Enhanced oligonucleotides to inhibit RTEL1 expression

Abstract

The present invention relates to enhanced antisense oligonucleotides targeted to regulator of telomere elongation helicase 1 (RTEL1), resulting in modulation of RTEL1 expression or modulation of RTEL1 activity. The present invention particularly relates to the use of enhanced antisense oligonucleotides targeted to RTEL1 for use in the treatment and / or prevention of Hepatitis B Virus (HBV) infection, particularly chronic HBV infection. The present invention particularly relates to the use of enhanced antisense oligonucleotides targeted to RTEL1 to destabilize cccDNA, such as HBV cccDNA. The present invention also includes pharmaceutical compositions and their use in the treatment and / or prevention of HBV infection.

Description

[Technical Field]

[0001] The present invention relates to enhanced antisense oligonucleotides targeting RTEL1 that result in the regulation of the expression of telomere elongation helicase 1 (RTEL1) or the regulation of RTEL1 activity. The present invention particularly relates to the use of enhanced antisense oligonucleotides targeting RTEL1 for the treatment and / or prevention of hepatitis B virus (HBV) infection, particularly chronic HBV infection. The present invention particularly relates to the use of enhanced antisense oligonucleotides targeting RTEL1 to destabilize cccDNA, such as HBV cccDNA. The present invention also includes pharmaceutical compositions and their use in the treatment and / or prevention of HBV infection. [Background technology]

[0002] Hepatitis B is an infectious disease caused by the hepatitis B virus (HBV), a small, liver-targeting virus that replicates via reverse transcription. Chronic HBV infection is a significant factor in serious liver diseases such as cirrhosis and hepatocellular carcinoma. Current treatment for chronic HBV infection is based on the administration of pegylated type I interferons or nucleoside analogs such as lamivudine, adefovir, entecavir, tenofovir diisoproxil, and tenofovir alafenamide, which target viral polymerase, a multifunctional reverse transcriptase. The success of treatment is usually measured as the disappearance of hepatitis B surface antigen (HBsAg). However, complete HBsAg clearance is rarely achieved because hepatitis B virus DNA persists in the body after infection. HBV persistence is mediated by the episomal type of the HBV genome, which is stably maintained in the nucleus. This episomal type is called "covalently closed circular DNA" (cccDNA). cccDNA serves as a template for all HBV transcripts, including pregenomic RNA (pgRNA), which is an intermediate in viral replication. The presence of several copies of cccDNA may be sufficient to reactivate HBV infection. Current treatments for HBV do not target cccDNA. However, elimination of cccDNA may be necessary for the cure of chronic HBV infection (as outlined by Nassal, Gut. 2015 Dec;64(12):1972-84.doi:10.1136 / gutjnl-2015-309809).

[0003] The regulator of telomere elongation helicase 1 (RTEL1) encodes a DNA helicase that functions in telomere stability, protection, and elongation, and interacts with proteins in the sheltarin complex known to protect telomeres during DNA replication. Mutations in this gene are associated with congenital keratosis and Hoyerall-Hreidarsson syndrome (see, for example, the overview by Vannier et al., 2014 Trends Cell Biol. Vol 24 p.416).

[0004] Located in the nucleus, RTEL1 functions as an ATP-dependent DNA helicase involved in telomere length regulation, DNA repair, and maintaining genomic stability. Acting as an anti-recombinase, RTEL1 controls meiotic recombination and cross-homeostasis by counteracting toxic recombination, limiting cross-recombination during meiosis, and physically dissociating strand entry events. This promotes synthesis-dependent strand annealing (SDSA) during meiosis and non-cross-repair through the degradation of D-loop recombination intermediates. Furthermore, RTEL1 prevents telomere fragility by degrading T-loops and antagonizing the G4-DNA structure of telomeres, thereby ensuring both telomere dynamics and stability.

[0005] RTEL1 has been identified as an HPV episome stabilizer in siRNA screening (Edwards et al., 2013 PLoS One Vol 8, e75406). Similarly, siRNAs targeting RTEL1 have been used to identify substances that interact with RTEL1 in Hoyeraal-Hreidarsson syndrome (Schertzer et al 2015 Nucleic Acid Res Vol 43 p.1834). In addition, RTEL1 was identified as an HIV host-dependent factor through siRNA screening of essential host proteins that provide targets to inhibit HIV infection (International Publication No. 2007 / 094818).

[0006] International Publication No. 2020 / 011902 demonstrated that targeting RTEL1 with antisense oligonucleotides reduced RTEL1 levels. Furthermore, effects on HBV infection parameters such as HBV cccDNA, pgRNA, HBsAg, and HBeAg were observed.

[0007] There is a need for therapeutic agents that can specifically inhibit RTEL1. The inventors screened over 1000 antisense oligonucleotides targeting human RTEL1 and identified sequences and compounds that are particularly potent and effective in specifically targeting human RTEL1. Specifically, they identified four LNA gapmer oligonucleotides that confer strong downregulation of human RTEL1 in vitro. The identified LNA gapmer oligonucleotides target the intronic region of human RTEL1 premRNA.

[0008] Purpose of the invention The present invention provides antisense oligonucleotides and their conjugates that regulate RTEL1 ("Telomere Elongation Helicase 1 Regulator") expression. The inventors have identified intron target sequences present in human RTEL1 premRNA that can be targeted by antisense oligonucleotides or their conjugates to provide effective RTEL1 inhibition. For example, targeting positions 8681-8701 or 11753-11774 in SEQ ID NO: 1 is advantageous in reducing RTEL1. Therefore, an object of the present invention is to provide enhanced antisense oligonucleotides or their conjugates that target RTEL1, which can inhibit RTEL1 expression in vitro and in vivo, thereby reducing cccDNA in HBV-infected cells. Enhanced antisense oligonucleotides targeting RTEL1 or its conjugates can be used in the treatment of HBV infection. [Overview of the project]

[0009] The present invention provides antisense oligonucleotides or their conjugates that are complementary to RTEL1 nucleic acid and can inhibit its expression, and their use in pharmaceuticals.

[0010] The present invention provides an antisense oligonucleotide comprising a continuous nucleotide sequence that is complementary, for example, completely complementary, to a region of human RTEL1 premRNA (shown in SEQ ID NO: 1), such as the region from nucleotides 8681-8701 or nucleotides 11753-11774 of SEQ ID NO: 1.

[0011] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence is complementary, for example, perfectly complementary, to the region of nucleotides 8681-8701 of SEQ ID NO: 1.

[0012] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence is complementary, for example, perfectly complementary, to the region from nucleotides 11753-11774 of SEQ ID NO: 1, for example, from nucleotides 11757-11774, 11756-11774, or 11753-11770 of SEQ ID NO: 1.

[0013] The antisense oligonucleotides of the present invention are typically 12 to 24 nucleotides long, for example 12 to 22, or for example 16 to 22 nucleotides long, and comprise a sequence of at least 12 nucleotides that is complementary, for example, perfectly complementary, to a region of human RTEL1 premRNA (shown in SEQ ID NO: 1) selected from nucleotides 8681 to 8701 and 11753 to 11774 of SEQ ID NO: 1.

[0014] The present invention provides an antisense oligonucleotide having a length of 12 to 22 nucleotides, comprising a continuous nucleotide sequence of 12 to 22 nucleotides, wherein the continuous nucleotide sequence is complementary, for example, perfectly complementary, to SEQ ID NOs: 7, 8, 9, and / or 10.

[0015] The present invention provides an antisense oligonucleotide having a length of 12 to 22 nucleotides (e.g., 15, 16, 17, or 18 nucleotides), comprising a continuous nucleotide sequence of 12 to 18 nucleotides (e.g., 15, 16, 17, 18, 19, or 20 nucleotides), wherein the continuous nucleotide sequence is complementary, for example, perfectly complementary, to SEQ ID NO: 11.

[0016] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a continuous nucleotide sequence of 10 to 30 nucleotides, wherein the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6, or is 100% identical to at least 14 of those continuous nucleotides.

[0017] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a continuous nucleotide sequence of 10 to 30 nucleotides, wherein the continuous nucleotide sequence is 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6, or to at least 15 of the continuous nucleotides thereof.

[0018] The present invention provides an antisense oligonucleotide having a length of 10 to 30 nucleotides, comprising a continuous nucleotide sequence of 10 to 30 nucleotides, wherein the continuous nucleotide sequence is a sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6, or is 100% identical to at least 16 of those continuous nucleotides.

[0019] The present invention provides an antisense oligonucleotide comprising a sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6, or a sequence of nucleotides that is 100% identical to the 14 consecutive nucleotides thereof.

[0020] The present invention provides an antisense oligonucleotide comprising a continuous nucleotide sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6.

[0021] The present invention provides an antisense oligonucleotide that is 100% identical to sequence number 3 (AATTTTACATACTCTGGT), or that contains at least 14, 15, 16, or 17 such sequences of nucleotides.

[0022] The present invention provides an antisense oligonucleotide that is 100% identical to sequence number 4 (AATTTTACATACTCTGGTC), or that contains at least 14, 15, 16, 17, or 18 such sequences of nucleotides.

[0023] The present invention provides an antisense oligonucleotide that is 100% identical to sequence number 5 (TTACATACTCTGGTCAAA), or that contains at least 14, 15, 16, or 17 such sequences of nucleotides.

[0024] The present invention provides an antisense oligonucleotide that is 100% identical to sequence number 6 (CTTTATTATAACTTGAATCTC), or that contains at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides thereof.

[0025] The present invention provides antisense oligonucleotides comprising a sequence of nucleotides of compounds selected from the group consisting of compound ID numbers 3_1, 4_1, 5_1, and 6_1 (see, for example, Table 6 below).

[0026] In some embodiments, the antisense oligonucleotide is not an antisense oligonucleotide selected from the group consisting of compound ID numbers 36_1, 35_1, 33_1, 34_1, and 37_1 of International Publication No. 2020 / 011902A1 (see, for example, Table 6 of International Publication No. 2020 / 011902A1).

[0027] In some embodiments, the antisense oligonucleotide is not antisense oligonucleotide compound ID number 23_1 in International Publication No. 2020 / 011902A1 (see, for example, Table 6 of International Publication No. 2020 / 011902A1).

[0028] The present invention provides antisense oligonucleotides or pharmaceutically acceptable salts thereof selected from the group listed in Table 1.

[0029] The present invention provides antisense oligonucleotides selected from the group consisting of: AATTttacatactctgGT (SEQ ID NO: 3, Compound ID number: 3_1) AAttttacatactctGGTC (Sequence ID 4, Compound ID number 4_1), TTacatactctggtCAAA (SEQ ID NO: 5, Compound ID number: 5_1), and CTttattataactTgaAtCTC (Sequence ID 6, Compound ID number 6_1), Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are LNA5-methylcytosine, and all nucleoside bonds are phosphorothioate nucleoside bonds.

[0030] The present invention also provides pharmaceutically acceptable salts of the antisense oligonucleotides of the present invention.

[0031] The present invention provides antisense oligonucleotides or pharmaceutically acceptable salts thereof selected from the group listed in Table 1. [Table 1]

[0032] Helm annotation keys: [LR](G) is a beta-D-oxy-LNA guanine nucleoside, [LR](T) is a beta-D-oxy-LNA thymine nucleoside, [LR](A) is a beta-D-oxy-LNA adenine nucleoside, [LR]([5meC]) is a beta-D-oxy-LNA5-methylcytosine nucleoside, [dR](G) is a DNA guanine nucleoside, [dR](T) is a DNA thymine nucleoside, [dR](A) is a DNA adenine nucleoside, [dR](C) is a DNA cytosine nucleoside, [sP] is a phosphorothioate nucleoside bond, P is a phosphodiester nucleoside bond.

[0033] Therefore, the present invention provides antisense oligonucleotides selected from the group consisting of compound ID numbers 3_1, 4_1, 5_1, and 6_1.

[0034] The present invention further provides a conjugate comprising an antisense oligonucleotide and at least one conjugate moiety covalently bonded to the antisense oligonucleotide.

[0035] In some embodiments, the conjugate moiety can bind to an asialoglycoprotein receptor, such as the human asialoglycoprotein receptor. For example, the conjugate moiety may include at least one asialoglycoprotein receptor-targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalaxamine.

[0036] In some embodiments, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc). Therefore, the antisense oligonucleotide of the present invention can be conjugated to at least one conjugate moiety containing at least one N-acetylgalactosamine (GalNAc) moiety, for example, at least one conjugate moiety containing at least one N-acetylgalactosamine (GalNAc) moiety as described below. According to one aspect of the present invention, the conjugate moiety is a GalNAc residue R as described below herein.

[0037] In some embodiments, the conjugate moiety is at least trivalent, for example, divalent, trivalent, or tetravalent GalNAc residue R. Preferably, the conjugate moiety is a trivalent GalNAc residue R. As used herein, the term “trivalent GalNAc residue” refers to a residue comprising three N-acetylgalactosamine moieties, i.e., preferably three moieties of the following formula: [ka]

[0038] The conjugate moiety or GalNAc residue R and the antisense oligonucleotide may be linked together via a linker L, such as a biocleavable linker L. Therefore, the conjugate compound may contain linkers L positioned between the antisense oligonucleotide and the conjugate moiety or GalNAc residue R, respectively.

[0039] In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5. In another embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5A-1 or Figure 5A-2, or a mixture thereof. In another embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5B-1 or Figure 5B-2, or a mixture thereof. In yet another embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5C-1 or Figure 5C-2, or a mixture thereof. In yet another embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D-1 or Figure 5D-2, or a mixture thereof. The conjugate portion and the antisense oligonucleotide may be linked to each other via a linker such as a biocleavable linker. Therefore, the conjugate compound may include a linker located between the antisense oligonucleotide and the conjugate portion.

[0040] In some embodiments, the linker comprises or consists of 1 to 10 linked nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, e.g., 2 to 6 linked nucleosides, e.g., 2 to 5 linked nucleosides, e.g., 2 to 4 linked nucleosides. In some embodiments, the linker comprises two linked nucleotides. Thus, the nucleosides can be DNA nucleosides. Typically, the nucleosides are linked via phosphodiester nucleoside bonds. Furthermore, the linker may be linked to an antisense compound via phosphodiester nucleoside bonds.

[0041] Exemplary conjugates are provided in Table 2 (in HELM annotation format). In addition to the compounds shown in Table 1, the compounds contain two nucleotides "ca" as a cleavable linker at the 5' end. This is part of the HELM annotation for the sequences in Table 2. The cleavable linker is cleaved after successful GalNAc-mediated delivery, leaving the compound as the active drug.

[0042] The present invention provides a conjugate selected from the group of conjugates listed in Table 2, or a pharmaceutically acceptable salt thereof.

[0043] [Table 2]

[0044] In the table above, 5gn2c6 is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D-1 or Figure 5D-2, or a mixture of both. In some embodiments, 5gn2c6 is a GalNAc residue R having the following formula: [ka]

[0045] It should be understood that R shown in the above figure is a mixture of the two stereoisomers shown in Figures 5D1 and 5D2.

[0046] According to a further aspect of the present invention, R shown in the above figure is the stereoisomer shown in Figure 5D1.

[0047] According to a further aspect of the present invention, R shown in the above figure is the stereoisomer shown in Figure 5D2. The structures of the conjugates provided in Table 2 are shown in Figures 1 to 4.

[0048] The present invention provides the conjugate shown in Figure 1 or a pharmaceutically acceptable salt thereof. The present invention provides the antisense oligonucleotide of compound number 3_1 or a pharmaceutically acceptable salt thereof.

[0049] The present invention provides the conjugate shown in Figure 2 or a pharmaceutically acceptable salt thereof. The present invention provides the antisense oligonucleotide of compound number 4_1 or a pharmaceutically acceptable salt thereof.

[0050] The present invention provides the conjugate shown in Figure 3 or a pharmaceutically acceptable salt thereof. The present invention provides the antisense oligonucleotide of compound number 6_1 or a pharmaceutically acceptable salt thereof.

[0051] The present invention provides the conjugate shown in Figure 4 or a pharmaceutically acceptable salt thereof. The present invention provides the antisense oligonucleotide of compound number 5_1 or a pharmaceutically acceptable salt thereof. Compound of formula (I)

[0052] The present invention also provides compounds of the following formula (I). [ka] During the ceremony, n is either 0 or 1. p is either 0 or 1. However, if n is 1, then p is preferably 1. Furthermore, when n is 0 and p is 0, R is preferably H. L is a linker, preferably L is a linker containing or consisting of 2 to 10 nucleosides, for example, 2 to 5 nucleosides. R is a GalNAc residue, preferably a trivalent GalNAc residue. A is an antisense oligonucleotide residue according to the present invention.

[0053] The term "antisense oligonucleotide residue" is derived from its 5' end -(L) n -(OP(=O)(-OH)-) pThis refers to antisense oligonucleotides according to the present invention that are bound to residue R via -, for example, the antisense oligonucleotides shown in Table 6. Preferred antisense oligonucleotide residues are shown in Figures 1A, 2A, 3A, 4A, 5A, 6A, 7A, and 8A. GalNAc residue R

[0054] R is a GalNAc residue, preferably a trivalent GalNAc residue. As used herein, the term "GalNAc residue" means a residue containing at least one N-acetylgalactosamine (GalNAc) moiety, i.e., at least one part of the following formula: [ka]

[0055] As used herein, the term “trivalent GalNAc residue” refers to a residue comprising three N-acetylgalactosamine (GalNAc) moieties, preferably three moieties of the following formula: [ka]

[0056] Preferably, the GalNAc residue consists of at least one, preferably three, GalNAc constituent units (L) having the following structure. a ) including, [ka] During the ceremony, the linker a This is selected from alkyl groups, alkyl-oxy-alkyl groups, alkyl groups containing at least one phosphodiester bond, alkyl groups containing at least one amide bond, alkyl-oxy-alkyl groups containing at least one phosphodiester bond, and alkyl-oxy-alkyl groups containing at least one amide bond.

[0057] The term "alkyl" refers to a substituted or unsubstituted linear or branched alkyl group, for example a C1-C20 alkyl group, preferably C2-C8, for example C2, C3, C4, C5, C6, C7 or C8 alkyl group. Preferably, the alkyl group is unsubstituted, more preferably linear and unsubstituted alkyl group.

[0058] The term "alkyloxyalkyl" group refers to at least two alkyl groups linked via oxygen, preferably an ethyl-oxy-ethyl group, for example -(CH2-O) x -group, the integer x is preferably in the range of 2 to 20, more preferably in the range of 2 to 6, for example 2, 3, 4, 5 or 6, and more preferably x is 3 or 5.

[0059] According to one aspect of the present invention, the GalNAc building unit (L a ) is selected from the group of the following structures (L a ) .

[0060] When more than one residue (L a ) is present in a GalNAc residue, such as three residues in a trivalent GalNAc residue, it is preferred that all residues are identical.

[0061] Most preferably, L a has the following structure.

Chemical Formula

[0062] When the conjugate moiety R comprises a plurality of, for example preferably 3, GalNAc moieties, in addition to the GalNAc building unit (L a ), R preferably comprises a multivalent, preferably tetravalent building unit (L a ) which is linked to the antisense oligonucleotide residue A via -(L) n -(O-P(=O)(-OH)-) p -. b

[0063] Lb The structure is preferably selected from one of the following: [ka]

[0064] In the formula, X is O or S, Z is O or NH, and n is 1 to 4, preferably 2 or 3, more preferably 2.

[0065] More preferably, L b It has the following structure: [ka] L b Structure L b *or structure L b It should be understood that ** has any of the above, or a mixture thereof. In a preferred embodiment, L b L b * and L b It is a mixture of **. [ka]

[0066] Therefore, the conjugate portion R is preferably structured (L a )3-L b -Includes, and uiR includes one of the following structures, [ka] More preferably, the following structure is included. [ka]

[0067] In the formula, L b Preferably L b * and L b It is a mixture of **, X is O or S, Z is O or NH, n is 1 to 3, preferably 2, L aAs described above, preferably L a The following [ka] Selected from the group consisting of and mixtures thereof, preferably all residues (L) within the GalNAc residue. a ) are the same.

[0068] (L a )3-L b If the following applies, [ka] L a The following are more preferably selected from the group:

[0069] [ka] (L a )3-L b If the following applies, [ka] Preferably, [ka] L a Preferably, the following: [ka]

[0070] Optionally, the conjugate portion R is linked to linker L. c It further includes the following. Therefore, R is preferably structure (L a )3-L b -(L c ) c It has -, and the integer c is 1 or 0.

[0071] Such linker compounds are known to those skilled in the art, and the rest of the compound, the antisense oligonucleotide residue, namely -(L) n -(OP(=O)(-OH)-) p -via (L a )3-L b Appropriate selection is made to combine them.

[0072] L b Depending on the structure, L c L is selected from the group consisting of alkyl, alkyl-oxy-alkyl, amino-alkyl(-NH-alkyl-), amino-alkyl-oxy-alkyl, unnatural amino acid residues, and natural amino acid residues. According to one aspect of the present invention, c This is a substituted or unsubstituted lysine group.

[0073] According to one aspect of the present invention, R is (L a )3-L b -(L c ) c And c=1 and (L a )3-L b The following applies: [ka]

[0074] L c The amino acid is preferably an amino-alkyl group, or a substituted or unsubstituted lysine group, and is particularly L C For example, it is selected from the following group: [ka] The amino group is L b It binds to the carbonyl group, thereby forming an amide bond. Preferred residues R in this embodiment are shown in Figures 5A1, 5A2, 5C1, 5C2, 5D1, and 5D2. Accordingly, according to one embodiment of the present invention, R is selected from the group consisting of residues shown in Figures 5A1, 5A2; 5C1, 5C2, 5D1, and 5D2.

[0075] According to a further aspect of the present invention, R is structure (L a )3-L b -(L c ) c It has, c is 0, (L a )3-L b The following applies: [ka]

[0076] Preferred residues R according to this embodiment of the present invention are shown in Figures 5B1 and 5B2.

[0077] According to a further aspect of the present invention, R is structure (L a )3-L b -(L c ) c (L a )3-L b The following is: [ka] Z is O. In this case, c is preferably 1 and L c The residue R is preferably an alkyl group, more preferably a C3-C6 alkyl group, more preferably a propyl group, and most preferably an n-propyl group. Preferred residues R in this embodiment are shown in Figures 5E1, 5F1, 5G1 and 5H1. Therefore, according to one embodiment of the present invention, R is selected from the group consisting of residues shown in Figures 5E1, 5F1, 5G1 and 5H1.

[0078] According to a further aspect of the present invention, R is structure (L a )3-L b -(L c ) c (L a )3-L b The following is: [ka] Z is NH. In this case, c is preferably 1 and L cis preferably an alkyl group, an amino acid-containing group, or a group having the following structure.

Chemical Formula

[0079] In particular, in this case, L c is as follows.

Chemical Formula

[0080] Preferred residues R according to this aspect of the present invention are shown in Figure 5J1. According to a further aspect of the present invention, R has the structure (L a )3-L b -(L c ) c , wherein (L a )3-L b is as follows,

Chemical Formula

[0081] According to one aspect of the present invention, R is (L a )3-L b -(L c ) c wherein c=0, and (L a )3-L b is as follows.

Chemical Formula

[0082] Preferred residues R according to this aspect of the present invention are shown in Figure 5L1 and Figure 5L2.

[0083] Therefore, R is preferably selected from the residues shown in Figures 5A1, 5A2; 5B1, 5B2, 5C1, 5C2, 5D1, 5D2, 5E1, 5F1, 5G1, 5H1, 5I1, 5J1, 5L1, 5L2 and mixtures thereof, for example, a mixture of stereoisomers of 5A1 and 5A2; 5B1 and 5B2, 5C1 and 5C2 or 5D1 and D2; more preferably, R is selected from the residues shown in 5D1, 5D2 and mixtures thereof; more preferably, R is a mixture of the residues shown in 5D1 and 5D2, having a molar ratio of 5D1 to 5D2 in the range of, for example, 10:90 to 90:10, for example, 30:70 to 70:30, or for example, 45:55 to 55:45.

[0084] Therefore, compound (I) is preferably the compounds shown in Figures 6A1, 6A2, 6B1, 6B2, 6C1, 6C2, 6D1, 6D2, 6E1, 6F1, 6G1, 6H1, 6I1, 6J1, 6L1, 6L2 and mixtures thereof, for example, a mixture of stereoisomers of 6A1 and 6A2; 6B1 and 6B2, 6C1 and 6C2 or 6D1 and 6D2; more preferably, compound (I) is selected from the group consisting of the compounds shown in 6D1 and 6D2 and mixtures thereof; more preferably, compound (I) is a mixture of the compounds shown in 6D1 and 6D2, having a molar ratio of 6D1 to 6D2 in the range of, for example, 10:90 to 90:10, for example, 30:70 to 70:30, for example, 45:55 to 55:45.

[0085] Linker L In the above formula, L is a linker as defined herein, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, for example 2 to 5 nucleosides, for example 2 nucleosides, and optionally the nucleosides are phosphodiester-linked nucleosides.

[0086] Linker L comprises 1 to 10 linked nucleosides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, for example, 2 to 6 linked nucleosides, for example, 2 to 5 linked nucleosides, for example, 2 to 4 linked nucleosides. In some embodiments, the linker comprises two linked nucleotides. Thus, the nucleosides can be DNA nucleosides. Typically, the nucleosides are linked via phosphodiester nucleoside bonds. Furthermore, linker L may be linked to an antisense compound via phosphodiester nucleoside bonds. Furthermore, linker L is linked to conjugate moiety R via appropriate functional groups, for example, via amide, amine, ether, ester, phosphodiester (-OP(=O)(-OH)-O-) or thiophosphodiester (-OP(=S)(-OH)-O-) bonds. It should be understood that L may optionally further contain alkyl groups or alkyl-oxy-alkyl groups between the nucleoside and the functional group linking L to R. In this case, the nucleoside is preferably linked to an alkyl group or alkyl-oxy-alkyl group via a phosphodiester bond, which is then linked to R via appropriate functional groups, such as via amide, amine, ether, ester, phosphodiester (-OP(=O)(-OH)-O-) or thiophosphodiester (-OP(=S)(-OH)-O-) bonds.

[0087] According to a preferred embodiment, L is as follows: [ka]

[0088] Antisense (A) oligonucleotide residues A is connected to R via its 5' end -(L) n -(OP(=O)(-OH)-) pThe antisense oligonucleotide residue according to the present invention, such as the antisense oligonucleotides shown in Table 6, is bound via the . Preferably, A is an antisense oligonucleotide residue selected from the residues shown in Figures 1A, 2A, 3A, and 4.

[0089] Therefore, compound (I) is preferably selected from the compounds shown in Figures 6A1, 6A2; 6B1, 6B2, 6C1, 6C2, 6D1, 6D2, 6E1, 6F1, 6G1, 6H1, 6I1, 6J1, 6L1, 6L2, and mixtures thereof, for example, a mixture of stereoisomers of 6A1 and 6A2; 6B1 and 6B2, 6C1 and 6C2, or 6D1 and 6D2; more preferably, compound (I) is selected from the compounds shown in 6D1 and 6D2 and mixtures thereof; more preferably, compound (I) is a mixture of compounds 6D1 and 6D2; preferably, A is selected from the antisense oligonucleotides shown in Table 6; preferably, A is from Figures 1A, 2A L is an antisense oligonucleotide residue selected from the residues shown in 3A, 4A, 5A, 6A, 7A, and 8A, where L is a linker containing or consisting of 2 to 10 nucleosides, for example 2 to 5 nucleosides, for example 2 nucleosides, and optionally the nucleosides are phosphodiester-linked nucleosides, and more preferably L is as follows. [ka]

[0090] In a further embodiment, R is a residue having structure (I), [ka]

[0091] L is a linker as defined herein, preferably L is a linker comprising or consisting of 2 to 10 nucleosides, for example 2 to 5 nucleosides, for example 2 nucleosides, optionally the nucleosides are phosphodiester-linked nucleosides, and more preferably L is as follows: [ka] and A is an antisense oligonucleotide according to the present invention, for example, the antisense oligonucleotides shown in Table 6.

[0092] According to one aspect of the present invention, A is an antisense oligonucleotide residue selected from the residues shown in Figures 1A, 2A, 3A, and 4A. For example, A is an antisense oligonucleotide in the following equation. [ka]

[0093] The present invention provides a pharmaceutical composition comprising an antisense oligonucleotide or its conjugate, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant.

[0094] The present invention provides pharmaceutically acceptable salts of antisense oligonucleotides or their conjugates. In some embodiments, the pharmaceutically acceptable salts are selected from the group consisting of sodium salts, potassium salts, and ammonium salts.

[0095] The present invention provides a pharmaceutical solution of the antisense oligonucleotide or its conjugate, comprising the antisense oligonucleotide or its conjugate and a pharmaceutically acceptable solvent such as physiological saline.

[0096] The present invention provides antisense oligonucleotides or their conjugates in solid powder form, such as in the form of freeze-dried powder.

[0097] The present invention provides pharmaceutically acceptable salts of the antisense oligonucleotide or its conjugate.

[0098] The present invention provides pharmaceutically acceptable salts of antisense oligonucleotides according to the present invention or conjugates of the present invention, wherein the pharmaceutically acceptable salt is a sodium salt or a potassium salt.

[0099] The present invention provides a pharmaceutical composition comprising an antisense oligonucleotide of the present invention, a conjugate of the present invention, or a salt of the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0100] The present invention provides a method for inhibiting RTEL1 expression in target cells expressing RTEL1, comprising administering an effective amount of the antisense oligonucleotide of the present invention, or the conjugate of the present invention, or the salt of the present invention, or the composition of the present invention to said cells. This method may be an in vivo or in vitro method.

[0101] The present invention provides a method for treating and / or preventing HBV infection in a subject such as a human, comprising administering a therapeutically effective amount or a preventively effective amount of the antisense oligonucleotide, conjugate, salt, or composition of the present invention to treat and / or prevent HBV infection, such as chronic HBV infection.

[0102] In some embodiments, the antisense oligonucleotides of the present invention, or the conjugates of the present invention, or the salts of the present invention, or the pharmaceutical compositions of the present invention are intended for use in the treatment and / or prevention of HBV infection, such as chronic HBV infection.

[0103] The present invention provides an antisense oligonucleotide, a conjugate, a pharmaceutical composition, or a salt for use in pharmaceuticals.

[0104] In a further embodiment, the present invention provides a method for inhibiting RTEL1 expression in target cells expressing RTEL1 by administering an effective amount of the antisense oligonucleotide or conjugate of the present invention to cells. In a further embodiment, the present invention provides a method for an in vivo or in vitro method for inhibiting RTEL1 expression in target cells expressing RTEL1 by administering an effective amount of the antisense oligonucleotide or conjugate of the present invention to cells. The cells may be human cells, for example, liver cells, for example, hepatocytes.

[0105] In a further embodiment, the present invention provides a method for reducing cccDNA in HBV-infected cells by administering an effective amount of the antisense oligonucleotide or conjugate of the present invention to cells. In a further embodiment, the present invention provides a method for an in vivo or in vitro method for reducing cccDNA in HBV-infected cells by administering an effective amount of the antisense oligonucleotide or conjugate of the present invention to cells.

[0106] In a further embodiment, the present invention provides a method for treating and / or preventing HBV infections, such as chronic HBV infection.

[0107] In further embodiments, the antisense oligonucleotides of the present invention, or the conjugates of the present invention, or the pharmaceutical compositions of the present invention are used for the treatment and / or prevention of viral liver infections such as HBV, HCV, HDV, or parasitic infections such as malaria, toxoplasmosis, leishmaniasis, and trypanosomiasis, or liver cancer or metastasis in the liver.

[0108] In a further embodiment, the present invention provides antisense oligonucleotides, conjugates, or pharmaceutical compositions for use in the manufacture of pharmaceuticals for treating and / or preventing HBV infections, such as chronic HBV infections.

[0109] In a further embodiment, the present invention provides an antisense oligonucleotide or conjugate of the present invention, or a pharmaceutical composition of the present invention, for use in the manufacture of an antiviral drug.

[0110] The present invention provides an antisense oligonucleotide, a conjugate, or a pharmaceutical composition for use in the treatment of HBV infection, such as chronic HBV infection. Sequence List

[0111] The sequence listing submitted with this application is incorporated herein by reference. In the event of any discrepancy between the sequence listing and the specification or drawings, the information disclosed in the specification (including the drawings) shall be deemed correct. [Brief explanation of the drawing]

[0112] [Figure 1-1] Compound 3_1 (SEQ ID NO: 3) conjugated to the trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 1-2] Figure 1A: Residue A of compound 3_1 (SEQ ID NO: 3) [Figure 2-1] Compound 4_1 (SEQ ID NO: 4) conjugated to the trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 2-2] Figure 2A: Residue A of compound 4_1 (SEQ ID NO: 4) [Figure 3-1] Compound 6_1 (SEQ ID NO: 6) conjugated to the trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 3-2] Figure 3A: Residue A of compound 6_1 (SEQ ID NO: 6) [Figure 4-1] Compound 5_1 (SEQ ID NO: 5) conjugated to the trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide. [Figure 4-2] Figure 4A: Residue A of compound 5_1 (SEQ ID NO: 5) [Figure 5-1]Figure 5 shows an exemplary GalNAc moiety. The compound in Figure 5L consists of a monomeric GalNAc phosphoramidite added to an oligonucleotide while it was still on a solid support as part of the synthesis, where X is S or O, Y is S or O, and n=1 to 3 (see International Publication No. 2017 / 178656). Figures 5B and 5D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 5-2] Figure 5 shows an exemplary GalNAc moiety. The compound in Figure 5L consists of a monomeric GalNAc phosphoramidite added to an oligonucleotide while it was still on a solid support as part of the synthesis, where X is S or O, Y is S or O, and n=1 to 3 (see International Publication No. 2017 / 178656). Figures 5B and 5D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 5-3] Figure 5 shows an exemplary GalNAc moiety. The compound in Figure 5L consists of a monomeric GalNAc phosphoramidite added to an oligonucleotide while it was still on a solid support as part of the synthesis, where X is S or O, Y is S or O, and n=1 to 3 (see International Publication No. 2017 / 178656). Figures 5B and 5D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 5-4] Figure 5 shows an exemplary GalNAc moiety. The compound in Figure 5L consists of a monomeric GalNAc phosphoramidite added to an oligonucleotide while it was still on a solid support as part of the synthesis, where X is S or O, Y is S or O, and n=1 to 3 (see International Publication No. 2017 / 178656). Figures 5B and 5D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 5-5]Figure 5 shows exemplary GalNAc moieties. The compound of Figure 5L consists of a monomeric GalNAc phosphoramidite added to the oligonucleotide while still on the solid support as part of the synthesis, wherein X is S or O, Y is S or O, and n=1 to 3 (see WO 2017 / 178656). Figure 5B and Figure 5D, also referred to herein as GalNAc2 or GN2, are those without and with a C6 linker, respectively. [Figure 5-6] Figure 5 shows exemplary GalNAc moieties. The compound of Figure 5L consists of a monomeric GalNAc phosphoramidite added to the oligonucleotide while still on the solid support as part of the synthesis, wherein X is S or O, Y is S or O, and n=1 to 3 (see WO 2017 / 178656). Figure 5B and Figure 5D, also referred to herein as GalNAc2 or GN2, are those without and with a C6 linker, respectively. [Figure 5-7] Figure 5 shows exemplary GalNAc moieties. The compound of Figure 5L consists of a monomeric GalNAc phosphoramidite added to the oligonucleotide while still on the solid support as part of the synthesis, wherein X is S or O, Y is S or O, and n=1 to 3 (see WO 2017 / 178656). Figure 5B and Figure 5D, also referred to herein as GalNAc2 or GN2, are those without and with a C6 linker, respectively. [Figure 5-8] Figure 5 shows exemplary GalNAc moieties. The compound of Figure 5L consists of a monomeric GalNAc phosphoramidite added to the oligonucleotide while still on the solid support as part of the synthesis, wherein X is S or O, Y is S or O, and n=1 to 3 (see WO 2017 / 178656). Figure 5B and Figure 5D, also referred to herein as GalNAc2 or GN2, are those without and with a C6 linker, respectively. [Figure 6-1]Figures 6A to 6L: show exemplary antisense oligonucleotide conjugates, wherein the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A to 6D comprise a dilysine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. For the compounds of Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialoglycoprotein receptor-targeting conjugate moiety without an alkyl linker. For the compounds of Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialoglycoprotein receptor-targeting conjugate moiety via a C6 linker. The compounds of Figures 6E to 6J comprise commercially available trebler brancher molecules and spacers of various lengths and structures, and three terminal GalNAc carbohydrate moieties. The compounds of Figures 6L1 and 6L2 are constructed from monomeric GalNAc phosphoramidite added to the oligonucleotide while it is still on a solid support as part of the synthesis, wherein X = S or O, Y is independently S or O, and n = 1 to 3 (see International Publication No. WO 2017 / 178656). [Figure 6-2]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 6-3]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 6-4]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 6-5]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 6-6]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 6-7]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 6-8]Figures 6A–6L show exemplary antisense oligonucleotide conjugates where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A–D contain a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figure 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and Figure 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without an alkyl linker. In the compounds in Figure 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and Figure 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. The compounds in Figures 6E–J include commercially available trebler launcher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compounds in Figures 6L1 and 6L2 consist of monomeric GalNAc phosphoramidites added to oligonucleotides while they remain on a solid support as part of the synthesis, where X=S or O, Y=S or O independently, and n=1–3 (see International Publication 2017 / 178656). [Figure 7] The concentration-dependent efficacy and effectiveness of oligonucleotides CMP ID numbers 3_1, 4_1, 5_1, and 6_1 will be tested in vitro in the human cell line MDA-MB-231. [Figure 8] The concentration-dependent efficacy and effectiveness of oligonucleotides (CMP ID numbers 3_1, 4_1, 5_1, and 6_1) and prior art compounds (CMP ID numbers 7_1 to 23_1) will be tested in vitro to determine their efficacy in the human cell line MDA-MB-231. [Figure 9-1]The concentration-dependent potency and efficacy of oligonucleotide antisense molecules and their shorter metabolites will be tested in vitro in the human cell line MDA-MB-231. A) CMP ID 5_1, B) CMP ID 7_1, C) CMP ID 8_1, D) CMP ID 9_1, E) CMP ID 10_1. [Figure 9-2] The concentration-dependent potency and efficacy of oligonucleotide antisense molecules and their shorter metabolites will be tested in vitro in the human cell line MDA-MB-231. A) CMP ID 5_1, B) CMP ID 7_1, C) CMP ID 8_1, D) CMP ID 9_1, E) CMP ID 10_1. [Figure 9-3] The concentration-dependent potency and efficacy of oligonucleotide antisense molecules and their shorter metabolites will be tested in vitro in the human cell line MDA-MB-231. A) CMP ID 5_1, B) CMP ID 7_1, C) CMP ID 8_1, D) CMP ID 9_1, E) CMP ID 10_1. [Figure 10] Research protocol for in vivo analysis in mice treated with GalNAc-conjugate CMP ID 5_1 [Figure 11] Levels of RTEL1 mRNA in liver tissue of PXB mice treated with GalNAc-conjugate oligonucleotide antisense CMP ID numbers 3_1 and 5_1 [Figure 12] Research protocol for in vivo analysis of HBV-infected PXB mice treated with GalNAc-conjugate CMP ID 5_1. [Figure 13] RTEL1 mRNA levels and HBV cccDNA levels in liver tissue of HBV-infected PXB mice treated with GalNAc-conjugated CMP ID 5_1 and control: A) Day 105, B) Day 56. [Modes for carrying out the invention]

[0113] definition HBV infection The term "hepatitis B virus infection" or "HBV infection" is commonly known in the technical field and refers to an infectious disease caused by the hepatitis B virus (HBV) that affects the liver. HBV infection can be acute or chronic. Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million people worldwide. Approximately 686,000 deaths per year are attributable to HBV-related end-stage liver disease and hepatocellular carcinoma (HCC) (GBD 2013; Schweitzer et al., 2015). The WHO predicted that without further intervention, the number of CHB infections would remain at current high levels for the next 40-50 years, with a cumulative 20 million deaths between 2015 and 2030 (WHO, 2016). CHB infection is not a homogeneous disease that presents with specific clinical symptoms. Infected individuals progress through several stages of CHB-related liver disease throughout their lives. These disease stages also form the basis for treatment with standard of care (SOC). Current guidelines recommend treating only specific individuals infected with CHB based on three criteria: serum ALT levels, HBV DNA levels, and severity of liver disease (EASL, 2017). This recommendation stems from the fact that SOC, namely nucleoside analogs (NA) and pegylated interferon-alpha (PEG-IFN), are not curative and must be administered for extended periods, thereby increasing safety risks. NA effectively suppresses HBV DNA replication. However, it has very limited or no effect on other viral markers. Two characteristics of HBV infection, hepatitis B surface antigen (HBsAg) and covalent closed circular DNA (cccDNA), are the main targets of new drugs aimed at curing HBV. In the plasma of CHB patients, HBsAg subvirus (hollow) particles number 10¹⁶ HBV virions. 3 ~10 5The ratio is more than double (Ganem & Prince, 2014). This excess is thought to contribute to the immunopathogenesis of the disease, including individuals who cannot express neutralizing anti-HBs antibodies, a serological marker observed after the resolution of acute HBV infection.

[0114] cccDNA (covalently closed circular DNA) cccDNA is the genetic template of the virus present in the nucleus of infected hepatocytes, producing all the HBV RNA transcripts necessary for proliferative infection and contributing to viral persistence during the natural course of chronic HBV infection (Locarnini & Zoulim, 2010 Antivir Ther. 15 Suppl 3:3-14. doi:10.3851 / IMP1619). cccDNA acts as a viral reservoir and is a source of viral rebound after treatment discontinuation, requiring long-term, sometimes lifelong, treatment. Due to its various side effects, PEG-IFN can only be administered to a small subset of CHB patients.

[0115] Therefore, there is a strong need for novel therapies that can bring about a complete cure, defined by the degradation or removal of HBV cccDNA, in the majority of CHB patients.

[0116] compound In this specification, the term “compound” means any molecule that can inhibit the expression or activity of RTEL1. Certain compounds of the present invention are antisense oligonucleotides according to the present invention, or any conjugate comprising such nucleic acid molecules. For example, in this specification, a compound may be a nucleic acid molecule that targets RTEL1, in particular an antisense oligonucleotide.

[0117] oligonucleotides As used herein, the term "oligonucleotide" is defined as generally understood by those skilled in the art to mean a molecule comprising two or more covalently linked nucleosides. Such covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid-phase chemical synthesis, followed by purification and isolation. When reference is made to the sequence of an oligonucleotide, the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides, or modifications thereof, are referred to. The oligonucleotides of the present invention are artificial and chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may comprise one or more modified nucleosides, such as 2'-sugar modified nucleosides. The oligonucleotides of the present invention may comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0118] Antisense oligonucleotide As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of modulating the expression of a target gene by hybridizing to a target nucleic acid, particularly a contiguous sequence on the target nucleic acid. Antisense oligonucleotides are not inherently double-stranded and are therefore neither siRNA nor shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It is understood that the single-stranded oligonucleotides of the present invention may form hairpins or intermolecular double-stranded structures (double strands between two molecules of the same oligonucleotide) as long as the degree of internal or mutual self-complementarity over the entire length of the oligonucleotide is less than 50%.

[0119] In some embodiments, the single-stranded antisense oligonucleotides of the present invention may be free of RNA nucleosides.

[0120] Advantageously, the oligonucleotide of the present invention comprises one or more modified nucleosides or nucleotides, such as 2'-sugar modified nucleosides. Furthermore, it is advantageous that the unmodified nucleoside is a DNA nucleoside.

[0121] Sequential nucleotide sequence The term “continuous nucleotide sequence” refers to a region of oligonucleotide complementary to the target nucleic acid. This term is used herein interchangeably with the terms “continuous nucleic acid base sequence” and “oligonucleotide motif sequence.” In some embodiments, all nucleotides of the nucleoside constitute a continuous nucleotide sequence. In some embodiments, the oligonucleotide includes a continuous nucleotide sequence, such as an FG-F' gapmer region, and optionally includes a nucleotide linker region that can be used to attach further nucleotides, such as functional groups (e.g., conjugate groups), to the continuous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleic acid base sequence of the antisense oligonucleotide constitutes a continuous nucleotide sequence.

[0122] Nucleotides and nucleosides Nucleotides and nucleosides are the constituent units of oligonucleotides and polynucleotides, and for the purposes of this invention, include both naturally occurring nucleotides and nucleosides and those not naturally occurring. Nucleotides, such as DNA nucleotides and RNA nucleotides, naturally consist of a ribose sugar moiety, a nucleic acid base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides may also be interchangeably referred to as "units" or "monomers."

[0123] Modified nucleoside As used herein, the terms “modified nucleoside” or “nucleoside modification” refer to a nucleoside modified compared to an equivalent DNA or RNA nucleoside by the introduction of one or more modifications to the sugar moiety or (nucleic acid) base moiety. Advantageously, a modified nucleoside of one or more antisense oligonucleotides of the present invention includes a modified sugar moiety. The term “modified nucleoside” may also be used interchangeably with the terms “nucleoside analog” or modified “unit” or modified “monomer.” A nucleoside having an unmodified DNA or RNA sugar moiety is referred to herein as a DNA or RNA nucleoside. A nucleoside having modifications to the base region of a DNA or RNA nucleoside is still generally referred to as DNA or RNA if they are Watson-Crick base-pairable.

[0124] Inter-modified nucleoside bonding The term "modified nucleoside bond" is defined as is generally understood by those skilled in the art to be a bond other than a phosphodiester (PO) bond that covalently bonds two nucleosides to each other. Accordingly, the oligonucleotides of the present invention may contain one or more modified nucleoside bonds, such as one or more phosphorothioate nucleoside bonds or one or more phosphorodithioate nucleoside bonds. In some embodiments, at least 50% of the internucleoside bonds of the oligonucleotide or its sequence of nucleotides are phosphorothioates, and at least 60%, for example, at least 70%, for example, at least 75%, for example, at least 80%, or for example, at least 90%, of the oligonucleotide or its sequence of nucleotides are phosphorothioates. In some embodiments, all of the internucleoside bonds of the oligonucleotide or its sequence of nucleotides are phosphorothioates.

[0125] In some advantageous embodiments, all nucleoside-to-nucleoside bonds in the continuous nucleotide sequence of the oligonucleotide are phosphorothioates, or all nucleoside-to-nucleoside bonds of the oligonucleotide are phosphorothioate bonds.

[0126] As disclosed in European Patent No. 2742135, it is recognized that antisense oligonucleotides may include other nucleoside bonds (other than phosphodiesters, phosphorothioates, and phosphorodithioates), such as alkylphosphonate / methylphosphonate nucleoside bonds, which, according to European Patent No. 2742135, may be resistant, for example, within the gap region of another DNA phosphorothioate.

[0127] Nucleic acid bases The term "nucleic acid base" includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of this invention, the term "nucleic acid base" may differ from naturally occurring nucleic acid bases, but also includes modified nucleic acid bases that are functional in nucleic acid hybridization. In this context, "nucleic acid base" refers to both naturally occurring nucleic acid bases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, and variants that do not exist naturally. Such variants are described, for example, in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0128] In some embodiments, the nucleic acid base moiety is modified by replacing the purine or pyrimidine with a nucleobased base selected from modified purines or pyrimidines, such as substituted purines or pyrimidines, such as isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolocytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazolouracil, 2-thiouracil, 2'thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0129] The nucleic acid base portion may be represented by a letter code for each corresponding nucleic acid base, for example, A, T, G, C, or U, where each letter may optionally contain a modified nucleic acid base with equivalent function. For example, in the illustrated oligonucleotide, the nucleic acid base portion is selected from A, T, G, C, and 5-methylcytosine. Optionally, in the LNA gapmer, a 5-methylcytosine LNA nucleoside may be used.

[0130] Modified oligonucleotides The term "modified oligonucleotide" refers to an oligonucleotide containing one or more sugar-modified nucleosides and / or modified nucleoside bonds. The term "chimeric oligonucleotide" is a term used in the literature to describe oligonucleotides containing sugar-modified nucleosides and DNA nucleosides. The antisense oligonucleotides of the present invention are advantageously chimeric oligonucleotides.

[0131] Complementarity The term "complementarity" describes the ability of nucleosides / nucleotides to form Watson-Crick base pairs. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may also contain nucleosides with modified nucleic acid bases; for example, 5-methylcytosine is often used in place of cytosine, and therefore the term complementarity will be understood to encompass Watson-Crick base pair formation between unmodified and modified nucleic acid bases (see, e.g., Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0132] As used herein, the term “% complementary” refers to the percentage of nucleotides in a sequence of nucleic acid molecules (e.g., oligonucleotides) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the sequence. Therefore, the percentage of complementarity is calculated by counting the number of complementary (from Watson-Crick base pairs) nucleic acid bases between two sequences (when the oligonucleotide sequence is aligned from the target sequence 5'-3' and 3'-5'), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleic acid bases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not permitted in the calculation of the % complementarity of a sequence of nucleotides. It will be understood that, in determining complementarity, chemical modifications of nucleic acid bases are ignored as long as the nucleic acid base retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating % identity).

[0133] The term "perfectly complementary" refers to 100% complementarity.

[0134] Identity As used herein, the term "identity" refers to the percentage (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif) over the contiguous nucleotide sequence. Accordingly, the percentage of identity is calculated by counting the number of identical (matched) aligned nucleobases between two sequences (the contiguous nucleotide sequence of the compound of the invention and the reference sequence), dividing the number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, percentage of identity = (number of matches × 100) / length of the aligned region (e.g., a contiguous nucleotide sequence). Insertions and deletions are not permitted in the calculation of percentage identity of a contiguous nucleotide sequence. It will be understood that in the determination of identity, chemical modifications of nucleobases are ignored so long as the functional ability of the nucleobase to form Watson-Crick base pairs is retained (e.g., 5-methylcytosine is considered identical to cytosine for the purpose of calculating % identity).

[0135] Hybridization As used herein, the terms "hybridize" or "hybridizing" should be understood to mean that two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) form a duplex by forming hydrogen bonds between base pairs on opposite strands. The binding affinity between two nucleic acid strands is the strength of hybridization. This is often described by the melting temperature (T m m), which is defined as the temperature at which half of the oligonucleotides form duplexes with the target nucleic acid. Under physiological conditions, T m m is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The Gibbs free energy ΔG° at standard state more accurately represents binding affinity, and the dissociation constant of the reaction (K d d) is given by ΔG° = -RT ln(K d) is associated with this. Therefore, a very low ΔG° for the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous solution concentration of 1 M, pH 7, and temperature of 37°C. Hybridization of oligonucleotides with target nucleic acids is a spontaneous reaction, and in the case of a spontaneous reaction, ΔG° is less than zero. ΔG° can be measured experimentally by isothermal titration calorimetry (ITC), for example, as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. Those skilled in the art will know that commercially available instruments are available for ΔG° measurement. ΔG° can also be numerically estimated by using the nearest neighbor model described by Santa Lucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To ensure the possibility of modulating its intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize to target nucleic acids with estimated ΔG° values ​​of less than -10 kcal for oligonucleotides of 10-30 nucleotide lengths. In some embodiments, the degree or intensity of hybridization is measured by the Gibbs free energy ΔG° at standard conditions. Oligonucleotides can hybridize to target nucleic acids with estimated ΔG° values ​​less than -10 kcal for oligonucleotides of 8 to 30 nucleotides in length, e.g., less than -15 kcal, e.g., less than -20 kcal, and e.g., less than -25 kcal. In some embodiments, oligonucleotides hybridize to target nucleic acids with estimated ΔG° values ​​of -10 to -60 kcal, e.g., -12 to -40, e.g., -15 to -30 kcal, or -16 to -27 kcal, e.g., -18 to -25 kcal.

[0136] target As used herein, the term “target” refers to the mammalian protein RTEL1 (“Telomere Elongation Helicase 1 Regulator”), also known as “KIAA1088” or “C20ORF41” or “Telomere Length Regulator” or “Telomere Length Regulator” or “Chromosome 20 Open Reading Frame 41”. The Homo sapiens RTEL1 gene is located in the complements 63, 657, 810-63, 696, and 253 of chromosome 20 (Homo sapiens Renewal Annotation, Release 109.20200228, GRCh38.p13). The RTEL1 protein is an ATP-dependent DNA helicase involved in telomere length regulation, DNA repair, and maintaining genomic stability. The amino acid sequence of human RTEL1 is publicly known in the art and can be evaluated by UniProt; see UniProt entry Q9NZ71 for human RTEL1 (incorporated herein by reference).

[0137] target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid that encodes mammalian RTEL1, and may be, for example, a gene, RNA, mRNA, and premRNA, mature mRNA, or cDNA sequence. Therefore, the target may be called an RTEL1 target nucleic acid.

[0138] The antisense oligonucleotides of the present invention may, for example, target the target exon region of mammalian RTEL1, or, for example, target the intron region of RTEL1 premRNA. The human RTEL1 gene encodes 15 of these seven protein-coding transcripts and is therefore a potential nucleic acid target. Table 3 lists the predicted exon and intron regions of the seven transcripts located on the human RTEL1 premRNA of Sequence ID No. 1. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0139] Preferably, the target nucleic acid encodes the RTEL1 protein, particularly mammalian RTEL1, such as human RTEL1 (see, for example, Tables 3 and 4). This provides premRNA sequences for human and monkey RTEL1.

[0140] In some embodiments, the target nucleic acid is selected from sequence numbers 1 and / or 2, or their naturally occurring variants (e.g., sequences encoding the mammalian RTEL1 protein).

[0141] When using the antisense oligonucleotide or conjugate of the present invention for research or diagnostic purposes, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0142] For in vivo or in vitro applications, the antisense oligonucleotides of the present invention can typically inhibit the expression of RTEL1 target nucleic acid in cells expressing the RTEL1 target nucleic acid. The sequence of nucleic acid bases of the antisense oligonucleotides of the present invention is typically complementary to the RTEL1 target nucleic acid, measured over the length of the antisense oligonucleotide, except for optionally one or two mismatches and optionally a nucleotide-based linker region that can link the antisense oligonucleotide to any functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g., region D' or D”). In some embodiments, the target nucleic acid may be RNA or DNA, such as a pre-mRNA such as human RTEL1, a human RTEL1 pre-mRNA sequence such as disclosed as SEQ ID NO: 1, or a messenger RNA such as a cynomolgus monkey RTEL1 pre-mRNA sequence such as disclosed as SEQ ID NO: 2. SEQ ID NOs: 1 and 2 are DNA sequences. It will be understood that the target RNA sequence has uracil (U) bases instead of thymidine bases (T).

[0143] Further information regarding exemplary target nucleic acids is provided in Tables 4 and 5. [Table 4] Fwd = Forward strand. Genomic coordinates provide the pre-mRNA sequence (genome sequence). NCBI references provide the mRNA sequence (cDNA sequence). [Table 5] Note: Sequence ID 2 contains multiple NNNN regions where sequencing could not accurately purify the sequence and therefore includes a degenerate sequence. To avoid any doubt, the compounds of the present invention are complementary to the actual target sequence and are therefore not degenerate compounds.

[0144] In some embodiments, the target nucleic acid is SEQ ID NO: 1.

[0145] In some embodiments, the target nucleic acid is SEQ ID NO: 2.

[0146] In some embodiments, the target nucleic acids are SEQ ID NOs: 1 and 2.

[0147] target sequence As used herein, the term “target sequence” refers to a sequence of nucleotides present in a target nucleic acid, comprising a nucleic acid base sequence complementary to the oligonucleotide of the present invention. In some embodiments, the target sequence consists of a region on the target nucleic acid having a nucleic acid base sequence complementary to the continuous nucleotide sequence of the oligonucleotide of the present invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, target sequence, or target region. In some embodiments, the target sequence may be longer than the complementary sequence of a single oligonucleotide and may represent, for example, a preferred region of the target nucleic acid that can be targeted by several oligonucleotides of the present invention.

[0148] The oligonucleotides of the present invention include a sequence of nucleotides that is complementary to and hybridizes with a target nucleic acid, such as a target sequence described herein.

[0149] Target sequences to which oligonucleotides are complementary generally contain a sequence of at least 10 consecutive nucleic acid bases. The sequence of consecutive nucleotides is 10 to 30 nucleotides long, e.g., 12 to 30, e.g., 14 to 20, e.g., 15 to 18 consecutive nucleotides long, e.g., 15, 16, 17 consecutive nucleotides long.

[0150] Target sequence region The inventors have identified particularly effective sequences of RTEL1 target nucleic acids that can be targeted by the oligonucleotides or conjugates of the present invention.

[0151] In some embodiments, the target sequence is sequence number 7.

[0152] In some embodiments, the target sequence is sequence number 8.

[0153] In some embodiments, the target sequence is sequence number 9.

[0154] In some embodiments, the target sequence is sequence number 10.

[0155] In some embodiments, the target sequence is sequence number 11.

[0156] Sequence ID 7: TTTGACCAGAGTATGTAAAATT Sequence ID 8: ACCAGAGTATGTAAAATT Sequence ID 9: GACCAGAGTATGTAAAATT Sequence ID 10: TTTGACCAGAGTATGTAA Sequence ID 11: GAGATTCAAGTTATAATAAAG Sequence IDs 7-11 are DNA sequences. It should be understood that the target RNA sequence has uracil (U) bases instead of thymidine (T) bases.

[0157] The target sequences shown in SEQ ID NOs: 7-10 can be found in intron 8 of human RTEL1. The target sequence shown in SEQ ID NO: 11 can be found in intron 7 of human RTEL1.

[0158] In some embodiments, the target sequence is the region of nucleotides 11753-11774 of SEQ ID NO: 1.

[0159] In some embodiments, the target sequence is the region of nucleotides 11757-11774 of SEQ ID NO: 1.

[0160] In some embodiments, the target sequence is the region of nucleotides 11756-11774 of SEQ ID NO: 1.

[0161] In some embodiments, the target sequence is the region of nucleotides 11753-11770 of SEQ ID NO: 1.

[0162] In some embodiments, the target sequence is the region of nucleotides 8681-8701 of SEQ ID NO: 1.

[0163] target cell As used herein, the term “target cell” refers to a cell expressing the target nucleic acid. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell may be a mammalian cell, e.g., a rodent cell, e.g., a mouse cell or a rat cell, or a primate cell, e.g., a monkey cell or a human cell.

[0164] Typically, target cells express RTEL1 mRNA, such as RTEL1 premRNA or RTEL1 mature mRNA. For experimental evaluation, target cells expressing nucleic acids containing the target sequence, such as human RTEL1 premRNA, e.g., SEQ ID NO: 1, may be used.

[0165] The poly(A) tail of RTEL1 mRNA is typically ignored in antisense oligonucleotide targeting.

[0166] The antisense oligonucleotides of the present invention can typically inhibit the expression of RTEL1 target nucleic acids in cells expressing RTEL1 target nucleic acids (target cells), for example, either in vivo or in vitro.

[0167] Furthermore, the target cells may be hepatocytes. In one embodiment, the target cells are primary human hepatocytes infected with HBV, and are either derived from an HBV-infected individual or from an HBV-infected mouse (PhoenixBio, PXB mouse) that has a humanized liver.

[0168] According to the present invention, target cells may be infected with HBV. Furthermore, target cells may contain HBV cccDNA. Therefore, it is preferable that target cells contain RTEL1 mRNA, such as RTEL1 premRNA or RTEL1 mature mRNA, and HBV cccDNA.

[0169] Naturally occurring variants The term "naturally occurring variant" refers to variants of the RTEL1 gene or transcript, and allele variants, that originate from the same locus as the target nucleic acid but may differ due to, for example, degeneracy of the genetic code resulting in multiple codons encoding the same amino acid, or due to alternative splicing of premRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs). Based on the presence of sufficiently complementary sequences for the oligonucleotide, the oligonucleotides of the present invention can therefore target the target nucleic acid and its naturally occurring variants.

[0170] In some embodiments, naturally occurring variants have at least 95%, for example, at least 98%, or at least 99% homology to mammalian RTEL1 target nucleic acids, such as the target nucleic acid of SEQ ID NO: 1. In some embodiments, naturally occurring variants have at least 99% homology to the human RTEL1 target nucleic acid of SEQ ID NO: 1.

[0171] Inhibition of expression As used herein, the term “inhibition of expression” should be understood as the overall ability of an oligonucleotide to inhibit the amount or activity of RTEL1 in target cells. Inhibition of activity may be determined by measuring the levels of RTEL1 premRNA or RTEL1 mRNA, or by measuring the levels of RTEL1 or RTEL1 activity in cells. Therefore, inhibition of expression may be determined in vitro or in vivo.

[0172] Typically, inhibition of expression is determined by comparing the inhibition of activity by administering an effective amount of antisense oligonucleotide to target cells and comparing the level to a reference level (control experiment) obtained from target cells without administration of the antisense oligonucleotide, or a known reference level (e.g., the expression level before administration of an effective amount of antisense oligonucleotide, or a predetermined or other known expression level).

[0173] For example, the control experiment may involve animals or humans treated with a saline composition or a reference oligonucleotide (often a scrambled control), or target cells.

[0174] The terms "inhibition" or "to inhibit" can also be used to describe downregulating, reducing, suppressing, decreasing, or lowering the expression of RTEL1, for example, RTEL1 premRNA.

[0175] Inhibition of expression can occur, for example, by degradation of premRNA or mRNA (e.g., using RNase H mobilizing oligonucleotides, e.g., gapmers).

[0176] High affinity modified nucleoside High affinity modified nucleosides are modified nucleotides that, when incorporated into oligonucleotides, enhance the affinity of the oligonucleotide to its complementary target, for example, by its melting temperature (Tm). The high affinity modified nucleosides of the present invention preferably result in an increase in melting temperature of +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNAs) (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0177] sugar modification The oligomer of the present invention may contain one or more nucleosides in which the sugar moiety has been modified, i.e., compared to the ribose sugar moiety found in DNA and RNA. Numerous nucleosides with modifications to the ribose sugar moiety exhibit affinity and / or nuclear

[0178] These were primarily developed with the aim of improving certain properties of oligonucleotides, such as resistance to ze.

[0179] Such modifications include those in which the ribose ring structure is modified by replacing it with, for example, a hexose ring (HNA), or a bicyclic ring (LNA) typically having a biradical bridge between the C2 and C4 carbons on the ribose ring, or an unbonded ribose ring typically lacking a bond between the C2 and C3 carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (International Publication No. 2011 / 017521) or tricyclic nucleic acids (International Publication No. 2013 / 154798). Modified nucleosides also include those in which the sugar moiety is replaced with a non-sugar moiety, for example, a peptide nucleic acid (PNA) or a morpholino nucleic acid.

[0180] Sugar modifications also include modifications made by changing substituents on the ribose ring to groups other than hydrogen, or to 2'-OH groups that are naturally present in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions.

[0181] 2' sugar-modified nucleoside 2'-sugar-modified nucleosides are nucleosides that have substituents other than H or -OH at the 2' position (2'-substituted nucleosides), or nucleosides that contain a 2'-bonded biradical capable of forming a bridge between the 2' carbon and the second carbon on the ribose ring, such as LNA (2'-4' biradical bridged) nucleosides.

[0182] In fact, the development of 2'-sugar-substituted nucleosides has attracted considerable attention, and numerous 2'-substituted nucleosides have been found to possess beneficial properties when incorporated into oligonucleotides. For example, 2'-modified nucleosides can provide oligonucleotides with improved binding affinity and / or increased nuclease resistance. Examples of 2'-substituted nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey & Damha, Chemistry and Biology 2012, 19, 937. The following are some examples of 2' substitution-modified nucleosides. [ka]

[0183] In relation to the present invention, the 2'-substituted sugar-modified nucleoside does not contain a 2'-crosslinked nucleoside such as LNA.

[0184] Locked nucleic acid nucleosides (LNA nucleosides) An "LNA nucleoside" is a 2'-modified nucleoside containing a biradical (also called a "2'-4' bridge") that links the C2' and C4' of the ribose sugar ring of the nucleoside, thereby restricting or fixing the conformation of the ribose ring. These nucleosides are also referred to in the literature as cross-linked nucleic acids or bicyclic nucleic acids (BNAs). The fixation of the ribose conformation is related to improved hybridization affinity (double-strand stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary double-strand.

[0185] Non-restrictive and exemplary LNA nucleosides are described in International Publications 99 / 014226, 00 / 66604, 98 / 039352, 2004 / 046160, 00 / 047599, 2007 / 134181, 2010 / 077578, 2010 / 036698, 2007 / 090071, 2009 / 006478, 2011 / 156202, 2008 / 154401, 2009 / 067647, 2008 / 150729, Morita et al. See also al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0186] Further non-limiting, exemplary LNA nucleosides are disclosed in Scheme 1. [ka]

[0187] Certain LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxy-LNA, e.g., (S)-6'-methyl-beta-D-oxy-LNA(ScET) and ENA. A particularly favorable LNA is beta-D-oxy-LNA.

[0188] Nuclease-mediated degradation Nuclease-mediated degradation refers to oligonucleotides that can mediate the degradation of complementary nucleotide sequences when they form a double helix with such sequences.

[0189] In some embodiments, oligonucleotides can function via nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the present invention can recruit nucleases, particularly endonucleases, preferably endoribonucleases (RNases) such as RNase H. An example of an oligonucleotide design that acts via a nuclease-mediated mechanism is an oligonucleotide that typically comprises at least five or six consecutive DNA nucleoside regions, flanked on one or both sides by affinity-enhancing nucleosides, such as gapmers.

[0190] Activation and recruitment of RNase H The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a double helix with a complementary RNA molecule. International Publication 01 / 23613 provides an in vitro method for determining RNase H activity that can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered capable of recruiting RNase H if it has an initial rate measured at at least 5% of the initial rate determined using the methodology provided in Examples 91-95 of International Publication 01 / 23613 (incorporated herein by reference), e.g., at least 10% or more than 20% of the initial rate measured at pmol / l / min. For use in determining RNase H activity, recombinant human RNase H1 is available from Creative Biomart® (recombinant human RNase H1 fused with a His tag expressed in E. coli).

[0191] Gapmar The antisense oligonucleotide or its sequence of nucleotides according to the present invention may be a gapmer, and may also be referred to as a gapmer oligonucleotide or gapmer design. Antisense gapmers are typically used to inhibit target nucleic acids via RNase H-mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions, a 5'-flank, a gap, and a 3'-flank, FG-F' in the 5'→3' direction. The "gap" region (G) contains a sequence of consecutive DNA nucleotides that enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5'-adjacent region (F) containing one or more glycosylated nucleosides, preferably high-affinity glycosylated nucleosides, and a 3'-adjacent region (F') containing one or more glycosylated nucleosides, preferably high-affinity glycosylated nucleosides. One or more glycosylated nucleosides in regions F and F' enhance the affinity of the oligonucleotide to the target nucleic acid (i.e., they are affinity-enhancing glycosylated nucleosides). In some embodiments, one or more glycosylated nucleosides in regions F and F' are 2'-glycosylated nucleosides, such as high-affinity 2'-glycosylated nucleosides, which are independently selected from, for example, LNA and 2'-MOE.

[0192] In gapmer designs, the outermost 5' and 3' nucleosides in the gap region are DNA nucleosides, located adjacent to the sugar-modified nucleosides in the 5'(F) or 3'(F') region, respectively. A flank can be further defined by having at least one sugar-modified nucleoside at the furthest end from the gap region, i.e., the 5' end of the 5' flank and the 3' end of the 3' flank. In some embodiments, all internucleoside bonds between nucleosides in the gapmer region of formula FG-F' are phosphorothioate internucleoside bonds.

[0193] Region FG-F' forms a continuous nucleotide sequence. The antisense oligonucleotide of the present invention, or its continuous nucleotide sequence, may include the gapmer region of formula FG-F'.

[0194] The total length of the gapmer design FG-F' can be, for example, 12-32 nucleosides, 13-24, 14-22 nucleosides, 15-20, or 16-18 nucleosides.

[0195] For example, the gapmer oligonucleotide of the present invention can be represented by the following formula: F 1-8 -G 5-16 -F' 1-8 ,for example F 1-8 -G 7-16 -F' 2-8 , or F 1-8 -G 11-16 -F' 2-8 , However, the total length of the gapmer region FG-F' is at least 12, for example, at least 14 nucleotides long.

[0196] In one aspect of the present invention, an antisense oligonucleotide or a sequence of nucleotides thereof consists of or comprises a gapmer of formula 5'-FG-F'-3' (wherein regions F and F' independently contain or consist of 1 to 8 nucleosides, of which 1 to 4 are 2'-sugar modified to define the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H).

[0197] Regions F, G, and F' are further defined below and can be incorporated into the FG-F' formula.

[0198] Gapmar-region G The gapmer region G (gap region) is a region of nucleosides, typically DNA nucleosides, that allows the oligonucleotide to recruit RNase H, such as human RNase H1. RNase H is a cellular enzyme that recognizes the double helix between DNA and RNA and enzymatically cleaves RNA molecules. Preferably, the gapmer may have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides, e.g., 5-16 consecutive DNA nucleosides, e.g., 6-15 consecutive DNA nucleosides, e.g., 7-14 consecutive DNA nucleosides, e.g., 8-12 consecutive DNA nucleotides, e.g., 8-12 consecutive DNA nucleotides. In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive DNA nucleosides. Furthermore, region G may have a length of 11-16 consecutive DNA nucleotides.

[0199] One or more cytosine (C)DNAs within a gap region may be methylated in some cases (e.g., DNA c followed by DNA g), and such residues may be 5-methylcytosine ( me C) is annotated. In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-binding DNA nucleosides.

[0200] In some embodiments, all nucleoside-to-nucleoside bonds within the gap are phosphorothioate bonds.

[0201] Gapmer-adjacent regions, F and F' Region F' is located immediately adjacent to the 5' DNA nucleoside of region G. The furthest 3' nucleoside in region F is a glycosylated nucleoside, such as a high-affinity glycosylated nucleoside, such as a 2'-substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0202] Region F' is located immediately adjacent to the 3' DNA nucleoside of region G. The furthest 5' nucleoside in region F is a glycosylated nucleoside, such as a high-affinity glycosylated nucleoside, such as a 2'-substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0203] Region F has a length of 1 to 8 consecutive nucleotides, for example, 2 to 6, or for example, 2 to 4 consecutive nucleotides. In some embodiments, the length of region F is 2 consecutive nucleotides. In some embodiments, the length of region F' is 3 consecutive nucleotides. In some embodiments, the length of region F is 4 consecutive nucleotides.

[0204] Advantageously, the outermost 5' nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two outermost 5' nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the outermost 5' nucleosides of region F' are LNA nucleosides. In some embodiments, the two outermost 5' nucleosides of region F' are LNA nucleosides.

[0205] Region F' is a length of 1 to 8 consecutive nucleotides, for example, 2 to 6 consecutive nucleotides. In some embodiments, the length of region F' is 2 consecutive nucleotides. In some embodiments, the length of region F' is 4 consecutive nucleotides. In some embodiments, the length of region F is 5 consecutive nucleotides. In some embodiments, the length of region F is 6 consecutive nucleotides.

[0206] Advantageously, the most 3' nucleoside in region F' is a sugar-modified nucleoside. In some embodiments, the two most 3' nucleosides in region F' are sugar-modified nucleosides. In some embodiments, the two most 3' nucleosides in region F' are LNA nucleosides. In some embodiments, the most 3' nucleoside in region F' is an LNA nucleoside.

[0207] It should be noted that if the length of region F is 1, it is favorably an LNA nucleoside. Furthermore, if the length of region F and / or F' is 2, it should be noted that the nucleosides of both regions F and / or F' are favorably LNA nucleosides.

[0208] In some embodiments, the sugar-modified nucleosides in regions F and F' consist of only one type of sugar-modified nucleoside, such as MOE only, or β-D-oxy LNA only, or ScET only. Such designs are also referred to as uniform flank or uniform gapmer designs.

[0209] In some embodiments, all nucleosides in region F or F', or in both F and F', are LNA nucleosides, such as beta-D-oxy LNA nucleosides. In alternative embodiments, all sugar-modified nucleosides in regions F and F' are LNA nucleosides, such as beta-D-oxy LNA nucleosides, and region F or F', or both F and F', may contain DNA nucleosides (alternating flanks; see definitions for details).

[0210] In some embodiments, the 5' and 3' nucleosides in regions F and F' are LNA nucleosides, such as beta-D-oxy LNA nucleosides.

[0211] In some embodiments, the nucleoside bonds between region F and region G and / or between region F' and region G are phosphorothioate nucleoside bonds. In some embodiments, the nucleoside bonds between the nucleosides of region F or F', F and F' are phosphorothioate nucleoside bonds.

[0212] LNA gapmer An LNA gapmer is a gapmer containing or comprising an LNA nucleoside in one or both of regions F and F'. A beta-D-oxy gapmer is a gapmer containing or comprising a beta-D-oxy LNA nucleoside in one or both of regions F and F'.

[0213] In some embodiments, the LNA gapmer is given by the formula: [LNA] 1~5 -[Area G]-[LNA] 1~5 (In the formula, region G is a region of a continuous DNA nucleoside capable of recruiting RNaseH, or contains such a region.)

[0214] MOE Gap Marker A MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, the MOE gapmer is designed [MOE] 1~8 -[Area G] 5~16 -[MOE] 1~8 For example, [MOE] 2~7 -[Area G] 6~14 -[MOE] 2~7 For example, [MOE] 3~6 -[Area G] 8~12 -[MOE] 3~6 (In the formula, region G is as defined in the definition of a gapmer). MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0215] Mixed wing gapmer A mixed wing gapmer is an LNA gapmer in which one or both of regions F and F' contain a 2'-substituted nucleoside, such as a MOE nucleoside, independently selected from the group consisting of 2'-substituted nucleosides, e.g., 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units, and 2'-fluoro-ANA units. In some embodiments in which at least one of regions F and F', or both regions F and F', contain at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments in which at least one of regions F and F', or both regions F and F', contain at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further contain one or more DNA nucleosides.

[0216] Alternating Frank Gap Marker Flanking regions may contain both LNA nucleosides and DNA nucleosides, and are called "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleosides. Gapmers containing at least one alternating flank are referred to as "alternating flank gapmers." Thus, an "alternating flank gapmer" is an LNA gapmer oligonucleotide in which at least one flank (F or F') contains DNA in addition to LNA nucleosides. In some embodiments, at least one of regions F or F', or both regions F and F', contains both LNA nucleosides and DNA nucleosides. In such embodiments, adjacent regions F or F', or both F and F', contain at least three nucleosides, and the furthest 5' and 3' nucleosides in regions F and / or F' are LNA nucleosides. Alternating flank LNA gapmers are disclosed in International Publication No. 2016 / 127002.

[0217] The alternating flank region may contain one to two, or one, two, or three consecutive DNA nucleosides, or up to three consecutive DNA nucleosides. Alternating flake regions can be annotated as a series of integers, which represent several LNA nucleosides (L) followed by several DNA nucleosides (D), e.g., [L]1-3-[D]1-3-[L]1-3 or [L]1-2-[D]1-2-[L]1-2-[D]1-2-[L]1-2. In oligonucleotide design, these are often represented as numbers such that 2-2-1 represents 5'[L]2-[D]2-[L]3' and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The lengths of the flanks (regions F and F') in oligonucleotides with alternating flanks can be, for example, 4-8, e.g., 5-6 nucleosides, e.g., 4, 5, 6, or 7 modified nucleosides, as described herein for these regions. To confer additional exonuclease resistance, it may be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F'). Region D' or D'' in oligonucleotides In some embodiments, the oligonucleotides of the present invention may comprise, or consist of, a sequential nucleotide sequence of oligonucleotides complementary to the target nucleic acid, e.g., a gapmer region FG-F', and further 5' and / or 3' nucleosides. The further 5' and / or 3' nucleosides may be fully complementary to the target nucleic acid or not. Such further 5' and / or 3' nucleosides may be referred to herein as regions D' and D''.

[0218] The addition of region D' or D'' may be used to link a continuous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used for linking, the continuous nucleotide sequence with the conjugate moiety may act as a bio-cleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacture.

[0219] Regions D' and D'' can be bonded to the 5' end of region F or the 3' end of region F', respectively, to generate the following designs of formula D'-FG-F', FG-F'-D'', or D'-FG-F'-D''. In this case, FG-F' is the gapmer portion of the oligonucleotide, and region D' or D'' constitutes a separate portion of the oligonucleotide.

[0220] Region D' or D'' independently contains or consists of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides such as DNA or RNA, nor are they base-modified versions thereof. The D' or D'' region can function as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D'' are disclosed in International Publication 2014 / 076195, which includes, as an example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in International Publication 2015 / 113922, where they are used to link multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0221] In one embodiment, the oligonucleotide of the present invention includes regions D' and / or D'' in addition to the continuous nucleotide sequence constituting the gapmer.

[0222] In some embodiments, the oligonucleotide of the present invention can be represented by the following formula: FG-F'; especially F 1-8 -G 5-16 -F' 2-8 D'-FG-F', especially D' 1-3-F 1-8 -G 5-16 -F' 2-8 FG-F'-D”, especially F 1-8 -G 5-16 -F' 2-8 -D” 1-3 D'-FG-F'-D”, especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 -D” 1-3 In some embodiments, the internucleoside bond located between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside bond located between region F' and region D'' is a phosphodiester bond.

[0223] Conjugate As used herein, the term "conjugate" refers to an oligonucleotide covalently bonded to a non-nucleotide portion (the conjugate portion or region C or a third region). The conjugate portion may optionally be covalently bonded to the antisense oligonucleotide via a linker group such as region D' or D''.

[0224] Oligonucleotide conjugates and their synthesis have also been reported in comprehensive overviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, STCrooke, ed., Ch.16, Marcel Dekker, Inc., 2001, and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0225] In some embodiments, the non-nucleotide portion (conjugate portion) is selected from the group consisting of carbohydrates (e.g., GalNAc), cell surface receptor ligands, active pharmaceutical ingredients, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g., bacterial toxins), vitamins, viral proteins (e.g., capsids), or combinations thereof.

[0226] Exemplary conjugate moieties include those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular, the conjugate moiety of trivalent N-acetylgalactosamine is suitable for binding to ASGPR; see, for example, International Publications 2014 / 076196, 2014 / 207232, and 2014 / 179620. Such conjugates help enhance the uptake of oligonucleotides into the liver.

[0227] In some embodiments, the conjugate is an antibody or antibody fragment having specific affinity for the transferrin receptor, such as disclosed in International Publication No. 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide portion is an antibody or antibody fragment, such as an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, in particular an antibody or antibody fragment that targets the transferrin receptor.

[0228] Linker A linker or conjugate is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. The conjugate portion can be conjugated to an oligonucleotide directly or via a linking portion (e.g., a linker or tether). The linker plays the role of covalently bonding a third region, e.g., the conjugate portion (region C), to a first region, e.g., an oligonucleotide or sequence of nucleotides complementary to the target nucleic acid (region A).

[0229] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally include a linker region (second region or region B and / or region Y) located between an oligonucleotide or sequential nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate portion (region C or third region).

[0230] A bio-cleavable linker (region B) contains or consists of a physiologically unstable bond that can be cleaved under conditions normally encountered or similar to those encountered in the mammalian body. Conditions under which the physiologically unstable linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidation or reduction conditions, or drugs, as well as salt concentrations similar to those found in or encountered in mammalian cells. Intracellular mammalian conditions also include the presence of enzyme activity normally present in mammalian cells, such as proteolytic enzymes, hydrolytic enzymes, or nucleases. In one embodiment, the bio-cleavable linker is susceptible to S1 nuclease cleavage. In some embodiments, the physiologically unstable linker (biologically cleavable) comprises 1 to 10 linked nucleosides, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 linked nucleosides, for example, 2 to 6 linked nucleosides, for example, 2 to 5 linked nucleosides, for example, 2 to 4 linked nucleosides, where at least two consecutive links are biologically cleavable, for example, phosphodiester links, for example, at least 3, 4, or 5 consecutive phosphodiester links. Preferably, the nucleosides are DNA or RNA.

[0231] In one embodiment, the linker between the oligonucleotide and the conjugate moiety is a physiologically unstable linker composed of 2 to 5 consecutive phosphodiester nucleosides, each containing at least two consecutive phosphodiester bonds at the 5' or 3' end of the consecutive nucleotide sequence of the antisense oligonucleotide.

[0232] In some embodiments, the physiologically unstable linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein a phosphodiester bond exists between the two DNA nucleosides, and at least one further phosphodiester is present at the 5' or 3' end of the dinucleotide that links the oligonucleotide of the nucleic acid molecule to the dinucleotide or links the conjugate portion to the dinucleotide. For example, the linker may be a CA dinucleotide. In some embodiments, the physiologically unstable linker comprises or consists of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG, with phosphodiester bonds present between DNA nucleosides and potentially further phosphodiesters at the 5' or 3' ends of the trinucleotides. Biocleavable linkers containing phosphodiesters are described in more detail in International Publication No. 2014 / 076195 (incorporated herein by reference). In conjugate compounds having biocleavable linkers, compared to a standard, at least about 50% of the conjugate moiety is cleaved from the oligonucleotide, for example, at least about 60%, for example, at least about 70%, for example, at least about 80%, for example, at least about 85%, for example, at least about 90%, for example, at least about 95% of the conjugate moiety is cleaved from the oligonucleotide.

[0233] Region Y refers to a linker that is not necessarily biocleavable but primarily serves to covalently bond the conjugate portion (region C or third region) to the oligonucleotide (region A or first region). The region Y linker may include a chain structure or oligomer of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. The oligonucleotide conjugate of the present invention can be constructed from the following region elements AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group including a C6-C12 aminoalkyl group. In some embodiments, the linker (region Y) is a C6 aminoalkyl group.

[0234] Preferably, the cleavable linker is cleaved after the conjugate of the present invention is delivered to its target cells. For example, the linker is cleaved after GalNAc-mediated delivery of the conjugate to target cells (e.g., liver cells), leaving the naked compound as the active drug. For example, the conjugates tested in the Examples section contain a CA dinucleotide linker.

[0235] Pharmaceutically acceptable salts The term "pharmaceutically acceptable salt" refers to a salt that retains the biological efficacy and properties of a free base or free acid, and is not biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, particularly hydrochloric acid, as well as organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. In addition, these salts can be prepared by adding an inorganic base or organic base to a free acid. Salts derived from inorganic bases include, but are not limited to, salts of sodium, potassium, lithium, ammonium, calcium, and magnesium. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and salts of basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resins. The compounds of the present invention may also exist in zwitterionic form. Particularly preferred are pharmaceutically acceptable salts of the compound of formula (I) of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0236] treatment As used herein, the term “treatment” refers to both the treatment of an existing disease (e.g., any disease or disorder referred to herein) and the prevention, or prophylaxis, of a disease. Therefore, it will be recognized that the treatments referred to herein may be prophylactic in some embodiments. Prophylactic can be understood as preventing HBV infection from progressing to chronic HBV infection, or preventing serious liver diseases such as cirrhosis and hepatocellular carcinoma caused by chronic HBV infection.

[0237] prevention In this specification, the terms “prevention,” “prevention,” or “to prevent” relate to preventive measures, i.e., measurements or means whose purpose is to prevent a disease rather than to cure it. Prevention means that the desired pharmacological and / or physiological effect is obtained preventively, in terms of completely or partially preventing the disease or its symptoms. Accordingly, “preventing HBV infection” in this specification includes preventing the occurrence of HBV infection in a subject and preventing the occurrence of symptoms of HBV infection. In particular, the present invention aims to prevent HBV infection in children from mothers infected with HBV. It also aims to prevent acute HBV infection from progressing to chronic HBV infection.

[0238] patient For the purposes of the present invention, the "subject" or "patient" may be a vertebrate. In relation to the present invention, the term "subject" includes both humans and other animals, particularly mammals, and other living organisms. Accordingly, the means and methods provided herein are applicable to both human therapeutic and veterinary uses. Accordingly, herein, the subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, cattle, horse, camel, or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the patient suffers from a disease referred to herein, such as HBV infection. In some embodiments, the patient is susceptible to such disease. [Modes for carrying out the invention]

[0239] The covalently closed circular DNA (cccDNA) of hepatitis B virus (HBV) in infected hepatocytes is involved in persistent chronic infection and reactivation, serving as a template for all viral subgenomic transcripts and pregenomic RNA (pgRNA), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recirculation. RTEL1 is associated with cccDNA stability. Inhibition of RTEL1 leads to cccDNA destabilization in HBV-infected subjects, which in turn opens up the opportunity for complete cure in chronically infected HBV patients.

[0240] One aspect of the present invention is an enhanced antisense oligonucleotide targeting RTEL1, or a conjugate thereof, for use in the treatment and / or prevention of HBV infection, particularly chronic HBV infection.

[0241] In one embodiment, an antisense oligonucleotide or its conjugate that targets RTEL1 can, for example, reduce the expression of the RTEL1 protein or the binding of the RTEL1 protein to cccDNA, thereby reducing cccDNA and / or pgRNA in infected cells, such as HBV-infected cells.

[0242] In one embodiment, an antisense oligonucleotide or its conjugate targeting RTEL1 can reduce HBsAg and / or HBeAg in vivo in HBV-infected individuals.

[0243] In one embodiment, an antisense oligonucleotide or its conjugate targeting RTEL1 can reduce cccDNA in vivo in HBV-infected individuals.

[0244] In one embodiment, an antisense oligonucleotide or its conjugate targeting RTEL1 can reduce pgDNA in vivo in HBV-infected individuals.

[0245] The present invention's antisense oligonucleotide The enhanced antisense oligonucleotides or their conjugates of the present invention can target RTEL1 transcripts and promote their degradation via RNase H cleavage, and are therefore potentially excellent RTEL1 inhibitors.

[0246] One aspect of the present invention is an enhanced antisense oligonucleotide or conjugate thereof for use in the treatment and / or prevention of HBV infection.

[0247] This section of the present invention describes novel oligonucleotides suitable for the treatment and / or prevention of HBV infection.

[0248] The antisense oligonucleotides or their conjugates of the present invention can inhibit RTEL1 expression in vitro and in vivo. Inhibition is achieved by hybridizing the oligonucleotide to a target nucleic acid that encodes RTEL1 or is involved in the regulation of RTEL1. The target nucleic acid may be a mammalian RTEL1 sequence such as sequence SEQ ID NO: 1 and / or 2.

[0249] In some embodiments, the antisense oligonucleotides or their conjugates of the present invention can be modulated by inhibiting or downregulating the expression of a target. Preferably, such modification results in inhibition of at least 20%, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% compared to the normal expression level of the target. In some embodiments, the antisense oligonucleotides or their conjugates of the present invention may be able to inhibit the expression level of RTEL1 mRNA by at least 60% or 70% in vitro using 10 μM in PXB-PHH cells. In some embodiments, the antisense oligonucleotides or their conjugates of the present invention may be able to inhibit the expression level of RTEL1 protein by at least 50% in vitro using 10 μM in PXB-PHH cells, and this range of target reduction is advantageous in selecting antisense oligonucleotides that correlate well with cccDNA reduction. Appropriately, the examples provide assays that can be used to measure RTEL1 RNA inhibition (e.g., Example 1). Targeted inhibition is caused by hybridization between the sequence of nucleotides in the antisense oligonucleotide and the target nucleic acid. In some embodiments, the antisense oligonucleotide of the present invention includes a mismatch between the antisense oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to exhibit the desired inhibition of RTEL1 expression. The decrease in binding affinity resulting from the mismatch can be favorably compensated by increasing the number of nucleotides in the oligonucleotide and / or by increasing the number of modified nucleosides, such as 2' sugar-modified nucleosides containing LNA, which can increase the binding affinity to the target, present in the oligonucleotide sequence.

[0250] One aspect of the present invention relates to an enhanced antisense oligonucleotide, 12 to 60 nucleotides in length, comprising a continuous nucleotide sequence of at least 10 nucleotides, for example, at least 12 to 30 nucleotides in length, and being at least 95% complementary, for example, fully complementary, to mammalian RTEL1 target nucleic acid, particularly human RTEL1 nucleic acid. The antisense oligonucleotide can inhibit RTEL1 expression.

[0251] In some embodiments, the antisense oligonucleotides of the present invention include a sequence of 12 to 22 nucleotides, for example, 15 to 20 nucleotides, which has at least 90% complementarity, for example, complete complementarity, to the target nucleic acid of SEQ ID NO: 7.

[0252] In some embodiments, the antisense oligonucleotide comprises a sequence of 15 to 18 nucleotides, for example, 17 or 18 nucleotides, having at least 90% complementarity, for example, complete complementarity, to the target nucleic acid of SEQ ID NO: 8.

[0253] In some embodiments, the antisense oligonucleotide comprises a sequence of 15 to 19 nucleotides, for example, 18 or 19 nucleotides, having at least 90% complementarity, for example, complete complementarity, to the target nucleic acid of SEQ ID NO: 9.

[0254] In some embodiments, the antisense oligonucleotide comprises a sequence of 15 to 18 nucleotides, for example, 17 or 18 nucleotides, having at least 90% complementarity, for example, complete complementarity, to the target nucleic acid of SEQ ID NO: 10.

[0255] In some embodiments, the antisense oligonucleotides of the present invention include a sequence of 12 to 22 nucleotides, for example, 17 to 22 nucleotides, which have at least 90% complementarity, for example, complete complementarity, to the target nucleic acid of SEQ ID NO: 11.

[0256] In some embodiments, the antisense oligonucleotide comprises a sequence of 15-22 nucleotides, e.g., 15-18 nucleotides, e.g., 17 or 18 nucleotides, having at least 90% complementarity, e.g., complete complementarity, to a target nucleic acid selected from, for example, nucleotides 11757-11774, 11756-11774, or 11753-11770 of SEQ ID NO: 1.

[0257] One aspect of the present invention relates to an antisense oligonucleotide having a length of 12 to 30 nucleotides, comprising a continuous nucleotide sequence of at least 10 nucleotides, for example, 10 to 30 nucleotides, which is at least 90% complementary, for example, completely complementary, to mammalian RTEL1.

[0258] A further aspect of the present invention relates to an antisense oligonucleotide comprising a continuous nucleotide sequence of 12 to 20, for example, 15 to 22 nucleotides in length, which has at least 90% complementarity to the target nucleic acid of SEQ ID NO: 1, for example, is perfectly complementary.

[0259] In some embodiments, the antisense oligonucleotide comprises a continuous sequence of 10 to 30 nucleotides in length, which is at least 90% complementary, e.g., at least 91%, e.g., at least 92%, e.g., at least 93%, e.g., at least 94%, e.g., at least 95%, e.g., at least 96%, e.g., at least 97%, e.g., at least 98%, or 100% complementary, to a region of the target nucleic acid or target sequence.

[0260] The antisense oligonucleotide or its sequence of nucleotides according to the present invention is advantageous when it is perfectly complementary (100% complementary) to the region of the target nucleic acid, or, in some embodiments, when it may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0261] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid region of SEQ ID NO: 1.

[0262] In some embodiments, the antisense oligonucleotide or sequential nucleotide sequence of the present invention is at least 95% complementary, for example, perfectly (or 100%) complementary, to the target nucleic acids of SEQ ID NO: 1 and SEQ ID NO: 2.

[0263] In some embodiments, the continuous nucleotide sequence includes a sequence of nucleic acid bases selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6, or at least 14 such continuous nucleotides.

[0264] In some embodiments, the antisense oligonucleotide or the sequence thereof of the present invention comprises or consists of 10 to 30 nucleotides in length, for example 12 to 25, for example 11 to 22, for example 12 to 20, for example 14 to 18 or 14 to 16 consecutive nucleotides.

[0265] In some embodiments, an antisense oligonucleotide or its sequence of nucleotides contains or consists of 22 or fewer nucleotides, e.g., 20 or fewer nucleotides, e.g., 18 or fewer nucleotides, e.g., 14, 15, 16, or 17 nucleotides. It should be understood that any range provided herein includes the endpoint of the range. Therefore, when an oligonucleotide is described as containing 10 to 30 nucleotides, it includes both 10 and 30 nucleotides.

[0266] In some embodiments, the continuous nucleotide sequence includes or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 continuous nucleotide lengths.

[0267] In some embodiments, the antisense oligonucleotide or the sequence thereof includes or consists of a sequence selected from SEQ ID NOs: 3, 4, 5, and 6.

[0268] The present invention provides antisense oligonucleotides according to the present invention, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, the antisense oligonucleotides comprising a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 7.

[0269] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, and the antisense oligonucleotides include a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 8.

[0270] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, and the antisense oligonucleotides include a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 9.

[0271] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, wherein the antisense oligonucleotides include a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 10.

[0272] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, wherein the antisense oligonucleotides include a sequence of nucleotides containing at least 12, for example, at least 13, for example, at least 14, for example, at least 15, or at least 16 consecutive nucleotides, as present in SEQ ID NO: 11.

[0273] In a favorable embodiment, the antisense oligonucleotide comprises one or more glycosylated nucleosides, for example, one or more 2'-saccharide modified nucleosides, for example, one or more 2'-saccharide modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleosides are locked nucleic acid (LNA).

[0274] In some embodiments, the continuous nucleotide sequence includes LNA nucleosides.

[0275] In some embodiments of the oligonucleotides of the present invention, all LNA nucleosides are β-D-oxy LNA nucleosides.

[0276] In some embodiments, the continuous nucleotide sequence includes LNA nucleosides and DNA nucleosides.

[0277] In some embodiments, the continuous nucleotide sequence comprises a 2'-O-methoxyethyl (2'MOE) nucleoside.

[0278] In some embodiments, the continuous nucleotide sequence comprises a 2'-O-methoxyethyl (2'MOE) nucleoside and a DNA nucleoside.

[0279] Advantageously, the antisense oligonucleotide, or the 3'-most nucleoside of its sequence of nucleotides, is a 2'-sugar-modified nucleoside.

[0280] Advantageously, the antisense oligonucleotide contains at least one modified internucleoside bond, such as a phosphorothioate or phosphorodithioate.

[0281] In some embodiments, at least one nucleoside bond in a sequence of nucleotides is a phosphorothioate nucleoside bond.

[0282] In some embodiments, at least one nucleoside bond in a sequence of nucleotides is a phosphorodithioate nucleoside bond.

[0283] In some embodiments, at least one nucleoside bond in a sequence of nucleotides is a phosphodiester nucleoside bond.

[0284] In some embodiments, all nucleoside-to-nucleoside bonds within a continuous nucleotide sequence are phosphorothioate nucleoside-to-nucleoside bonds.

[0285] In some embodiments, at least 75% of the nucleoside-to-nucleoside bonds within an antisense oligonucleotide or its sequential nucleotide sequence are phosphorothioate-nucleoside bonds.

[0286] In some embodiments, all nucleoside-to-nucleoside bonds within an antisense oligonucleotide or its sequence of nucleotides are phosphorothioate nucleoside bonds.

[0287] In advantageous embodiments of the present invention, the antisense oligonucleotide of the present invention can recruit RNase H, for example, RNase H1. In some embodiments, the antisense oligonucleotide of the present invention or the sequence of nucleotides thereof is a gapmer.

[0288] In some embodiments, the antisense oligonucleotide or its sequential nucleotide sequence consists of or includes a gapmer of formula 5'-FG-F'-3'.

[0289] In some embodiments, region G consists of 6 to 16 DNA nucleosides, for example, 11 to 16 DNA nucleosides. In some embodiments, region F contains 2 to 4 DNA nucleosides, and / or region F' contains 2 to 6 DNA nucleosides.

[0290] In some embodiments, regions F and F' each contain at least one LNA nucleoside.

[0291] In some embodiments, the oligonucleotides of the present invention are LNA gapmers having uniform flanks. For example, LNA gapmers having uniform flanks may have designs selected from the following designs: 4-12-2, 2-13-4, and 2-12-5. Table 6 lists preferred designs for each motif sequence.

[0292] In some embodiments of the present invention, the LNA gapmer is an alternating flank LNA gapmer. In some embodiments, the alternating flank LNA gapmer includes at least one alternating flank (flank F', etc.). In some embodiments, the alternating flank LNA gapmer includes one alternating flank (flank F', etc.) and one uniform flank (flank F, etc.). For example, an LNA gapmer having one alternating F' flank may have the following design: 2-11-1-2-1-3.

[0293] The present invention provides the following oligonucleotide compounds (Table 6): [Table 6] The heading "Oligonide Compound" in the table represents a specific design of the motif sequence. Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all nucleoside bonds are phosphorothioate nucleoside bonds. The heading "Design" refers to the gapmer design, FG-F'. In a classical gapmer design, i.e., a gapmer with a uniform flank (e.g., 4-12-2), all nucleotides in the flanks (F and F') consist of the same type of 2' sugar-modified nucleosides, e.g., LNA, cET, or MOE, and a stretch of central DNA that forms the gap (G). In gapmers with alternating flank designs, the oligonucleotide flanks are annotated as a series of integers, representing several β-D-oxy LNA nucleosides (L) followed by several DNA nucleosides (D). For example, flank F', which has the 1-2-1-1-3 motif, represents LDDLDLLL (see CMP ID number 6_1). Both flanks have β-D-oxy LNA nucleosides at their 5' and 3' ends. The gap region (G) consists of several DNA nucleosides located between the flanks.

[0294] In some embodiments of the present invention, the oligonucleotide is selected from the group of oligonucleotide compounds consisting of CMP-ID numbers 3_1, 4_1, 5_1, and 6_1 (see Table 6).

[0295] In all cases, the FG-F' design may further include regions D' and / or D'' as described in the "Definition" section of "Region D' or D'' in Oligonucleotides". In some embodiments, the oligonucleotides of the present invention have one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5' or 3' end of the gapmer region, e.g., the 5' end. In some embodiments, the oligonucleotides of the present invention consist of two 5' phosphodiester-linked DNA nucleosides followed by the FG-F' gapmer region as defined above. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further include conjugated moieties as described herein. For delivery to the liver, the ASGPR-targeting moiety is particularly advantageous as a conjugated moiety. See Conjugated Moieties for further details. Conjugate

[0296] Since HBV infection primarily affects hepatocytes in the liver, it is advantageous to conjugate the enhanced antisense oligonucleotide of the present invention to a conjugate portion that increases the delivery of the antisense oligonucleotide to the liver compared to a non-conjugated antisense oligonucleotide. In one embodiment, the liver-targeting portion is selected from a portion containing cholesterol or other lipids, or a conjugate portion capable of binding to the asialoglycoprotein receptor (ASGPR).

[0297] In some embodiments, the present invention provides a conjugate comprising an antisense oligonucleotide of the present invention covalently bonded to the conjugate portion.

[0298] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moiety) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives to the asialoglycoprotein receptor have been studied (see, e.g., Jobst, ST and Drickamer, K.JB.C. 1996, 271, 6686) or can be readily determined using methods typical in the art.

[0299] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0300] To generate an ASGPR conjugate moiety, an ASPGR-targeting moiety (preferably GalNAc) can be attached to a conjugate scaffold. Generally, the ASPGR-targeting moiety may be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of 2 to 4 terminal GalNAc moieties linked to spacers that link each GalNAc moiety to a blaster molecule that can be conjugated to an antisense oligonucleotide.

[0301] In further embodiments, the conjugate moiety is monovalent, divalent, trivalent, or tetravalent with respect to the asialoclycoprotein receptor targeting moiety. Advantageously, the asialoclycoprotein receptor targeting moiety includes an N-acetylgalactosamine (GalNAc) moiety.

[0302] Examples of GalNAc conjugate moieties include those described in International Publication Nos. 2014 / 179620 and 2016 / 055601 and International Application No. PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides to which GalNAc moieties are attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3(YEE(ahGalNAc)3); glycotripeptides that bind to asialocrypoprotein receptors on hepatocytes, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297; lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and corane-based galactose clusters (e.g., carbohydrate recognition motifs for asialocrypoprotein receptors).

[0303] The ASGPR conjugate moiety, particularly the trivalent GalNAc conjugate moiety, can be conjugated to the 3' or 5' end of an oligonucleotide using methods known in the art. In one embodiment, the ASGPR conjugate moiety is ligated to the 5' end of the oligonucleotide.

[0304] In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5. In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5A-1 or Figure 5A-2, or a mixture of both. In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5B-1 or Figure 5B-2, or a mixture of both. In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5C-1 or Figure 5C-2, or a mixture of both. In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D-1 or Figure 5D-2, or a mixture of both.

[0305] In some embodiments, the conjugate is selected from the group consisting of the following: 5'-GN2-C6 o c o a o A s A s T s T s t s t s a s c s a s t s a s c s t s c s t s g s G s T s , 5'-GN2-C6 o c o a o A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C s , 5'-GN2-C6 o c o a o m C s T s t s t s a s t s t s a s t s a s a s c s t s T s g s a s As t s m C s T s m C s , and 5'-GN2-C6 o c o a o T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A s

[0306] Uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, each LNA cytosine is 5-methylcytosine, the subscript s represents a phosphorothioate nucleoside bond, the subscript o represents a phosphodiester nucleoside bond, and GN2-C6 is trivalent N-acetylgalactosamine (GalNAc), such as the trivalent N-acetylgalactosamine (GalNAc) shown in Figure 5D-1 or Figure 5D-2, or a mixture of both.

[0307] Chemical diagrams representing several molecules are shown in Figures 1 to 4.

[0308] In some embodiments, the conjugate is the conjugate shown in Figure 1.

[0309] In some embodiments, the conjugate is the conjugate shown in Figure 2.

[0310] In some embodiments, the conjugate is the conjugate shown in Figure 3.

[0311] In some embodiments, the conjugate is the conjugate shown in Figure 4.

[0312] The compounds shown in Figures 1-4 are represented in their protonated form. The sulfur atom on the phosphorothioate bond is protonated. It will be understood that the presence of the proton changes depending on the acidity of the molecular environment and the presence of alternative cations (for example, when the oligonucleotide is in salt form). Protonated phosphorothioates exist in tautomerized forms. Pharmaceutically acceptable salts

[0313] The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term "pharmaceutically acceptable salt" refers to conventional acid addition salts or base addition salts formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases that retain the biological efficacy and properties of the compounds of the present invention. Acid addition salts include, for example, those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, as well as those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of pharmaceutically acceptable compounds into salts is a well-known technique to pharmacists for obtaining improved physical and chemical stability, hygroscopicity, fluidity, and solubility of the compounds. This is described, for example, in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, a pharmaceutically acceptable salt of a compound provided herein may be a sodium salt.

[0314] In a further embodiment, the present invention provides pharmaceutically acceptable salts of antisense oligonucleotides or their conjugates, such as pharmaceutically acceptable sodium salts, ammonium salts, or potassium salts.

[0315] Manufacturing method In further embodiments, the present invention provides a method for producing oligonucleotides of the present invention, comprising reacting nucleotide units to form a covalently linked sequence of oligonucleotides. Preferably, this method uses phosphoramidite chemistry (see, for example, Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In further embodiments, this method further comprises reacting a sequence of nucleotides with a conjugate moiety (ligand) to covalently bond the conjugate moiety to the oligonucleotide. In further embodiments, a method for producing a composition of the present invention is provided, comprising mixing the oligonucleotide or conjugated oligonucleotide of the present invention with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0316] Pharmaceutical composition In further embodiments, the present invention provides a pharmaceutical composition comprising any of the aforementioned oligonucleotides and / or oligonucleotide conjugates or salts thereof, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. The pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS), and the pharmaceutically acceptable salt includes, but is not limited to, sodium salts and potassium salts. In some embodiments, the pharmaceutically acceptable diluent is sterile phosphate-buffered saline. In some embodiments, the oligonucleotide is used in a concentration of 50 to 300 μM solution in the pharmaceutically acceptable diluent.

[0317] Formulations suitable for use in the present invention can be found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief overview of drug delivery methods, see, for example, Langer (Science 249:1527-1533, 1990). International Publication No. 2007 / 031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers, and adjuvants (incorporated herein by reference). Suitable doses, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in International Publication No. 2007 / 031091.

[0318] In some embodiments, the antisense oligonucleotides of the present invention, their conjugates, or pharmaceutically acceptable salts thereof are in solid form, such as powder, such as freeze-dried powder.

[0319] In some embodiments, the antisense oligonucleotides or their conjugates of the present invention may be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The composition and methods for the preparation of pharmaceutical compositions depend on many criteria, including the route of administration, the severity of the disease, or the dose administered, but are not limited.

[0320] These compositions may be sterilized by conventional sterilization techniques or subjected to a sterile filter. The resulting aqueous solution can be packaged for immediate use or freeze-dried, and the freeze-dried preparation is combined with a sterile aqueous carrier before administration. The pH of the preparation will typically be 3 to 11, more preferably 5 to 9 or 6 to 8, most preferably 7 to 8, for example, 7 to 7.5. The resulting solid-form compositions can be packaged in multiple single-dose units, each containing a fixed amount of the above-mentioned drug or group of drugs, such as in sealed tablet or capsule packages. The solid-form compositions can also be packaged in flexible-volume containers, such as squeeze-out tubes designed for topically applicable creams or ointments.

[0321] In some embodiments, the antisense oligonucleotide or its conjugate of the present invention is a prodrug. In particular, with respect to antisense oligonucleotide conjugates, when the prodrug is delivered to the site of action, for example, a target cell, the conjugate portion is cleaved from the oligonucleotide.

[0322] Purpose The enhanced antisense oligonucleotides of the present invention can be used, for example, as research reagents for diagnostic, therapeutic, and prophylactic methods.

[0323] In research, such antisense oligonucleotides can be used to specifically regulate the synthesis of the RTEL1 protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating the functional analysis of the target or the evaluation of its usefulness as a target for therapeutic intervention. Typically, target regulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting the protein-producing gene or mRNA modulator.

[0324] When the antisense oligonucleotide of the present invention is used for research or diagnostic purposes, the target nucleic acid may be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0325] The present invention also includes in vivo or in vitro methods for regulating RTEL1 expression in target cells expressing RTEL1, comprising administering an effective amount of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention to said cells.

[0326] In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells may be in vitro cell cultures or in vivo cells that form part of a mammalian tissue. In preferred embodiments, the target cells are located in the liver. The target cells may be hepatocytes.

[0327] One aspect of the present invention relates to an antisense oligonucleotide, its conjugate, or a pharmaceutical composition used as a pharmaceutical.

[0328] In one aspect of the present invention, the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention can reduce cccDNA levels in infected cells and thus inhibit HBV infection. In particular, the antisense oligonucleotide or its conjugate can affect one or more of the following parameters in infected cells: (i) a decrease in cccDNA and / or (ii) a decrease in pgRNA and / or (iii) a decrease in HBV DNA and / or (iv) a decrease in HBV viral antigen.

[0329] For example, antisense oligonucleotides or their conjugates that inhibit HBV infection can (i) reduce cccDNA levels in infected cells by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control, or (ii) reduce pgRNA levels by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control. The control may be untreated cells or animals, or cells or animals treated with an appropriate control.

[0330] Inhibition of HBV infection can be measured in vitro using primary human hepatocytes infected with HBV, or in vivo using a humanized hepatocyte PXB mouse model (available from PhoenixBio; see also Kakuni et al 2014 Int.J.Mol.Sci.15:58-74). Inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA, for example, using the CLIA ELISA kit (Autobio Diagnostic), according to the manufacturer's instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA can be measured by qPCR, for example, as described in the Materials and Methods section. Further methods for evaluating whether a test compound inhibits HBV infection are to measure HBV DNA secretion by qPCR, for example, as described in International Publication No. 2015 / 173208, or by Northern blotting, in situ hybridization, or immunofluorescence.

[0331] By reducing RTEL1 levels, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention can be used to inhibit the development or treatment of HBV infection. In particular, the destabilization and reduction of cccDNA, antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention more efficiently inhibit or treat the development of chronic HBV infection compared to compounds that only reduce HBsAg secretion.

[0332] Accordingly, one aspect of the present invention relates to the use of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention for reducing cccDNA and / or pgRNA in HBV-infected individuals.

[0333] A further aspect of the present invention relates to the use of the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention for inhibiting or treating the development of chronic HBV infection.

[0334] Further aspects of the present invention relate to the use of the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention to reduce the infectivity of HBV-infected individuals. In certain aspects of the present invention, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention inhibit the development of chronic HBV infection.

[0335] The subjects treated with the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention (or those who prophylactically receive the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention) are preferably human, more preferably HBsAg-positive and / or HBeAg-positive human patients, and more preferably HBsAg-positive and HBeAg-positive human patients.

[0336] Accordingly, the present invention relates to a method for treating HBV infection, comprising administering an effective amount of the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention. The present invention further relates to a method for preventing cirrhosis and hepatocellular carcinoma resulting from chronic HBV infection.

[0337] The present invention also provides the use of the antisense oligonucleotides thereof, their conjugates, or pharmaceutical compositions for the manufacture of pharmaceuticals, particularly for use in the treatment of HBV infection or chronic HBV infection, or for reducing the infectivity of HBV-infected persons. In preferred embodiments, the pharmaceuticals are manufactured in dosage forms for subcutaneous administration.

[0338] The present invention also provides the use of the antisense oligonucleotide, its conjugate, and pharmaceutical composition for the manufacture of a pharmaceutical, the pharmaceutical being in a dosage form for intravenous administration.

[0339] The antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention may be used in combination therapy. For example, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention may be used for the treatment and / or prevention of HBV in combination with other anti-HBV agents such as interferon α-2b, interferon α-2a, and interferon alpha-con-1 (pegylated and unpegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, terbivudine (LdT), adefovir, or HBV RNA replication inhibitors, HBsAg secretion inhibitors, HBV capsid inhibitors, antisense oligomers (e.g., described in International Publications 2012 / 145697, 2014 / 179629, and 2017 / 216390), siRNA (e.g., described in International Publications 2005 / 014806, 2012 / 024170, 2012 / 2055362, 2013 / 003520, 2013 / 159109, 2017 / 027350, and 2017 / 015175), HBV therapeutic vaccines, HBV prophylactic vaccines, HBV antibody therapy (monoclonal or polyclonal), or other anti-HBV agents such as TLR2, 3, 7, 8, or 9 agonists may be used in combination.

[0340] Combination therapy In some embodiments, the enhanced antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention are intended for use in combination with other therapeutic agents. The therapeutic agent may, for example, be standard care for the aforementioned diseases or disorders.

[0341] For example, antisense oligonucleotides, their conjugates, or pharmaceutical compositions can be used in combination with other activators such as oligonucleotide antiviral agents, e.g., sequence-specific oligonucleotide antiviral agents, which act via any of the following mechanisms: antisense (including other LNA oligomers), siRNA (such as ARC520), aptama, morpholino, or any other antiviral, nucleotide sequence-dependent mode of action.

[0342] As a further example, antisense oligonucleotides, their conjugates, or pharmaceutical compositions can be used in combination with other active substances such as interferons (e.g., pegylated interferon-α), TLR7 agonists (e.g., GS-9620), or immunostimulatory antiviral compounds such as therapeutic vaccines.

[0343] As a further example, antisense oligonucleotides, their conjugates, or pharmaceutical compositions can be used in combination with other active substances having antiviral activity, such as small molecules. These other active substances may be, for example, nucleoside / nucleotide inhibitors (e.g., entecavir or tenofovir disoproxil fumarate), inclusion inhibitors, or entry inhibitors (e.g., Myrcludex B).

[0344] In certain embodiments, additional therapeutic agents may be HBV drugs, hepatitis C virus (HCV) drugs, chemotherapeutic agents, antibiotics, analgesics, nonsteroidal anti-inflammatory drugs (NSAIDs), antifungal agents, antiparasitic agents, antiemetics, antidiarrheals, or immunosuppressants.

[0345] In particular, in the relevant embodiments, additional HBV agents may be interferon α-2b, interferon α-2a, and interferon alphacon-1 (pegylated and non-pegylated), ribavirin; HBV RNA replication inhibitors; second antisense oligomers; HBV therapeutic vaccines; HBV prophylactic vaccines; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); terbivudine (LdT); adefovir; or HBV antibody therapy (monoclonal or polyclonal).

[0346] In other specific related embodiments, further HCV agents may include interferon α-2b, interferon α-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; pegasys; HCV RNA replication inhibitors (e.g., ViroPharma VP50406 series); HCV antisense agents; HCV therapeutic vaccines; HCV protease inhibitors; HCV helicase inhibitors; or HCV monoclonal antibody therapy or HCV polyclonal antibody therapy.

[0347] Administration The enhanced antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention may be administered topically (e.g., through the skin, by inhalation, by the eyes or ears), enterally (e.g., orally or through the gastrointestinal tract), or parenterally (e.g., intravenously, subcutaneously, or intramuscularly).

[0348] In preferred embodiments, the antisense oligonucleotide, its conjugate, or pharmaceutical composition of the present invention is administered by parenteral routes, including intravenous, intra-arterial, subcutaneous, intraperitoneal, or intramuscular administration. In one embodiment, the active antisense oligonucleotide or its conjugate is administered intravenously. In another embodiment, the active antisense oligonucleotide or its conjugate is administered subcutaneously.

[0349] In some embodiments, the antisense oligonucleotides, their conjugates, or pharmaceutical compositions of the present invention are administered in doses of 0.1 to 15 mg / kg, for example, 0.2 to 10 mg / kg, or for example, 0.25 to 5 mg / kg. Administration may be once a week, once every two weeks, once every three weeks, or once a month.

[0350] The present invention also provides the use of the antisense oligonucleotide or its conjugate described herein for the manufacture of a pharmaceutical, the pharmaceutical being in a dosage form for subcutaneous administration. Embodiments of the present invention

[0351] The following embodiments of the present invention can be used in combination with any other embodiments described herein. The definitions and descriptions provided above, in particular in the sections “Summary of the Invention,” “Definitions,” and “Detailed Description of the Invention,” will apply mutatis mutandis below.

[0352] 1. An antisense oligonucleotide comprising a continuous nucleotide sequence having at least 90% complementarity, e.g., 100% complementarity, to RTEL1 nucleic acid, which can inhibit the expression of RTEL1 such as human RTEL1 in cells.

[0353] 2. The antisense oligonucleotide according to Embodiment 1, wherein the continuous nucleotide sequence is completely complementary to the region from nucleotides 11753-11774 of the human RTEL1 premRNA shown in SEQ ID NO: 1, for example, the region from nucleotides 11757-11774, nucleotides 11756-11774, or nucleotides 11753-11770 of SEQ ID NO: 1.

[0354] 3. The antisense oligonucleotide according to Embodiments 1 and 2, wherein the continuous nucleotide sequence is completely complementary to SEQ ID NOs: 7, 8, 9 and / or 10.

[0355] 4. The antisense oligonucleotide according to Embodiment 1, wherein the continuous nucleotide sequence is completely complementary to the region from nucleotides 8681-8701 of the human RTEL1 premRNA shown in SEQ ID NO: 1.

[0356] 5. The antisense oligonucleotide according to Embodiments 1 and 4, wherein the continuous nucleotide sequence is completely complementary to Sequence ID No. 11.

[0357] 6. The antisense oligonucleotide according to any one of Embodiments 1 to 5, wherein the antisense oligonucleotide is 12 to 30 nucleotides long, for example, 12 to 22 nucleotides long, for example, 16 to 20 nucleotides long.

[0358] 7. An antisense oligonucleotide according to any one of Embodiments 1 to 6, wherein the continuous nucleotide sequence is a continuous sequence of at least 12 nucleotides, for example, 14, 15, 16, 17, 18, 19, or 20 nucleotides.

[0359] 8. The antisense oligonucleotide according to Embodiment 7, wherein the continuous nucleotide sequence is a continuous sequence of 18 or 19 nucleotides.

[0360] 9. An antisense oligonucleotide according to any one of Embodiments 1 to 8, wherein the sequence of nucleotides is 100% identical to a sequence selected from the group consisting of SEQ ID NOs: 3, 4, 5, and 6, or to at least 15 of those sequences of nucleotides.

[0361] 10. An antisense oligonucleotide according to any one of Embodiments 1 to 9, comprising one or more modified nucleosides in the continuous nucleotide sequence.

[0362] 11. The antisense oligonucleotide according to Embodiment 10, wherein one or more modified nucleosides in the continuous nucleotide sequence are 2'-saccharide modified nucleosides.

[0363] 12. The antisense oligonucleotide according to Embodiment 11, wherein one or more 2'-saccharide-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0364] 13. The antisense oligonucleotide according to any one of embodiments 10 to 12, wherein the one or more modified nucleosides are LNA nucleosides such as oxy-LNA having the following 2'-4' crosslinked-O-CH2-.

[0365] 14. The antisense oligonucleotide according to Embodiment 13, wherein one or more of the modified nucleosides are β-D-oxy-LNA.

[0366] 15. The antisense oligonucleotide according to any one of Embodiments 1 to 14, wherein at least one nucleoside bond in the continuous nucleotide sequence is a phosphorothioate nucleoside bond.

[0367] 16. An antisense oligonucleotide according to any one of Embodiments 1 to 15, wherein at least one nucleoside bond in the continuous nucleotide sequence is a phosphorodithioate nucleoside bond.

[0368] 17. An antisense oligonucleotide according to any one of embodiments 1 to 16, wherein at least one nucleoside bond in the continuous nucleotide sequence is a phosphodiester nucleoside bond.

[0369] 18. The antisense oligonucleotide according to Embodiment 17, wherein all nucleoside-to-nucleoside bonds in the continuous nucleotide sequence are phosphorothioate nucleoside-to-nucleoside bonds.

[0370] 19. The antisense oligonucleotide according to any one of Embodiments 1 to 18, wherein the antisense oligonucleotide is an antisense oligonucleotide capable of recruiting RNase H such as RNase H1.

[0371] 20. The antisense oligonucleotide according to Embodiment 19, wherein the antisense oligonucleotide, or the continuous nucleotide sequence thereof, consists of or includes a gapmer of formula 5'-FG-F'-3'.

[0372] 21. The antisense oligonucleotide according to Embodiment 20, wherein region G has a length of 6 to 16 DNA nucleosides, for example, 11 to 16 DNA nucleosides.

[0373] 22. An antisense oligonucleotide according to any one of embodiments 19 to 21, wherein regions F and F' each contain at least one LNA nucleoside, for example, regions F and F' each contain at least one LNA nucleoside.

[0374] 23. An antisense oligonucleotide according to any one of embodiments 19 to 22, wherein region F has a length of 1 to 8 DNA nucleosides, for example, 2 to 4 DNA nucleosides.

[0375] 24. An antisense oligonucleotide according to any one of embodiments 19 to 23, wherein region F has a length of 1 to 8 DNA nucleosides, for example, 2 to 6 DNA nucleosides.

[0376] 25. The antisense oligonucleotide or its sequence of nucleotides is defined as formula F 2-4 -G 11-16 -F' 2-6 An antisense oligonucleotide according to any one of embodiments 19 to 24, comprising or including a gapmer.

[0377] 26. The antisense oligonucleotide according to any one of embodiments 19 to 25, wherein the gapmer includes at least one alternating flank.

[0378] 27. The antisense oligonucleotide according to any one of embodiments 19 to 25, wherein the gapmer includes two uniform flanks.

[0379] 28. The antisense oligonucleotide is as follows: AATTttacatactctgGT (SEQ ID NO: 3, Compound ID number: 3_1) AAttttacatactctGGTC (Sequence ID 4, Compound ID number 4_1), TTacatactctggtCAAA (SEQ ID NO: 5, Compound ID number: 5_1), and Selected from the group of antisense oligonucleotides consisting of CTttattataactTgaAtCTC (SEQ ID NO: 6, Compound ID number: 6_1), An antisense oligonucleotide according to any one of Embodiments 1 to 27, wherein uppercase letters represent β-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA Cs are 5-methylcytosine, and all nucleoside bonds are phosphorothioate nucleoside bonds.

[0380] 29. A conjugate comprising an antisense oligonucleotide according to any one of embodiments 1 to 28 and at least one conjugate portion covalently bonded to the antisense oligonucleotide.

[0381] 30. The conjugate according to Embodiment 29, wherein the conjugate portion comprises at least one asialoglycoprotein receptor targeting portion selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalaxamine.

[0382] 31. The conjugate according to Embodiment 30, wherein the asialoclycoprotein receptor targeting portion is N-acetylgalactosamine (GalNAc).

[0383] 32. The compound according to Embodiment 30 or 31, wherein the conjugate portion is monovalent, divalent, trivalent, or tetravalent with respect to the asialocrypoprotein receptor targeting portion.

[0384] 33. The compound according to Embodiment 32, wherein the conjugate portion comprises 2 to 4 terminal GalNAc portions and spacers that connect each GalNAc portion to a blaster molecule that can be conjugated to an antisense compound.

[0385] 34. The conjugate according to embodiment 33, wherein the spacer is a PEG spacer.

[0386] 35. The conjugate according to any one of embodiments 30 to 34, wherein the conjugate portion is a trivalent N-acetylgalactosamine (GalNAc) portion.

[0387] 36. The compound according to any one of embodiments 30 to 35, wherein the conjugate portion is selected from one of the trivalent GalNAc portions in Figure 5.

[0388] 37. The conjugate according to embodiment 36, wherein the conjugate portion is the trivalent GalNAc portion of Figure 5, for example, the trivalent GalNAc portion of Figure 5D-1 or Figure 5D-2, or a mixture of both.

[0389] 38. A conjugate according to any one of embodiments 29 to 37, comprising a linker disposed between the antisense oligonucleotide and the conjugate portion.

[0390] 39. The conjugate according to Embodiment 38, wherein the physiologically unstable linker comprises or consists of 2 to 5 consecutive phosphodiester bonded nucleosides, for example, 2 consecutive phosphodiester bonded nucleosides.

[0391] 40. The aforementioned conjugate is as follows: 5'-GN2-C6 o c o a o A s A s T s T s t s t s a s c s a s t s a s c s t s c s t s g s G s T, 5'-GN2-C6 o co a o A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C, 5’-GN2-C6 o c o a o m C s T s t s t s a s t s t s a s t s a s a s c s t s T s g s a s A s t s m C s T s m C,and 5’-GN2-C6 o c o a o T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A sSelected from the group consisting of A, Uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is 5-methylcytosine. m c is 5-methylcytosine DNA, the subscript s represents a phosphorothioate nucleoside bond, the subscript o represents a phosphodiester nucleoside bond, and GN2-C6 is the residue of the following formula: [ka] The conjugate according to any one of Embodiments 29 to 39, wherein residue GN2-C6 is linked to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues shown in Figure 5D1 or Figure 5D2.

[0392] 41. The conjugate shown in Figure 1.

[0393] 42. The conjugate shown in Figure 2.

[0394] 43. The conjugate shown in Figure 3.

[0395] 44. The conjugate shown in Figure 4.

[0396] 45. A pharmaceutically acceptable salt of any one oligonucleotide from Embodiments 1 to 28 or any one of the conjugates described in Embodiments 29 to 44.

[0397] 46. ​​A pharmaceutical composition comprising an antisense oligonucleotide according to any one of Embodiments 1 to 28, a conjugate according to any one of Embodiments 29 to 44, or a pharmaceutically acceptable salt according to Embodiment 45, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0398] 47. An in vivo or in vitro method for regulating RTEL1 expression in target cells expressing RTEL1, comprising administering to the cells in an effective amount of an antisense oligonucleotide according to any one of Embodiments 1 to 28, a conjugate according to any one of Embodiments 29 to 44, a pharmaceutically acceptable salt according to Embodiment 45, or a pharmaceutical composition according to Embodiment 46.

[0399] 48. A method for treating or preventing a disease, comprising administering to a subject who is suffering from or susceptible to the disease a therapeutically effective amount or a preventively effective amount of an antisense oligonucleotide according to any one of Embodiments 1 to 28, a conjugate according to any one of Embodiments 29 to 44, a pharmaceutically acceptable salt according to Embodiment 45, or a pharmaceutical composition according to Embodiment 46, wherein the disease is hepatitis B virus (HBV) infection, for example, chronic HBV infection.

[0400] 49. An antisense oligonucleotide according to any one of Embodiments 1 to 28, a conjugate according to any one of Embodiments 29 to 44, a pharmaceutically acceptable salt according to Embodiment 45, or a pharmaceutical composition according to Embodiment 46, for use in a pharmaceutical.

[0401] 50. An antisense oligonucleotide according to any one of Embodiments 1 to 28, a conjugate according to any one of Embodiments 29 to 44, a pharmaceutically acceptable salt according to Embodiment 45, or a pharmaceutical composition according to Embodiment 46, for use in the treatment or prevention of hepatitis B virus (HBV) infection, such as chronic HBV infection.

[0402] 51. For the preparation of a pharmaceutical for the treatment or prevention of hepatitis B virus (HBV) infection, such as chronic HBV infection, an antisense oligonucleotide according to any one of Embodiments 1 to 28, a conjugate according to any one of Embodiments 29 to 44, a pharmaceutically acceptable salt according to Embodiment 45, or a pharmaceutical composition according to Embodiment 46. [Examples]

[0403] Materials and methods oligonucleotide synthesis

[0404] Oligonucleotide synthesis is generally known in the art. The following are applicable protocols. The oligonucleotides of the present invention may be produced by methods that differ slightly in terms of the apparatus, support, and concentration used.

[0405] Oligonucleotides are synthesized on a uridine universal support using the phosphoramidite approach of Oligomaker 48 on a 1 μmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support with aqueous ammonia at 60°C for 5–16 hours. The oligonucleotides are purified by reverse-phase HPLC (RP-HPLC) or solid-phase extraction, characterized by ULC, and their molecular weight is further confirmed by ESI-MS.

[0406] The coupling of β-cyanoethyl phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is carried out using a solution of 0.1 M 5'-O-DMT protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activators. In the final cycle, phosphoramidites with the desired modifications, such as a C6 linker for attaching a conjugate group, or such a conjugate group, can be used. Thiolation for introducing phosphoruthioate bonds is carried out using xanthan hydride (0.01 M in acetonitrile / pyridine 9:1). Phosphodiester bonds can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those commonly used in oligonucleotide synthesis.

[0407] In conjugation following solid-phase synthesis, a commercially available C6 aminolinker phoromamide can be used in the final cycle of solid-phase synthesis. After deprotection and cleavage from the solid support, the amino-bonded deprotected oligonucleotide is isolated. The conjugate is introduced by activation of the functional group using a standard synthetic method.

[0408] The crude compound is purified by RP-HPLC using a Phenomenex Jupiter® C18 10μ 150x10mm column. 0.1M ammonium acetate pH 8 and acetonitrile are used as buffers at a flow rate of 5 mL / min. The collected fractions are lyophilized to obtain the purified compound, typically as a white solid.

[0409] Abbreviation: DCI: 4,5-dicyanoimidazole DCM: Dichloromethane DMF: Dimethylformamide DMT: 4,4'-dimethoxytrityl THF: Tetrahydrofuran Bz: Benzoyl Ibu: Isobutyryl RP-HPLC: Reverse-phase high-performance liquid chromatography Primary human hepatocytes (PXB-PHH)

[0410] Fresh primary human hepatocytes (PXB-PHH) isolated from humanized mice (uPA / SCID mice) (referred to as PHH herein) were obtained in 96-well format from PhoenixBio Co.,Ltd (Japan) and cultured in modified hepatocyte clonal growth medium (dHCGM). dHCGM is a DMEM medium containing 100 U / ml penicillin, 100 μg / ml streptomycin, 20 mM Hepes, 44 mM NaHCO3, 15 μg / ml L-proline, 0.25 μg / ml insulin, 50 nM dexamethasone, 5 ng / ml EGF, 0.1 mM Asc-2P, 2% DMSO, and 10% FBS (Ishida et al., 2015).

[0411] Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2. The culture medium was changed every two days until harvesting, except on weekends.

[0412] HBV infection and oligonucleotide treatment PHH was incubated with 4% PEG at a multiple of infection (MOI) of 40 with HBV (purified from chronic hepatitis B (CHB) individuals) for 24 hours. The following day, the viral inoculation material was removed, the cells were washed three times with PBS, and then fresh culture medium was added.

[0413] Treatment with cccDNA-establishing compounds in PHH cells was initiated on day 3 post-HBV infection. Cells were administered in a 1:10 stepwise dose-response manner, starting with 10 μM. On days 3, 5, and 7 post-HBV infection, cells were administered oligonucleotide compounds in a final volume of 100 μI / well dHCGM medium. Treatment with 10 nM entecavir (ETV) was initiated on day 5 post-infection to ensure actual cccDNA detection by qPCR, and the medium containing 10 nM ETV was changed every two days (except weekends) until cells were collected on day 16 post-HBV infection. The experiment was performed in a biological triple series.

[0414] Real-time PCR of intracellular RTEL1 RNA In accordance with the manufacturer's protocol, the Qiagen BioRobot Universal System, and RNeasy 96-well extraction plate (RNeasy 96 BioRobot 8000 Kit (12) / Catalog number II D:967152) Total mRNA was extracted from cells using [a specific method]. mRNA expression levels were analyzed using real-time PCR with ABI QuantStudio® 12k Flex. β-actin (ACT B) was quantified by technical replication using qPCR with TaqMan Fast Advanced Master Mix (Life Technologies, catalog number 4444558). qPCR for the RTEL1 gene was performed using Fast SYBR® Green Master Mix (Life Technologies, catalog number 4385612). Results were normalized with human ACT B endogenous control. mRNA expression was analyzed using the comparative cycle threshold 2-ΔΔCt method, normalized to the reference gene ACT B and untreated cells. The primers used for quantification of ACTB RNA and RTEL1 RNA are listed in Table 7. [Table 7]

[0415] Quantification of HBV cccDNA DNA was extracted from HBV-infected primary human hepatocytes using SDS lysis buffer (50 mM Tris pH 8, 5 mM EDTA, 1% SDS). After lysing the cells with 80 μl of SDS lysis buffer, the samples were frozen at -80°C for at least 2 hours. The samples were thawed at 37°C, and 1 μl of proteinase K (Ambion biosciences catalog no. AM25448, 20 mg / mL stock) was added to each well of a 96-well plate. The samples were incubated at 56°C for 30 minutes. After incubation, three volumes of ChIP DNA binding buffer from the ZYMO Research Genomic DNA Clean & Concentrator kit (ZymoResearch, catalog no. D4067) were added, and the DNA was purified according to the manufacturer's protocol. The DNA was eluted with 20 μl of DNA elution buffer, and qPCR was performed using 2 μl of the DNA.

[0416] cccDNA expression levels were quantified by technical replication using the comparative cycle threshold 2-ΔΔCt method. Quantitative real-time polymerase chain reaction measurements were performed using the QuantStudio 12K Flex PCR System (Applied Biosystems). Normalization was performed against mitochondrial DNA (mitoDNA) and untreated cells as an endogenous control using Fast SYBR® Green Master Mix (Life Technologies, catalog no. 4385612). The cycler settings were adjusted to 5 minutes at 95°C, followed by 45 cycles of incubation at 95°C for 1 second and 60°C for 35 seconds. The primers used are listed in Table 8 below (all probes in the table are SYBR Green): [Table 8]

[0417] Example 1: Effect of RTEL1-targeting antisense oligonucleotides on RTEL1 RNA and cccDNA in HBV-infected PHH cells. The effects of RTEL1 knockdown on RTEL1 RNA and cccDNA were tested using the oligonucleotide compounds listed in Table 6. PHH cells were cultured as described in the Materials and Methods section. HBV-infected PHH cells were treated with the compounds listed in Table 6. After 16 days of treatment, RTEL1 mRNA and cccDNA were measured by qPCR as described above. The results are shown in Table 9 as a percentage of the mean drug-free control (NDC) sample (i.e., lower values ​​indicate greater inhibition / reduction). [Table 9] Regarding the compounds: Uppercase letters represent LNA nucleosides (using β-D-oxy LNA nucleosides), all LNA cytosines are 5-methylcytosine, and lowercase letters represent DNA nucleosides. All nucleoside bonds are phosphorothioate nucleoside bonds.

[0418] Example 2: In vitro efficacy testing of antisense oligonucleotides targeting RTEL1 mRNA in human MDA-MB-231 cell line at different concentrations for concentration-response curves.

[0419] Human MDA-MB-231 cell lines were purchased from ATCC and maintained in a humidified incubator at 37°C and 5% CO2, as recommended by the supplier. For the assay, 3500 cells / well were seeded into 96 multiwell plates in culture medium. After incubating the cells for 24 hours, oligonucleotides dissolved in PBS were added. The maximum screening concentration of oligonucleotides was 50 μM followed by eight 1:1 dilutions. Cells were harvested three days after oligonucleotide addition. RNA was extracted using the PureLink® Pro 96 RNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer's instructions and eluted with 50 μl of water. The RNA was then diluted 10-fold with DNase / RNase-free water (Gibco) and heated at 90°C for 1 minute.

[0420] Gene expression analysis was performed using One Step RT-qPCR in a double-strand setup with qScript® XLT One-Step RT-qPCR ToughMix® and Low ROX® (Quantabio). The following TaqMan primer assays were used for qPCR: RTEL1_Hs00249668_m1 [FAM-MGB] and the endogenous control GUSB_Hs99999908_m1 [VIC-MGB]. All primer sets were purchased from Thermo Fisher Scientific. IC50 determination was performed using GraphPad Prism 7.04 from n=2 biological replicas. Table 10 shows the relative RTEL1 mRNA levels as a percentage of the control (PBS-treated sample) after treatment with 50 μM oligonucleotides. [Table 10]

[0421] The compound exhibits excellent efficacy and potency for knockdown of human RTEL1 mRNA, as shown by the concentration-response curve in the human cell line MDA-MB-231 provided in Figure 7.

[0422] Example 3: Direct comparison of the in vivo efficacy of the compound of the present invention and a conventional compound. In this experiment, the compounds of the present invention (CMP ID numbers: 3_1, 4_1, 5_1, and 6_1, see Table 6, for example) were compared with compounds disclosed in International Publication No. 2020 / 011902A1. The prior art compounds tested are shown in Table 11 (CMP ID numbers: 7_1 to 23_1). Specifically, the effect on RTEL1 mRNA levels in human MDA-MB-231 cells was tested.

[0423] Human MDA-MB-231 cell line was purchased from ATCC and maintained in a humidified incubator at 37°C and 5% CO2 as recommended by the supplier. For the assay, 3500 cells / well were seeded into a 96-multiwell plate in culture medium. After incubating the cells for 24 hours, oligonucleotides dissolved in PBS were added. The maximum screening concentration of oligonucleotides was 50 μM followed by eight 1:1 dilutions. Cells were harvested three days after oligonucleotide addition. RNA was extracted using the PureLink® Pro 96 RNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer's instructions and eluted with 50 μl of water. The RNA was then diluted 10-fold with DNase / RNase-free water (Gibco) and heated at 90°C for 1 minute.

[0424] Gene expression analysis was performed using One Step RT-qPCR in a double-strand setup with qScript® XLT One-Step RT-qPCR ToughMix® and Low ROX® (Quantabio). The following TaqMan primer assays were used for qPCR: RTEL1_Hs00249668_m1 [FAM-MGB] and the endogenous control GUSB_Hs99999908_m1 [VIC-MGB]. All primer sets were purchased from Thermo Fisher Scientific. IC50 determination was performed using GraphPad Prism 7.04 from n=2 biological replicas. Table 11 shows the relative RTEL1 mRNA levels as a percentage of the control (PBS-treated sample) after treatment with 50 μM oligonucleotides. The results are also shown in Figure 8. [Table 11]

[0425] Example 4: Antisense oligonucleotide caspases were screened in HepG2 and 3T3 cells at a concentration of 100 nM for 24 hours.

[0426] In this experiment, the toxicity of the compounds of the present invention (CMP ID numbers 3_1, 4_1, 5_1, and 6_1, see, e.g., Table 6) was evaluated by caspase screening in HepG2 cells. The prior art compounds tested in Example 3 were included in this study. Furthermore, shorter metabolites of full-length CMP ID numbers 3_1 and 5_1 were analyzed (see Example 6 for further details).

[0427] HepG2 or 3T3 cells were cultured at approximately 70% confluence in MEM medium containing GlutaMax (Gibco no. 41090; HepG2) or DMEM (Gibco no. 31966) containing GlutaMax, supplemented with 10% thermoinactivated fetal bovine serum and completed in 5 mM HEPES (3T3). Cells were detached with 0.25% trypsin-EDTA solution (Gibco no. 25200056) and 1 × 10⁶ cells were cultured.4 Cells / well (HepG2) or 0.25 × 10 4 Cells were seeded at a density of cells / well (3T3) in a black, transparent 96-well plate (Corning No. 3904, New York, USA). 24 hours after seeding, cells were transiently transfected with Lipofectamine 2000 (Life Technologies No. 11668019) using a 100 nM oligonucleotide dissolved in Opti-MEM (Gibco No. 31985). Caspase-3 / 7 activity was determined using the Caspase-Glo® 3 / 7 assay (Promega Corporation, Madison, Wisconsin, USA). Reconstituted Caspase-Glo® 3 / 7 reagent was added to cells 24 hours after transfection, incubated for 60 minutes, and cell lysates were transferred to an opaque 96-well plate (Corning No. 3600, New York, USA). Luminescence was then determined using an Enspire multimode plate reader (Perkin Elmer) according to the manufacturer's instructions.

[0428] The results are shown in Table 12. [Table 12]

[0429] Compounds with an AW value exceeding 60% were considered toxic (T). Compounds with an AW value of 40-60% were considered moderately toxic (MT). Compounds with an AW value of 20-40% were considered mildly toxic (M). Compounds with an AW value less than 20% were considered non-toxic (NT).

[0430] As can be deduced from Table 12, compounds with CMP ID numbers 11_1(MT), 12_1(T), 13_1(MT), 14_1(MT), 15_1(T), 16_1(T), 17_1(T), 18_1(T), 19_1(T), 20_1(MT), 21_1, 22_1, and 23_1 exhibited moderate toxicity (MT) or toxicity (T), which allowed for the deselection of these compounds for further profiling.

[0431] Example 5: In vitro efficacy testing of full-length antisense oligonucleotides and their metabolites targeting RTEL1 mRNA in human MDA-MB-231 cell line at different concentrations for concentration-response curves.

[0432] Antisense oligonucleotides are known to be metabolized within cells. In this experiment, we will test the in vitro efficacy of full-length oligonucleotides from the 3' end and their metabolites (i.e., n-1, n-2, n-3, n-4, n-5, and n-6) in reducing the RTEL1 mRNA target.

[0433] Human MDA-MB-231 cell line was purchased from ATCC and maintained in a humidified incubator at 37°C and 5% CO2 as recommended by the supplier. For the assay, 3500 cells / well were seeded into a 96-multiwell plate in culture medium. After incubating the cells for 24 hours, oligonucleotides dissolved in PBS were added. The maximum screening concentration of oligonucleotides was 50 μM and then eight subsequent dilutions. Cells were harvested three days after the addition of oligonucleotides. RNA was extracted using the PureLink® Pro 96 RNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer's instructions and eluted with 50 μl of water. The RNA was then diluted 10-fold with DNase / RNase-free water (Gibco) and heated at 90°C for 1 minute.

[0434] Gene expression analysis was performed using One Step RT-qPCR in a double-strand setup with qScript® XLT One-Step RT-qPCR ToughMix® and Low ROX® (Quantabio). The following TaqMan primer assays were used for qPCR: RTEL1_Hs01548056_m1[FAM-MGB] and the endogenous control GUSB_Hs99999908_m1 [VIC-MGB]. All primer sets were purchased from Thermo Fisher Scientific. Relative RTEL1 mRNA levels are shown as a percentage of the control (PBS-treated sample), and IC50 is calculated. 50 This was determined using GraphPad Prism 7.04.

[0435] The results are shown in Figure 9 and Table 13. [Table 13]

[0436] As can be deduced from Table 13 and Figure 9a, the full-length oligonucleotide CMP 5_1 is 0.6 μM IC2. 50It has the following advantages: the first and second metabolites (CMP 5_1-1 and CMP 5_1-2) retain similar target knockdown activity and IC 50 These concentrations are 0.4 μM and 0.7 μM, respectively, and thereafter, further metabolites (n-3 to n-6) show a decrease in maximum potency and potency. For all other compounds, the n-1 and n-2 metabolites already show a significant loss of potency and / or maximum potency compared to their respective full-length compounds.

[0437] Example 6: In vivo study of CMP 5_1-GalNAc antisense oligonucleotide Research Schedule This study was conducted in HBV-infected PXB mice (registered trademark), a chimeric mouse model (PhoenixBio) with stable human hepatocyte engraftment, using three groups of 20 animals each (vehicle, CMPD 3_1_GalNAc, CMPD 5_1_GalNAc) for a total of 77 days. The animals were administered weekly with 10 mg / kg of the compound or an equivalent amount of vehicle. Five animals from each group were sacrificed on days 28 and 56, respectively. On day 77, the remaining animals were subjected to bioanalysis, and subsequently, the livers of the animals were analyzed. The study protocol is shown in Figure 10.

[0438] Methods and materials GalNAc conjugates for CMP 3_1 and CMP 5_1 were generated by methods known in the art (e.g., Javanbakh et al. Liver-Targeted Anti-HBV Single-Stranded Oligonucleotides with Locked Nucleic Acid Potently Reduce HBV Gene Expression In Vivo. Mol Ther Nucleic Acids. 2018 Jun 1;11:441-454.doi:10.1016 / j.omtn.2018.02.005.Epub 2018 Feb 23.PMID:29858079;PMCID:PMC5992345). The generated conjugates are shown in Figures 1 and 4, respectively.

[0439] Animals and handling HBV genotype C-infected human liver chimeric uPA / SCID mice (PXB mice; donor hepatocytes BD195 (Corning Incorporated)) were purchased from PhoenixBio Co., Ltd. Animal handling was performed locally by PhoenixBio Co., Ltd. in Higashihiroshima, Japan. Male mice were selected for the study that were at least 20 weeks old at the start of treatment (day 0) and had a body weight of 18g or more as determined the day before the start of treatment (-1 day). The mice were infected with HBV genotype C (code number: PBB004, lot: 180118, PhoenixBio Co., Ltd.) at least 6 weeks prior to the start of treatment, and were determined to be >1x10 by qPCR on -7 day. 6 Serum HBV-DNA levels were expressed in copies / ml. Group randomization at baseline was determined on day 1 based on the arithmetic mean of body weight and the geometric mean of blood h-album concentration and serum HBV-DNA concentration.

[0440] All doses of 10 mg / kg were calculated on the day of administration based on the individual body weight of the mouse prior to administration. All subject mice received injections of the dose formulation into the subcutaneous tissue of the neck in the upper back using a disposable 1.0 mL syringe (Terumo Corporation) with a needle that could not be removed, on days 0, 7, 14, 28, 35, 42, 49, 56, 63, and 70.

[0441] On each slaughter day, the target animals were anesthetized with isoflurane and slaughtered by cardiac puncture and blood loss. The livers were removed, and the lateral left lobe was divided into small pieces of approximately 100 mg each. The exact weight was recorded, and the liver samples were rapidly frozen in liquid nitrogen and stored at -80°C until further processing.

[0442] Animals showing signs of being near death or having lost more than 20% of their initial body weight were euthanized as needed. All animals that died prematurely, as well as mice with thymoma / lymphoma at the time of euthanasia, were excluded from the analysis.

[0443] Quantification of RTEL1 mRNA expression Liver tissue samples were kept frozen until dissolved in MagNA Pure LC RNA Isolation Tissue Lysis Buffer (product number 03604721001, Roche). RNA extraction was then continued on a MagNA Pure 96 Instrument (Roche) using the MagNA Pure 96 Cellular RNA Large Volume Kit (product number 05467535001, Roche) according to the user manual, and the RNA concentration was adjusted with water.

[0444] Gene expression analysis was performed using One-Step RT-qPCR with qScript® XLT One-Step RT-qPCR ToughMix® and Low ROX® (Quantabio). The following TaqMan primer assays were used for qPCR: Hs01548056_m1; Hs00249680_m1; Hs00249668_m1 and the reference genes GAPDH_Hs99999905_m1; PGK1_Hs99999906_m1 and GUSB_Hs99999908_m1. All primer sets were purchased from Thermo Fisher Scientific. Relative mRNA expression levels are shown as a percentage relative to the control group treated with physiological saline.

[0445] The results are shown in Figure 11. This analysis shows that weekly administration of 10 mg / kg of CMP3_1_GalNAc resulted in approximately 80% knockdown efficacy, and weekly administration of 10 mg / kg of CMP5_1_GalNAc resulted in approximately 95% knockdown efficacy.

[0446] Example 7: In vitro study in primary human hepatocytes Methods and materials cell culture Primary human hepatocytes (PHH) isolated by collagenase perfusion from chimeric urokinase-type plasminogen activator / severe combined immunodeficiency (uPA / SCID) mice with humanized livers were obtained from PhoenixBio (Hiroshima, Japan). PHH were divided into 7 × 10⁶ cells in modified hepatocyte clonal growth medium (dHCGM). 4 Cells were seeded in type I collagen-coated 96-well plates at a cell / well concentration. The dHCGM medium was DMEM medium (Ishida et al., 2015) containing 100 U / ml penicillin, 100 μg / ml streptomycin, 20 mM Hepes, 44 mM NaHCO3, 15 μg / ml L-proline, 0.25 μg / ml insulin, 50 nM dexamethasone, 5 ng / ml EGF, 0.1 mM Asc-2P, 2% DMSO, and 10% FBS.

[0447] Cells were cultured at 37°C in a humidified atmosphere containing 5% CO2. The culture medium was changed every two days until harvesting, except on weekends.

[0448] Next, HBV genotype C with a multiple of infection (MOI) of 40 was added to cells in a 96-well plate at a final concentration of 4% PEG 8000 (Sigma-Aldrich). Infected cells were incubated at 37°C for 20 hours, then washed twice with PBS to remove the HBV inoculum, and refilled with complete medium. On post-infection day 4, cells were treated with different concentrations of LNA. On post-infection days 6 and 8, the medium was replaced with fresh LNA. Phosphate-buffered saline (PBS) was used as a "no-drug" control (NDC). Supernatants and cells were collected and used for HBV marker and target knockdown analysis on post-infection day 19.

[0449] The cytotoxicity of LNA was evaluated using Cell Counting Kit 8 (Sigma-Aldrich) according to the manufacturer's protocol and expressed as % cytotoxicity against NDC.

[0450] RNA extraction and real-time quantitative PCR Intracellular mRNA was extracted from cells using the MagNA Pure 96 robot and the MagNA Pure 96 Cellular RNA Large Volume Kit (Roche) according to the manufacturer's protocol. Relative total HBV, RTEL1, pgRNA, and β-glucuronidase (GusB) endogenous control mRNA were quantified by technical replication using the TaqMan RNA-to-Ct 1-Step Kit (Applied Biosystems, No. 4392938) on a QuantStudio 12 K Flex (Life Technologies). mRNA expression was analyzed using the comparative cycle threshold 2-ΔΔCt method normalized against the reference gene GusB and a drug-free control. The TaqMan primers and assay IDs were as follows: RTEL1, Hs02568623_s1; Total HBV RNA Pa03453406_s1; HBV pgRNA AILJKX5. Hs00939627_m1 was used as the reference gene GusB. All primer and probe sets were obtained from ThermoFisher.

[0451] The results for 25 μM antisense oligonucleotides are shown in Table 14, which include, among other things, information regarding cytotoxicity and RTEL1 mRNA knockdown. CMP 10_1 shows high cytotoxicity and low efficacy in targeting RTEL1 mRNA. Furthermore, CMP9_1 shows the second lowest knockdown of RTEL1 mRNA with 57% residual RTEL1 mRNA. [Table 14]

[0452] The results for 5 μM antisense oligonucleotides are shown in Table 15. CMP10_1 shows low efficacy in targeting RTEL1 mRNA. Furthermore, CMP9_1 again shows the second lowest knockdown of RTEL1 mRNA with 79% residual RTEL1 mRNA. [Table 15]

[0453] Example 8: In vivo proof of concept of CMP5_1-GalNAc Research Schedule The study was conducted using HBV-infected PXB mice (registered trademark), a chimeric mouse model (PhoenixBio) in which human hepatocytes were stably engrafted, which were sacrificed on days 56 and 105. CMP5_1-GalNac was evaluated after eight weekly doses of 5, 10, and 20 mg / kg (day 56, see Figure 12). Furthermore, CMP5_1-GalNac was evaluated again after 15 weekly doses of 10 mg / kg (day 105). Each group had a separate vehicle control arm administered the same volume of vehicle as the treated animals. All groups were 6 mice in size at the start of the study. Biological analyses were performed on the livers of the animals.

[0454] Methods and materials Animals and handling HBV genotype C-infected human liver chimeric uPA / SCID mice (PXB mice; donor hepatocytes BD 195 (Corning)) were purchased from PhoenixBio Co., Ltd. Animal handling was performed by LSIM Safety Institute Corporation in Uto, Japan. Male mice were selected for the study that were at least 25 weeks old at the start of treatment (day 0) and had a body weight of 18g or more as determined the day before the start of treatment (-1 day). The mice were infected with HBV genotype C (code number: PBB004, lot: 180118, PhoenixBio Co., Ltd.) at least 6 weeks prior to the start of treatment, and were determined to be >1x10 by qPCR on -7 day. 6 Serum HBV-DNA levels were shown in copies / ml. Stratification and randomization were performed at the start of the study on day 1 based on body weight, blood h-alb concentration, and serum HBV-DNA concentration.

[0455] All doses were calculated based on the individual body weight of the mouse prior to administration on the day of administration. All subject mice received injections of the dose formulation into the subcutaneous tissue of the neck in the upper back or the corresponding vehicle. Animals sacrificed on day 56 were injected on days 0, 7, 14, 21, 28, 35, 42, and 49 (see Figure 12). To avoid ASGPR overload in the chimeric liver, a dose of 20 mg / kg / week was administered in two consecutive injections of 10 mg / kg. These mice were therefore administered on days 0, 1, 7, 8, 14, 15, 21, 22, 28, 29, 35, 36, 42, 43, 49, and 50. Animals slaughtered on day 105 were administered 10 mg / kg on days 0, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, and 98 (see Figure 12) using disposable 1.0 mL syringes with needles that could not be removed (Terumo Corporation).

[0456] On each slaughter day, the target animals were anesthetized with isoflurane and slaughtered by cardiac puncture and blood loss. The livers were removed, and the lateral left lobe was divided into small pieces of approximately 100 mg each. The exact weight was recorded, and the liver samples were rapidly frozen in liquid nitrogen and stored at -80°C until further processing.

[0457] Animals showing signs of being near death or having lost more than 20% of their initial body weight were euthanized as needed. All animals that died prematurely, as well as mice with thymoma / lymphoma at the time of euthanasia, were excluded from the analysis.

[0458] Determination of cccDNA by Southern blot analysis Liver tissue was kept frozen until homogenized in DNA extraction buffer (50 mM Tris pH 8, 5 mM EDTA, 150 mM NaCl, 1% SDS). First, the extract was digested with an RNase cocktail (ThermoFisher) at ambient temperature for 30 minutes, followed by digestion with proteinase K (ThermoFisher) at 56°C for 2 hours with gentle stirring. The debris was pelletized by centrifugation, and DNA was extracted from the supernatant by shaking three times with 1 volume of UltraPure buffer saturated phenol (ThermoFisher), followed by extraction with 1 volume of phenol:chloroform:isoamyl alcohol (25:24:1;ThermoFisher). Next, the DNA was precipitated by adding 1 volume of 100% ethanol and 60 mM (final) NaAc (SigmaAldrich) overnight at -20°C. Next, the DNA is pelletized by centrifugation, washed with 70% ethanol, air-dried, and then resuspended in 10 mM Tris-HCl pH 8 (ThermoFisher).

[0459] DNA content is quantified using NanoDrop (ThermoFisher) and the concentration is normalized to 1.5 μg / μl. Then, 30 μg of DNA is digested with 70 U T5 exonuclease (New England Biolabs) in 1× CutSmart buffer (New England Biolabs) for 2 hours at 37°C. For each sample, an equal volume is mixed with Blue Juice loading buffer (ThermoFisher) and loaded onto a 0.95% agarose-TAE gel (SigmaAldrich). Between all (biological) groups of samples, one lane loaded with DNA molecular weight marker VII (Roche) is added (the same amount in each lane). After separation, the gel is transferred to fresh 0.2 M HCl (Acros Organics) for 10 minutes, then rinsed three times with water. Subsequently, the gel is placed in denaturation buffer (0.5 M NaOH, 1.5 M NaCl) for 30 minutes and rinsed once with water. Next, transfer the gel to a neutralizing buffer (0.5 M Tris pH 7.5, 1.5 M NaCl) for 30 minutes. Finally, equilibrate the gel in 20 × SSC buffer (ThermoFisher) for 30 minutes. Then, transfer the DNA to a Hybond-XL membrane (Cytiva) using a TurboBlotter kit (Cytiva) according to the manufacturer's instructions, using 20 × SSC buffer (ThermoFisher) for overnight transfer. After transfer, crosslink the DNA to the membrane by irradiation with 1800 J of UV radiation and dry the membrane.

[0460] For specific detection of HBV cccDNA, use the DIG nucleic acid detection kit with DIG EasyHyb buffer and DIG wash and blocking buffer set (all Roche) according to the manufacturer's instructions. Generate the probe by PCR using the DIG PCR probe kit (Roche) according to the manufacturer's instructions. Use the plasmid containing the HBV genotype C genome as a template with the following primers: forward, GTTTTTCACCTCTGCCTAATCATC (SEQ ID NO: 70); reverse, GCAAAAAGTTGCATGGTGCTGGT (SEQ ID NO: 71).

[0461] Hybridization is performed using probes that have been denatured at 100°C for 5 minutes and then rapidly cooled to 4°C overnight at 37°C. Washing and detection are performed according to the manufacturer's instructions. Images are acquired using a FUSION FX system (Vilber) with appropriate exposure times set for detecting cccDNA in the vehicle control sample. For analysis, the cccDNA band (2.1kB size) is quantified using ImageStudio software (Licor). To account for heterogeneous transcription, the 2.8kB band of DNA molecular weight marker VII is also quantified, and the cccDNA band intensity is normalized to the average intensity of the two bands constituting the group. Then, the individual values ​​are normalized to the average band intensity of the vehicle control group.

[0462] RTEL1 mRNA analysis Liver tissue samples were kept frozen until dissolved in MagNA Pure LC RNA Isolation Tissue Lysis Buffer (product number 03604721001, Roche). RNA extraction was then continued on a MagNA Pure 96 Instrument (Roche) using the MagNA Pure 96 Cellular RNA Large Volume Kit (product number 05467535001, Roche) according to the user manual, and the RNA concentration was adjusted with water.

[0463] Gene expression analysis was performed using One-Step RT-qPCR with qScript® XLT One-Step RT-qPCR ToughMix® and Low ROX® (Quantabio). The following TaqMan primer assays were used for qPCR: Hs01548056_m1; Hs00249680_m1; Hs00249668_m1 and the reference genes GAPDH_Hs99999905_m1; PGK1_Hs99999906_m1 and GUSB_Hs99999908_m1. All primer sets were purchased from Thermo Fisher Scientific. Relative mRNA expression levels are shown as a percentage relative to the control group treated with physiological saline.

[0464] Figure 13A shows an example where weekly administration of CMP5_1-GalNAc for 105 days reduced RTEL1 mRNA by approximately 15% and cccDNA by approximately 20%.

[0465] Figure 13B shows the 87%, 91%, and 97% knockdown of RTEL1 mRNA after weekly administration of 5, 10, and 20 mg / kg of CMP5_1-GalNac, respectively, on day 56. cccDNA was reduced by 59% and 73% for 10 and 20 mg / kg of CMP5_1-GalNac, respectively.

[0466] Conclusion: From the above examples, CMP ID 5_1 represents a safe and effective compound for targeting RTEL1 mRNA both in vivo and in vitro. The inventors present here the preferred in vitro drug property profile of CMP ID 5_1 and demonstrate that it can very efficiently engage RTEL1 targeting in vivo and subsequently reduce viral cccDNA. In addition, the inventors demonstrated that downregulation of RTEL1 mRNA can induce a significant dose-dependent effect on viral cccDNA using a humanized mouse model of hepatitis B infection. Furthermore, compound 5_1 has the property of retaining activity even after degradation from the 3' end. This means that n-1 and n-2 from the 3' end have comparable in vitro potency compared to full-length CMP ID 5_1. n-3 degradation also retains activity against RTEL1, although with lower in vitro potency. This profile provides a clear benefit to the molecule, as the metabolites of the parent molecule still induce the desired effect against RTEL1 mRNA.

Claims

1. It is an antisense oligonucleotide, TTacatactctggtCAAAA (Sequence ID 5), AATTTttacatactctgGT (Sequence ID 3), AAtttttacatactctGGTC (Sequence ID 4), and CTttattataaactTgaAtCTC (Sequence ID 6) Selected from a group of antisense oligonucleotides consisting of, The uppercase letters represent beta-D-oxycrosslinked nucleic acid nucleosides, the lowercase letters represent DNA nucleosides, all crosslinked nucleic acids C is 5-methylcytosine, and all nucleoside-to-nucleoside bonds are phosphorothioate nucleoside-to-nucleoside bonds; these are antisense oligonucleotides.

2. A conjugate comprising an antisense oligonucleotide according to claim 1 and at least one conjugate portion covalently bonded to the antisense oligonucleotide, wherein the conjugate portion is the following GalNAc portion: 【Chemistry 1】 【Chemistry 2】 【Transformation 3】 【Chemistry 4】 【Transformation 5】 【Transformation 6】 【Transformation 7】 【Transformation 8】 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】 【Chemistry 12】 【Chemistry 13】 【Chemistry 14】 【Chemistry 15】 【Chemistry 16】 A conjugate selected from one of the following options.

3. The conjugate according to claim 2, wherein at least one conjugate portion is capable of binding to an asialoclycoprotein receptor.

4. The aforementioned conjugate portion is as follows: 【Chemistry 17】 The trivalent GalNAc portion, as follows: [Chemistry 18] The conjugate according to claim 2 or 3, which is the trivalent GalNAc portion or a mixture of both.

5. The conjugate according to any one of claims 2 to 4, comprising a linker located between the antisense oligonucleotide and the conjugate portion.

6. The conjugate according to claim 5, wherein the linker comprises or consists of 2 to 5 consecutive phosphodiester bonded nucleosides.

7. The following: 【Chemistry 19】 【Chemistry 20】 【Chemistry 21】 【Chemistry 22】 A conjugate selected from the group of conjugates shown.

8. A pharmaceutically acceptable salt of the antisense oligonucleotide according to claim 1, or the conjugate according to any one of claims 2 to 7.

9. A pharmaceutical composition comprising an antisense oligonucleotide according to claim 1, a conjugate according to any one of claims 2 to 7, or a pharmaceutically acceptable salt according to claim 8, and a pharmaceutically acceptable diluent, solvent, carrier and / or adjuvant.

10. An antisense oligonucleotide according to claim 1, a conjugate according to any one of claims 2 to 7, a pharmaceutically acceptable salt according to claim 8, or a pharmaceutical composition according to claim 9, for use in an in vivo or in vitro method for regulating RTEL1 expression in target cells expressing RTEL1, wherein the method comprises administering an effective amount of the antisense oligonucleotide according to claim 1, a conjugate according to any one of claims 2 to 7, a pharmaceutically acceptable salt according to claim 8, or the pharmaceutical composition according to claim 9 to the cells.

11. An antisense oligonucleotide, conjugate, pharmaceutically acceptable salt, or pharmaceutical composition according to claim 9, for use in a method for treating or preventing a disease, comprising administering to a subject a therapeutically effective amount or a preventively effective amount of the antisense oligonucleotide, conjugate, conjugate, pharmaceutically acceptable salt, or pharmaceutical composition according to claim 9, wherein the disease is hepatitis B virus (HBV) infection or chronic HBV infection.

12. An antisense oligonucleotide according to claim 1, a conjugate according to any one of claims 2 to 7, a pharmaceutically acceptable salt according to claim 8, or a pharmaceutical composition according to claim 9, for use in a drug.

13. An antisense oligonucleotide according to claim 1, a conjugate according to any one of claims 2 to 7, a pharmaceutically acceptable salt according to claim 8, or a pharmaceutical composition according to claim 9, for use in the treatment or prevention of hepatitis B virus (HBV) infection or chronic HBV infection.

14. Use of an antisense oligonucleotide according to claim 1, a conjugate according to any one of claims 2 to 7, a pharmaceutically acceptable salt according to claim 8, or a pharmaceutical composition according to claim 9 for the preparation of a pharmaceutical for treating or preventing hepatitis B virus (HBV) infection or chronic HBV infection.

Images