tRNA, aminoacyl-tRNA, reagents for polypeptide synthesis, methods for introducing unnatural amino acids, methods for producing polypeptides, methods for producing nucleic acid display libraries, nucleic acid-polypeptide conjugates, and screening methods

Abstract

The present invention provides tRNA produced by modifying the tRNA for tryptophan from Mycoplasma pneumoniae. The anticodon of the tRNA is UUA, and the tRNA pairs with the UAA codon. The present invention also provides a use for the tRNA.

Description

[Technical Field]

[0001] The present disclosure relates to tRNAs, aminoacyl tRNAs, reagents for polypeptide synthesis, methods for introducing unnatural amino acids, methods for producing polypeptides, methods for producing nucleic acid display libraries, nucleic acid-polypeptide conjugates, and screening methods. [Background Art]

[0002] Polypeptides into which unnatural amino acids (also referred to as special amino acids) have been introduced are attracting attention as drug candidates. Patent Document 1 discloses a method in which tRNA is acylated with a special amino acid using an artificial aminoacylation catalyst, a library of special polypeptides is produced by a cell-free translation system containing the tRNA acylated with the special amino acid, and special polypeptides that bind to a target protein are screened. Patent Document 2 discloses a method for producing and a method for screening a cyclic peptide compound excellent in cell membrane permeability. Patent Document 3 discloses a modified tRNA which is a tryptophan tRNA of *Mycoplasma capricolum*, has CUA as an anticodon and pairs with a UAG codon, and a method for introducing an unnatural amino acid into a polypeptide using the tRNA. [Prior Art Documents] [Patent Documents]

[0003] [Patent Document 1] Japanese Unexamined Patent Application Publication No. 2012-058092 [Patent Document 2] International Publication No. WO 2018 / 174078 [Patent Document 3] International Publication No. WO 2007 / 055429 [Summary of the Invention] [Problem to be Solved by the Invention]

[0004] The object of this disclosure is to provide tRNA and aminoacyl-tRNA that translate UAA codons into amino acids, a reagent for polypeptide synthesis that introduces at least two non-natural amino acids into a polypeptide, a method for introducing non-natural amino acids, a method for producing polypeptides, a method for producing nucleic acid display libraries, a nucleic acid-polypeptide conjugate into which at least two non-natural amino acids have been introduced, and a screening method for finding polypeptides with desired activity from among polypeptides into which at least two non-natural amino acids have been introduced. [Means for solving the problem]

[0005] The following are examples of specific means for solving the problem:

[0006] <1> A modified tRNA for tryptophan from Mycoplasma pneumoniae, which has UUA as its anticodon and pairs with the UAA codon. <2> The base adjacent to the 5' end of the CCA terminus is A or G. <1> The tRNA described above. <3> The combination of the third base from the 5' end and the base that pairs with it is UA, GU, or UG. <1> or <2> The tRNA described above. <4> The combination of the fourth base from the 5' end and the base that pairs with it is GU. <1> or <2> The tRNA described above. <5> A tRNA having one nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, 13, 15, and 17. <6> <1> ~ <5> An aminoacyl-tRNA in which an amino acid is bound to a tRNA described in any one of the items. <7> The amino acid is one selected from the group consisting of unnatural amino acids, modified amino acids, and their derivatives. <6> The aminoacyl-tRNA described above. <8> The amino acid is one selected from the group consisting of chloroacetylated lysine, N-methylalanine, N-methylphenylalanine, and fluorescently labeled amino acids. <6> The aminoacyl-tRNA described above. <9> A modified tRNA for tryptophan from Mycoplasma capricolum, which has CUA as an anticodon and pairs with the UAG codon, A polypeptide synthesis reagent comprising a modified tRNA for tryptophan from Mycoplasma pneumoniae, which has UUA as an anticodon and pairs with a UAA codon. <10> A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as the anticodon and pairing with the UAG codon, is an aminoacyl-tRNA. A polypeptide synthesis reagent comprising: an aminoacyl-tRNA, which is a modified tRNA for tryptophan from Mycoplasma pneumoniae, having UUA as an anticodon and pairing with a UAA codon, to which a second non-natural amino acid is bound; and an aminoacyl-tRNA. <11> A method for introducing at least two non-natural amino acids into a polypeptide, Nucleic acids having a base sequence including UAG codons and UAA codons, A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as the anticodon and pairing with the UAG codon, is an aminoacyl-tRNA. A modified tRNA for tryptophan from Mycoplasma pneumoniae, which has UUA as an anticodon and pairs with the UAA codon, and an aminoacyl-tRNA to which a second non-natural amino acid is bound, A method for introducing non-natural amino acids, comprising expressing polypeptides from nucleic acids using a cell-free peptide synthesis system containing [a specific substance]. <12> The base sequence further includes the UGA codon, which is a stop codon. <11> The method for introducing non-natural amino acids as described above. <13> A method for producing a polypeptide containing at least two types of unnatural amino acids in its amino acid sequence, Nucleic acids having a base sequence including UAG codons and UAA codons, A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as the anticodon and pairing with the UAG codon, is an aminoacyl-tRNA. A modified tRNA for tryptophan from Mycoplasma pneumoniae, which has UUA as an anticodon and pairs with the UAA codon, and an aminoacyl-tRNA to which a second non-natural amino acid is bound, A method for producing polypeptides, comprising expressing polypeptides from nucleic acids using a cell-free peptide synthesis system containing [a specific substance]. <14> The base sequence further includes the UGA codon, which is a stop codon. <13> The method for preparing the polypeptide described in [the document]. <15> Nucleic acids having a base sequence including UAG codons and UAA codons, A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as the anticodon and pairing with the UAG codon, is an aminoacyl-tRNA. A modified tRNA for tryptophan from Mycoplasma pneumoniae, which has UUA as an anticodon and pairs with the UAA codon, and an aminoacyl-tRNA to which a second non-natural amino acid is bound, A method for preparing a nucleic acid display library, comprising expressing polypeptides from nucleic acids using a cell-free peptide synthesis system containing [a specific substance], and producing nucleic acid-polypeptide conjugates. <16> The process of producing nucleic acid-polypeptide conjugates includes producing mRNA-polypeptide conjugates and reverse transcribing the mRNA of the mRNA-polypeptide conjugate to produce cDNA-polypeptide conjugates. <15> The method for preparing nucleic acid display libraries as described above. <17> In nucleic acid-polypeptide conjugates, the nucleic acid and polypeptide are linked by a puromycin linker. <15> or <16> The method for preparing nucleic acid display libraries as described above. <18> A nucleic acid-polypeptide conjugate comprising a polypeptide containing at least two non-natural amino acids in its amino acid sequence and a nucleic acid having a base sequence encoding the polypeptide, The base sequence includes UAG codons and UAA codons, In the base sequence, the UAG codon codes for the first non-natural amino acid in the polypeptide. A nucleic acid-polypeptide conjugate in which the UAA codon in the base sequence encodes a second non-natural amino acid in the polypeptide. <19> It is an mRNA-polypeptide conjugate or a cDNA-polypeptide conjugate. <18> The nucleic acid-polypeptide conjugate described above. <20> <15> ~ <17> A nucleic acid display library is prepared by the method for preparing a nucleic acid display library described in any one of the items, A screening method comprising selecting a nucleic acid-polypeptide conjugate having desired activity from a nucleic acid display library, and identifying the base sequence of the nucleic acid of the selected nucleic acid-polypeptide conjugate. [Effects of the Invention]

[0007] According to the present disclosure, there are provided: a tRNA that translates a UAA codon into an amino acid and an aminoacyl-tRNA; a reagent for polypeptide synthesis that introduces at least two types of non-natural amino acids into a polypeptide; a method for introducing a non-natural amino acid, a method for producing a polypeptide, and a method for producing a nucleic acid display library; a nucleic acid-polypeptide conjugate in which at least two types of non-natural amino acids are introduced into a polypeptide; and a screening method for finding a polypeptide having a target activity from polypeptides into which at least two types of non-natural amino acids are introduced. [Brief Description of Drawings]

[0008] [Figure 1] FIG. 1 is a schematic diagram of a cloverleaf structure, showing an example embodiment of the tRNA of the present disclosure. [Figure 2] FIG. 2 is an electrophoresis gel of tRNA fixed with formamide. [Figure 3] FIG. 3 is an electrophoresis gel of a polypeptide into which a fluorescently labeled amino acid and N-methylphenylalanine are multiply introduced. [Figure 4] FIG. 4 is an electrophoresis gel of an mRNA display into which a fluorescently labeled amino acid and N-methylphenylalanine are multiply introduced. [Mode for Carrying Out the Invention]

[0009] Hereinafter, embodiments of the present disclosure will be described. These descriptions and examples are illustrative of the embodiments, and do not limit the scope of the embodiments. The mechanism of action described in the present disclosure includes estimation, and its correctness or incorrectness does not limit the scope of the embodiments.

[0010] In the present disclosure, a numerical range indicated using "~" represents a range including the numerical values described before and after "~" as the minimum value and the maximum value, respectively. In numerical ranges described in stages within this disclosure, the upper or lower limit of one numerical range may be replaced with the upper or lower limit of another numerical range described in stages. Furthermore, in numerical ranges described within this disclosure, the upper or lower limit of that range may be replaced with the values ​​shown in the examples.

[0011] In this disclosure, each component may contain multiple types of the corresponding substance. When referring to the amount of each component in a composition in this disclosure, if there are multiple types of the substance corresponding to each component in the composition, it means the total amount of the multiple types of substances present in the composition unless otherwise specified.

[0012] In this disclosure, polypeptide refers to a molecule in which amino acids are linked by peptide bonds. There is no limit to the number of amino acid residues in a polypeptide, and polypeptide is a term that includes proteins. Preferably, polypeptides in this disclosure have six or more amino acid residues. Polypeptides include polypeptides in which amino acids have undergone post-translational modification. Examples of post-translational modification of amino acids include phosphorylation, methylation, and acetylation.

[0013] In this disclosure, nucleic acid refers to a molecule that carries the information for the synthesis of polypeptides. The term nucleic acid includes all nucleic acids (e.g., DNA, RNA, their analogues, natural products, and artifacts) and all nucleic acids to which small molecules, groups, non-nucleic acid molecules, structures, etc., are linked. Nucleic acids may be single-stranded or double-stranded.

[0014] The nucleotide sequences of the tRNAs identified by the sequence numbers in this disclosure are shown in Table 1. Sequence IDs 2 and 5-17 are modified versions of tryptophan-producing tRNA from Mycoplasma pneumoniae. Sequence ID 18 is the wild-type tryptophan tRNA of Mycoplasma pneumoniae. Sequence IDs 1 and 19 are modified tryptophan-producing tRNAs from Mycoplasma capricolum. Sequence ID 3 is a modified tRNA for tryptophan from Staphylococcus aureus. Sequence ID No. 4 is a modified tRNA for tryptophan from Shewanella oneidensis. In Table 1, anticodons are underlined, and the bases that differ from the wild-type tryptophan tRNA for each microorganism are italicized.

[0015] [Table 1]

[0016] tRNAs found in nature have a range of base numbers from 70 to 90. Typical tRNAs have 76 bases. The base positions listed in the remarks column of Table 1 are those identified in comparison to a typical tRNA with 76 bases. For example, sequence number 2 has 74 bases, but the position at the 3' end is identified as base number 76, and the position adjacent to the 5' side of the CCA end is identified as base number 73.

[0017] <trna> The tRNA disclosed herein is a modified tRNA for tryptophan from Mycoplasma pneumoniae, having UUA as the anticodon and pairing with the UAA codon. The tRNA disclosed herein translates the UAA codon into an amino acid.

[0018] Mycoplasma pneumoniae has two types of wild-type tryptophan tRNA (Nucleic Acids Res. 1993 Oct 25; 21(21): 4967-4974). The tRNA of this disclosure includes any variant of either of the two wild-type tryptophan tRNAs. Preferably, the tRNA of this disclosure is a modified version of the wild-type tryptophan tRNA shown in SEQ ID NO: 18.

[0019] The tRNA disclosed herein is a tRNA obtained by modifying the anticodon of wild-type tryptophan tRNA of Mycoplasma pneumoniae from CCA to UUA. This modification gives the tRNA disclosed herein the function of translating the UAA codon into an amino acid.

[0020] The inventors of this disclosure modified and examined wild-type tryptophan tRNAs from various microorganisms and found that a modified tryptophan tRNA from Mycoplasma pneumoniae efficiently translates UAA codons into amino acids.

[0021] The tRNA of this disclosure is preferably a modified form of wild-type tryptophan tRNA of Mycoplasma pneumoniae, in which the acceptor stem has been modified in addition to the anticodon. It is presumed that the modification of the acceptor stem affects the higher-order structure of the tRNA and increases the efficiency of the peptidyl transfer reaction in ribosomes. Examples of acceptor stem modifications include modification of the base adjacent to the 5' end of the CCA terminus; modification of the combination of the third base from the 5' end and the base that pairs with this base; and modification of the combination of the fourth base from the 5' end and the base that pairs with this base.

[0022] The CCA terminus of tRNA is a set of three bases that are universally present at the 3' end of tRNA. Pairing within tRNA refers to the process where base pairs face each other in the cloverleaf structure of tRNA.

[0023] Figure 1 is a diagram showing an example of an embodiment of the tRNA of this disclosure, and is a schematic diagram of the cloverleaf structure. Figure 1 illustrates examples of modifications to the base adjacent to the 5' end of the CCA (base number 73), an example of modifications to the combination of the third base from the 5' end and the base that pairs with it (base number 70), and an example of modifications to the combination of the fourth base from the 5' end and the base that pairs with it (base number 69).

[0024] From the viewpoint of efficiently translating UAA codons into amino acids, the tRNA of this disclosure preferably comprises at least one form selected from the group consisting of the following forms (1), (2), and (3).

[0025] Morphology (1): The base adjacent to the 5' end of the CCA terminus is either A or G. Morphology (2): The combination of the third base from the 5' end and the base that pairs with it is UA, GU, or UG. Here, when describing two bases, the third base from the 5' end is described first. For example, in "UA", the third base from the 5' end is U, and the base that pairs with the third base in the cloverleaf structure is A. Morphology (3): The combination of the fourth base from the 5' end and the base that pairs with it is GU. Here, the two bases are described with the fourth base from the 5' end listed first. The fourth base from the 5' end is G, and the base that pairs with the fourth base in the cloverleaf structure is U.

[0026] Examples of embodiments of the tRNA of this disclosure include a tRNA having morphology (1) and morphology (2), and a tRNA having morphology (1) and morphology (3).

[0027] Examples of embodiments of the tRNA of this disclosure include tRNAs having the nucleotide sequences of SEQ ID NOs. 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17. Among these, tRNAs having the nucleotide sequences of SEQ ID NOs. 7, 8, 9, 13, 15, or 17 are preferred from the viewpoint of efficiently translating UAA codons into amino acids.

[0028] The tRNAs of this disclosure can be produced using known genetic engineering techniques based on the nucleotide sequence of wild-type tryptophan tRNA from Mycoplasma pneumoniae. For example, a tRNA gene can be designed, the tRNA gene can be produced by PCR (Polymerase Chain Reaction) using appropriate primers, and tRNA can be transcribed from the tRNA gene.

[0029] <aminoacyl-tRNA> The aminoacyl-tRNAs of this disclosure are tRNAs to which an amino acid is bound. In aminoacyl-tRNAs, the amino acid is covalently bound to the 3' end of the tRNA.

[0030] The tRNAs of this disclosure can be acylated with any amino acid. Therefore, there are no limitations on the types of amino acids that the aminoacyl-tRNAs of this disclosure may possess. Here, amino acids include natural amino acids, unnatural amino acids, modified amino acids, and their derivatives.

[0031] In this disclosure, "natural amino acids" refers to amino acids that make up common proteins, and includes alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. Natural amino acids may be natural products or artificial products. In this disclosure, "non-natural amino acids" refers to amino acids other than the 20 amino acids listed above, and includes both natural and artificial products.

[0032] Examples of non-natural amino acids include amino acids containing a chloroacetyl group (for example, chloroacetylated amino acids such as chloroacethyl lysine, and chloroacetyldiaminobutyric acid). Examples of non-natural amino acids include N-methyl amino acids (e.g., N-methylalanine, N-methylphenylalanine).

[0033] One example of modified amino acids is labeled amino acids, which are amino acids bound to a labeling compound. Labeling compounds are substances that can be detected by biochemical, chemical, immunochemical, or electromagnetic detection methods. Examples of labeling compounds include dyes, fluorescent substances, chemiluminescent substances, bioluminescent substances, enzyme substrates, coenzymes, antigenic substances, substances that bind to specific proteins, and magnetic substances. Labeled amino acids can be classified by function into, for example, fluorescently labeled amino acids, photoresponsive amino acids, photoswitched amino acids, and fluorescent probe amino acids.

[0034] The labeled amino acid may be directly bonded to the labeled compound, or it may be bonded to the amino acid via a spacer. Examples of spacers include polyolefins such as polyethylene and polypropylene; polyethers such as polyoxyethylene, polyethylene glycol, and polyvinyl alcohol; and polystyrene, polyvinyl chloride, polyester, polyamide, polyimide, polyurethane, and polycarbonate.

[0035] Examples of derivatives of natural amino acids, unnatural amino acids, or modified amino acids include hydroxy acids, mercaptoic acids, and carboxylic acids.

[0036] Examples of embodiments of the aminoacyl-tRNA of this disclosure include aminoacyl-tRNA in which one selected from the group consisting of chloroacetylated lysine, N-methylalanine, N-methylphenylalanine, and fluorescently labeled amino acids is conjugated to tRNA.

[0037] The following methods can be used to acylate the tRNA of this disclosure with amino acids. The CA dinucleotide at the 3' end of the tRNA is deleted. On the other hand, the CA dinucleotide is attached to the carboxyl group of the amino acid. The two are then ligated together using RNA ligase. This method is publicly known, and its details are disclosed, for example, in International Publication 2004 / 009709 and International Publication 2007 / 055429. The method disclosed in these documents can be used to prepare the aminoacyl-tRNA described in this disclosure.

[0038] <Reagents for polypeptide synthesis> This disclosure provides two forms of polypeptide synthesis reagents (i.e., a first polypeptide synthesis reagent and a second polypeptide synthesis reagent).

[0039] The first polypeptide synthesis reagent is, A modified tRNA for tryptophan in Mycoplasma capricornum, which has CUA as an anticodon and pairs with the UAG codon, The tRNA for tryptophan of Mycoplasma pneumoniae is modified and includes a tRNA having UUA as an anticodon that pairs with the UAA codon.

[0040] In the first polypeptide synthesis reagent, the two types of tRNA may be mixed or unmixed. The first polypeptide synthesis reagent may further contain tRNA other than the two types of tRNA mentioned above.

[0041] The second reagent for polypeptide synthesis is, A modified tRNA for tryptophan in Mycoplasma capricorum, in which a first non-natural amino acid is bound to a tRNA having CUA as an anticodon and pairing with the UAG codon, is an aminoacyl-tRNA, The tRNA for tryptophan of Mycoplasma pneumoniae is modified and includes an aminoacyl-tRNA in which a second non-natural amino acid is bound to a tRNA having UUA as an anticodon that pairs with a UAA codon.

[0042] In the second polypeptide synthesis reagent, the two types of aminoacyl-tRNAs may be mixed or unmixed. The second polypeptide synthesis reagent may further contain aminoacyl-tRNAs other than the two types of aminoacyl-tRNAs mentioned above.

[0043] In the second polypeptide synthesis reagent, the first non-natural amino acid and the second non-natural amino acid are different types of amino acids. The first and second non-natural amino acids each include a non-natural amino acid; a natural amino acid or a modified non-natural amino acid; or a derivative of a natural amino acid, a non-natural amino acid, or a modified amino acid. Details of these amino acids are as described above.

[0044] Hereinafter, tRNAs in which the tryptophan-producing tRNA of Mycoplasma capricornum has been modified and which have CUA as an anticodon and pair with the UAG codon will be referred to as "UAG codon-translating tRNAs". Hereinafter, a tRNA in which the tryptophan-related tRNA of Mycoplasma pneumoniae has been modified and which has UUA as its anticodon and pairs with the UAA codon will be referred to as "UAA codon-translating tRNA".

[0045] The polypeptide synthesis reagent disclosed herein is a reagent that uses UAG codon-translated tRNA and UAA codon-translated tRNA in combination. By acylating both tRNAs with different non-natural amino acids and using them in combination, at least two types of non-natural amino acids can be introduced into the polypeptide.

[0046] The first polypeptide synthesis reagent is used by acylation with a non-natural amino acid, for example, and then adding it to a cell-free peptide synthesis system. The second polypeptide synthesis reagent is used by adding it to a cell-free peptide synthesis system, for example. With these usage methods, at least two non-natural amino acids can be introduced into the polypeptide synthesized by the cell-free peptide synthesis system. Details of the cell-free peptide synthesis system will be described later.

[0047] The first polypeptide synthesis reagent only needs to contain at least UAG codon-translated tRNA and UAA codon-translated tRNA, which are elements necessary for polypeptide synthesis. The second polypeptide synthesis reagent only needs to contain UAG codon-translated tRNA to which at least one of the elements necessary for polypeptide synthesis, a first non-natural amino acid, is bound, and UAA codon-translated tRNA to which a second non-natural amino acid is bound. The polypeptide synthesis reagents disclosed herein may include all the elements necessary for polypeptide synthesis. The polypeptide synthesis reagents disclosed herein may also include the equipment used for polypeptide synthesis.

[0048] The UAG codon-translated tRNA, a modified version of the tryptophan-using tRNA of Mycoplasma capricornum, is disclosed in International Publication No. 2007 / 055429. The tRNA modified version disclosed in International Publication No. 2007 / 055429 can be used in the polypeptide synthesis reagents described herein, as well as in the methods for introducing non-natural amino acids, polypeptide production, and nucleic acid display library production described later.

[0049] The UAG codon-translating tRNA, which is a modified form of the tryptophan-using tRNA of Mycoplasma capricorn, preferably comprises at least one form selected from the group consisting of the following forms (A), (B), and (C), from the viewpoint of efficiently translating the UAG codon into an amino acid.

[0050] Morphology (A): The combination of the 5' end and the base that pairs with it is GC. Here, the two bases are described with the 5' end base listed first. The 5' end base is G, and the base that pairs with the 5' end base in the cloverleaf structure is C. Morphology (B): The fourth base from the 3' end is A. Morphology (C): A, C, G, or U is inserted adjacent to the 5' end of the CCA.

[0051] Modified tryptophan-producing tRNAs of Mycoplasma capricorma can be created using known genetic engineering techniques based on the nucleotide sequence of wild-type tryptophan-producing tRNAs of Mycoplasma capricorma. For example, a tRNA gene can be designed, the tRNA gene can be produced by PCR using appropriate primers, and tRNA can be transcribed from the tRNA gene.

[0052] <Methods for introducing unnatural amino acids and preparing polypeptides> The method for introducing unnatural amino acids described herein is a method for introducing at least two types of unnatural amino acids into a polypeptide, and includes expressing a polypeptide from a nucleic acid using a cell-free peptide synthesis system. The method for producing polypeptides according to this disclosure is a method for producing polypeptides containing at least two non-natural amino acids in their amino acid sequence, and includes expressing polypeptides from nucleic acids using a cell-free peptide synthesis system.

[0053] The cell-free peptide synthesis system in the method for introducing unnatural amino acids and the method for producing polypeptides described herein is Nucleic acids having a base sequence including UAG codons and UAA codons, The aminoacyl-tRNA, which is a modified version of the tryptophan-tRNA of Mycoplasma capricorum, has a first non-natural amino acid attached to the UAG codon-translating tRNA, It contains aminoacyl-tRNA, which is a modified UAA codon-translated tRNA of Mycoplasma pneumoniae's tryptophan-use tRNA, to which a second non-natural amino acid is attached.

[0054] The first non-natural amino acid and the second non-natural amino acid are different types of amino acids. The first and second non-natural amino acids each include: a non-natural amino acid; a natural amino acid or a modified non-natural amino acid; or a derivative of a natural amino acid, a non-natural amino acid, or a modified amino acid. Details of these amino acids are as described above.

[0055] A cell-free peptide synthesis system is a reaction system for polypeptide synthesis that, without using cells themselves, (1) performs nucleic acid translation, or (2) performs nucleic acid transcription and translation. A cell-free peptide synthesis system consists of template nucleic acids, ribosomes, factors and enzymes for transcription and / or translation, other enzymes necessary for the system's structure, various substrates, energy sources, buffers, and salts. Examples of factors and enzymes for transcription and / or translation include substances derived from prokaryotic cells such as E. coli; and substances derived from eukaryotic cells such as wheat germ, animal cells, and insect cells.

[0056] In cell-free peptide synthesis systems, the template nucleic acid can be either DNA or RNA. In DNA, UAG codons are read as TAG, and UAA codons are read as TAA. The template nucleic acid may be a single-stranded nucleic acid or a double-stranded nucleic acid. The template nucleic acid may be a linear nucleic acid or a circular nucleic acid. The template nucleic acid may be a nucleic acid in which the base sequence necessary for polypeptide synthesis is incorporated into a vector (plasmid vector, cosmid vector, etc.).

[0057] Template nucleic acids have the nucleotide sequence necessary for polypeptide synthesis by a cell-free peptide synthesis system. The nucleotide sequence necessary for polypeptide synthesis includes not only the nucleotide sequence containing codons corresponding to the amino acid sequence of the polypeptide (i.e., the coding region), but also other sequences such as the promoter sequence and the ribosome binding sequence.

[0058] The base sequence of the template nucleic acid may or may not contain a stop codon. Here, a stop codon is a codon that does not have a corresponding tRNA. An example of a stop codon is the UGA codon. If the base sequence of the template nucleic acid does not contain a stop codon, an mRNA-ribosome-polypeptide conjugate may be formed.

[0059] (1) A cell-free peptide synthesis system for translating nucleic acids (e.g., RNA) comprises ribosomes, a translation initiation factor, a translation elongation factor, a translation termination factor, aminoacyl-tRNA synthetase, tRNA acylated by aminoacyl-tRNA synthetase, and tRNA of the disclosure bound to an amino acid, and if the system is derived from Escherichia coli, it further comprises methionyl-tRNA transformylase. (2) A cell-free peptide synthesis system for transcribing and translating nucleic acids (e.g., DNA) includes, in addition to the components of (1), RNA polymerase (e.g., T7 RNA polymerase) and nucleoside triphosphate, which is a substrate for RNA polymerase. In both (1) and (2), an mRNA-ribosome-polypeptide conjugate can be formed by removing the translation termination factor from the constituent materials.

[0060] Examples of enzymes other than factors and enzymes for transcription and / or translation include enzymes for energy regeneration such as creatine kinase, myokinase, and nucleoside diphosphate kinase (NDPK); and enzymes for the breakdown of inorganic pyrophosphates produced during transcription and / or translation, such as inorganic pyrophosphatases. Various substrates include natural amino acids and / or unnatural amino acids, nucleotide triphosphates as energy sources, creatine phosphate, formylfolic acid, etc. Examples of nucleotide triphosphates include ATP, GTP, CTP, and UTP, with ATP and GTP being used in (1) and ATP, GTP, CTP, and UTP being used in (2). Potassium phosphate buffer (pH 7.3) is commonly used as a buffer solution. Commonly used salts include potassium glutamate, ammonium chloride, magnesium acetate, calcium chloride, putrescine, spermidine, and dithiothreitol (DTT).

[0061] Any known cell-free peptide synthesis system can be used for the method of introducing unnatural amino acids and producing polypeptides described herein. Examples of commercially available cell-free peptide synthesis systems include PUREfrex (Gene Frontier, "PUREfrex" is a registered trademark), Human Cell-Free Protein Expression System (Takara Bio), Rapid Translation System (Roche), and Expressway Cell-Free Expression System (Invitrogen).

[0062] In the method for introducing unnatural amino acids and the method for producing polypeptides according to this disclosure, the UAG codon and UAA codon of the base sequence encoding the polypeptide are translated by a UAG codon-translating tRNA to which a first unnatural amino acid is bound and a UAA codon-translating tRNA to which a second unnatural amino acid is bound, respectively, thereby introducing at least two types of unnatural amino acids into the polypeptide.

[0063] An example of a polypeptide embodiment is a polypeptide containing an N-methyl amino acid (e.g., N-methylalanine or N-methylphenylalanine), an amino acid having a chloroacetyl group (e.g., chloroacetyldiaminobutyric acid or chloroacetylated lysine), and an amino acid having a thiol group (e.g., cysteine) in a single molecule. For the synthesis of this polypeptide, a UAG codon-translation tRNA to which an N-methyl amino acid is attached and a UAA codon-translation tRNA to which an amino acid having a chloroacetyl group is attached (or a UAG codon-translation tRNA to which an amino acid having a chloroacetyl group is attached and a UAA codon-translation tRNA to which an N-methyl amino acid is attached) can be used. In this polypeptide, the chloroacetyl group and the thiol group react to form a cyclization molecule, becoming a cyclic N-methyl polypeptide. The number of amino acid residues in the cyclic N-methyl polypeptide is, for example, 3 to 20.

[0064] <Method for preparing nucleic acid display libraries, nucleic acid-polypeptide conjugates> A nucleic acid display library is composed of nucleic acid-polypeptide conjugates, and refers to a collection of multiple nucleic acid-polypeptide conjugates. There are no restrictions on the number of clones or copies of nucleic acid-polypeptide conjugates that make up a nucleic acid display library.

[0065] The nucleic acid-polypeptide conjugate of the present disclosure is a nucleic acid-polypeptide conjugate in which a polypeptide containing at least two non-natural amino acids in its amino acid sequence is linked to a nucleic acid having a base sequence encoding the polypeptide, The base sequence includes UAG codons and UAA codons, In the base sequence, the UAG codon codes for the first non-natural amino acid in the polypeptide. In the base sequence, the UAA codon encodes the second non-natural amino acid in the polypeptide.

[0066] Examples of embodiments of the nucleic acid-polypeptide conjugates of this disclosure include mRNA-polypeptide conjugates and cDNA-polypeptide conjugates. A cDNA-polypeptide conjugate is the reverse transcript product of an mRNA-polypeptide conjugate. In a cDNA-polypeptide conjugate, the UAG codon is read as TAG, and the UAA codon is read as TAA.

[0067] In the nucleic acid-polypeptide conjugates of this disclosure, the nucleic acid and polypeptide are linked, for example, via a puromycin linker or ribosome.

[0068] The method for preparing a nucleic acid display library according to this disclosure includes expressing polypeptides from nucleic acids using a cell-free peptide synthesis system and preparing nucleic acid-polypeptide conjugates.

[0069] The cell-free peptide synthesis system in the method for preparing nucleic acid display libraries described herein aims to introduce at least two non-natural amino acids into a polypeptide. Nucleic acids having a base sequence including UAG codons and UAA codons, The aminoacyl-tRNA, which is a modified version of the tryptophan-tRNA of Mycoplasma capricorum, has a first non-natural amino acid attached to the UAG codon-translating tRNA, It contains aminoacyl-tRNA, which is a modified UAA codon-translated tRNA of Mycoplasma pneumoniae's tryptophan-use tRNA, to which a second non-natural amino acid is attached.

[0070] The cell-free peptide synthesis system may be either (1) a system for translating nucleic acids, or (2) a system for transcribing and translating nucleic acids. Details of the cell-free peptide synthesis system are as described above. Any known cell-free peptide synthesis system and any known nucleic acid display library preparation technique can be used in the method for preparing the nucleic acid display library of this disclosure.

[0071] In a cell-free peptide synthesis system, the template nucleic acid may be DNA or RNA. The template nucleic acid is, for example, a collection of double-stranded DNA fragments produced by performing overlap extension PCR using a random primer set containing a random sequence. The random sequence is, for example, a triplet repeat sequence [NNK]m (where m is a positive integer, N is independently A, T, G, or C, and K is independently T or G). By setting the number of repeats in the triplet [NNK] to any number, peptides of any length can be produced. From the viewpoint of suppressing the appearance of stop codons, the random sequence is preferably a trimer oligonucleotide in which one type of codon is assigned to one type of amino acid.

[0072] From the viewpoint of increasing the flexibility of the polypeptide, it is preferable that the 3' end of the template nucleic acid contains a base sequence that encodes a spacer. The spacer is, for example, at least one amino acid selected from glycine and serine.

[0073] One example of an embodiment of the method for preparing a nucleic acid display library according to this disclosure includes preparing an mRNA-polypeptide conjugate and then reverse transcribing the mRNA of the mRNA-polypeptide conjugate to prepare a cDNA-polypeptide conjugate. According to this embodiment, since the nucleic acid of the nucleic acid-polypeptide conjugate is DNA, a chemically more stable nucleic acid display library can be obtained.

[0074] In the method for preparing a nucleic acid display library according to this disclosure, the linkage between the nucleic acid to be translated (usually mRNA) and the translation product may be via a puromycin linker, a ribosome, or any other method. From the viewpoint of the ease with which the translation product can form an appropriate higher-order structure and the ease with which the function of the translation product can be evaluated, the linkage between the nucleic acid to be translated and the translation product is preferably via a puromycin linker. Therefore, the nucleic acids translated in the cell-free peptide synthesis system are preferably nucleic acids to which a puromycin linker is attached to the 3' end. As a linker for attaching puromycin to nucleic acids, a 2'-O-methylated nucleic acid linker or a nucleic acid linker having an UV crosslinkable compound at the 5' end is preferred from the viewpoint of suppressing the dissociation of nucleic acids and puromycin.

[0075] The method for preparing nucleic acid display libraries described herein preserves 20 types of natural amino acid codons, and further utilizes UAG and UAA codons in amino acid translation, thereby diversifying the amino acid sequences of polypeptides that constitute the nucleic acid display library.

[0076] <Screening Method> The screening method of this disclosure includes preparing a nucleic acid display library by the method for preparing a nucleic acid display library of this disclosure, selecting a nucleic acid-polypeptide conjugate having the desired activity from the nucleic acid display library, and identifying the base sequence of the nucleic acid of the selected nucleic acid-polypeptide conjugate.

[0077] "Desired activity" refers, for example, to binding to a target substance. "Target substance" is a term encompassing any chemical substance exhibiting physiological activity, including compounds, groups, molecules, proteins, nucleic acids, lipids, carbohydrates, and complexes thereof. Examples of target substances include receptors, transcription factors, enzymes, coenzymes, regulators, antibodies, antigens, DNA, RNA, fragments thereof, complexes thereof, and modifying groups thereof.

[0078] One example of an embodiment of the screening method of this disclosure includes contacting a nucleic acid display library with a target substance (e.g., a target protein) and incubating it. For example, the nucleic acid display library and the target substance are brought into contact in a buffer solution, and the pH and temperature of the buffer solution and the contact time are adjusted for incubation. In this case, the target substance may be immobilized on a solid support, and the nucleic acid display library may be brought into contact with the immobilized target substance. The solid support is not limited as long as it can immobilize the target substance, and examples include microtiter plates, substrates, beads, magnetic beads, nitrocellulose membranes, nylon membranes, PVDF membranes, etc. The target substance is immobilized on these solid supports by known techniques.

[0079] Following the above contact, nucleic acid-polypeptide conjugates bound to the target substance (e.g., target protein) are extracted, and the base sequence of the nucleic acid in the extracted nucleic acid-polypeptide conjugate is identified. Base sequence identification can be performed using a nucleic acid amplification system and a sequencer.

[0080] A nucleic acid amplification system refers to a system that amplifies nucleic acids using a nucleic acid as a template. The nucleic acid amplification reaction in a nucleic acid amplification system can be any of the following: polymerase chain reaction (PCR), ligase chain reaction (LCR), TMA (transcription-mediated amplification), NASBA (nucleic acid sequence-based amplification), etc.

[0081] In this disclosure, "sequencer" is a term that includes first-generation sequencers (capillary sequencers), second-generation sequencers (next-generation sequencers), third-generation sequencers, fourth-generation sequencers, and sequencers to be developed in the future. The sequencer may be a capillary sequencer, a next-generation sequencer, or any other type of sequencer. As a sequencer, a next-generation sequencer is preferred from the viewpoint of speed of analysis and the number of samples that can be processed at one time. A next-generation sequencer (NGS) refers to a sequencer classified in contrast to a capillary sequencer (called a first-generation sequencer) that uses the Sanger method. The most widely used next-generation sequencer at present is a sequencer that determines the base sequence by capturing fluorescence or emission linked to complementary strand synthesis by DNA polymerase or complementary strand binding by DNA ligase. Specifically, examples include MiSeq (Illumina, MiSeq is a registered trademark), HiSeq2000 (Illumina, HiSeq is a registered trademark), and Roche454 (Roche).

[0082] According to the screening method of this disclosure, a polypeptide having the desired activity, the base sequence encoding it, and its amino acid sequence can be found from among polypeptides into which at least two non-natural amino acids have been introduced. [Examples]

[0083] The following specific examples will provide a more detailed explanation of the tRNA and other related materials described herein. The materials, processing procedures, etc., shown in the following examples may be modified as appropriate, provided that they do not deviate from the spirit of this disclosure. The scope of the tRNA and other related materials described herein should not be interpreted restrictively by the following examples.

[0084] In the following explanation, synthesis, processing, and manufacturing were carried out at room temperature (25°C ± 3°C) unless otherwise specified. Percentages relating to substance concentration are on a mass basis. "M" relating to substance concentration represents molar concentration, where 1M = 1 mol / L.

[0085] In the following explanation, the abbreviations have the following meanings: AcOK: Potassium acetate α-CHCA:α-cyano-4-hydroxycinnamic acid BSA: Bovine Serum Album In DMSO: dimethyl sulfoxide dNTP:deoxynucleoside triphosphate D-PBS: Dulbecco's phosphate buffered saline DTT: dithiothreitol GMP: guanosine monophosphate NTP: nucleoside triphosphate SDS-PAGE:sodium dodecyl sulphate-polyacrylamide gel electrophoresis

[0086] <Example 1> The tryptophan-producing tRNAs of Mycoplasma capricorum, Mycoplasma pneumoniae, Staphylococcus aureus, and Shewanella oneidensis were modified to design tRNAs with UUA in the anticodon, resulting in the sequence numbers 1-4.

[0087] -TRNA gene generation- Based on the nucleotide sequences of Sequence IDs 1-4, two oligonucleotides were chemically synthesized as primers. The forward primer contained the T7 promoter and nucleotide sequences 1-51 of tRNA. The reverse primer contained nucleotide sequences 36-74 of tRNA (up to the first C at the CCA terminus). PCR was performed using these primers, and the PCR product was purified to obtain the tRNA gene. This gene is called the tRNA-CA gene. The PCR reaction mixture contained KOD Dash Buffer, 0.2 mM dNTPs, and 2.5 units of KOD Dash, and contained 0.2 nmol of each primer per 100 μL. MinElute PCR Purification Kit (Qiagen) was used to purify the PCR product.

[0088] - tRNA preparation - The tRNA-CA gene was transcribed, and the transcript was purified to obtain tRNA. This tRNA is called tRNA-CA. 100 μL of the transcription reaction solution contained 40 mM Tris-HCl (pH 8.0), 20 mM MgCl2, 5 mM DTT, 4 mM NTP, 20 mM GMP, 2 mM Spermidine, 10 μg / mL BSA, 40 units Ribonuclease inhibitor, 0.5 units Inorganic Pyrophosphatase, 400 units T7 RNA Polymerase, and the tRNA-CA gene. The reaction solution was incubated at 37°C for 12 hours, and tRNA-CA was purified using the RNEasy Minelute Cleanup Kit (Qiagen).

[0089] - Aminoacylation of tRNA - tRNA was conjugated with BODIPYFL-aminophenylalanine. This tRNA is called fluorescently labeled amino acid-tRNA. 4 μL of 5× Ligation Buffer (275 mM Hepes-Na (pH 7.5), 75 mM MgCl2, 16.5 mM DTT, 5 mM ATP), 2.5 μL of 200 μM tRNA-CA, 2 μL of DMSO solution of BODIPYFL-aminophenylalanine-pdCpA, 0.4 μL of 0.1% BSA, 0.6 μL of T4 RNA Ligase (40 units / μL), and 10.5 μL of water were mixed and reacted at 4°C for 2 hours. 20 μL of 0.3 M AcOK (pH 4.5) and 120 μL of ethanol were added, gently mixed, and left at -80°C for 30 minutes. After centrifugation at 15,000 rpm for 30 minutes at 4°C, the supernatant was removed, 200 μL of 70% ethanol stored at -30°C was added, and the mixture was centrifuged at 15,000 rpm for 1 minute at 4°C. The supernatant was removed and the mixture was dried under reduced pressure. It was then dissolved in 3 μL of 1 mM AcOK (pH 4.5).

[0090] -Introduction of fluorescently labeled amino acids into polypeptides- DNA containing a base sequence (SEQ ID NO: 21: ATGTGCAAATAAAAACCGCGGAGCAAAAACATGAGCGATTATAAAGATGATGATGATAAG) encoding a polypeptide consisting of 20 amino acids (SEQ ID NO: 20: MCKXKPRSKNMSDYKDDDDK, where X is a non-natural amino acid) was prepared. This polypeptide and DNA are referred to as polypeptide(1) and DNA(1) respectively. Polypeptide(1) contains a FLAG tag, with amino acid positions 13-20 being the FLAG tag. DNA(1) contains all the base sequences necessary for the expression of polypeptide(1) by PUREfrex2.0. DNA(1) was transcribed, and the transcript was purified to obtain mRNA. The transcription from DNA(1) was carried out in the same manner as the transcription from the tRNA-CA gene described above, except that 20 mM GMP was not added to the reaction mixture. Polypeptide (1) was translated from mRNA, which is the transcript and purified product of DNA(1), using fluorescently labeled amino acid-tRNA and PUREfrex2.0 (Gene Frontier Co., Ltd.). A 10 μL reaction solution contained 5 μL of PUREfrex2.0 Solution I, 0.5 μL of Solution II, 1 μL of Solution III, 1 μL of 16 μM mRNA, 1 μL of fluorescently labeled amino acid-tRNA solution, and 1.5 μL of water. The translation reaction was carried out at 25°C for 1 hour.

[0091] -Evaluation of the introduction efficiency of fluorescently labeled amino acids- 9 μL of 1× sample buffer was added to 1 μL of the reaction mixture after the translation reaction. Of this, 5 μL was subjected to 15% SDS-PAGE (0.1% SDS). The electrophoretic gel was observed with a fluorescence scanner (Hitachi Software Engineering Co., Ltd., FMBIO-III). The introduction of fluorescently labeled amino acids in polypeptide (1) was confirmed by 488 nm excitation / 520 nm detection, and the introduction efficiency was quantified. Table 2 shows the relative values ​​with SEQ ID NO: 1 set as the baseline value of 1.00. Meanwhile, 81 μL of D-PBS(-) (Nacalai Tex) and 20 μL of anti-FLAGM2 magnetic beads (Sigma-Aldrich) were added to 9 μL of the reaction solution after the translation reaction, and the mixture was shaken at room temperature for 30 minutes. The magnetic beads were washed five times with 200 μL of D-PBS(-). 9 μL of 2% formic acid aqueous solution was added to the magnetic beads, and the mixture was shaken at room temperature for 1 hour. The supernatant was collected as the purified polypeptide (1). 0.75 μL of the purified solution was mixed with 0.75 μL of saturated α-CHCA solution (50% acetonitrile / 0.1% trifluoroacetic acid), and mass spectrometry (Bruker ultrafleXtreme, positive mode measurement) was performed. It was confirmed that fluorescently labeled amino acids had been introduced into polypeptide (1).

[0092] [Table 2]

[0093] The superiority of a modified tryptophan-using tRNA from Mycoplasma pneumoniae was demonstrated.

[0094] <Example 2> The tryptophan-containing tRNA of Mycoplasma pneumoniae was modified to design tRNAs with the anticodon UUA, known as SEQ ID NOs. 5-9 were produced using the same method as in Example 1, including tRNA gene generation, tRNA synthesis, tRNA aminoacylation, introduction of fluorescently labeled amino acids into polypeptides, and evaluation of the introduction efficiency. Table 3 shows the relative values, with SEQ ID NO. 2 set as the baseline of 1.00.

[0095] [Table 3]

[0096] The tRNAs of Sequence ID No. 7, Sequence ID No. 8, and Sequence ID No. 9 showed high efficiency in introducing fluorescently labeled amino acids. This indicates the superiority of tRNAs for tryptophan in Mycoplasma pneumoniae where the combination of the third base from the 5' end and the base that pairs with it is UA, GU, or UG.

[0097] <Example 3> The tryptophan-containing tRNA of Mycoplasma pneumoniae was modified to design tRNAs with the anticodon UUA, known as SEQ ID NOs. 10-14 were produced using the same method as in Example 1, including tRNA gene generation, tRNA synthesis, tRNA aminoacylation, introduction of fluorescently labeled amino acids into polypeptides, and evaluation of the introduction efficiency. Table 4 shows the relative values ​​with SEQ ID NO. 2 set as the baseline of 1.00.

[0098] [Table 4]

[0099] The tRNA of Sequence ID No. 13 showed high efficiency in introducing fluorescently labeled amino acids. This indicates the superiority of tRNAs in Mycoplasma pneumoniae for tryptophan production, where the combination of the fourth base from the 5' end and the base that pairs with it is GU.

[0100] <Example 4> The tryptophan-containing tRNA of Mycoplasma pneumoniae was modified to design tRNAs with the anticodon UUA, known as SEQ ID NOs. 15-17 were produced using the same method as in Example 1, including tRNA gene generation, tRNA synthesis, tRNA aminoacylation, introduction of fluorescently labeled amino acids into polypeptides, and evaluation of the synthesis efficiency. Table 5 shows the relative values ​​with SEQ ID NO. 2 set as the baseline of 1.00.

[0101] [Table 5]

[0102] The tRNA of Sequence ID No. 17 showed high efficiency in introducing fluorescently labeled amino acids. This indicates the superiority of tRNAs for tryptophan in Mycoplasma pneumoniae where the combination of the fourth base from the 5' end and the base that pairs with this base is GU, and the base adjacent to the 5' end of the CCA terminus is G.

[0103] <Example 5> Formamide was added to tRNAs with sequence numbers 2 and 5-17, and the mixture was heat-treated (95°C, 3 minutes) and mixed with 10× Loading Buffer (TaKaRa, 9157). Electrophoresis was performed on a urea-containing acrylamide gel (SuperSepTMRNA, 15%, 17 wells (Wako, 194-15881)), and the samples were stained with a staining reagent (Gel Red Nucleic Acid Gel Stain (Biotium, 41003)) for detection. Figure 2 shows the electrophoresis gel after staining. In Figure 2, the numbers on the gel are the sequence numbers.

[0104] In the gel shown in Figure 2, we observed changes in the higher-order structure of tRNA and sharp band intensity in sequence numbers 7-9, 13, and 17, which have high efficiency in introducing non-natural amino acids.

[0105] <Example 6> DNA(a) to (d) were prepared by making substitutions to the base sequence (sequence number 21) encoding polypeptide (1) in DNA(1). Each of DNA(a) to (d) has a base sequence in which the following substitutions have been made to sequence number 21.

[0106] DNA(a): DNA obtained by substituting the 4th codon with TAG and the 11th codon with TAA in sequence number 21. DNA(b): DNA obtained by substituting the 4th and 5th codons with TAG and the 11th codon with TAA in sequence number 21. DNA(c): DNA obtained by substituting the 4th and 6th codons with TAG and the 11th codon with TAA in sequence number 21. DNA(d): DNA obtained by substituting the 4th and 7th codons with TAG and the 11th codon with TAA in sequence number 21.

[0107] As a UAG codon-translating tRNA, a modified version of the tryptophan-using tRNA of Mycoplasma capricornum, the tRNA of Sequence ID No. 19 was prepared, and N-methylphenylalanine or BODIPYFL-aminophenylalanine was conjugated to this tRNA.

[0108] As a modified UAA codon-translating tRNA for Mycoplasma pneumoniae, we prepared the tRNA shown in Sequence ID No. 2, and then conjugated N-methylphenylalanine or BODIPYFL-aminophenylalanine to this tRNA.

[0109] Using the same method as in Example 1, tRNA gene generation, tRNA generation, tRNA aminoacylation, introduction of fluorescently labeled amino acids into polypeptides, and evaluation of introduction efficiency were performed. Figure 3 shows the electrophoresis gels. The gel on the left of Figure 3 is the electrophoresis gel of the sample before purification, and the gel on the right of Figure 3 is the electrophoresis gel of the sample after purification using the FLAG tag.

[0110] In Figure 3, the numbers on the gel represent the following polypeptides. (1) A polypeptide translated from DNA(a), which was translated using a UAG codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine and a UAA codon-translation tRNA conjugated with N-methylphenylalanine. (2) A polypeptide translated from DNA(a), which is a polypeptide translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (3) A polypeptide translated from DNA(b), which was translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (4) A polypeptide translated from DNA(c), which is a polypeptide translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (5) A polypeptide translated from DNA(d), which was translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine.

[0111] In the gel on the right side of Figure 3, the relatively dark band represents the polypeptide. As can be seen from the detection of the purified polypeptide band, the fluorescently labeled amino acid and N-methylphenylalanine were successfully multiplexed into the polypeptide using two types of tRNA variants.

[0112] <Example 7> The same experiment as in Example 6 was performed, except that puromycin was added to the 3' end of the mRNA to be translated. N-methylphenylalanine, N-methylalanine, or BODIPYFL-aminophenylalanine was conjugated to the UAG codon-translated tRNA and UAA codon-translated tRNA. Figure 4 shows the gels obtained from electrophoresis.

[0113] In Figure 4, the numbers on the gel represent the following polypeptides. (6) A polypeptide translated from DNA(a), which was translated using a UAG codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine and a UAA codon-translation tRNA conjugated with N-methylphenylalanine. (7) A polypeptide translated from DNA(a), which was translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (8) A polypeptide translated from DNA(b), which was translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (9) A polypeptide translated from DNA(c), which was translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (10) A polypeptide translated from DNA(d), which was translated using UAG codon-translation tRNA conjugated with N-methylphenylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (11) A polypeptide translated from DNA(a), which was translated using a UAG codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine and a UAA codon-translation tRNA conjugated with N-methylalanine. (12) A polypeptide translated from DNA(a), which was translated using UAG codon-translation tRNA conjugated with N-methylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (13) A polypeptide translated from DNA(b), which was translated using UAG codon-translation tRNA conjugated with N-methylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (14) A polypeptide translated from DNA(c), which was translated using UAG codon-translation tRNA conjugated with N-methylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine. (15) A polypeptide translated from DNA(d), which was translated using UAG codon-translation tRNA conjugated with N-methylalanine and UAA codon-translation tRNA conjugated with BODIPYFL-aminophenylalanine.

[0114] In the gel shown in Figure 4, the thick band at the bottom is BODIPYFL-aminophenylalanine, the band slightly above it is polypeptide, and the thin band around 98 kDa is mRNA-polypeptide conjugate. As can be seen from the gel in Figure 4, an mRNA display with multiple fluorescently labeled amino acids and N-methylphenylalanine was successfully achieved.

[0115] The disclosure of Japanese Patent Application No. 2021-156183 is incorporated herein by reference in its entirety. All documents, patent applications, and technical standards described herein are incorporated by reference to the same extent as if each individual document, patent application, and technical standard were specifically and individually noted to be incorporated by reference.< / trna>

Claims

1. A tRNA obtained by modifying the tryptophan-using tRNA of wild-type Mycoplasma pneumoniae, represented by Sequence ID No. 18, It has UUA as its anticodon and is paired with the UAA codon. The aforementioned modification is a modification in which the anticodon is set to UUA, (i) A modification in which the combination of the fourth base from the 5' end and the base that pairs with that base is defined as GU, and / or (ii) Modifications in which the combination of the third base from the 5' end and the base that pairs with it is UA, GU, or UG, and / or (iii) A modification in which the base adjacent to the 5' end of the CCA terminus is A, Consists of only, tRNA.

2. The tRNA according to claim 1, wherein the modification includes the modification of (i) and / or (ii).

3. The tRNA according to claim 1, wherein the base adjacent to the 5' end of the CCA terminus is A or G.

4. The tRNA according to claim 1, wherein the combination of the third base from the 5' end and the base that pairs with it is UA, GU, or UG.

5. The tRNA according to claim 1, wherein the combination of the fourth base from the 5' end and the base that pairs with that base is GU.

6. A tRNA having one nucleotide sequence selected from the group consisting of SEQ ID NOs: 7, 8, 9, 13, 15, and 17. Array7: GGUGGUGUAG UUUAGUGGCA GAACACAGU CUUUAAAACU GUCUGUGUGUGG GUUCGAUUCC UUCCCACCACC ACCA Array8: GGGGGUGUAG UUUAGUGGCA GAACACAGU CUUUAAAACU GUCUGUGUGG GUUCGAUUCC UUCCCACCUC ACCA Array 9: GGUGGUGUAG UUUAGUGGCA GAACACAGU CUUUAAAACU GUCUGUGUGG GUUCGAUUCC UUCCCACCGCC ACCA ALL 13: GGGGGUGUAG UUUAGUGGCA GAACACAGU CUUUAAAACU GUCUGUGUGG GUUCGAUUCC UUCCAUCUCCC ACCA Sequence number 15: GGGGGUGUAG UUUAGUGGCA GAACAACAGU CUUUAAAACU GUCUGUGUGG GUUCGAUUCC UUCCACCCCC GCCA Sequence number 17: GGGGGUGUAG UUUAGUGGCA GAACAACAGU CUUUAAAACU GUCUGUGUGG GUUCGAUUCC UUCCACUCCC GCCA

7. An aminoacyl-tRNA in which an amino acid is bound to the tRNA according to any one of claims 1 to 6.

8. The aminoacyl-tRNA according to claim 7, wherein the amino acid is one selected from the group consisting of unnatural amino acids, modified amino acids, and derivatives thereof.

9. The aminoacyl-tRNA according to claim 7, wherein the amino acid is one selected from the group consisting of chloroacetylated lysine, N-methylalanine, N-methylphenylalanine, and fluorescently labeled amino acids.

10. A modified tRNA for tryptophan from Mycoplasma capricolum, which has CUA as an anticodon and pairs with the UAG codon, The tRNA described in any one of claims 1 to 6, Reagents for polypeptide synthesis.

11. A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as an anticodon and pairing with a UAG codon, is an aminoacyl-tRNA. The present invention comprises an aminoacyl-tRNA in which a second non-natural amino acid is bound to the tRNA described in any one of claims 1 to 6, Reagents for polypeptide synthesis.

12. A method for introducing at least two types of unnatural amino acids into a polypeptide, Nucleic acids having a base sequence including UAG codons and UAA codons, A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as an anticodon and pairing with a UAG codon, is an aminoacyl-tRNA. An aminoacyl-tRNA obtained by binding a second non-natural amino acid to the tRNA according to any one of claims 1 to 6, This includes expressing polypeptides from nucleic acids using a cell-free peptide synthesis system containing the following: Methods for introducing non-natural amino acids.

13. The method for introducing a non-natural amino acid according to claim 12, further comprising a UGA codon whose base sequence is a stop codon.

14. A method for producing a polypeptide containing at least two types of unnatural amino acids in its amino acid sequence, Nucleic acids having a base sequence including UAG codons and UAA codons, A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as an anticodon and pairing with a UAG codon, is an aminoacyl-tRNA. An aminoacyl-tRNA obtained by binding a second non-natural amino acid to the tRNA according to any one of claims 1 to 6, This includes expressing polypeptides from nucleic acids using a cell-free peptide synthesis system containing the following: Method for producing polypeptides.

15. The method for producing a polypeptide according to claim 14, further comprising a UGA codon whose base sequence is a stop codon.

16. Nucleic acids having a base sequence including UAG codons and UAA codons, A modified tRNA for tryptophan from Mycoplasma capricolum, in which a first non-natural amino acid is bound to a tRNA having CUA as an anticodon and pairing with a UAG codon, is an aminoacyl-tRNA. An aminoacyl-tRNA obtained by binding a second non-natural amino acid to the tRNA according to any one of claims 1 to 6, This includes expressing polypeptides from nucleic acids using a cell-free peptide synthesis system containing the above, and producing nucleic acid-polypeptide conjugates. Method for preparing nucleic acid display libraries.

17. The process of producing the nucleic acid-polypeptide conjugate includes producing an mRNA-polypeptide conjugate and reverse transcribing the mRNA of the mRNA-polypeptide conjugate to produce a cDNA-polypeptide conjugate. A method for preparing a nucleic acid display library according to claim 16.

18. The method for producing a nucleic acid display library according to claim 16, wherein the nucleic acid and polypeptide in the nucleic acid-polypeptide conjugate are linked by a puromycin linker.

19. A nucleic acid display library is prepared by the method for preparing a nucleic acid display library described in claim 16, This includes selecting a nucleic acid-polypeptide conjugate having the desired activity from the nucleic acid display library and identifying the base sequence of the nucleic acid of the selected nucleic acid-polypeptide conjugate. Screening method.

Images