidazole compound described above.

[0034] In this application, the term "prodrug" refers to a compound obtained after chemical structural modification of a drug, which is inactive or has low activity in vitro, and exerts its pharmacological effect by releasing an active drug in the body through enzymatic or non-enzymatic conversion.

[0035] In this application, the benzimidazole-based prodrug is inactive or has low activity outside the body, and after undergoing metabolic changes in the body, it releases an active benzimidazole-based compound and exerts its effects.

[0036] In embodiment 6, the present application provides tautomers or stereoisomers of the benzimidazole compounds described above. Common tautomers include, but are not limited to, those resulting from tautomerism of the double bond in the benzimidazole ring in the structures of formulas I and II.

[0037] In aspect 7, the present application is: The above-mentioned benzimidazole compounds are included, To provide a pharmaceutical composition.

[0038] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.

[0039] Preferably, the pharmaceutically acceptable adjuvant is one of the following: an excipient, diluent, vector, flavoring agent, binder, or filler.

[0040] Preferably, the dosage form of the pharmaceutical composition is an oral preparation, a parenteral preparation, or a topical preparation.

[0041] For example, in this application, the pharmaceutical composition may be prepared as a solid, semi-solid, liquid, or gaseous preparation, such as tablets, pills, capsules, powders, granules, creams, emulsions, suspensions, suppositories, injections, inhalants, gels, microspheres, and aerosols.

[0042] Typical routes for administering the compound of the present application, its pharmaceutically acceptable salt, or its pharmaceutical composition include, but are not limited to, oral, rectal, topical, inhalation, parenteral, sublingual, vaginal, nasal, intraocular, intraperitoneal, intramuscular, subcutaneous, and intravenous administration.

[0043] In embodiment 8, the present application provides the use of the above-mentioned benzimidazole compounds, their pharmaceutically acceptable salts, solvates, prodrugs, tautomers, or stereoisomers, or pharmaceutical compositions in the preparation of agents for the treatment of chronic heart failure.

[0044] In embodiment 9, the present application provides the use of a substituted benzimidazole compound, a tautomer thereof, a pharmaceutically acceptable salt thereof, a solvate thereof, a hydrate thereof, or a pharmaceutical composition thereof in the preparation of a drug for the treatment of chronic heart failure, wherein the substituted benzimidazole compound has the following structure: [ka] [Effects of the Invention]

[0045] Compared to the prior art, this invention offers the following beneficial effects.

[0046] The benzimidazole compounds of this application, their pharmaceutically acceptable salts, solvates, prodrugs, tautomers, stereoisomers, or pharmaceutical compositions have therapeutic effects on chronic heart failure and have a wide range of potential applications. [Brief explanation of the drawing]

[0047] [Figure 1]This is the nuclear magnetic hydrogen spectrum of compound formula I-1 of the present invention. [Figure 2] This is the nuclear magnetic hydrogen spectrum of compound formula I-24 of the present invention. [Figure 3] This is the nuclear magnetic hydrogen spectrum of compound formula I-25 of the present invention. [Modes for carrying out the invention]

[0048] The technical proposal of this application will be further explained below with reference to specific embodiments. Those skilled in the art should understand that the above embodiments are merely for the purpose of understanding this application and should not be considered as specifically limiting it.

[0049] Example 1: Synthesis of compound I-1 Under the protection of nitrogen gas, 2-bromo-4-fluorophenol (19.1 g, 0.1 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (17.6 g, 0.1 mol) were added to 1,4-dioxane (100 ml), followed by potassium acetate (19.6 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (3.6 g, 5 mmol), and 1,1'-bis(diphenylphosphine). ) Ferrocene (2.8 g, 5 mmol) was added, and the temperature was raised to 110°C and the reaction was carried out for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 13.4 g of 4-fluoro-2-(2-methyl-1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 55.3%. EI-MS M / Z 243.3[M + ].

[0050] 1¹H-NMR (DMSO-d6, 400MHz): 2.49 (3H,s), 6.86-7.02 (2H,m), 7.10 (1H,dd,J=9.7,2.4Hz), 7.30 (1H,d,J=8.3Hz), 7.45 (1H,d,J=6.3Hz), 7.63 (1H,s), 9.46 (1H,s), 12.20 (1H,s). See Figure 1 for nuclear magnetic hydrogen spectra.

[0051] Note: (2-methyl-1H-benzimidazole-5-yl)boric acid was obtained by the usual Miyaura boration reaction of commercially available 5-bromo-1H-benzimidazole. The arylboric acids in the other examples were obtained by the same preparation method or principle. Other starting materials can generally be obtained directly from the market or by conventional chemical synthesis methods using commercially available raw materials, as can be obtained by those skilled in the art.

[0052] Example 2 Synthesis of compound I-2 Under the protection of nitrogen gas, 2-bromo-4,6-difluorophenol (2.08 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.54 g of 2,4-difluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained with a yield of 59.2%. EI-MS M / Z 261.2[M + ].

[0053] Example 3: Synthesis of compound I-3 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-hydroxybenzonitrile (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.18 g of 5-fluoro-2-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 44.2%. EI-MS M / Z 268.3[M + ].

[0054] Example 4: Synthesis of compound I-4 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzamide (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.88 g of 4-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 32.9%. EI-MS M / Z 268.3[M + ].

[0055] Example 5: Synthesis of compound I-5 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzamide (2.34 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.89 g of 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 31.2%. EI-MS M / Z 286.3[M + ].

[0056] Example 6: Synthesis of compound I-6 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzamide (2.41 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.81 g of 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 27.6%. EI-MS M / Z 293.3[M + ].

[0057] Example 7 Synthesis of compound I-7 Under the protection of nitrogen gas, 3-bromo-4-hydroxy-N,N-dimethylbenzamide (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110°C and reacted for 2 h. After completion of the reaction, the reaction solution was allowed to cool, extracted by adding water / ethyl acetate. The organic phase was concentrated to dryness, subjected to column chromatography, using ethyl acetate / petroleum ether as the eluent, to obtain 1.18 g of 4-hydroxy-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide as an off-white powdery solid, with a yield of 39.9%. EI-MS M / Z 296.3 [M + .

[0058] Example 8 Synthesis of compound of formula I-8 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxy-N,N-dimethylbenzamide (2.60 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110°C and reacted for 2 h. After completion of the reaction, the reaction solution was allowed to cool, extracted by adding water / ethyl acetate. The organic phase was concentrated to dryness, subjected to column chromatography, using ethyl acetate / petroleum ether as the eluent, to obtain 1.19 g of 3-fluoro-4-hydroxy-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide as an off-white powdery solid, with a yield of 38.0%. EI-MS M / Z 314.3 [M + .

[0059] Example 9: Synthesis of compound I-9 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxy-N,N-dimethylbenzamide (2.69 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.15 g of 3-cyano-4-hydroxy-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 35.9%. EI-MS M / Z 321.4[M + ].

[0060] Example 10 Synthesis of compound I-48 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzoic acid (2.17 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.78 g of off-white powder solid 4-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 26.1%. EI-MS M / Z 269.3[M + ].

[0061] Example 11 Synthesis of compound I-10 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzoic acid (2.35 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.69 g of off-white powder solid 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 24.1%. EI-MS M / Z 287.3[M + ].

[0062] Example 12 Synthesis of compound I-11 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzoic acid (2.42 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.61 g of 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained with a yield of 20.8%. EI-MS M / Z 294.3[M + ].

[0063] Example 13 Synthesis of compound I-12 Under the protection of nitrogen gas, methyl 3-bromo-4-hydroxybenzoate (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.58 g of methyl 4-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 56.0%. EI-MS M / Z 283.3[M + ].

[0064] Example 14 Synthesis of compound I-13 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-hydroxybenzoate (2.49 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction solution was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.69 g of methyl 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 56.3%. EI-MS M / Z 301.3[M + ].

[0065] Example 15 Synthesis of compound I-14 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-hydroxybenzoate (2.56 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction solution was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.61 g of methyl 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 43.2%. EI-MS M / Z 308.3[M + ].

[0066] Example 16: Synthesis of compound I-15 Under the protection of nitrogen gas, 4-allyl-2-bromophenol (2.13 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.78 g of 4-allyl-2-(2-methyl-1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 29.4%. EI-MS M / Z 265.3[M + ].

[0067] Example 17 Synthesis of compound I-16 Under the protection of nitrogen gas, 4-allyl-2-bromo-6-fluorophenol (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.69 g of 4-allyl-2-(2-methyl-1H-benzimidazole-5-yl)-6-fluorophenol, a white powder solid, was obtained, with a yield of 24.4%. EI-MS M / Z 283.3[M + ].

[0068] Example 18 Synthesis of compound I-17 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-hydroxybenzonitrile (2.38 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.81 g of 5-allyl-3-(2-methyl-1H-benzimidazole-5-yl)-2-hydroxybenzonitrile, a white powder solid, was obtained, with a yield of 28.0%. EI-MS M / Z 290.3[M+ ].

[0069] Example 19: Synthesis of compound I-18 Under the protection of nitrogen gas, 2-(3-bromo-4-hydroxyphenyl)acetonitrile (2.12 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.28 g of off-white powder solid 2-(4-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 48.7%. EI-MS M / Z 264.3[M + ].

[0070] Example 20 Synthesis of compound I-19 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-phenol)acetonitrile (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Erocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.19 g of off-white powder solid 2-(3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazole-5-yl))phenyl)acetonitrile was obtained, with a yield of 42.3%. EI-MS M / Z 282.3[M + ].

[0071] Example 21 Synthesis of compound I-20 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-hydroxybenzonitrile (2.37 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.01 g of 5-cyanomethyl-2-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 35.0%. EI-MS M / Z 289.3[M + ].

[0072] Example 22 Synthesis of compound I-21 Under the protection of nitrogen gas, 2-bromo-4-propylphenol (2.15 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.75 g of 2-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenol, a white powder solid, was obtained with a yield of 65.5%. EI-MS M / Z 267.3[M + ].

[0073] Example 23 Synthesis of compound I-22 Under the protection of nitrogen gas, 2-bromo-6-fluoro-4-propylphenol (2.33 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.39 g of 2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenol, a white powder solid, was obtained, with a yield of 48.7%. EI-MS M / Z 285.3[M + ].

[0074] Example 24 Synthesis of compound I-23 Under the protection of nitrogen gas, 3-bromo-2-hydroxy-5-propylbenzonitrile (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.11 g of 2-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained with a yield of 38.0%. EI-MS M / Z 292.4[M + ].

[0075] Example 25 Synthesis of compound I-24 Under the protection of nitrogen gas, 2-bromo-4-fluorophenol (19.1 g, 0.1 mol) and (1H-benzimidazole-5-yl)boric acid (16.2 g, 0.1 mol) were added to 1,4-dioxane (100 ml), potassium acetate (19.6 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene dichloropalladium (3.6 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (2.8 g, 5 mmol) were added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed. Using ethyl acetate / petroleum ether as an eluent, 14.5 g of 4-fluoro-2-(1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 63.5%. EI-MS M / Z 229.2[M + ].

[0076] 1¹H-NMR (DMSO-d6, 400MHz): 6.91-7.01 (2H,m), 7.12 (1H,dd,J=9.8,3.0Hz), 7.38 (1H,d,J=8.4Hz), 7.60 (1H,d,J=8.3Hz), 7.77 (1H,s), 8.24 (1H,s), 9.48 (1H,s), 12.47 (1H,s). See Figure 2 for nuclear magnetic hydrogen spectra.

[0077] Example 26 Synthesis of compound I-25 Under the protection of nitrogen gas, 2-bromo-4,6-difluorophenol (2.08 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.57 g of 2,4-difluoro-6-(1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 63.8%. EI-MS M / Z 247.2[M + ].

[0078] 1 ¹H-NMR (DMSO-d6, 400MHz): 7.03-7.06 (1H,m), 7.17-7.23 (1H,m), 7.39 (1H,dd,J=8.4Hz), 7.63 (1H,d,J=8.4Hz), 7.79 (1H,s), 8.27 (1H,s), 9.44 (1H,s), 12.52 (1H,s). See Figure 3 for nuclear magnetic hydrogen spectra.

[0079] Example 27 Synthesis of compound I-26 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-hydroxybenzonitrile (2.16 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.12 g of 5-fluoro-2-hydroxy-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 44.3%. EI-MS M / Z 254.2[M + ].

[0080] Example 28 Synthesis of compound I-27 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzamide (2.16 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.86 g of 4-hydroxy-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 34.0%. EI-MS M / Z 254.3[M + ].

[0081] Example 29 Synthesis of compound I-28 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzamide (2.34 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.82 g of 3-fluoro-4-hydroxy-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 30.1%. EI-MS M / Z 272.3[M + ].

[0082] Example 30 Synthesis of compound I-29 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzamide (2.41 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.80 g of 3-cyano-4-hydroxy-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 26.9%. EI-MS M / Z 279.3[M + ].

[0083] Example 31 Synthesis of compound I-30 Under the protection of nitrogen gas, 3-bromo-4-hydroxy-N,N-dimethylbenzamide (2.16 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.12 g of 4-hydroxy-N,N-dimethyl-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained with a yield of 39.9%. EI-MS M / Z 282.3[M + ].

[0084] Example 32 Synthesis of compound I-31 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxy-N,N-dimethylbenzamide (2.60 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.09 g of 3-fluoro-4-hydroxy-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 36.4%. EI-MS M / Z 300.3[M + ].

[0085] Example 33 Synthesis of compound I-32 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxy-N,N-dimethylbenzamide (2.69 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.05 g of 3-cyano-4-hydroxy-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 34.3%. EI-MS M / Z 307.3[M + ].

[0086] Example 34 Synthesis of compound I-33 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzoic acid (2.17 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.68 g of 4-hydroxy-3-(1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 26.8%. EI-MS M / Z 255.3[M + ].

[0087] Example 35 Synthesis of compound I-34 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzoic acid (2.35 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.52 g of off-white powder solid 3-fluoro-4-hydroxy-5-(1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 19.0%. EI-MS M / Z 273.2[M + ].

[0088] Example 36 Synthesis of compound I-35 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzoic acid (2.42 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.63 g of 3-cyano-4-hydroxy-5-(1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 22.5%. EI-MS M / Z 280.3[M + ].

[0089] Example 37 Synthesis of compound I-36 Under the protection of nitrogen gas, methyl 3-bromo-4-hydroxybenzoate (2.31 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.50 g of off-white powder solid methyl 4-hydroxy-3-(1H-benzimidazole-5-yl)benzoate was obtained, with a yield of 56.0%. EI-MS M / Z 269.3[M + ].

[0090] Example 38 Synthesis of compound I-37 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-hydroxybenzoate (2.49 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.62 g of methyl 3-fluoro-4-hydroxy-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 56.6%. EI-MS M / Z 287.3[M + ].

[0091] Example 39 Synthesis of compound I-38 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-hydroxybenzoate (2.56 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.60 g of methyl 3-cyano-4-hydroxy-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 54.6%. EI-MS M / Z 294.3[M + ].

[0092] Example 40 Synthesis of compound I-39 Under the protection of nitrogen gas, 4-allyl-2-bromophenol (2.13 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.68 g of 4-allyl-2-(1H-benzoimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 27.2%. EI-MS M / Z 251.3[M + ].

[0093] Example 41 Synthesis of compound I-40 Under the protection of nitrogen gas, 4-allyl-2-bromo-6-fluorophenol (2.31 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.65 g of 4-allyl-2-(1H-benzimidazole-5-yl)-6-fluorophenol, a white powder solid, was obtained, with a yield of 24.2%. EI-MS M / Z 269.3[M + ].

[0094] Example 42 Synthesis of compound I-41 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-hydroxybenzonitrile (2.38 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.80 g of 5-allyl-3-(1H-benzimidazole-5-yl)-2-hydroxybenzonitrile, a white powder solid, was obtained, with a yield of 29.1%. EI-MS M / Z 276.3[M + ].

[0095] Example 43 Synthesis of compound I-42 Under the protection of nitrogen gas, 2-(3-bromo-4-hydroxyphenyl)acetonitrile (2.12 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.28 g of off-white powder solid 2-(4-hydroxy-3-(1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 51.2%. EI-MS M / Z 250.3[M + ].

[0096] Example 44 Synthesis of compound I-43 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-phenol)acetonitrile (2.30 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Erocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.12 g of 2-(3-fluoro-4-hydroxy-5-(1H-benzimidazole-5-yl))phenyl)acetonitrile, a white powder solid, was obtained, with a yield of 41.9%. EI-MS M / Z 268.3[M + ].

[0097] Example 45 Synthesis of compound I-44 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-hydroxybenzonitrile (2.37 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.12 g of 5-cyanomethyl-2-hydroxy-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained with a yield of 40.9%. EI-MS M / Z 275.3[M + ].

[0098] Example 46 Synthesis of compound I-45 Under the protection of nitrogen gas, 2-bromo-4-propylphenol (2.15 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.55 g of 2-(1H-benzimidazole-5-yl)-4-propylphenol, a white powder solid, was obtained, with a yield of 61.5%. EI-MS M / Z 253.3[M + ].

[0099] Example 47 Synthesis of compound I-46 Under the protection of nitrogen gas, 2-bromo-6-fluoro-4-propylphenol (2.33 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.33 g of 2-fluoro-6-(1H-benzimidazole-5-yl)-4-propylphenol, a white powder solid, was obtained, with a yield of 49.2%. EI-MS M / Z 271.3[M + ].

[0100] Example 48 Synthesis of compound I-47 Under the protection of nitrogen gas, 3-bromo-2-hydroxy-5-propylbenzonitrile (2.40 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.02 g of 2-hydroxy-3-(1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained, with a yield of 36.8%. EI-MS M / Z 278.3[M + ].

[0101] Example 49 Synthesis of compound II-1 Under the protection of nitrogen gas, 2-(2-bromo-4-fluorophenyl)propan-2-ol (2.31 g, 0.1 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.24 g of 2-(4-fluoro-2-(2-methyl-1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 43.7%. EI-MS M / Z 285.3[M + ].

[0102] Example 50 Synthesis of compound II-2 Under the protection of nitrogen gas, 2-(2-bromo-4,6-difluorophenyl)propan-2-ol (2.50 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.59 g of 2-(2,4-difluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 52.5%. EI-MS M / Z 303.3[M + ].

[0103] Example 51 Synthesis of compound II-3 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(2-hydroxypropan-2-yl)benzonitrile (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.28 g of 5-fluoro-2-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 41.4%. EI-MS M / Z 310.3[M + ].

[0104] Example 52 Synthesis of compound II-4 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzamide (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.78 g of 4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 25.4%. EI-MS M / Z 310.4[M+ ].

[0105] Example 53 Synthesis of compound II-5 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzamide (2.76 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.89 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 27.1%. EI-MS M / Z 328.4[M + ].

[0106] Example 54 Synthesis of compound II-6 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzamide (2.83 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.71 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 21.2%. EI-MS M / Z 335.4[M + ].

[0107] Example 55 Synthesis of compound II-7 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (2.86 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.18 g of 4-(2-hydroxypropan-2-yl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 35.0%. EI-MS M / Z 338.4[M + ].

[0108] Example 56 Synthesis of compound II-8 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.04 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.21 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 34.0%. EI-MS M / Z 356.4[M + ].

[0109] Example 57 Synthesis of compound II-9 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.11 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.20 g of 3-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 33.1%. EI-MS M / Z 363.4[M + ].

[0110] Example 58 Synthesis of compound II-10 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzoic acid (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.79 g of off-white powder solid 4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 25.4%. EI-MS M / Z 311.4[M + ].

[0111] Example 59 Synthesis of compound II-11 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoic acid (2.77 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.74 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 22.5%. EI-MS M / Z 329.3[M + ].

[0112] Example 60 Synthesis of compound II-12 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoic acid (2.84 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.63 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 19.4%. EI-MS M / Z 336.4[M + ].

[0113] Example 61 Synthesis of compound II-13 Under the protection of nitrogen gas, methyl 3-bromo-4-(2-hydroxypropan-2-yl)benzoate (2.73 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.55 g of methyl 4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 47.8%. EI-MS M / Z 325.4[M + ].

[0114] Example 62 Synthesis of compound II-14 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoate (2.91 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.69 g of methyl 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 49.4%. EI-MS M / Z 343.4[M + ].

[0115] Example 63 Synthesis of compound II-15 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoate (2.98 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.63 g of methyl 3-cyano-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 46.5%. EI-MS M / Z 350.4[M + ].

[0116] Example 64 Synthesis of compound II-16 Under the protection of nitrogen gas, 2-(4-allyl-2-bromophenyl)propan-2-ol (2.55 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.68 g of 2-(4-allyl-2-(2-methyl-1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 22.2%. EI-MS M / Z 307.4[M + ].

[0117] Example 65 Synthesis of compound II-17 Under the protection of nitrogen gas, 2-(4-allyl-2-bromo-6-fluorophenyl)propan-2-ol (2.73 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.59 g of 2-(4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 18.2%. EI-MS M / Z 325.4[M + ].

[0118] Example 66 Synthesis of compound II-18 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(2-hydroxypropan-2-yl)benzonitrile (2.80 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.61 g of 5-allyl-2-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 18.4%. EI-MS M / Z 332.4[M + ].

[0119] Example 67 Synthesis of compound II-19 Under the protection of nitrogen gas, 2-(3-bromo-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.54 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.08 g of 2-(4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)phenyl)acetonitrile, a white powder solid, was obtained, with a yield of 35.4%. EI-MS M / Z 306.4[M + ].

[0120] Example 68 Synthesis of compound II-20 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.72 g, 0.01 mol), (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.11 g of 2-(3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazole-5-yl)phenyl)acetonitrile, a white powder solid, was obtained, with a yield of 34.3%. EI-MS M / Z 324.4[M + ].

[0121] Example 69 Synthesis of compound II-21 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(2-hydroxypropan-2-yl)benzonitrile (2.79 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.93 g of 5-cyanomethyl-2-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained with a yield of 28.1%. EI-MS M / Z 331.4[M + ].

[0122] Example 70 Synthesis of the compound of formula II-22 Under the protection of nitrogen gas, 2-(2-bromo-4-propylphenyl)propan-2-ol (2.57 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.65 g of 2-(2-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenyl)propan-2-ol, a white powder solid, was obtained with a yield of 53.5%. EI-MS M / Z 309.4[M + ].

[0123] Example 71 Synthesis of compound II-23 Under the protection of nitrogen gas, 2-(2-bromo-6-fluoro-4-propylphenyl)propan-2-ol (2.75 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.33 g of 2-(2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 40.7%. EI-MS M / Z 327.4[M + ].

[0124] Example 72 Synthesis of compound II-24 Under the protection of nitrogen gas, 3-bromo-2-(2-hydroxypropan-2-yl)-5-propanebenzonitrile (2.82 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenyl) Nylphosphine)ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.01 g of 2-hydroxy-3-(2-methyl-1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained with a yield of 30.3%. EI-MS M / Z 334.4[M + ].

[0125] Example 73 Synthesis of compound II-25 Under the protection of nitrogen gas, 2-(2-bromo-4-fluorophenyl)propan-2-ol (2.31 g, 0.1 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.21 g of 2-(4-fluoro-2-(1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 44.8%. EI-MS M / Z 271.3[M + ].

[0126] Example 74 Synthesis of compound II-26 Under the protection of nitrogen gas, 2-(2-bromo-4,6-difluorophenyl)propan-2-ol (2.50 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.44 g of 2-(2,4-difluoro-6-(1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 49.9%. EI-MS M / Z 289.3[M + ].

[0127] Example 75 Synthesis of compound II-27 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(2-hydroxypropan-2-yl)benzonitrile (2.58 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.08 g of 5-fluoro-2-(2-hydroxypropan-2-yl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 36.6%. EI-MS M / Z 296.3[M + ].

[0128] Example 76 Synthesis of compound II-28 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzamide (2.58 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.72 g of 4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 24.4%. EI-MS M / Z 296.3[M + ].

[0129] Example 77 Synthesis of compound II-29 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzamide (2.76 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.83 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 26.5%. EI-MS M / Z 314.3[M + ].

[0130] Example 78 Synthesis of compound II-30 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzamide (2.83 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.66 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 20.6%. EI-MS M / Z 321.4[M + ].

[0131] Example 79 Synthesis of compound II-31 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (2.86 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.03 g of 4-(2-hydroxypropan-2-yl)-N,N-dimethyl-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 31.8%. EI-MS M / Z 324.4[M + ].

[0132] Example 80 Synthesis of compound II-32 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.04 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.04 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained with a yield of 30.5%. EI-MS M / Z 342.4[M + ].

[0133] Example 81 Synthesis of compound II-33 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.11 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.09 g of 3-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 31.3%. EI-MS M / Z 349.4[M+ ].

[0134] Example 82 Synthesis of compound II-34 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzoic acid (2.59 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.77 g of off-white powder solid 4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 26.0%. EI-MS M / Z 297.3[M + ].

[0135] Example 83 Synthesis of compound II-35 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoic acid (2.77 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.76 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 24.2%. EI-MS M / Z 315.3[M + ].

[0136] Example 84 Synthesis of compound II-36 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoic acid (2.84 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.74 g of off-white powder solid 3-cyano-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 23.0%. EI-MS M / Z 322.3[M + ].

[0137] Example 85 Synthesis of compound II-37 Under the protection of nitrogen gas, methyl 3-bromo-4-(2-hydroxypropan-2-yl)benzoate (2.73 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.25 g of off-white powder solid 4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazole-5-yl)methyl benzoate was obtained, with a yield of 40.3%. EI-MS M / Z 311.4[M + ].

[0138] Example 86 Synthesis of compound II-38 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoate (2.91 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.89 g of methyl 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 57.6%. EI-MS M / Z 329.3[M + ].

[0139] Example 87 Synthesis of the compound of formula II-39 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoate (2.98 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The temperature was raised to 110°C and the reaction was carried out for 2 h. After the completion of the reaction, the reaction solution was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography, with ethyl acetate / petroleum ether as the eluent, to obtain 1.68 g of methyl 3-cyano-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzoate, which is an off-white powdery solid, with a yield of 50.1%. EI-MS M / Z 336.4[M + .

[0140] Example 88 Synthesis of the compound of formula II-40 Under the protection of nitrogen gas, 2-(4-allyl-2-bromophenyl)propan-2-ol (2.55 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.61 g of 2-(4-allyl-2-(1H-benzoimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 20.9%. EI-MS M / Z 293.4[M + ].

[0141] Example 89 Synthesis of compound II-41 Under the protection of nitrogen gas, 2-(4-allyl-2-bromo-6-fluorophenyl)propan-2-ol (2.73 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.50 g of 2-(4-allyl-2-fluoro-6-(1H-benzimidazole-5-yl)phenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 16.1%. EI-MS M / Z 311.4[M + ].

[0142] Example 90 Synthesis of compound II-42 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(2-hydroxypropan-2-yl)benzonitrile (2.80 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.56 g of 5-allyl-2-(2-hydroxypropan-2-yl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 17.6%. EI-MS M / Z 318.4[M + ].

[0143] Example 91 Synthesis of compound II-43 Under the protection of nitrogen gas, 2-(3-bromo-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.54 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.02 g of off-white powder solid 2-(4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 26.1%. EI-MS M / Z 292.4[M+ ].

[0144] Example 92 Synthesis of compound II-44 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.72 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.31 g of off-white powder solid 2-(3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 42.3%. EI-MS M / Z 310.3[M + ].

[0145] Example 93 Synthesis of compound II-45 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(2-hydroxypropan-2-yl)benzonitrile (2.79 g, 0.01 mol) and (1H-benzoimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110°C and reacted for 2 h. After completion of the reaction, the reaction solution was allowed to cool to room temperature, extracted by adding water / ethyl acetate. The organic phase was concentrated to dryness, and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to obtain 1.03 g of 5-cyanomethyl-2-(2-hydroxypropan-2-yl)-3-(1H-benzoimidazol-5-yl)benzonitrile as an off-white powdery solid, with a yield of 32.6%. EI-MS M / Z 317.4 [M + .

[0146] Example 94 Synthesis of the compound of Formula II-46 Under the protection of nitrogen gas, 2-(2-bromo-4-propylphenyl)propan-2-ol (2.57 g, 0.01 mol) and (1H-benzoimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110°C and reacted for 2 h. After completion of the reaction, the reaction solution was allowed to cool to room temperature, extracted by adding water / ethyl acetate. The organic phase was concentrated to dryness, and subjected to column chromatography with ethyl acetate / petroleum ether as the eluent to obtain 1.66 g of 2-(2-(1H-benzoimidazol-5-yl)-4-propylphenyl)propan-2-ol as an off-white powdery solid, with a yield of 56.4%. EI-MS M / Z 295.4 [M + .

[0147] Example 95 Synthesis of compound II-47 Under the protection of nitrogen gas, 2-(2-bromo-6-fluoro-4-propylphenyl)propan-2-ol (2.75 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.38 g of 2-(2-fluoro-6-(1H-benzimidazole-5-yl)-4-propylphenyl)propan-2-ol, a white powder solid, was obtained, with a yield of 44.2%. EI-MS M / Z 313.4[M + ].

[0148] Example 96 Synthesis of compound II-48 Under the protection of nitrogen gas, 3-bromo-2-(2-hydroxypropan-2-yl)-5-propanebenzonitrile (2.82 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenyl) Nylphosphine)ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.89 g of off-white powder solid 2-hydroxy-3-(1H-benzimidazole-5-yl)-5-propylbenzonitrile was obtained, with a yield of 27.9%. EI-MS M / Z 320.4[M + ].

[0149] Example 97 Synthesis of compound II-49 Under the protection of nitrogen gas, 1-(2-bromo-4-fluorophenyl)ethane-1-ol (2.19 g, 0.1 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.04 g of 1-(4-fluoro-2-(2-methyl-1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained with a yield of 38.5%. EI-MS M / Z 271.3[M + ].

[0150] Example 98 Synthesis of compound II-50 Under the protection of nitrogen gas, 1-(2-bromo-4,6-difluorophenyl)ethane-1-ol (2.37 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.69 g of 1-(2,4-difluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 58.4%. EI-MS M / Z 289.3[M+ ].

[0151] Example 99 Synthesis of compound II-51 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(1-hydroxyethyl)benzonitrile (2.44 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.09 g of 5-fluoro-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 36.9%. EI-MS M / Z 296.3[M + ].

[0152] Example 100 Synthesis of compound II-52 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzamide (2.42 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.72 g of 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 24.4%. EI-MS M / Z 296.3[M + ].

[0153] Example 101 Synthesis of compound II-53 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzamide (2.62 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.86 g of 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 27.4%. EI-MS M / Z 314.3[M + ].

[0154] Example 102 Synthesis of compound II-54 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzamide (2.69 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.70 g of 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 21.8%. EI-MS M / Z 321.4[M + ].

[0155] Example 103 Synthesis of compound II-55 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.72 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol) and raise the temperature to 110°C for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.10 g of 4-(1-hydroxyethyl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 34.0%. EI-MS M / Z 324.4[M+ ].

[0156] Example 104 Synthesis of compound II-56 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.90 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.25 g of 3-fluoro-4-(1-hydroxyethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained with a yield of 38.9%. EI-MS M / Z 342.4[M + ].

[0157] Example 105 Synthesis of compound II-57 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.97 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.33 g of 3-cyano-4-(1-hydroxyethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 38.1%. EI-MS M / Z 349.4[M + ].

[0158] Example 106 Synthesis of compound II-58 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzoic acid (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.77 g of off-white powder solid 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 26.0%. EI-MS M / Z 297.3[M + ].

[0159] Example 107 Synthesis of compound II-59 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoic acid (2.63 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.68 g of 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained with a yield of 21.6%. EI-MS M / Z 315.3[M + ].

[0160] Example 108 Synthesis of compound II-60 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoic acid (2.70 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.71 g of off-white powder solid 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 22.0%. EI-MS M / Z 322.3[M+ ].

[0161] Example 109 Synthesis of compound II-61 Under the protection of nitrogen gas, methyl 3-bromo-4-(1-hydroxyethyl)benzoate (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.55 g of methyl 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 47.8%. EI-MS M / Z 311.4[M + ].

[0162] Example 110 Synthesis of compound II-62 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoate (2.77 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.74 g of methyl 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 53.0%. EI-MS M / Z 329.3[M + ].

[0163] Example 111 Synthesis of compound II-63 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoate (2.84 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.60 g of methyl 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 47.7%. EI-MS M / Z 336.4[M + ].

[0164] Example 112 Synthesis of compound II-64 Under the protection of nitrogen gas, 1-(4-allyl-2-bromophenyl)ethane-1-ol (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.72 g of 1-(4-allyl-2-(2-methyl-1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 24.6%. EI-MS M / Z 293.4[M + ].

[0165] Example 113 Synthesis of compound II-65 Under the protection of nitrogen gas, 1-(4-allyl-2-bromo-6-fluorophenyl)ethane-1-ol (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.57 g of 1-(4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 18.4%. EI-MS M / Z 311.4[M+ .

[0166] Example 114 Synthesis of the compound of Formula II-66 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(1-hydroxyethyl)benzonitrile (2.66 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 mL). Potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) were added thereto. The temperature was raised to 110°C and the reaction was carried out for 2 h. After completion of the reaction, the reaction solution was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography, with ethyl acetate / petroleum ether as the eluent, 0.66 g of 5-allyl-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile, an off-white powdery solid, was obtained, and the yield was 20.7%. EI-MS M / Z 318.4 [M + .

[0167] Example 115 Synthesis of the compound of Formula II-67 Under the protection of nitrogen gas, 2-(3-bromo-(1-hydroxyethyl)phenyl)acetonitrile (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 mL). Potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) were added thereto. The temperature was raised to 110°C and the reaction was carried out for 2 hours. After completion of the reaction, the reaction solution was allowed to cool, water / ethyl acetate was added for extraction, the organic phase was concentrated to dryness, and column chromatography was performed with ethyl acetate / petroleum ether as the eluent to obtain 1.02 g of 2-(4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, which was an off-white powdery solid, with a yield of 35.9%. EI-MS M / Z 292.4 [M + .

[0168] Example 116 Synthesis of the compound of formula II-68 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(1-hydroxyethyl)phenyl)acetonitrile (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 mL). Potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol) were added thereto. The temperature was raised to 110°C and the reaction was carried out for 2 hours. After completion of the reaction, the reaction solution was allowed to cool, water / ethyl acetate was added for extraction, the organic phase was concentrated to dryness, and column chromatography was performed with ethyl acetate / petroleum ether as the eluent to obtain 1.02 g of 2-(3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile, which was an off-white powdery solid, with a yield of 33.0%. EI-MS M / Z 310.3 [M + .

[0169] Example 117 Synthesis of compound II-69 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(1-hydroxyethyl)benzonitrile (2.65 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.84 g of 5-cyanomethyl-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 26.7%. EI-MS M / Z 317.4[M + ].

[0170] Example 118 Synthesis of compound II-70 Under the protection of nitrogen gas, 1-(2-bromo-4-propylphenyl)ethane-1-ol (2.43 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.58 g of 1-(2-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenyl)ethane-1-ol, a white powder solid, was obtained with a yield of 53.7%. EI-MS M / Z 295.4[M + ].

[0171] Example 119 Synthesis of compound II-71 Under the protection of nitrogen gas, 1-(2-bromo-6-fluoro-4-propylphenyl)ethane-2-ol (2.61 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.19 g of 1-(2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 38.0%. EI-MS M / Z 313.4[M + ].

[0172] Example 120 Synthesis of the compound of formula II-72 Under the protection of nitrogen gas, 3-bromo-2-(1-hydroxyethyl)-5-propanebenzonitrile (2.68 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.19 g of 2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained, with a yield of 37.3%. EI-MS M / Z 320.4[M + ].

[0173] Example 121 Synthesis of compound II-73 Under the protection of nitrogen gas, 1-(2-bromo-4-fluorophenyl)ethane-1-ol (2.19 g, 0.1 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.33 g of 1-(4-fluoro-2-(1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained with a yield of 51.9%. EI-MS M / Z 257.3[M + ].

[0174] Example 122 Synthesis of compound II-74 Under the protection of nitrogen gas, 1-(2-bromo-4,6-difluorophenyl)ethane-1-ol (2.37 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.58 g of 1-(2,4-difluoro-6-(1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained with a yield of 57.6%. EI-MS M / Z 275.3[M + ].

[0175] Example 123 Synthesis of compound II-75 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(1-hydroxyethyl)benzonitrile (2.44 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.89 g of 5-fluoro-2-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 31.6%. EI-MS M / Z 282.3[M + ].

[0176] Example 124 Synthesis of compound II-76 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzamide (2.42 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.71 g of 4-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 25.2%. EI-MS M / Z 282.3[M + ].

[0177] Example 125 Synthesis of compound II-77 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzamide (2.62 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.81 g of 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 27.1%. EI-MS M / Z 300.3[M + ].

[0178] Example 126 Synthesis of compound II-78 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzamide (2.69 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.61 g of 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 19.9%. EI-MS M / Z 307.3[M + ].

[0179] Example 127 Synthesis of compound II-79 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.72 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.21 g of 4-(1-hydroxyethyl)-N,N-dimethyl-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 39.1%. EI-MS M / Z 310.4[M + ].

[0180] Example 128 Synthesis of compound II-80 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.90 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.22 g of 3-fluoro-4-(1-hydroxyethyl)-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 37.3%. EI-MS M / Z 328.4[M +].

[0181] Example 129 Synthesis of compound II-81 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.97 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.22 g of 3-cyano-4-(1-hydroxyethyl)-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 36.5%. EI-MS M / Z 335.4[M + ].

[0182] Example 130 Synthesis of compound II-82 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzoic acid (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110°C and reacted for 2 h. After completion of the reaction, the reaction solution was allowed to cool, extracted by adding water / ethyl acetate. The organic phase was concentrated to dryness, and subjected to column chromatography, with ethyl acetate / petroleum ether as the eluent, to obtain 0.71 g of 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzoic acid, which was an off-white powdery solid, with a yield of 25.2%. EI-MS M / Z 283.3[M + .

[0183] Example 131 Synthesis of Compound of Formula II-83 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoic acid (2.63 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 mL), followed by addition of potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocene palladium dichloride (0.36 g, 0.5 mmol) and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 0.5 mmol). The mixture was heated to 110°C and reacted for 2 h. After completion of the reaction, the reaction solution was allowed to cool, extracted by adding water / ethyl acetate. The organic phase was concentrated to dryness, and subjected to column chromatography, with ethyl acetate / petroleum ether as the eluent, to obtain 0.60 g of 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoic acid, which was an off-white powdery solid, with a yield of 20.0%. EI-MS M / Z 301.3[M + .

[0184] Example 132 Synthesis of Compound of Formula II-84 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoic acid (2.70 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.62 g of off-white powder solid 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 20.2%. EI-MS M / Z 308.3[M + ].

[0185] Example 133 Synthesis of compound II-85 Under the protection of nitrogen gas, methyl 3-bromo-4-(1-hydroxyethyl)benzoate (2.59 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.59 g of off-white powder solid methyl 4-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)benzoate was obtained, with a yield of 53.6%. EI-MS M / Z 297.3[M + ].

[0186] Example 134 Synthesis of compound II-86 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoate (2.77 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.54 g of methyl 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 49.0%. EI-MS M / Z 315.3[M + ].

[0187] Example 135 Synthesis of compound II-87 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoate (2.84 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.68 g of methyl 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 52.3%. EI-MS M / Z 322.3[M + ].

[0188] Example 136 Synthesis of compound II-88 Under the protection of nitrogen gas, 1-(4-allyl-2-bromophenyl)ethane-1-ol (2.40 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.77 g of 1-(4-allyl-2-(1H-benzoimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 27.7%. EI-MS M / Z 279.4[M + ].

[0189] Example 137 Synthesis of compound II-89 Under the protection of nitrogen gas, 1-(4-allyl-2-bromo-6-fluorophenyl)ethane-1-ol (2.59 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.51 g of 1-(4-allyl-2-fluoro-6-(1H-benzimidazole-5-yl)phenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 17.2%. EI-MS M / Z 297.4[M + ].

[0190] Example 138 Synthesis of compound II-90 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(1-hydroxyethyl)benzonitrile (2.66 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.69 g of 5-allyl-2-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 22.7%. EI-MS M / Z 304.4[M + ].

[0191] Example 139 Synthesis of compound II-91 Under the protection of nitrogen gas, 2-(3-bromo-(1-hydroxyethyl)phenyl)acetonitrile (2.40 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine). )Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110°C and the reaction was carried out for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.85 g of off-white powder solid 2-(4-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 30.6%. EI-MS M / Z 278.3[M + ].

[0192] Example 140 Synthesis of compound II-92 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(1-hydroxyethyl)phenyl)acetonitrile (2.58 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.24 g of off-white powder solid 2-(3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 42.0%. EI-MS M / Z 296.3[M + ].

[0193] Example 141 Synthesis of compound II-93 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(1-hydroxyethyl)benzonitrile (2.65 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.89 g of 5-cyanomethyl-2-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 29.4%. EI-MS M / Z 303.3[M + ].

[0194] Example 142 Synthesis of compound II-94 Under the protection of nitrogen gas, 1-(2-bromo-4-propylphenyl)ethane-1-ol (2.43 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.55 g of 1-(2-(1H-benzimidazole-5-yl)-4-propylphenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 55.3%. EI-MS M / Z 281.4[M + ].

[0195] Example 143 Synthesis of compound II-95 Under the protection of nitrogen gas, 1-(2-bromo-6-fluoro-4-propylphenyl)ethane-2-ol (2.61 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.06 g of 1-(2-fluoro-6-(1H-benzimidazole-5-yl)-4-propylphenyl)ethane-1-ol, a white powder solid, was obtained, with a yield of 35.5%. EI-MS M / Z 299.4[M + ].

[0196] Example 144 Synthesis of compound II-96 Under the protection of nitrogen gas, 3-bromo-2-(1-hydroxyethyl)-5-propanebenzonitrile (2.68 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.02 g of 2-(1-hydroxyethyl)-3-(1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained, with a yield of 33.4%. EI-MS M / Z 306.4[M + ].

[0197] Example 145 Synthesis of compound II-97 Under the protection of nitrogen gas, (2-bromo-4-fluorophenyl)methanol (2.05 g, 0.1 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.11 g of (4-fluoro-2-(2-methyl-1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 43.3%. EI-MS M / Z 257.3[M + ].

[0198] Example 146 Synthesis of compound II-98 Under the protection of nitrogen gas, (2-bromo-4,6-difluorophenyl)methanol (2.23 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.39 g of (2,4-difluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 50.7%. EI-MS M / Z 275.3[M +].

[0199] Example 147 Synthesis of compound II-99 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(hydroxymethyl)benzonitrile (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.01 g of 5-fluoro-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 35.9%. EI-MS M / Z 282.3[M + ].

[0200] Example 148 Synthesis of compound II-100 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzamide (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.66 g of 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 23.5%. EI-MS M / Z 282.3[M + ].

[0201] Example 149 Synthesis of compound II-101 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzamide (2.48 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.56 g of 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 18.7%. EI-MS M / Z 300.3[M + ].

[0202] Example 150 Synthesis of compound II-102 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzamide (2.55 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.88 g of 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 28.7%. EI-MS M / Z 307.3[M + ].

[0203] Example 151 Synthesis of compound II-103 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.82 g of 4-(hydroxymethyl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 58.8%. EI-MS M / Z 310.4[M +].

[0204] Example 152 Synthesis of compound II-104 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.76 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.45 g of 3-fluoro-4-(hydroxymethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 44.3%. EI-MS M / Z 328.4[M + ].

[0205] Example 153 Synthesis of compound II-105 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.83 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.16 g of 3-cyano-4-(hydroxymethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 34.7%. EI-MS M / Z 335.4[M + ].

[0206] Example 154 Synthesis of compound II-106 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzoic acid (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.57 g of off-white powder solid 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 20.2%. EI-MS M / Z 283.3[M + ].

[0207] Example 155 Synthesis of compound II-107 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzoic acid (2.49 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.53 g of 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 17.6%. EI-MS M / Z 301.3[M + ].

[0208] Example 156 Synthesis of compound II-108 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzoic acid (2.56 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.63 g of 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained with a yield of 20.5%. EI-MS M / Z 308.3[M +].

[0209] Example 157 Synthesis of compound II-109 Under the protection of nitrogen gas, methyl 3-bromo-4-(hydroxymethyl)benzoate (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.85 g of methyl 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 62.4%. EI-MS M / Z 297.3[M + ].

[0210] Example 158 Synthesis of compound II-110 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(hydroxymethyl)benzoate (2.63 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.77 g of methyl 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained with a yield of 56.3%. EI-MS M / Z 315.3[M + ].

[0211] Example 159 Synthesis of compound II-111 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(hydroxymethyl)benzoate (2.70 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.69 g of methyl 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 52.6%. EI-MS M / Z 322.4[M + ].

[0212] Example 160 Synthesis of compound II-112 Under the protection of nitrogen gas, (4-allyl-2-bromophenyl)methanol (2.27 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.42 g of (4-allyl-2-(2-methyl-1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 14.1%. EI-MS M / Z 279.4[M + ].

[0213] Example 161 Synthesis of compound II-113 Under the protection of nitrogen gas, (4-allyl-2-bromo-6-fluorophenyl)methanol (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.41 g of (4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 13.8%. EI-MS M / Z 297.4[M + ].

[0214] Example 162 Synthesis of compound II-114 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(hydroxymethyl)benzonitrile (2.52 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.51 g of 5-allyl-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 16.8%. EI-MS M / Z 304.4[M + ].

[0215] Example 163 Synthesis of compound II-115 Under the protection of nitrogen gas, 2-(3-bromo-4-(hydroxymethyl)phenyl)acetonitrile (2.26 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.88 g of off-white powder solid 2-(4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 31.7%. EI-MS M / Z 278.4[M + ].

[0216] Example 164 Synthesis of compound II-116 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(hydroxymethyl)phenyl)acetonitrile (2.44 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.22 g of off-white powder solid 2-(3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 41.3%. EI-MS M / Z 296.3[M + ].

[0217] Example 165 Synthesis of compound II-117 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(hydroxymethyl)benzonitrile (2.51 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.82 g of 5-cyanomethyl-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 27.1%. EI-MS M / Z 303.3[M + ].

[0218] Example 166 Synthesis of compound II-118 Under the protection of nitrogen gas, (2-bromo-4-propylphenyl)methanol (2.29 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.58 g of (2-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenyl)methanol, a white powder solid, was obtained with a yield of 53.7%. EI-MS M / Z 281.4[M + ].

[0219] Example 167 Synthesis of compound II-119 Under the protection of nitrogen gas, (2-bromo-6-fluoro-4-propylphenyl)methanol (2.47 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.06 g of (2-fluoro-6-(2-methyl-1H-benzimidazole-5-yl)-4-propylphenyl)methanol, a white powder solid, was obtained with a yield of 35.5%. EI-MS M / Z 299.4[M + ]. Example 168 Synthesis of compound II-120 Under the protection of nitrogen gas, 3-bromo-2-(hydroxymethyl)-5-propanebenzonitrile (2.54 g, 0.01 mol) and (2-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.12 g of 2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained, with a yield of 36.7%. EI-MS M / Z 306.4[M + ].

[0220] Example 169 Synthesis of compound II-121 Under the protection of nitrogen gas, (2-bromo-4-fluorophenyl)methanol (2.05 g, 0.1 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocene dichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol) were added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent to obtain 1.24 g of (4-fluoro-2-(1H-benzimidazole-5-yl)phenyl)methanol as a white powder solid with a yield of 51.2%. EI-MS M / Z 243.3[M + ].

[0221] Example 170 Synthesis of the compound of formula II-122 Under the protection of nitrogen gas, (2-bromo-4,6-difluorophenyl)methanol (2.23 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.52 g of (2,4-difluoro-6-(1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 58.4%. EI-MS M / Z 261.2[M + ].

[0222] Example 171 Synthesis of compound II-123 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(hydroxymethyl)benzonitrile (2.30 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.13 g of 5-fluoro-2-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained, with a yield of 42.3%. EI-MS M / Z 268.3[M + ].

[0223] Example 172 Synthesis of compound II-124 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzamide (2.30 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.58 g of 4-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 21.7%. EI-MS M / Z 268.3[M + ].

[0224] Example 173 Synthesis of compound II-125 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzamide (2.48 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.65 g of 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 22.8%. EI-MS M / Z 286.3[M + ].

[0225] Example 174 Synthesis of compound II-126 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzamide (2.55 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.83 g of 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 28.4%. EI-MS M / Z 293.3[M + ].

[0226] Example 175 Synthesis of compound II-127 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.58 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.12 g of 4-(hydroxymethyl)-N,N-dimethyl-3-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained with a yield of 37.9%. EI-MS M / Z 296.3[M + ].

[0227] Example 176 Synthesis of compound II-128 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.76 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.05 g of 3-fluoro-4-(hydroxymethyl)-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 33.5%. EI-MS M / Z 314.3[M + ].

[0228] Example 177 Synthesis of compound II-129 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.83 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.03 g of 3-cyano-4-(hydroxymethyl)-N,N-dimethyl-5-(1H-benzimidazole-5-yl)benzamide, a white powder solid, was obtained, with a yield of 32.1%. EI-MS M / Z 321.4[M + ].

[0229] Example 178 Synthesis of compound II-130 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzoic acid (2.31 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.37 g of off-white powder solid 4-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 13.8%. EI-MS M / Z 269.3[M + ].

[0230] Example 179 Synthesis of compound II-131 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzoic acid (2.49 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 0.63 g of 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)benzoic acid, a white powder solid, was obtained, with a yield of 22.0%. EI-MS M / Z 287.3[M + ].

[0231] Example 180 Synthesis of compound II-132 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzoic acid (2.56 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.33 g of off-white powder solid 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)benzoic acid was obtained, with a yield of 11.3%. EI-MS M / Z 294.3[M + ].

[0232] Example 181 Synthesis of compound II-133 Under the protection of nitrogen gas, methyl 3-bromo-4-(hydroxymethyl)benzoate (2.45 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.63 g of off-white powder solid methyl 4-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)benzoate was obtained, with a yield of 57.7%. EI-MS M / Z 283.3[M + ].

[0233] Example 182 Synthesis of compound II-134 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(hydroxymethyl)benzoate (2.63 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction solution was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.68 g of methyl 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 55.9%. EI-MS M / Z 301.3[M + ].

[0234] Example 183 Synthesis of compound II-135 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(hydroxymethyl)benzoate (2.70 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction solution was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.32 g of methyl 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)benzoate, a white powder solid, was obtained, with a yield of 43.0%. EI-MS M / Z 308.3[M + ].

[0235] Example 184 Synthesis of compound II-136 Under the protection of nitrogen gas, (4-allyl-2-bromophenyl)methanol (2.27 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.22 g of (4-allyl-2-(1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 8.3%. EI-MS M / Z 265.3[M + ].

[0236] Example 185 Synthesis of compound II-137 Under the protection of nitrogen gas, (4-allyl-2-bromo-6-fluorophenyl)methanol (2.45 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.36 g of (4-allyl-2-fluoro-6-(1H-benzimidazole-5-yl)phenyl)methanol, a white powder solid, was obtained, with a yield of 12.8%. EI-MS M / Z 283.3[M + ].

[0237] Example 186 Synthesis of compound II-138 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(hydroxymethyl)benzonitrile (2.52 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 0.38 g of 5-allyl-2-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained with a yield of 13.1%. EI-MS M / Z 290.3[M + ].

[0238] Example 187 Synthesis of compound II-139 Under the protection of nitrogen gas, 2-(3-bromo-4-(hydroxymethyl)phenyl)acetonitrile (2.26 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.15 g of 2-(4-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)phenyl)acetonitrile, a white powder solid, was obtained with a yield of 43.7%. EI-MS M / Z 264.3[M + ].

[0239] Example 188 Synthesis of compound II-140 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(hydroxymethyl)phenyl)acetonitrile (2.44 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.06 g of off-white powder solid 2-(3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazole-5-yl)phenyl)acetonitrile was obtained, with a yield of 37.7%. EI-MS M / Z 282.3[M + ].

[0240] Example 189 Synthesis of compound II-141 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(hydroxymethyl)benzonitrile (2.51 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.15 g of 5-cyanomethyl-2-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)benzonitrile, a white powder solid, was obtained with a yield of 39.9%. EI-MS M / Z 289.3[M + ].

[0241] Example 190 Synthesis of compound II-142 Under the protection of nitrogen gas, (2-bromo-4-propylphenyl)methanol (2.29 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate and extract, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.06 g of (2-(1H-benzimidazole-5-yl)-4-propylphenyl)methanol, a white powder solid, was obtained, with a yield of 39.8%. EI-MS M / Z 267.3[M + ].

[0242] Example 191 Synthesis of compound II-143 Under the protection of nitrogen gas, (2-bromo-6-fluoro-4-propylphenyl)methanol (2.47 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.23 g of (2-fluoro-6-(1H-benzimidazole-5-yl)-4-propylphenyl)methanol, a white powder solid, was obtained, with a yield of 42.3%. EI-MS M / Z 285.3[M + ].

[0243] Example 192 Synthesis of compound II-144 Under the protection of nitrogen gas, 3-bromo-2-(hydroxymethyl)-5-propanebenzonitrile (2.54 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.52 g of 2-(hydroxymethyl)-3-(1H-benzimidazole-5-yl)-5-propylbenzonitrile, a white powder solid, was obtained, with a yield of 52.2%. EI-MS M / Z 292.4[M + ].

[0244] Example 193 Synthesis of Formula I-24-A [ka] Under the protection of nitrogen gas, 2-bromo-4-fluoro-1-anisole (2.05 g, 0.01 mol) and (1H-benzimidazole-5-yl)boric acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) 0.28 g, 0.5 mmol of ferrocene was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent to obtain 1.55 g of 5-(5-fluoro-2-methoxyphenyl)-1H-benzimidazole, a white powder solid, with a yield of 64.0%. EI-MS M / Z 243.3[M + ].

[0245] Example 194 Synthesis of Formula I-24-B [ka] Under the protection of nitrogen gas, 2-bromo-4-fluorophenol (1.91 g, 0.01 mol) and (1-methyl-1H-benzimidazole-5-yl)boric acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Add ferrocene (0.28 g, 0.5 mmol), raise the temperature to 110°C and react for 2 hours. After the reaction is complete, allow the reaction mixture to cool, add water / ethyl acetate for extraction, concentrate the organic phase until dry, and perform column chromatography. Using ethyl acetate / petroleum ether as an eluent, 1.15 g of 4-fluoro-2-(1-methyl-1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 47.5%. EI-MS M / Z 243.3[M + ].

[0246] Example 195 Synthesis of Formula I-24-C [ka] Under the protection of nitrogen gas, 2-bromophenol (1.73 g, 0.01 mol) and (7-fluoro-1H-benzimidazole-5-yl)boric acid (1.80 g, 0.01 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 0.5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dry, and column chromatography was performed using ethyl acetate / petroleum ether as an eluent. 1.02 g of 2-(7-fluoro-1H-benzimidazole-5-yl)phenol, a white powder solid, was obtained, with a yield of 44.69%. EI-MS M / Z 229.2[M + ].

[0247] Example 196: Measurement of bioactivity of primary cardiomyocytes after injury in suckling rats

[0248] Test method: Primary cardiomyocytes from suckling rats were isolated and cultured, then placed on cell culture plates. Drug reservoirs were taken and added to cell wells at a specific dilution ratio, resulting in a final concentration of 10 μM. After half an hour of drug action, phenylephrine (PE) reservoir was added, resulting in a final PE concentration of 20 μM. After 48 hours of PE action, cell samples were collected and used for real-time quantitative PCR or cell area measurement.

[0249] Isolation and plating of rat cardiomyocytes: Depending on the actual number of cells needed, a certain number of SPF-level suckling rats were placed in a clean bench, the thoracic cavity was cut with scissors, the heart was isolated, and the heart was cut into tissue scraps with sterile surgical scissors. Type II collagenase (Manufacturer: Sigma, Catalog No.: C2-28-100MG) was taken and added to D-HANKS equilibrium salt buffer to create a 5 μg / mL enzyme digestion solution. Cardiac tissue debris was digested three times consecutively in a 37°C constant temperature water bath. In the first step, approximately 2 mL of enzyme digestion solution was added to digest the cardiomyocytes and tissue debris, and after centrifugation to precipitate, the supernatant was discarded. In the second and third steps, approximately 4 mL of enzyme digestion solution was added, respectively, and digestion was continued. The supernatant was collected each time, and immediately an equal volume of DMEM containing 10% FBS was added to neutralize the digestive enzyme. In the second and third steps, the supernatants were combined and centrifuged, the supernatant was discarded, and an appropriate amount of 10% FBS DMEM was added to resuspend the cardiomyocytes. The cells were inoculated into a 100 mm petri dish, and differential adhesion was performed in a constant temperature cell incubator for 2 hours. After that, the supernatant was taken and the cells were counted.

[0250] Area detection of rat cardiomyocytes: Take a 24-well plate pre-coated with 1% gelatin and measure 1.0 × 10⁶ cells. 3Cells were plated in wells, with 500 μL of 10% FBS+DMEM medium in each well. Cells were incubated in a 37°C incubator for 24 hours. Different compounds were mixed with 100 mM DMSO in a mother liquor, serially diluted with 10% FBS+DMEM medium, and then prepared as a 10 μM final compound solution containing 0.5% DMSO. The medium in the 24-well plate was discarded and replaced with medium containing 10 μM of the compound in 500 μL / well. Three duplicate wells were created for each compound, and a negative control well was also provided. After 0.5 hours of drug action, 20 μM PE (Manufacturer: Meilun Biotechnology, Catalog No.: MB1602) was added to each well, except for the negative control well. After 48 hours of PE action, at least five fields of view were randomly selected from each well under an inverted microscope (Manufacturer: Nikon, Model: Eclipse TS100), and cell area data was calculated using ImageJ software. With the cell area of ​​the negative control well set to 1, the cell area hypertrophy multiplier for the PE well and each administration well was calculated, and statistical analysis was performed using the One-Way ANOVA method.

[0251] Real-time quantitative PCR Take a 24-well plate pre-coated with 1% gelatin, and 1 x 10 5 Cells were plated in wells, and 500 μL of 10% FBS+DMEM medium was added to each well. Cells were incubated in a 37°C incubator for 24 hours. Different compounds were mixed with DMSO to a 100 mM mother liquor, serially diluted with 10% FBS+DMEM medium, and then prepared as a 10 μM final compound solution containing 0.5% DMSO. The medium in the 24-well plate was discarded and replaced with medium containing 10 μM of the compound in 500 μL / well. Three duplicate wells were created for each compound, and a negative control well was also provided. After 0.5 hours of drug action, 20 μM PE (Manufacturer: Meilun Biotechnology, Catalog No.: MB1602) was added to each well. PE was not added to the negative control well. After 48 hours of PE action, samples were detected.

[0252] Gene expression levels associated with cardiomyocyte hypertrophy were compared by detecting mRNA levels of atrial natriuretic peptide (ANP) and myosin heavy chain β (β-MHC) using real-time quantitative PCR. The process included extraction of total cellular RNA, reverse transcription synthesis of cDNA, and real-time quantitative PCR testing.

[0253] The real-time quantitative PCR process was completed according to the following reaction system and program (Note: all relevant primers are commercially available).

[0254] ANP primer: Forward primer: AGAGACGGCAGTGCTCTAGG (SEQ ID NO: 1) Reverse primer: CAATCCTACCCCCGAAGCAG (SEQ ID NO: 2) β-MHC primer: Forward primer: CTCCAGGGGTGATGGACAAC (SEQ ID NO: 3) Reverse primer: CGATACCTCTGCCGGAAGTC (SEQ ID NO: 4) Reaction system: 20 μL Reaction program: [Table 1]

[0255] Summary and analysis of results: (1) Preliminary modeling test of cardiomyocyte hypertrophy: It is necessary to confirm that PE can induce cardiomyocyte hypertrophy before the test. (2) Results of drug selection Real-time quantitative PCR was used to detect ANP mRNA levels in cardiomyocytes, and drugs with potential to counter cardiomyocyte hypertrophy were initially selected. Subsequently, these were validated at the mRNA level of another hypertrophy gene, β-MHC. One-way ANOVA was used for statistical analysis, and GraphPad Prism was employed. Significant differences (P-values ​​less than 0.05 in all cases) were found between typical compounds in equations I-1 to I-48 and II-1 to II-144 and the PE group.

[0256] [Table 2]

[0257] [Table 3]

[0258] [Table 4]

[0259] The findings were verified by directly measuring cardiomyocyte area and comparing the differences between groups. After intervention with both PE and the drug, cardiomyocytes were placed under a microscope for direct observation and image acquisition, and cell area data were calculated using ImageJ software. As shown in Table 4, the results indicate that the cardiomyocyte area of ​​the groups intervened with typical drugs of two different structures, formulas I and II, was significantly lower than that of the PE group, and that formulas I-24-A, I-24-B, and I-24-C did not have a clear improving effect.

[0260] [Table 5]

[0261] Example 197: Efficacy study of a mouse model of pressure overload heart failure.

[0262] 1. Materials and Methods 1.1 Animal: Healthy C57BL / 6 mouse 1.2 Drugs and Dosage Regimen [Table 6] 1.3 Method modeling: Modeling of thoracic aortic ligation surgery: To exclude mice with cardiac dysfunction, cardiac ultrasound detection was performed before surgery. Mice with normal cardiac function were anesthetized, and after the mice were anesthetized, they were moved to a small animal operating table and fixed in place. Anesthesia was maintained by establishing an respiratory route via tracheal intubation. The epidermis was cut along the sternum, centered on the second rib, toward the first and third ribs, exposing the connection between the second rib and the sternum. The second rib was cut, and the thoracic aorta was exposed. The aortic arch was freed, a thin thread was passed through below, and a thin needle was placed parallel to the aortic arch and ligated together. After ligation, the thin needle was removed and the mouse's condition was observed, and after the condition stabilized, the layers were sutured. The mice were kept warm on an insulating mat, and after awakening, they were returned to their cages for daily care based on their movement and condition.

[0263] Experimental grouping and dosing regimen: Five weeks after modeling, cardiac ultrasound was performed on the mice to determine their ejection fraction. When the ejection fraction decreased by approximately 50%, the experimental requirements were met and the administration experiment was started. Based on the ultrasound data, the animals were randomly divided into groups and administered the drug. Cardiac ultrasound was performed on the mice every two weeks until the experiment was completed in nine weeks, at which point pathological section analysis was performed.

[0264] Statistical analysis: The results are expressed as mean ± standard error. Data analysis was performed using GraphPad Prism statistical software, and t-test analysis was used for comparison. A statistically significant difference was determined if P < 0.05, and no significant difference otherwise.

[0265] 2 Results 2.1 Effects of the test drug on disease progression in mice As shown in Tables 5 and 6, the results showed that four weeks after administration (i.e., nine weeks after modeling), typical drugs of formulas I and II all had a clear improvement effect on cardiac contractility, while formulas I-24-A, I-24-B, and I-24-C did not have a clear improvement effect.

[0266] [Table 7]

[0267] [Table 8]

[0268] Four weeks after administration (i.e., nine weeks after modeling), tissue samples were taken from mouse hearts. Pathological results showed a significant increase in cardiac fibrosis after modeling treatment, and a significant decrease in the degree of fibrosis in all groups after treatment with typical test drugs of formulas I and II (as described in Tables 5 and 6).

[0269] In summary, the benzimidazole compounds of this application have a simple and short synthesis process, are easy to control, possess cardioprotective effects, can be used to treat chronic heart failure, and have broad potential applications.

[0270] While the present application illustrates the compound, its preparation method, and use with respect to the above-described examples, the applicant declares that the application is not limited to the above-described examples, that is, it does not mean that the application must be carried out in accordance with the above-described examples. Those skilled in the art should understand that any improvements to the present application, equivalent substitutions and additions of auxiliary components to the raw materials used in the present application, and selection of specific forms are all included within the scope of protection and disclosure of the present application.

Claims

1. A benzimidazole compound having the structure shown in formula A below. 【Chemistry 1】 (However, R is a hydroxyl group or 【Chemistry 2】 And, R １ , R ２ , R ３ and R ５ These are, independently, hydrogen, halogen, nitro group, amino group, hydroxyl group, cyano group, carboxyl group, C1-C4 linear or branched alkoxyformyl group, carbamoyl group, carbamoyl group with N substituted with a C1-C4 linear or branched alkyl group, C1-C4 linear or branched alkyl group, C1-C4 alkoxy group, C1-C4 alkylamino group, trifluoromethyl group, allyl group, cyanomethyl group, or trifluoromethoxy group. R ４ These are fluorine, bromine, nitro group, hydroxyl group, cyano group, carboxyl group, C1-C4 linear or branched alkoxyformyl group, carbamoyl group, carbamoyl group with N substituted with a C1-C4 linear or branched alkyl group, C1-C4 linear or branched alkyl group, non-halogenated C1-C4 alkoxy group, C1-C4 alkylamino group, amino group, trifluoromethyl group, allyl group, or cyanomethyl group. R ６ These are C1-C4 linear or branched alkylene groups. R ４ is a carboxyl group, R ３ is hydrogen, and when R is a hydroxy group, R ５ is not a methyl group.)

2. A benzimidazole compound according to claim 1, having a structure represented by formula I or formula II. 【Transformation 3】 (However, R １ , R ２ , R ３ , R ４ and R ５ The limitation is the same as in equation A.

3. R １ , R ２ , R ３ and R ５ Each of these is independently one of the following: hydrogen, fluorine, chlorine, bromine, amino group, hydroxyl group, cyano group, methoxyformyl group, ethoxyformyl group, dimethylcarbamoyl group, diethylcarbamoyl group, trifluoromethyl group, methyl group, ethyl group, n-propyl group, isopropyl group, allyl group, cyanomethyl group, methoxy group, trifluoromethoxy group, ethoxy group, methylamino group, dimethylamino group, ethylamino group, or diethylamino group. R4 is one of the following: fluorine, bromine, amino group, hydroxyl group, cyano group, carboxyl group, methoxyformyl group, ethoxyformyl group, carbamoyl group, dimethylcarbamoyl group, diethylcarbamoyl group, trifluoromethyl group, methyl group, ethyl group, n-propyl group, isopropyl group, allyl group, cyanomethyl group, methoxy group, ethoxy group, methylamino group, dimethylamino group, ethylamino group, or diethylamino group. The benzimidazole compound according to claim 1.

4. The benzimidazole compound according to claim 1, comprising any one of the compounds of formulas I-1 to I-47 and II-1 to II-144. 【Chemistry 4】 【Transformation 5】 【Transformation 6】 【Transformation 7】 【Transformation 8】 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】

5. The process includes the step of reacting a brominated compound represented by formula B with a boric acid compound represented by formula V using a catalyst to obtain a benzimidazole compound represented by formula A, and the reaction formula is as follows: 【Chemistry 12】 The molar ratio of the brominated compound represented by formula B to the boric acid compound represented by formula V is 1:0.8 to 1:

3. The catalyst is one or at least two of the following: tetrakis(triphenylphosphine)palladium, 1,1-bis(diphenylphosphine)ferrocenedichloropalladium, or palladium acetate. The molar ratio of the catalyst to the boric acid compound represented by formula V is 0.001:1 to 0.5:

1. The Suzuki reaction described above is carried out in the presence of an alkaline substance. The alkaline substance is one or at least two of the following: potassium fluoride, potassium acetate, sodium carbonate, potassium carbonate, or potassium phosphate. The Suzuki reaction is carried out in an organic solvent, which is one or at least two of the following: DMF, toluene, ethanol, 1,4-dioxane, water, or THF. The temperature of the Suzuki reaction is 70 to 150°C, and the duration is 0.25 to 48 hours. A method for preparing a benzimidazole compound according to any one of claims 1 to 4.

6. A pharmaceutically acceptable salt of a benzimidazole compound according to any one of claims 1 to 4, The pharmaceutically acceptable salt is an organic or inorganic salt of the benzimidazole compound. The aforementioned organic acid salt is one selected from tartrate, stearate, oxalate, citrate, lactate, sorbate, fumarate, formate, acetate, benzoate, benzenesulfonate, ethanesulfonate, resinate, trifluoroacetate, maleate, malate, L-malate, methanesulfonate, fumarate, amino acid salt, or nicotinate. The aforementioned organic acid salt is one selected from tartrate, acetate, maleate, malate, L-malate, or fumarate. The inorganic salt is one selected from phosphate, sulfate, nitrate, iodate, bromate, hydroiodide, hydrobromide, or hydrochloride. The inorganic salt is one selected from phosphate, sulfate, or hydrochloride. A medicinally acceptable salt.

7. A solvate, tautomer, or stereoisomer of a benzimidazole compound according to any one of claims 1 to 4, The solvate is a hydrate and / or alcoholic dihydrate of a benzimidazole compound. Solvates, tautomers, or stereoisomers.

8. A pharmaceutical composition, The compound comprises a benzimidazole compound according to any one of claims 1 to 4, The aforementioned pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant, The aforementioned pharmaceutically acceptable adjuvants are one of the following: excipients, diluents, vectors, flavorings, binders, or fillers. The dosage form of the pharmaceutical composition is an oral preparation, a parenteral preparation, or a topical preparation. Pharmaceutical composition.

9. Use of a benzimidazole compound according to any one of claims 1 to 4 in the preparation of a drug for treating chronic heart failure.

10. Use of a substituted benzimidazole compound, its tautomer, its pharmaceutically acceptable salt, its solvate, its hydrate, or its pharmaceutical composition in the preparation of a drug for the treatment of chronic heart failure, The substituted benzimidazole compound has the following structure and is used. 【Chemistry 13】

Images