Treatment method for wastewater containing ammonia nitrogen

Abstract

To provide a method for treating ammoniacal nitrogen-containing wastewater that can stably treat ammoniacal nitrogen-containing wastewater using an Anammox process while suppressing a decrease in activity.SOLUTION: There is provided a method for treating ammoniacal nitrogen-containing wastewater using an Anammox reaction tank, in which when K+ concentration in ammonia nitrogen-containing wastewater is higher than 1,000 mg / L, the K+ concentration in water to be treated introduced into the Anammox reaction tank is reduced to be 1,000 mg / L or less, and in order to reduce the K+ concentration, dilution water having a lower K+ concentration than the ammoniacal nitrogen-containing wastewater is introduced into the Anammox reaction tank or its upstream side.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to a technique for treating ammonia nitrogen-containing wastewater by an anaerobic ammonia oxidation (Anammox) process. Background Art

[0002] In the Anammox process, Anammox bacteria, which are autotrophic microorganisms using ammonia nitrogen as an electron donor and nitrite nitrogen as an electron acceptor, are utilized to denitrify by reacting ammonia nitrogen with nitrite nitrogen. In the Anammox reaction, ammonia nitrogen and nitrite nitrogen react at a ratio of 1:1.32. Therefore, the nitrogen treatment technology using the Anammox reaction oxidizes about half of the ammonia nitrogen in the water to be treated into nitrite nitrogen, and then supplies it to the Anammox reaction.

[0003] For the Anammox process, there are mainly two types: the two-tank Anammox process, in which the pretreatment (partial nitritation) for oxidizing about half of the ammonia nitrogen contained in the raw water by ammonia-oxidizing bacteria into nitrite nitrogen and the Anammox reaction tank are carried out in separate tanks, and the single-tank Anammox process, in which the above steps are carried out in one tank (Patent Documents 1 to 4). The present invention is applicable to any of these processes.

[0004] The reaction formulas for the nitritation of ammonia nitrogen and the Anammox reaction are as shown in Formula 1 and Formula 2 below. The single-tank Anammox reaction, which combines Formula 1 and Formula 2, is as shown in Formula 3 below. <Nitritation of ammonia nitrogen> 1.0NH4 + +1.5O2→1.0NO2+H2O+2.0H + Formula 1 <Anammox Reaction> 1.0NH4 + +1.32NO2 - +0.066HCO3 - → 1.02N2+0.26NO3 - +0.066CH2O 0.5 N0.15 +2.03H2O+0.13OH - Equation 2 <Denitrification reaction by single-tank Anammox reaction> 1.0NH4 + +0.65O2→ 0.44N2+0.11NO3 - +1.14H + +1.43H2O Equation 3

[0005] Five genera of Anammox bacteria have been reported: freshwater genera *Candidatus* Kuenenia (genus Ca. Kuenenia), *Candidatus* Brocadia (genus Ca. Brocadia), *Candidatus* Anammoxoglobus, and *Candidatus* Jettenia, and the marine genus *Candidatus* Scalindua. Among these, in wastewater treatment processes, the freshwater genus Ca. Brocadia is the most likely to become dominant in sludge, followed by the genus Ca. Kuenenia.

[0006] In order to efficiently perform the Anammox process, paragraph 0006 of Patent Document 3 describes removing fluoride ions from water to be treated as an inhibitory substance for the Anammox reaction. PRIOR ART DOCUMENTS PATENT DOCUMENTS

[0007] Patent Document 1 Japanese Unexamined Patent Publication No. 2019-37912 Patent Document 2 Japanese Unexamined Patent Publication No. 2018-161607 Patent Document 3 Japanese Unexamined Patent Publication No. 2007-125484 Patent Document 4 International Publication No. 2005 / 095289 SUMMARY OF THE INVENTION Problem to be Solved by the Invention

[0008] From the perspective of energy recovery from waste, biogas power generation using food waste and livestock manure as raw materials is increasing. Most biogas power generation is wet methane fermentation, where energy is recovered as methane gas and used to generate electricity. On the other hand, methane fermentation residue (digestate) contains high concentrations of ammonia, so denitrification treatment such as Anammox treatment is necessary.

[0009] When Anammox treatment was performed on digestate generated from methane fermentation of food waste and livestock manure using sludge predominantly composed of Ca. Brocadia species, a gradual decrease in activity was observed over a period of 30 days or more after Anammox treatment.

[0010] Such long-term declines in activity are difficult to predict in advance, and if an unexpected decline in activity occurs in the field, the slow growth rate of Anammox bacteria means that recovery takes a long time, leading to problems that make treatment difficult.

[0011] The object of this invention is to provide a method for treating ammonia nitrogen-containing wastewater that can be treated stably while suppressing the decrease in activity in the Anammox process. [Means for solving the problem]

[0012] The digestate produced when food waste or livestock manure undergoes methane fermentation has a high ammonia concentration and potassium ions (hereinafter referred to as "K + (Sometimes written as ") The concentration is high. The main reason for the high potassium ion concentration in the digested fluid is thought to be the plants contained in the methane fermentation raw materials.

[0013] Therefore, the inventors hypothesized that potassium ions might be the cause of the decreased activity of the Anammox treatment, and after diligent research, they found that the activity of the Anammox treatment could be maintained at a high level by reducing the potassium ion concentration in the water being treated.

[0014] This invention is based on the aforementioned findings and is summarized as follows.

[0015] [1] A method for treating ammonia nitrogen-containing wastewater using an Anammox reactor, K in wastewater containing ammoniacal nitrogen + If the concentration is higher than 1000 mg / L, the K in the water to be treated is introduced into the Anammox reactor. + K + A method for treating ammonia nitrogen-containing wastewater, characterized by reducing [amount].

[0016] [2] K + To reduce the concentration, K is used in wastewater containing ammonia nitrogen. + A method for treating ammonia nitrogen-containing wastewater, comprising adding a low-concentration diluted water to or upstream of the Anammox reactor [1].

[0017] [3] K in the water to be treated is introduced into the Anammox reactor + A method for treating ammonia nitrogen-containing wastewater, in which dilution water is added to bring the concentration to 100-900 mg / L [2].

[0018] [4] Wastewater containing ammonia nitrogen is subjected to ammonia stripping treatment, and the ammonia volatilized by ammonia stripping is compared to the wastewater before stripping in terms of K + A method for treating ammonia nitrogen-containing wastewater, any of the following [1] to [3], wherein the ammonia is absorbed into water of low concentration, and the water from which the ammonia has been recovered is treated using the Anammox reaction tank. [Effects of the Invention]

[0019] According to the present invention, Anammox treatment can be stably applied to wastewater with a high potassium ion concentration, such as digestate generated when food waste or livestock manure undergoes methane fermentation.

[0020] In other words, in the Anammox treatment process, K is introduced either before the Anammox reactor or into the Anammox reactor. +A means for reducing the concentration is provided, and the K of the treated water in the Anammox reaction vessel is provided. + K + By operating at a reduced concentration, the decrease in activity of Ca. Brocadia species is suppressed, and wastewater containing ammoniacal nitrogen can be treated stably.

[0021] The exact reason why potassium ions inhibit the Anammox reaction is unclear, but it is possible that because the ionic radius of potassium ions is similar to that of ammonium ions, which are substrates in the Anammox reaction, ammonia transporters take up potassium ions into the cell, thereby inhibiting the reaction.

[0022] Furthermore, conventional Anammox treatments have primarily targeted sewage and chemical plant wastewater, and since wastewater with high potassium ion concentrations is rare, it is believed that the effects of potassium ions have not been apparent. In addition, potassium is sometimes added to treated water to increase the growth rate of Anammox bacteria (paragraph 0040 of Patent Document 4), and it was not anticipated that it would inhibit the Anammox reaction. [Brief explanation of the drawing]

[0023] [Figure 1] This is a flowchart illustrating an example of the method of the present invention. [Figure 2] This is a flowchart illustrating an example of the method of the present invention. [Figure 3] This is a flowchart illustrating an example of the method of the present invention. [Modes for carrying out the invention]

[0024] Embodiments of the present invention will be described below.

[0025] In this invention, the ammonia nitrogen concentration of the ammonia nitrogen-containing wastewater introduced into the Anammox reactor is preferably 200 to 7000 mg / L, and particularly preferably around 500 to 5000 mg / L.

[0026] Specific examples of wastewater containing ammonia nitrogen include dehydrated filtrate from digestate and wastewater from various chemical plants. The water quality of dehydrated filtrate from digestate typically has an ammonia nitrogen concentration of 500 to 5,000 mg / L and a pH of 7.7 to 9.2.

[0027] The BOD concentration in the ammoniacal nitrogen-containing wastewater introduced into the Anammox reactor is preferably 0 to 2000 mg / L, and particularly preferably around 0 to 700 mg / L. Cr The concentration ranges from 0 to 5000. mg / L, particularly around 0 to 2000 mg / L, is preferred.

[0028] The Anammox process includes a two-tank Anammox process in which a pretreatment (partial nitrification treatment) is performed in a separate tank from the Anammox reaction tank, in which ammonia-oxidizing bacteria oxidize approximately half of the ammoniacal nitrogen in the raw water to nitrite nitrogen; and a single-tank Anammox process in which this treatment is performed in a single tank. The present invention is applicable to either process.

[0029] In a two-tank Anammox process, the water to be treated is introduced into a nitrite nitrification tank, aerated by an aeration device, and nitrite nitrification is carried out. To ensure stable nitrite nitrification, it is preferable to adjust the aeration rate by the aeration tank so that the DO concentration in the nitrite nitrification tank is 0.3 to 6 mg / L, and particularly 0.5 to 4 mg / L.

[0030] The nitrified liquid from the nitrite-type nitrification tank is introduced into the Anammox reaction tank 1, where it is denitrified by the action of Anammox bacteria, which perform a denitrification reaction using ammonia nitrogen as an electron donor and nitrite nitrogen as an electron acceptor. In order to efficiently react ammonia nitrogen and nitrite nitrogen and reduce residual nitrogen in this denitrification treatment by Anammox bacteria, it is preferable that the nitrified liquid from the nitrite-type nitrification tank has a molar ratio of ammonia nitrogen to nitrite nitrogen of 1:1.32 to 1.4.

[0031] The single-tank Anammox process may be continuous or batch (SBR type).

[0032] In a continuous system, the water to be treated is continuously supplied to the Anammox reactor, and the treated water is continuously withdrawn from the Anammox reactor.

[0033] In a batch-type, single-tank Anammox process, the operation is carried out as described in steps 1-5 below. 1. Add the raw water to the reaction vessel. 2. By aerating the reaction vessel, the single-tank Anammox reaction proceeds, converting ammoniacal nitrogen into nitrogen gas and removing it from the water. 3. Stop aeration and allow the sludge containing ammonia-oxidizing bacteria and Anammox bacteria to settle. 4. Discharge the supernatant water as treated water. 5. New raw water is added to the reaction tank again, and steps 2-4 are repeated.

[0034] In this invention, a BOD and SS removal step may be included as needed before the water to be treated is introduced into the Anammox reaction tank, as shown in Figures 1 and 2. BOD removal can be performed using aeration tank treatment, but there are no particular limitations. Figure 1 shows a two-tank Anammox process for treating dewatered sludge. Figure 1 shows an example of a flow in which aerobic biological treatment and a sedimentation tank are placed before the Anammox reactor 1. Figure 2 shows an example of a flow in a single-tank Anammox process for treating dewatered sludge, in which aerobic biological treatment and a sedimentation tank are placed before the Anammox reactor 2.

[0035] The ammonia-oxidizing bacteria used in the present invention for the nitrification of ammonia nitrogen are bacteria that have been conventionally used for the nitrification of ammonia nitrogen, and are bacteria that oxidize ammonia nitrogen under aerobic conditions to convert it into nitrite nitrogen. Sludge containing such nitrifying bacteria can be obtained from the nitrification process of organic wastewater treatment containing ammonia nitrogen, and the sludge containing nitrifying bacteria collected from the nitrification process of organic wastewater treatment can be used as is or attached to a carrier.

[0036] The Anammox bacteria used for denitrification in this invention are bacteria belonging to the phylum Plantomycetes, which are denitrifying bacteria that react ammoniacal nitrogen and nitrite nitrogen in an anaerobic atmosphere to directly convert them into nitrogen gas. This invention is suitable when the microbial community in the sludge of the Anammox process is dominated by the genus Ca. Brocadia. Such sludge containing Anammox bacteria can be obtained by culturing sludge collected from an organic wastewater treatment process or the like using ammoniacal nitrogen and nitrite nitrogen as substrates, thereby allowing Anammox bacteria to become dominant. Furthermore, sludge collected from an Anammox process that treats nitrogen-containing liquids can be used as is or attached to a carrier.

[0037] The single-tank Anammox process uses a mixed sludge containing ammonia-oxidizing bacteria and Anammox bacteria.

[0038] In this invention, air is preferred as the oxygen-containing gas used for aeration, but other gases can also be used.

[0039] As mentioned above, K in the water to be treated + A long-term impact assessment of the concentration on the Anammox reaction revealed that the K content in the water flowing into the Anammox reaction vessel was high. + It was found that the activity of Ca. Brocadia gradually decreases when operation is continued at concentrations exceeding 1000 mg / L.

[0040] In one aspect of the present invention, K is located either before or after the Anammox reactor.+ Measure the concentration, K + If the concentration exceeds 1000 mg / L, the K in the water flowing into the Anammox reactor will be affected. + The concentration should be 1000 mg / L or less, preferably 10 to 900 mg / L, and especially 50 to 500 mg / L, using K + By operating at a reduced concentration, high Anammox activity can be maintained, enabling stable treatment of wastewater containing ammoniacal nitrogen.

[0041] K + Methods for measuring concentration include atomic absorption spectrometry and ion electrode methods, but are not limited to any particular method.

[0042] K + As a means of reducing the concentration, K + Examples include dilution using low-concentration dilution water, desalination treatment using ion exchange resin, and ammonia stripping. A treatment method for ammonia nitrogen-containing wastewater using ammonia stripping is shown in Figure 3, K + High-concentration raw water is subjected to ammonia stripping treatment to volatilize ammonia, and the volatilized ammonia is converted to K + This method involves absorbing the ammonia in low-concentration water and then treating the resulting ammonia absorbent solution with Anammox. In this case, either a two-tank Anammox process or a single-tank Anammox process may be used.

[0043] The Anammox process may include an aeration tank for BOD removal and a sedimentation tank for SS removal as pretreatment, and in the case of a two-tank Anammox process, a nitrite nitrification tank is also included. The addition of dilution water can be done anywhere in or before the Anammox reaction tank, but it is preferable to do so before the Anammox reaction tank.

[0044] K + If dilution is the means to reduce the amount, the dilution water may be added continuously or intermittently. The dilution water may be added at two or more points. The dilution water is K +The concentration is preferably 100 mg / L or less, and more preferably 50 mg / L or less. Examples include industrial water, agricultural water, groundwater, and RO permeate.

[0045] Dilution lowers the ammonia concentration in the treated water and changes the residence time in the reaction tank, which can prevent the reduction of organic matter during pretreatment, and may also lead to the proliferation of nitrite-oxidizing bacteria in the nitrite tank, causing nitrite to be oxidized to nitrate. Therefore, by adding dilution water, K + When reducing the concentration, it is preferable to perform the following procedure.

[0046] (a) Dilution water is added before the Anammox reactor. (b) Adding dilution water lowers the ammonia concentration of the water to be treated. If the ammonia concentration of the water to be treated becomes excessively low, the nitrite reaction will not proceed properly, and nitrite will be oxidized to nitrate. Therefore, when adding dilution water, measure the ammonia concentration of the Anammox-treated water discharged from the Anammox reaction tank and reduce the aeration rate so that it is 50 mg-N / L or higher. Conversely, if dilution is stopped or the amount of dilution water is reduced, the ammonia concentration of the Anammox-treated water will rise, so increase the aeration rate so that this ammonia concentration is 200 mg-N / L or lower. (c) When dilution water is added, the water temperature in the nitrite tank and the Anammox reaction tank changes. The water temperature in the reaction tanks is adjusted so that the water temperature in the nitrite tank and the Anammox reaction tank is in the range of 30-38°C by increasing or decreasing the flow rate of hot water in the heat exchanger, increasing or decreasing the steam injection, adjusting the temperature of the dilution water, etc. (d) If aerobic biological treatment is performed as a pretreatment, the soluble COD after pretreatment Cr (COD after filtration with a 0.45 μm filter) Cr Adjust the flow rate so that the concentration is 2000 mg / L or less.

[0047] This invention is particularly suitable when the microbial flora in the sludge of the Anammox process is dominated by the genus Ca. Brocadia. Dominance of the genus Ca. Brocadia means that it has the highest abundance ratio among the bacteria that make up the Anammox community. On the other hand, in freshwater sludge, the abundance ratio of Ca. Brocadia to Ca. Kuenenia is often higher than that of other Anammox bacteria. Therefore, in this study, we determined that Ca. Brocadia is dominant if the abundance ratio of Ca. Brocadia to Ca. Kuenenia is greater than 1.

[0048] To determine whether sludge is dominated by the genus Ca. Brocadia, there is a method of analyzing the microbial flora targeting the 16s rRNA gene.

[0049] There are no particular limitations on the methods for determining whether the genus Ca. Brocadia is dominant, but examples include the following methods for analyzing bacterial flora and quantifying Anammox bacteria.

[0050] [Bacteria flora analysis, Anammox bacteria quantification method] The method for calculating the dominance rate of the genus Ca. Brocadia is not particularly limited, and methods well known to those skilled in the art can be used. Examples of such methods include polymerase chain reaction (PCR), shotgun metagenomic analysis, 16S amplicon analysis, real-time PCR, and LAMP. Among these methods, 16S amplicon analysis, which can distinguish between the genus Ca. Brocadia and other Anammox bacteria, such as the genus Ca. Kuenenia, and calculate their proportion in the total number of other prokaryotes, and real-time PCR, which can detect and quantify the genus Ca. Brocadia and calculate the proportion of the genus Ca. Brocadia in the total number of bacteria using commercially available universal primers, are preferred.

[0051] The following shows a configuration for performing 16S amplicon analysis and real-time PCR, but the analysis methods and sequences shown here are just examples and are not particularly limited.

[0052] <Preparation of genomic DNA samples> For example, commercially available DNA extraction kits can be used to prepare genomic DNA.

[0053] <When performing 16S amplicon analysis> Library preparation can be performed using oligoDNA with a base sequence capable of amplifying a specific region in the 16S rRNA gene of common bacteria, including Anammox bacteria, as primers, and amplicon sequencing can be performed using a next-generation sequencer, such as IlluminaMiseq.

[0054] For example, oligoDNA with the nucleotide sequences shown in SEQ ID NOs: 1 and 2 can be used as primer sequences.

[0055] Sequence ID 1: 5'-cctacgggrsgcagcag-3' Sequence ID 2: 5'-ggactachvgggtatctaat-3'

[0056] The obtained sequencing data can be analyzed using microbiome analysis tools such as Mothur or QIIME2.

[0057] OligoDNA with a nucleotide sequence that can amplify a specific region of the 16S rRNA gene of the genus Ca. Brocadia distinctly from that of other prokaryotes can be used as primers.

[0058] As primers, for example, the nucleotide sequences shown in SEQ ID NOs. 3 and 4 can be used as forward and reverse primers, respectively. Furthermore, when applying the probe method as a fluorescence monitoring method, the nucleotide sequence shown in SEQ ID NO. 5 can be used as the probe. In addition, any fluorescent dye and quencher, such as FAM (5-Carboxyfluorescein) and EQ (EclipseQuencher), can be used, and MGB (MinorGrooveBinder) may be used to further increase the Tm value.

[0059] For example, the base sequence shown in Sequence ID No. 4 can be used as the standard DNA for creating the calibration curve.

[0060] Sequence ID 3 corresponds to the base sequence from position 103 to 123 of Sequence ID 6.

[0061] Sequence ID 4 is inversely complementary to the base sequence from position 300 to 319 of Sequence ID 6. Sequence ID 5 is inversely complementary to the base sequence from position 252 to 269 of Sequence ID 6.

[0062] Sequence ID 3: 5'-ggagttaagaaatgcaaggat-3' Sequence ID 4: 5'-actcgagctatgcagtatcg-3' Sequence ID 5: 5'-tcacraccgacttacaya-3'

[0063] Sequence ID 6: 5'-tcctacgggaggctgcagtcgagaatctttcgcaatgcccgaaagggtgacgaagcgacgccgcgtgcgggaagaaggccttcgggttgtaaaccgct gtcgggagttaagaaatgcaaggatgttaatagcatctttgtttgactaaggctccggaggaagccacggctaactctgtgccagcagccgcggtaataca gaggcggcaagcgttgttcggaattattgggcgtaaagagcacgtaggcggctgtgtaagtcggttgtgaaagccttccgcttaacggaagaacggcatcc gatactgcatagctcgagtgcgggaggggagagtggaacttctggtggagcggtgaaatgcgtagatatcagaaggaacaccggcggcgaaggcgactc-3'

[0064] To ensure that Ca. Brocadia and other Anammox bacteria are quantified separately, Ca. Kuenenia can also be quantified simultaneously. This can be achieved by using oligoDNA as a primer, which has a base sequence that can amplify a specific region of the Ca. Kuenenia 16S rRNA gene distinctly from that of other prokaryotes.

[0065] As the aforementioned primers, for example, the nucleotide sequences shown in SEQ ID NOs. 7 and 8 can be used as forward and reverse primers, respectively. Furthermore, when applying the probe method as a fluorescence monitoring method, for example, the nucleotide sequence shown in SEQ ID NO. 7 can be used as the probe. In addition, any fluorescent dye and quencher, such as FAM (5-Carboxyfluorescein) and EQ (EclipseQuencher), can be used, and MGB (MinorGrooveBinder) may be used to further increase the Tm value.

[0066] For example, the base sequence shown in Sequence ID No. 10 can be used as the standard DNA for creating the calibration curve.

[0067] Sequence ID 7 corresponds to the base sequence from position 104 to 123 of Sequence ID 10.

[0068] Sequence ID 8 is reverse complementary to the base sequence from position 300 to 319 of Sequence ID 10. Sequence ID 9 is inversely complementary to the base sequence from position 252 to 269 of Sequence ID 10.

[0069] Sequence ID 7: 5'-gagttaggaaatgcaggtgc-3' Sequence ID 8: 5'-actcaagccctgtagtatca-3' Sequence ID 9: 5'-tcacaactgwctygcaag-3'

[0070] Sequence ID 10: 5'-ctcctacgggaggctgcagtcgagaatctttcgcaatgcccgaaaggtgacgaagcgacgccgcgtgtgggaagaaggccttcgggttgtaaaccact gtcgggagttaggaaatgcaggtgcgttaatagcgcacttgcttgactaaggctccagaggaagccacggcttactctgtgccagcagccgcggtaataca gaggcggcaaggcttgttcggaattattgggcgtaaagagcacgtaggcggccttgcaagtcagttgtgaaagccttccgcttaacggaagaacggcatct gatactacagggcttgagtacgggaggggagagtggaacttctggtggagcggtgaaatgcgtagatatcagaaggaacgccggcggcgaaagcgactc-3'

[0071] For the measurement of all bacteria, known or proprietary primers and probes can be used.

[0072] As primers, for example, the nucleotide sequences shown in SEQ ID NOs. 11 and 12 can be used as forward and reverse primers, respectively. Furthermore, when applying the probe method as a fluorescence monitoring method, the nucleotide sequence shown in SEQ ID NO. 13 can be used as the probe. In addition, any fluorescent dye and quencher, such as FAM and BHQ1 (BlackHoleQuencher1), can be used.

[0073] For example, the base sequence shown in Sequence ID No. 14 can be used as the standard DNA for creating the calibration curve.

[0074] Sequence ID 11 corresponds to the base sequence from position 1047 to 1062 of Sequence ID 14.

[0075] Sequence ID 12 is inversely complementary to the base sequence from position 1384 to 1398 of Sequence ID 14. Sequence ID 13 corresponds to the base sequence from position 1092 to 1106 of Sequence ID 14.

[0076] Sequence ID 11: 5'-atggctgtcgtcagct-3' Sequence ID 12: 5'-acgggcggtgtgtac-3' Sequence ID 13: 5'-caacgagcgcaaccc-3'

[0077] Sequence ID 14:

[0078] Commercially available reagents and instruments can be used for DNA amplification, trend detection, calibration curve creation, and quantification of target DNA in real-time PCR, such as the LightCycler® 480 ProbeMaster and LightCycler® 480 System II. [Examples]

[0079] The following describes some examples.

[0080] [Example 1, Comparative Example 1] (Single-tank Anammox process) <Water to be treated> Digestion fluid collected from a mesothermal methane fermentation tank (retention time 30-40 days, 35°C) used for processing food waste was mixed with an aqueous solution of a cationic polymer flocculant, and the solids and eluate were separated using a centrifugal dehydrator. The eluate was aerated in an aeration tank to obtain soluble COD. Cr The average concentration was 500 mg / L, the average NH4-N concentration was 1800 mg / L, and K + The source water used had an average concentration of 1200 mg / L.

[0081] <Dilution and Anammox treatment> This raw water was diluted with tap water (undiluted in Comparative Example 1-1) and subjected to a continuous water flow test of a single-tank Anammox reaction using Anammox granules. The Anammox granules used were cultured in factory wastewater containing ammoniacal nitrogen.

[0082] In Examples 1-1 and 1-2, tap water and raw water were mixed at the inlet of a single-tank Anammox reaction vessel according to the dilution ratios shown in Table 1 to dilute the solution. No dilution was performed in Comparative Example 1-1. The dilution ratio is (raw water + dilution water) / (raw water).

[0083] The ammonia concentration of the Anammox-treated water discharged from the Anammox reactor was measured, and the aeration rate of the Anammox reactor was adjusted so that it was 50 mg-N / L or higher.

[0084] <Result> The results of the nitrogen removal rate measurement are shown in Table 1. As shown in Table 1, K + In Comparative Example 1-1, an undiluted sample with a concentration exceeding 1000 mg / L, the nitrogen removal rate gradually decreased, reaching 0.5 kg-N / m³ after 30 days. 3 It became / d.

[0085] Furthermore, 16S amplicon analysis (V3-V4 region) was performed on the Anammox granules from Example 1-1 after 30 days. As a result, Anammox bacteria accounted for 39% of the total bacteria. In addition, the copy number ratio of the 16S rRNA gene between the genera Ca. Brocadia and Ca. Kuenenia was 4150, indicating that Ca. Brocadia was dominant.

[0086] [Table 1]

[0087] [Example 2, Comparative Example 2] (Two-tank Anammox process) Digestion from a medium-temperature methane fermentation tank (retention time 30-40 days, 35°C) used to process food waste was collected, and a cationic polymer solution was added to it. The solids and eluate were separated using a centrifugal dehydrator. This eluate was aerated in an aeration tank to obtain dissolved COD. Cr The concentration was adjusted to an average of 500 mg / L. This wastewater was used as raw water and treated by continuously passing it through a two-tank Anammox system (nitrite tank → sedimentation tank → Anammox reaction tank) after dilution (or without dilution).

[0088] In Example 2-1 and Comparative Example 2-1, the raw water was diluted with tap water to a ratio of 2:1 or 1.5:1, and sodium nitrite was added to adjust the ratio of ammonia to nitrite nitrogen to approximately 1.0 before treatment. In Comparative Example 2-2, the raw water was not diluted, and sodium nitrite was added to adjust the ratio of ammonia to nitrite nitrogen to approximately 1.0 before the treated water was used.

[0089] The same Anammox granules used in Example 1 were also used.

[0090] The results are shown in Table 2.

[0091] [Table 2]

[0092] <Consideration> Comparing Comparative Example 1-1 and Example 2-1, Example 2-1 contains Na + High, K + Concentration and Na + Despite a higher total concentration and higher conductivity compared to Comparative Example 1-1, no decrease in activity was observed. This suggests that, among the salts, the potassium ion concentration, in particular, significantly influences the inhibition of the Anammox reaction.

[0093] Furthermore, as is clear from the comparison between Examples 1-1, 1-2 and 2-1 and Comparative Examples 1-1, 2-1 and 2-2, K + When the concentration exceeds 1000 mg / L, the activity of the Anammox reaction decreases.

[0094] [Example 3] (Single-tank Anammox process) Digestion from a mesothermal methane fermentation tank (retention time 30 days, 35°C) used to process livestock manure was collected, and an aqueous solution of a cationic polymer flocculant was added to it. The solids and eluate were then separated using a centrifugal dehydrator. The eluate was aerated in an aeration tank to obtain soluble COD. Cr The average concentration was 2000 mg / L, the average NH4-N concentration was 1100 mg / L, and K + The raw water used had an average concentration of 1130 mg / L. This raw water was diluted with tap water (or not diluted) and used in a continuous water flow test of a single-tank Anammox system.

[0095] In this test, agricultural water (COD) was used at the inlet of a single-tank Anammox reactor at 0-56 days and 105-150 days. CrConcentration 50 mg / L, NH4-N concentration detection limit 0.02 mg / L or less, K + The solution (at a concentration of 0.1 mg / L) was mixed with raw water and diluted 1.5 times. No dilution was performed between days 57 and 102.

[0096] The results are shown in Table 3. K + At a concentration of 750 mg / L, the nitrogen removal rate (average value, same applies below) was 1.8 kg-N / m³ during days 30-56 out of 1-56 days. 3 It was / d. K + Activity began to decline from day 56 when the concentration was set to 1130 mg / L, and on day 90 (K + (34 days after changing to a concentration of 1130 mg / L) to day 102, the nitrogen removal rate was 1.3 kg-N / m 3 It decreased to / d. Therefore, K + When the concentration was returned to 750 mg / L (1.5-fold dilution), the nitrogen removal rate increased again, reaching 1.8 kg-N / m³ after 130-150 days. 3 Restored to / d

[0097] Furthermore, after 55 days, 16S amplicon analysis (V3-V4 region) was performed on Anammox granules. The results showed that Anammox bacteria accounted for 14.2% of all bacteria, and among them, the ratio of 16S rRNA gene copies between the genera Ca. Brocadia and Ca. Kuenenia was 1.9, indicating a dominance of the Ca. Brocadia gene.

[0098] [Table 3] [Explanation of Symbols]

[0099] 1,2 Anammox reactor

Claims

1. In a method for treating ammonia nitrogen-containing wastewater using an Anammox reactor, K in wastewater containing ammoniacal nitrogen ＋ If the concentration is higher than 1000 mg / L, the K in the water to be treated is introduced into the Anammox reactor. ＋ K ＋ A method for treating wastewater containing ammonia nitrogen, characterized by reducing [amount].

2. K ＋ To reduce the concentration, K is used in wastewater containing ammonia nitrogen. ＋ A method for treating ammonia nitrogen-containing wastewater according to claim 1, wherein a low-concentration diluted water is added to the Anammox reaction vessel or its upstream side.

3. K in the water to be treated is introduced into the Anammox reaction tank. ＋ A method for treating ammonia nitrogen-containing wastewater according to claim 2, wherein dilution water is added so that the concentration is 100 to 900 mg / L.

4. Ammonia nitrogen-containing wastewater is subjected to ammonia stripping treatment, and the ammonia volatilized by ammonia stripping is compared to the wastewater before stripping in terms of K ＋ A method for treating ammonia nitrogen-containing wastewater according to any one of claims 1 to 3, wherein the ammonia is absorbed into water of a low concentration, and the water from which the ammonia has been recovered is treated using the Anammox reaction vessel.

5. The method for treating ammonia nitrogen-containing wastewater according to any one of Claims 1 to 3, wherein the ammonia nitrogen-containing wastewater is digestate.

Images