Instruments that suppress the attachment of enveloped viruses.
Patent Information
- Application Number
- JP2022547654
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-01-15
- Filing Date
- 2021-09-09
- Publication Date
- 2026-09-15
- Estimated Expiration
- 2041-09-09
Smart Images

Figure 0007920915000017 
Figure 0007920915000018 
Figure 0007920915000019
Abstract
Description
[Technical Field]
[0001] The present invention relates to a device with suppressed adhesion of enveloped viruses, a method for reducing adhesion of enveloped viruses, an enveloped virus test kit, and a method for lowering the detection limit of enveloped virus tests. [Background Art]
[0002] Enveloped viruses cannot proliferate on their own, so they invade cells of animals and plants including humans, and sometimes cause severe infectious diseases. For this reason, operations to purify and store enveloped viruses are sometimes performed in the process of researching prevention and treatment methods for infectious diseases. In addition, in order to confirm and investigate enveloped virus infection, body fluids or sewage are collected, stored in containers, and then the enveloped viruses are sometimes measured. For example, as one of the attempts to grasp the epidemic situation of coronavirus disease 2019 (COVID-19), it has been reported that after storing sewage in a plastic container, SARS-CoV-2 (a type of enveloped virus) in aqueous solution was measured (see, for example, Non-Patent Document 1). However, it has been a problem that enveloped viruses adsorb to the surface of storage containers, resulting in loss of samples and decreased recoverability. Similar to enveloped viruses, proteins also have reduced recoverability and make stable detection difficult due to adsorption to container surfaces. While this problem can sometimes be improved by additives such as surfactants in the case of proteins, certain enveloped viruses are destroyed by surfactants; even if adsorption is suppressed, problems arise in subsequent recovery and detection, which has been an issue. In addition, although an ion complex material having ability to suppress adhesion of biological substances and a coating material for suppressing adhesion of biological substances using the same have been disclosed (see, for example, Patent Document 1), suppression of adhesion of enveloped viruses has not been reported. [Prior Art Literature] [Patent Literature]
[0003] [Patent Document 1] International Publication No. 2016 / 093293 [Non-patent literature]
[0004] [Non-Patent Document 1] Science of the Total Environment 739 (2020) 139076 [Overview of the project] [Problems that the invention aims to solve]
[0005] The present invention aims to provide an instrument in which the attachment of enveloped viruses is suppressed, a method for reducing the attachment of enveloped viruses, a virus testing kit for enveloped viruses, and a method for improving the sensitivity of virus testing for enveloped viruses. [Means for solving the problem]
[0006] The inventors have found that by applying a hydrophilic coating film to at least a portion of the surface of the instrument, it is possible to provide an instrument in which the adhesion of enveloped viruses is suppressed. The present invention encompasses the following:
[0007] [1] An instrument having a hydrophilic coating film on at least a portion of its surface, which inhibits the attachment of enveloped viruses. [2] The apparatus according to [1]1, wherein the coating film comprises a polymer of a monomer having a hydrophilic functional group. [3] The apparatus according to [2], wherein the hydrophilic functional group is selected from phosphoric acid, phosphonic acid and ester structures thereof; betaine structures; amide structures; alkylene glycol residues; amino groups; and sulfinyl groups. [4] The coating film is a copolymer comprising repeating units containing a group represented by the following formula (a) and repeating units containing a group represented by the following formula (b): [ka] (In the formula, U a1 , U a2 , U b1 , U b2 and U b3 Each of these independently represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms, and An - (This represents an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions.) The apparatus according to [1], which has a coating film containing the above. [5] The above copolymer is further converted to the following formula (c): [ka] [In the formula, R c This represents a linear or branched alkyl group having 1 to 18 carbon atoms, an alicyclic hydrocarbon group having 3 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms, an aralkyl group having 7 to 15 carbon atoms, or an aryloxyalkyl group having 7 to 15 carbon atoms (wherein the aryl portion may be substituted with a linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with a halogen atom). The apparatus described in [4], which is a coating film containing the above. [6] The apparatus according to [1], wherein the enveloped virus is an enveloped virus selected from the Flaviviridae, Togaviridae, Retroviridae, Coronaviridae, Filoviridae, Rhabdoviridae, Bunyaviridae, Orthomyxoviridae, Paramyxoviridae, Arenaviridae, Hepadnaviridae, Herpesviridae, and Poxviridae families. [7] The apparatus described in any one of [1] to [6], which is a virus storage container having an envelope. [8] A virus testing kit having an envelope, the device described in any one of [1] to [6]. [9] A method for reducing the attachment of enveloped viruses, using the apparatus described in any one of [1] to [8].
[10] A method for reducing the detection limit of an enveloped virus test, using the apparatus described in any one of [1] to [8].
[11] The method according to
[10] , carried out in the presence of a compound that disrupts the envelope.
[12] An apparatus according to any one of [1] to [8] for maintaining the infectivity of an enveloped virus.
[13] A method for maintaining the infectivity of an enveloped virus using the apparatus described in any one of [1] to [8]. [Effects of the Invention]
[0008] The present invention provides instruments in which the attachment of enveloped viruses is suppressed, and a method for reducing the attachment of enveloped viruses using such instruments. Specifically, it provides enveloped virus storage containers with reduced loss, and enveloped virus testing kits with improved detection sensitivity for enveloped viruses. Furthermore, the enveloped virus storage container of this application also has the effect of maintaining the infectivity titer (infectivity of enveloped viruses) of enveloped viruses even after storage for a certain period of time. In addition, for example, in enveloped virus storage containers and enveloped virus testing kits, even enveloped viruses that have come into contact with compounds that destroy the envelope are able to have their attachment of compositions containing the antigen and nucleic acid of the enveloped virus to the instruments suppressed, thereby improving the detection (sensitivity) of immunological and PCR measurements of enveloped viruses. [Brief explanation of the drawing]
[0009] [Figure 1] This graph shows the results of the adsorption inhibition test for inactivated Sendai virus (HVJ-E: HVJ-Envelop, HVJ: Hemagglutinating Virus of Japan) in Example 1. [Figure 2]This graph shows the results of the SARS-CoV-2 spike protein adsorption inhibition test in Example 2. [Figure 3] This graph shows the results of the BSA adsorption inhibition test in Example 3. [Figure 4] This graph shows the results of the inactivated Sendai virus adsorption inhibition test in Example 4. [Figure 5] This graph shows the results of the inactivated Sendai virus adsorption inhibition test in the presence of guanidine hydrochloride in Example 5. [Modes for carrying out the invention]
[0010] <Explanation of Terms> Unless otherwise specified, the terms used in this invention have the following definitions.
[0011] In this invention, "virus" refers to an "enveloped virus" as will be described in detail later, and the term "virus" in this specification means an "enveloped virus."
[0012] In this invention, "halogen atom" means a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.
[0013] In the present invention, "alkyl group" means a monovalent group of a saturated aliphatic hydrocarbon, either linear or branched. Examples of "linear or branched alkyl groups having 1 to 5 carbon atoms" include methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, isobutyl group, s-butyl group, t-butyl group, n-pentyl group, 1-methylbutyl group, 2-methylbutyl group, 3-methylbutyl group, 1,1-dimethylpropyl group, 1,2-dimethylpropyl group, 2,2-dimethylpropyl group, or 1-ethylpropyl group. Examples of "linear or branched alkyl groups having 1 to 18 carbon atoms" include, in addition to the examples of "linear or branched alkyl groups having 1 to 5 carbon atoms," hexyl group, heptyl group, octyl group, nonyl group, decyl group, undecyl group, dodecyl group, tridecyl group, tetradecyl group, pentadecyl group, hexadecyl group, heptadecyl group, or octadecyl group, or their isomers.
[0014] In the present invention, "linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with halogen atoms" means either the linear or branched alkyl group having 1 to 5 carbon atoms as described above, or the linear or branched alkyl group having 1 to 5 carbon atoms substituted with one or more halogen atoms as described above. Examples of "linear or branched alkyl group having 1 to 5 carbon atoms" are as described above. On the other hand, "linear or branched alkyl group having 1 to 5 carbon atoms substituted with one or more halogen atoms" means that one or more arbitrary hydrogen atoms of the linear or branched alkyl group having 1 to 5 carbon atoms as described above are replaced with halogen atoms. Examples include fluoromethyl group, difluoromethyl group, trifluoromethyl group, chloromethyl group, dichloromethyl group, trichloromethyl group, bromomethyl group, iodomethyl group, 2,2,2-trifluoroethyl group, 2,2,2-trichloroethyl group, perfluoroethyl group, perfluorobutyl group, or perfluoropentyl group.
[0015] In this invention, "ester bond" means -C(=O)-O- or -OC(=O)-, "amide bond" means -NHC(=O)- or -C(=O)NH-, and "ether bond" means -O-.
[0016] In the present invention, "linear or branched alkylene group having 1 to 10 carbon atoms, which may be substituted with halogen atoms" means a linear or branched alkylene group having 1 to 10 carbon atoms, or a linear or branched alkylene group having 1 to 10 carbon atoms substituted with one or more halogen atoms. Here, "alkylene group" means a divalent organic group corresponding to the alkyl group described above. Examples of "linear or branched alkylene groups having 1 to 10 carbon atoms" include methylene group, ethylene group, propylene group, trimethylene group, tetramethylene group, 1-methylpropylene group, 2-methylpropylene group, dimethylethylene group, ethylethylene group, pentamethylene group, 1-methyltetramethylene group, 2-methyltetramethylene group, 1,1-dimethyl-trimethylene group, 1,2-dimethyl-trimethylene group, 2,2-dimethyl-trimethylene group, 1-ethyl-trimethylene group, hexamethylene group, octamethylene group, and decamethylene group. Among these, ethylene group, propylene group, octamethylene group, and decamethylene group are preferred, and linear or branched alkylene groups having 1 to 5 carbon atoms, such as ethylene group, propylene group, trimethylene group, and tetramethylene group, are more preferred, with ethylene group or propylene group being particularly preferred. "A linear or branched alkylene group having 1 to 10 carbon atoms substituted with one or more halogen atoms" means that one or more arbitrary hydrogen atoms of the alkylene group are replaced with halogen atoms, and in particular, it is preferred that some or all of the hydrogen atoms of the ethylene group or propylene group are replaced with halogen atoms.
[0017] In the present invention, "alicyclic hydrocarbon group having 3 to 10 carbon atoms" means a monovalent group of aliphatic hydrocarbon having 3 to 10 carbon atoms, being monocyclic or polycyclic, saturated or partially unsaturated. Among these, a monovalent group of saturated aliphatic hydrocarbon having 3 to 10 carbon atoms, being monocyclic or bicyclic, is preferred. Examples include cycloalkyl groups having 3 to 10 carbon atoms such as cyclopropyl, cyclobutyl, or cyclohexyl groups, or bicycloalkyl groups having 4 to 10 carbon atoms such as bicyclo[3.2.1]octyl, bornyl, or isobornyl groups.
[0018] In the present invention, "aryl group having 6 to 10 carbon atoms" means a monovalent group of an aromatic hydrocarbon having 6 to 10 carbon atoms, either monocyclic or polycyclic, such as a phenyl group, naphthyl group, or anthryl group. The "aryl group having 6 to 10 carbon atoms" may be substituted with one or more of the above-mentioned "linear or branched alkyl groups having 1 to 5 carbon atoms, which may be substituted with halogen atoms."
[0019] In the present invention, "aralkyl group having 7 to 15 carbon atoms" means the group -R-R' (where R represents the above-mentioned "alkylene group having 1 to 5 carbon atoms" and R' represents the above-mentioned "aryl group having 6 to 10 carbon atoms"), and examples include the benzyl group, phenethyl group, or α-methylbenzyl group. The aryl portion of the "aralkyl group having 7 to 15 carbon atoms" may be substituted with one or more of the above-mentioned "linear or branched alkyl groups having 1 to 5 carbon atoms which may be substituted with halogen atoms".
[0020] In the present invention, "aryloxyalkyl group having 7 to 15 carbon atoms" means the group -RO-R' (where R represents the above-mentioned "alkylene group having 1 to 5 carbon atoms" and R' represents the above-mentioned "aryl group having 6 to 10 carbon atoms"), and examples include the phenoxymethyl group, the phenoxyethyl group, or the phenoxypropyl group. The aryl portion of the "aryloxyalkyl group having 7 to 15 carbon atoms" may be substituted with one or more of the above-mentioned "linear or branched alkyl groups having 1 to 5 carbon atoms which may be substituted with halogen atoms".
[0021] In the present invention, "halide ion" means fluoride ion, chloride ion, bromide ion, or iodide ion.
[0022] In the present invention, "inorganic acid ion" means carbonate ion, sulfate ion, phosphate ion, hydrogen phosphate ion, dihydrogen phosphate ion, nitrate ion, perchlorate ion, or borate ion.
[0023] The above An - Preferred ions include halide ions, sulfate ions, phosphate ions, hydroxide ions, and isothiocyanate ions, with halide ions being particularly preferred.
[0024] In this invention, (meth)acrylate compound means both acrylate compound and methacrylate compound. For example, (meth)acrylic acid means either acrylic acid or methacrylic acid.
[0025] <Devices in which the attachment of enveloped viruses is suppressed> The device for which the attachment of enveloped viruses is suppressed according to the present invention comprises a hydrophilic coating film on at least a portion of its surface.
[0026] <Hydrophilic coating film> A hydrophilic coating film is defined as having a contact angle of 140° or more, preferably 150° or more, with respect to bubbles in water (at room temperature, e.g., 20°C ± 5°C).
[0027] The hydrophilic coating film may be provided on at least a portion of the surface of the instrument described later, but it is preferable that the coating film be formed on the contact surface with enveloped viruses, and it is more preferable that the coating film be formed over the entire surface of the instrument.
[0028] Preferably, the hydrophilic coating film comprises a polymer of a monomer having a hydrophilic functional group.
[0029] The polymer of a monomer having a hydrophilic functional group according to the present invention may be a polymer of an ethylenically unsaturated monomer having a hydrophilic functional group or structure, or a polymer of a polysaccharide or a derivative thereof. Examples of ethylenically unsaturated monomers include one or more ethylenically unsaturated monomers selected from the group consisting of (meth)acrylic acid and esters thereof; vinyl acetate; vinyl pyrrolidone; ethylene; and vinyl alcohol. Examples of polysaccharides or derivatives thereof include cellulose-based polymers such as hydroxyalkyl cellulose (e.g., hydroxyethyl cellulose or hydroxypropyl cellulose), starch, dextran, and curdlan.
[0030] Preferably, the hydrophilic functional group (i.e., hydrophilic functional group or structure) is selected from phosphoric acid, phosphonic acid and ester structures thereof; betaine structures; amide structures; alkylene glycol residues; amino groups; and sulfinyl groups.
[0031] A betaine structure refers to a monovalent or divalent group of a compound having an amphoteric center consisting of a quaternary ammonium-type cation structure and an acidic anion structure, for example, a phosphorylcholine group:
Chemical Formula
[0032] An amide structure is represented by the following formula:
Chemical Formula
[0033] The alkylene glycol residue refers to the alkylene oxy group (-Alk-O-) remaining after the hydroxyl groups at one or both ends of an alkylene glycol (HO-Alk-OH; where Alk is an alkylene group having 1 to 10 carbon atoms) undergo a condensation reaction with another compound, and also includes poly(alkylene oxy) groups in which alkylene oxy units are repeated. Examples of ethylenically unsaturated monomers having such a structure include 2-hydroxyethyl (meth)acrylate and methoxypolyethylene glycol (meth)acrylate. Furthermore, monomers or polymers having such a structure are disclosed, for example, in Japanese Patent Application Publication No. 2008-533489.
[0034] The amino group is represented by the formulas: -NH2, -NHR 19 or -NR 20 R 21 [Here, R 19 , R 20 and R 21 The terms refer to groups that are independently organic groups (e.g., linear or branched alkyl groups having 1 to 5 carbon atoms). The amino group in this invention includes quaternized or chlorinated amino groups. Examples of ethylenically unsaturated monomers having such a structure include dimethylaminoethyl (meth)acrylate, 2-(t-butylamino)ethyl (meth)acrylate, and methacryloylcholinchloride.
[0035] The sulfinyl group is represented by the following formula: [ka] [Here, R 22 This is an organic group (for example, an organic group having 1 to 10 carbon atoms, preferably an alkyl group having 1 to 10 carbon atoms and having one or more hydroxyl groups). This refers to the group represented by [the symbol]. As a method for introducing the sulfinyl group, the method disclosed in Japanese Patent Publication No. 2014-48278, etc., can be cited.
[0036] The polymer contained in the coating film of the present invention is a copolymer comprising repeating units containing a group represented by the following formula (a) and repeating units containing a group represented by the following formula (b): [ka] [In the formula, U a1 , U a2 , U b1 , U b2 and U b3 Each of these independently represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms; An - [wherein it is preferable that it represents an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions.]
[0037] Furthermore, the copolymer is further expressed by the following formula (c): [ka] [In the formula, R c This represents a linear or branched alkyl group having 1 to 18 carbon atoms, an alicyclic hydrocarbon group having 3 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms, an aralkyl group having 7 to 15 carbon atoms, or an aryloxyalkyl group having 7 to 15 carbon atoms (wherein the aryl portion may be substituted with a linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with a halogen atom). It may include repeating units containing a base represented by .
[0038] <Coating film> The coating film according to the present invention can be produced by applying a coating film-forming composition containing a polymer of the aforementioned hydrophilic functional group monomer to at least a portion of the surface of an instrument using a known method.
[0039] In one embodiment of the present invention, the coating film according to the present invention is a copolymer comprising repeating units comprising a group represented by the following formula (a) and repeating units comprising a group represented by the following formula (b): [ka] [In the formula, U a1 , U a2 , U b1 , U b2 and U b3 Each of these independently represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms; An - A coating film-forming composition containing an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions, and a solvent, can be obtained by a method that includes the step of applying the composition to at least a portion of the surface of an instrument.
[0040] Furthermore, the copolymer is further formulated with the following formula (c): [ka] [In the formula, R c This represents a linear or branched alkyl group having 1 to 18 carbon atoms, an alicyclic hydrocarbon group having 3 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms, an aralkyl group having 7 to 15 carbon atoms, or an aryloxyalkyl group having 7 to 15 carbon atoms (wherein the aryl portion may be substituted with a linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with a halogen atom). It may include repeating units containing a base represented by .
[0041] The copolymer is not particularly limited as long as it is a copolymer comprising repeating units comprising a group represented by formula (a), repeating units comprising a group represented by formula (b), and preferably repeating units comprising a group represented by formula (c). In this invention, the repeating units comprising a group represented by formula (c) are different from the repeating units comprising a group represented by formula (a) and the repeating units comprising a group represented by formula (b). The copolymer is preferably obtained by radical polymerization of a monomer comprising a group represented by formula (a), a monomer comprising a group represented by formula (b), and optionally a monomer comprising a group represented by formula (c), but copolymers obtained by polycondensation or polyaddition reactions can also be used. Examples of copolymers include vinyl polymers obtained by the reaction of olefins, polyamides, polyesters, polycarbonates, polyurethanes, etc., but among these, vinyl polymers obtained by the reaction of olefins or (meth)acrylic polymers obtained by polymerizing (meth)acrylate compounds are particularly preferred. The weight-average molecular weight of the copolymer may be several thousand to several million, preferably 5,000 to 5,000,000. More preferably, it may be 10,000 to 2,000,000, and most preferably 5,000 to 1,000,000. It may also be a random copolymer, a block copolymer, or a graft copolymer. Furthermore, any of these copolymers may be used individually, or multiple copolymers may be mixed and used in varying ratios.
[0042] The proportion of repeating units containing the group represented by formula (a) in the copolymer is 3 mol% to 80 mol%, preferably 3.5 mol% to 50 mol%, and more preferably 4 mol% to 30 mol%. The copolymer may also contain repeating units containing two or more groups represented by formula (a).
[0043] The proportion of repeating units containing the group represented by formula (b) in the copolymer is 3 mol% to 80 mol%, preferably 5 mol% to 70 mol%, and more preferably 8 mol% to 65 mol%. The copolymer may also contain repeating units containing two or more groups represented by formula (b).
[0044] If the copolymer contains repeating units containing a group represented by formula (c), the proportion of repeating units containing a group represented by formula (c) in the copolymer may be the entire remainder after subtracting formulas (a) and (b) from the total copolymer, or the remainder after subtracting the total proportion of formulas (a) and (b) and the fourth component described below, but is for example 1 mol% to 90 mol%, preferably 3 mol% to 88 mol%, more preferably 5 mol% to 87 mol%, and most preferably 50 mol% to 86 mol%. The copolymer may also contain repeating units containing two or more groups represented by formula (c).
[0045] The combination of proportions of repeating units containing the groups represented by formula (a), formula (b), and optionally formula (c) in the copolymer is: Preferably, Formula (a): 3 mol% to 80 mol%, Formula (b): 3 mol% to 80 mol%, Formula (c): 0 mol% to 90 mol% more, Formula (a): 3.5 mol% to 50 mol%, Formula (b): 5 mol% to 70 mol%, Formula (c): 3 mol% to 88 mol%, More preferably, Formula (a): 4 mol% to 30 mol%, Formula (b): 8 mol% to 65 mol%, Formula (c): 5 mol% to 87 mol%, Most preferably, Formula (a): 4 mol% to 30 mol%, Formula (b): 8 mol% to 65 mol%, Formula (c): 50 mol% to 86 mol%, That is the case.
[0046] In another embodiment of the present invention, the copolymer may further include units derived from any fourth component. For example, the fourth component may include a crosslinked structure derived from a (meth)acrylate compound having two or more functional groups. Examples of such fourth components include ethylene glycol di(meth)acrylate, triethylene glycol di(meth)acrylate, propylene glycol di(meth)acrylate, bis(methacryloyloxymethyl) phosphate, bis[(2-methacryloyloxy)ethyl] phosphate, bis[3-(methacryloyloxy)propyl] phosphate, and phosphinyridine tris(oxy-2,1-ethanediyl) triacrylate.
[0047] For example, the proportion of crosslinked structures derived from (meth)acrylate compounds having two or more functional groups in the copolymer is 0 mol% to 50 mol%, preferably 5 mol% to 45 mol%, and most preferably 10 mol% to 40 mol%.
[0048] The solvents included in the aforementioned coating film-forming composition include water, phosphate-buffered saline (PBS), and alcohol. Examples of alcohols include C2 to C6 alcohols, such as ethanol, propanol, isopropanol, 1-butanol, 2-butanol, isobutanol, t-butanol, 1-pentanol, 2-pentanol, 3-pentanol, 1-heptanol, 2-heptanol, 2,2-dimethyl-1-propanol (=neopentyl alcohol), 2-methyl-1-propanol, 2-methyl-1-butanol, 2-methyl-2-butanol (=t-amyl alcohol), 3-methyl-1-butanol, 3-methyl-3-pentanol, cyclopentanol, 1-hexanol, 2-hexanol, 3-hexanol, 2,3-dimethyl-2-butanol, and 3,3-dimethyl Examples include -1-butanol, 3,3-dimethyl-2-butanol, 2-ethyl-1-butanol, 2-methyl-1-pentanol, 2-methyl-2-pentanol, 2-methyl-3-pentanol, 3-methyl-1-pentanol, 3-methyl-2-pentanol, 3-methyl-3-pentanol, 4-methyl-1-pentanol, 4-methyl-2-pentanol, 4-methyl-3-pentanol, and cyclohexanol. These can be used individually or as mixed solvents in combination. However, from the viewpoint of dissolving copolymers, it is preferable to select from water, PBS, ethanol, propanol, and mixed solvents thereof, and more preferably from water, ethanol, and mixed solvents thereof.
[0049] To form the coating film according to the present invention, the above-mentioned coating film-forming composition is applied to at least a portion of the surface of the instrument. There are no particular restrictions on the application method, and conventional application methods such as spin coating, dip coating, and solvent casting can be used.
[0050] The drying process for the coating film according to the present invention is carried out under air or vacuum, preferably at a temperature in the range of -200°C to 200°C. The drying process removes the solvent from the above-mentioned coating film forming composition, and the copolymers of formula (a) and formula (b) according to the present invention form ionic bonds and completely adhere to the device.
[0051] The coating film can be formed by drying at room temperature (10°C to 35°C, e.g., 25°C), but to form the coating film more quickly, drying may be performed at, for example, 40°C to 50°C. Alternatively, a freeze-drying process at extremely low to low temperatures (around -200°C to -30°C) may be used. Freeze-drying, also known as vacuum freeze-drying, is a method in which the material to be dried is cooled with a refrigerant, and the solvent is removed by sublimation under vacuum. Common refrigerants used in freeze-drying include a mixture of dry ice and methanol (-78°C) and liquid nitrogen (-196°C).
[0052] If the drying temperature is below -200°C, it requires the use of uncommon refrigerants, which limits versatility, and the drying process is inefficient due to the long drying time required for solvent sublimation. If the drying temperature is above 200°C, the ionic bonding reaction on the surface of the coating film proceeds too far, causing the surface to lose its hydrophilicity, and the ability to suppress the adhesion of enveloped viruses is not exhibited. More preferable drying temperatures are 10°C to 180°C, and even more preferable drying temperatures are 25°C to 150°C.
[0053] After drying, a washing step may be performed with at least one solvent selected from aqueous solutions containing water and electrolytes to remove any remaining impurities, unreacted monomers, etc., on the coating film, and to adjust the ion balance of the copolymer in the film. Washing is preferably done by running water or ultrasonic cleaning. The aqueous solution containing water and electrolytes may be heated to a temperature range of, for example, 40°C to 95°C. The aqueous solution containing electrolytes is preferably PBS, physiological saline (containing only sodium chloride), Dulbecco phosphate-buffered physiological saline, Tris-buffered physiological saline, HEPES-buffered physiological saline, and Veronal-buffered physiological saline, with PBS being particularly preferred. After setting, the coating film remains firmly attached to the substrate without eluting even when washed with water, PBS, and alcohol. Even if enveloped viruses adhere to the formed coating film, they can be easily removed by subsequent washing with water or other methods.
[0054] If necessary, treatments such as radiation, electron beam, ethylene oxide, or autoclaving may be performed to sterilize or remove enveloped viruses.
[0055] The thickness of the coating film according to the present invention is preferably 10 to 1000 Å, more preferably 10 to 500 Å, and most preferably 20 to 400 Å.
[0056] The instrument of the present invention has a coating film formed from the above-mentioned coating film-forming composition on at least a portion of the instrument's surface. Specifically, it is preferable that the coating film be on the surface that comes into contact with enveloped viruses, and more preferably that the coating film be on the entire surface of the instrument.
[0057] Prior to the coating process, the surface of the apparatus may be subjected to a known plasma treatment. For example, methods of hydrophilizing the surface of acid-value materials such as glass or ITO (Indium Tin Oxide) by UV irradiation or oxygen plasma treatment are known. Techniques have also been reported for hydrophilizing the surface of plastics and silicone rubber (polydimethylsiloxane) resins to promote adhesion with varnish. (Patent No. 5898703, Patent No. 4255911) Plasma can be generated using a device that can create a space in which active charged particles and active radicals exist at high density, such as vacuum plasma generated by various single gases of the oxygen, nitrogen, or fluorine systems, or mixtures thereof, or plasma generated under atmospheric pressure or near atmospheric pressure.
[0058] <Copolymer> In one embodiment of the present invention, a copolymer comprising a repeating unit comprising a group represented by formula (a) and a repeating unit comprising a group represented by formula (b) is a copolymer comprising repeating units of the following formulas (a1) and (b1). [ka]
[0059] In the formula, Ta and T b Each of these independently represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms, Q a and Q b Each of these independently represents a single bond, an ester bond, or an amide bond, and R a and R b Each of these independently represents a linear or branched alkylene group having 1 to 10 carbon atoms, which may be substituted with halogen atoms, and U a1 , U a2 , U b1 , U b2 and U b3 Each of these independently represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms, and An - m represents an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions, and m represents an integer from 0 to 6.
[0060] In one embodiment of the present invention, a copolymer further comprising a repeating unit comprising a group represented by formula (c) is a copolymer further comprising a repeating unit of the following formula (c1). [ka]
[0061] In the formula, T c Q represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms. c R represents a single bond, ether bond, or ester bond. c This represents a linear or branched alkyl group having 1 to 18 carbon atoms, an alicyclic hydrocarbon group having 3 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms, an aralkyl group having 7 to 15 carbon atoms, or an aryloxyalkyl group having 7 to 15 carbon atoms (wherein the aryl portion may be substituted with a linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with a halogen atom).
[0062] In formula (a1), m represents an integer from 0 to 6, preferably an integer from 1 to 6, more preferably an integer from 1 to 5, and particularly preferably 1.
[0063] Copolymers comprising repeating units of the aforementioned formulas (a1), (b1), and preferably further (c1) are defined as follows: (A), (B), and preferably further (C): [ka] [In the formula, T a , T b , T c , U a1 , U a2 , U b1 , U b2 and U b3 Each of these independently represents a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms; Q a and Q b Each of these independently represents a single bond, an ester bond, or an amide bond, Q c This represents a single bond, an ether bond, or an ester bond; R a and R b Each of these independently represents a linear or branched alkylene group having 1 to 10 carbon atoms, which may be substituted with halogen atoms, and R c This represents a linear or branched alkyl group having 1 to 18 carbon atoms, an alicyclic hydrocarbon group having 3 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms, an aralkyl group having 7 to 15 carbon atoms, or an aryloxyalkyl group having 7 to 15 carbon atoms (wherein the aryl portion may be substituted with a linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with a halogen atom); An - This represents an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions; m represents an integer between 0 and 6. It is obtained by reacting (polymerizing) a monomer mixture containing the compound represented by in a solvent.
[0064] T a , T b and T c Preferably, it is a hydrogen atom, a methyl group, or an ethyl group, and more preferably a hydrogen atom or a methyl group. a Q b and Q c As such, single bonds or ester bonds are preferred, and ester bonds are more preferred. a and R b As such, linear or branched alkylene groups having 1 to 5 carbon atoms are preferred, and methylene groups, ethylene groups, or propylene groups are more preferred. c Preferably, the group is a linear or branched alkyl group having 4 to 18 carbon atoms or a cycloalkyl group having 3 to 10 carbon atoms, and more preferably a butyl group, a pentyl group, a hexyl group or their isomers, or a cyclohexyl group. a1 , U a2 , U b1 , U b2 and U b3 The preferred components are a hydrogen atom, a methyl group, an ethyl group, or a t-butyl group, and the U of formula (a) a1 and U a2 It contains a hydrogen atom, U in formula (b) b1 , U b2 and U b3 A hydrogen atom, a methyl group, an ethyl group, or a t-butyl group is more preferable.
[0065] The methods for producing the copolymer described above are as described in International Publication No. 2014 / 196650, International Publication No. 2016 / 093293, etc., and the full disclosures of these publications are incorporated herein by reference.
[0066] <Enveloped viruses> In this invention, a virus is defined as a virus having an envelope (including vaccines and viral vectors). The envelope is a membrane-like structure composed of lipids and proteins derived from the host cell, as well as glycoproteins derived from the virus.
[0067] Enveloped viruses are selected from the Flaviviridae, Togaviridae, Retroviridae, Coronaviridae, Filoviridae, Rhabdoviridae, Bunyaviridae, Orthomyxoviridae, Paramyxoviridae, Arenaviridae, Hepadnaviridae, Herpesviridae, and Poxviridae. Specific examples include yellow fever virus, dengue virus, Japanese encephalitis virus, St. Louis encephalitis, Murray Valley encephalitis, West Nile virus, Central European encephalitis, Russian spring-summer encephalitis, hepatitis C virus, rubella virus, Sindbisvirus, Chikungunya virus, Eastern equine encephalitis virus, Western equine encephalitis virus, Venezuelan horse encephalitis virus, human T-lymphotropic virus, human immunodeficiency virus, coronavirus, SARS coronavirus (SARS-CoV-1), MERS coronavirus, novel coronavirus (SARS-CoV-2 / COVID-19 virus), and Marburg virus. Examples of viruses include Ebola virus, rabies virus, California encephalitis virus, Hunter's virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, influenza A virus, influenza B virus, influenza C virus, Togot virus, Dori virus, parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus (RSV), Lassa virus, lymphocytic choriomeningitis virus, Junin virus, Machupo virus, Guanalito virus, hepatitis D virus, hepatitis B virus, human herpesvirus 1 (herpes simplex virus type 1), human herpesvirus 2 (herpes simplex virus type 2), human herpesvirus 3 (varicella-zoster virus), human herpesvirus 5 (cytomegalovirus), human herpesvirus 6, human herpesvirus 7, human herpesvirus 4 (EBV), human herpesvirus 8, and smallpox virus. These vaccine and vector applications are also included in the rights of this application. One or more combinations of these enveloped viruses are not ruled out.
[0068] The term "enveloped virus" as used in this invention is not limited to those that are infectious or pathogenic to humans. Enveloped viruses that are infectious or pathogenic to animals other than humans or to plants are also not excluded from the definition of an enveloped virus as used in this invention.
[0069] <Equipment> The device of the present invention is not particularly limited as long as it is used with enveloped viruses, but it is desirable that it comes into contact with the virus and suppresses its attachment during use. The shape is also not particularly limited, such as flat, curved, uneven, mesh, or sheet.
[0070] Specific examples include microwell plates, microplates, microtubes, tips, culture flasks, biodevices, syringes, pre-filled syringes, filters, nonwoven fabrics, and vials, which typically have multiple wells (indentations).
[0071] One embodiment of the apparatus of the present invention may be a storage container for enveloped viruses. The storage container preferably has the aforementioned coating film on the surface that comes into contact with the enveloped virus. The shape of the storage container for enveloped viruses is not particularly limited, as long as it can store a solution containing an enveloped virus (such as an aqueous solution containing an enveloped virus, which is usually liquid at room temperature), such as a bottle or tube. It is preferable that the container has a lid or the like that can be tightly sealed on top so that it can be stored in an airtight container.
[0072] One embodiment of the device of the present invention may be a filter. This may be a filter included in the sample collection kit described below, or a nonwoven fabric mask.
[0073] The material of the apparatus of the present invention is not particularly limited. Examples include glass, metal-containing compounds or metalloid-containing compounds, or resin, but from the viewpoint of versatility, glass or resin molded products are preferably used. Examples of metal-containing compounds or metalloid-containing compounds include ceramics, which are sintered bodies whose basic component is a metal oxide and are hardened by heat treatment at high temperatures; semiconductors such as silicon; inorganic solid materials such as molded products of inorganic compounds such as metal oxides or metalloid oxides (silicon oxide, alumina, etc.), metal carbides or metalloid carbides, metal nitrides or metalloid nitrides (silicon nitride, etc.), metal borides or metalloid borides; aluminum, nickel titanium, stainless steel (SUS304, SUS316, SUS316L, etc.). The resin may be a natural resin or its derivative, or a synthetic resin. Examples of natural resins or their derivatives include cellulose, cellulose triacetate (CTA), nitrocellulose (NC), and cellulose immobilized with dextran sulfate. Examples of synthetic resins include polyacrylonitrile (PAN), polyimide (PI), polyester polymer alloy (PEPA), polystyrene (PS), polysulfone (PSF), polyethylene terephthalate (PET), polymethyl methacrylate (PMMA), polyvinyl alcohol (PVA), polyurethane (PU), and ethylene vinyl alcohol. Polyethylene (EVAL), polyethylene (PE), polyester, polypropylene (PP), polyvinylidene fluoride (PVDF), polyethersulfone (PES), polycarbonate (PC), cycloolefin polymer (COP) (e.g., ZEONOR®, ZEONEX® (manufactured by Nippon Zeon Co., Ltd.)), polyvinyl chloride (PVC), polytetrafluoroethylene (PTFE), ultra-high molecular weight polyethylene (UHPE), polydimethylsiloxane (PDMS), acrylonitrile-butadiene-styrene resin (ABS), or Teflon® are preferably used.
[0074] <Method for reducing the attachment of enveloped viruses> The present invention provides a method for reducing the adhesion of enveloped viruses, comprising the steps of applying the aforementioned hydrophilic coating film to at least a portion of the surface of an instrument, and bringing an enveloped virus into contact with the instrument, thereby reducing the amount of enveloped viruses adhering to the instrument. For example, if the instrument is a container, the method includes the steps of applying the aforementioned hydrophilic coating film to at least a portion of the inner surface of the container, and placing a solution containing an enveloped virus into the container, characterized in that, after storage for a certain period of time, the amount of enveloped virus in the solution changes less from the initial amount when using the container of the present invention compared to when using an uncoated container (for example, the change from the initial amount is within 30%). The certain period of time is, for example, 1 hour to 1 year. The temperature may be freezing (for example, -100°C to -20°C or below), refrigeration (for example, less than -20°C to 10°C or below), or room temperature (for example, less than 10°C to 35°C). Reducing the attachment of enveloped viruses means that, after storage, the amount of enveloped viruses in the solution is retained at, for example, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, 99% or more, preferably 100%, of the initial amount of enveloped viruses.
[0075] The present invention also relates to the use of a hydrophilic coating film to reduce the adhesion of enveloped viruses to instruments. The meanings of each term are as described above.
[0076] <Method for detecting viruses with an envelope> Generally, methods for detecting enveloped viruses can be broadly categorized into four types. The first is detecting the nucleic acid of the enveloped virus; the second is detecting the protein of the enveloped virus; the third is utilizing the properties of the enveloped virus; and the fourth is detecting the enveloped virus particle itself.
[0077] Methods for detecting the nucleic acids of enveloped viruses can identify and quantify enveloped viruses by detecting nucleic acid sequences specific to enveloped viruses. Examples include PCR, LAMP, TMA, NASBA, liquid-phase nucleic acid hybridization, Southern blot hybridization, Northern blot hybridization, in situ hybridization, and microarray methods.
[0078] Methods for detecting proteins in enveloped viruses allow for the identification and quantification of enveloped viruses by detecting proteins specific to enveloped viruses. Examples include enzyme immunoassay, immunofluorescence assay, immunochromatography, Western blotting, chemiluminescence immunoassay, and radioimmunoassay.
[0079] Methods that utilize the properties of enveloped viruses allow for the quantification of enveloped viruses by detecting characteristic phenotypes (such as cytopathic effects and hemagglutination) of enveloped viruses. Examples include TCID50, PFU, HA, and LD50.
[0080] Methods for detecting enveloped virus particles themselves allow for the identification and quantification of enveloped viruses by detecting a single virus particle with an envelope on the order of tens to hundreds of nanometers. These methods include electron microscopy (TEM, AFM, cryo-EM, etc.), nanoparticle tracking analysis (NTA (NanoSight, Zeta View, etc.)), and nanopore current measurement (qNano, etc.).
[0081] <Virus detection equipment for viruses with envelopes> In the aforementioned method for detecting enveloped viruses, specific detection equipment may be used. By applying the hydrophilic coating film according to the present invention to the parts of these devices where the attachment and adsorption of enveloped viruses are expected, the detection limit for enveloped viruses can be further reduced, thereby improving the performance of enveloped virus detection.
[0082] There are no particular restrictions on the detection equipment mentioned above, and commercially available products may be used. For example, the coating of the present invention may be applied to the sample attachment portion of the extraction container used in Mizuho Medi's Class III immunoassay series, influenza virus kit; Quick Chaser® Flu A, etc.
[0083] <Specific nucleic acid sequences used for detecting enveloped viruses> In the case of the COVID-19 virus, the nucleic acid sequence of the open reading flame 1a (ORF1a) region is used. Sence: ACCTCATGGTCATGTTATGG (Sequence No. 1) Antisence: GACATAGCGAGTGTATGCC (Sequence ID 2), As the nucleic acid sequence of the spike protein region Sence: AAGACTCACTTTCTTCCACAG (Sequence ID 3) Antisence: CAAAGACACCTTCACGAGG (Sequence ID 4) For influenza viruses, the RT-PCR primer (5' - 3') for HA (full length) is for type A(H1N1)pdm09. H1HA1-BEGINV2 AGCAAAAGCAGGGGAAAACAA (Sequence ID 5), HA2H1-1759-1778R AGTAGAAACAAGGGTGTTTTT (Sequence ID 6), Type A(H3N2) H3HA1-BEGIN AGCAAAAGCAGGGGATAATTC (Sequence ID 7), HA2H3-1743-1762R AGTAGAAACAAGGGTGTTTT (Sequence ID 8), Blood type B BHA1-N AATATCCACAAAATGAAGGC (Sequence ID 9), HA2B-1867-1887R AGTAGTAACAAGAGCATTTTT (Sequence ID 10), In HA1, the A(H1N1)pdm09 type H1HA1-BEGIN AGCAAAAGCAGGGGAAAATAA (Sequence ID 11), swine H1-1106-1087R TGATAACCGTACCATCCATC (Sequence ID 12), Type A(H3N2) H3HA1-BEGIN AGCAAAAGCAGGGGATAATTC (Sequence ID 13), H3-1105-1125R CATCCACCATTCCCTCCCAAC (Sequence ID 14), Blood type B BHA1-N AATATCCACAAAATGAAGGC (Sequence ID 15), BHA1-C AGCAATAGCTCCGAAGAAAC (Sequence ID 16), In HA2, the A(H1N1)pdm09 type swine H1-907-928F ATAAACACCAGCCTCCCATTTC (Sequence ID 17), HA2H1-1759-1778R AGTAGAAACAAGGGTGTTTTT (Sequence ID 18), Type A(H3N2) HA2H3-1017-1039F CTGAAATTGGCAACAGGGATGCG (Sequence ID 19), HA2H3-1743-1762R AGTAGAAACAAGGGTGTTTT (Sequence ID 20), Blood type B HA2B-1040-1061F GCCCAATATGGGTGAAAACACC (Sequence ID 21), HA2B-1867-1887R AGTAGTAACAAGAGCATTTTT (Sequence ID 22), In NA, the A(H1N1)pdm09 model is used. swine N1-F1 AGCAAAAGCAGGAGTTCAAAATGA (Sequence ID 23), swine N1-R1 GTAGAAACAAGGAGTTTTTTGAAC (Sequence ID 24), Type A(H3N2) H3N2-F1 AGCAAAAGCAGGAGT (Sequence ID 25) H3N2-R1413 AGTAGAAACAAGGAGTTTTTT (Sequence ID 26) Blood type B BNA-F 5v2 TCAAAACTGAAGCAAATAGGCCA (Sequence ID 27), BNA-R1498-1472 AATAGGAACAAAGGGTTTAGAACAGA (Sequence ID 28) In the case of Ebola virus, the primer names and primer sequences (directions) used in conventional RT-PCR are as follows: FiloNP-Fe 5'-TGGCAATCAGTDGGACACATGATGGT (+)(Sequence ID 29), FiloNP-Fm 5'-TGGCTTACYACAGGYCACATGAAAGT (+)(Sequence ID 30), FiloNP-Re 5'-GAAGCTGATTTCRTTCTTYTTCTGATGGAA (-)(Sequence ID 31), FiloNP-Rm 5'-GTGTGTGATTTCAGTTTTYTGGAGGTGGAA (-)(Sequence ID 32), FILO-A 5'-ATCGGAATTTTTCTTTCTCATT (+)(Sequence ID 33), FILO-B 5'-ATGTGGTGGGTTATAATAATCACTGACATG (-)(Sequence ID 34), RES-NP1 5'-GTATTTGGAAGGTCATGGATTC (+)(Sequence ID 35), RES-NP2 5'-CAAGAAATTAGTCCTCATCAATC (-)(Sequence ID 36), The primer names and primer sequences (directions) used in real-time RT-PCR are: Filo-A2_3 5'-AAGCATTCCCTAGCAACATGATGGT (+)(Sequence ID 37), Filo-A2_4 5'-AAGCATTTCCTAGCAATATGATGGT (+)(Sequence ID 38), Filo-B 5'-ATGTGGTGGGTTATAATAATCACTGACATG (-)(Sequence ID 39), Filo-B_ravn 5'-GTGAGGAGGGCTATAAAAGTCACTGACATG (-)(Sequence ID 40), Filo-B_BI 5'-ATGTGGGGGRTTATAATAATCACTYACATG (-)(Sequence ID 41), The primer names and primer sequences (directions) used in nested-PCR are as follows: Sudan Zaire 2nd F1 5'-CTAATACAYCAAGGGATGCA (+)(Sequence ID 42), Sudan Zaire 2nd R1 5'-TGGAGTTGCTTYTCAGCYTCAGT (-)(Sequence No. 43), Cote Bundi 2nd F1 5'-CTTATACATCAAGGRATGCA (+)(Sequence ID 44), Cote Bundi 2nd R1 5'-TGCAACTGYTTTTCKGCCTCAGT (-)(Sequence ID 45), Reston 2nd F1 5'-CCACCAGGGYATGCATATGGTA (+)(Sequence ID 46), Reston 2nd R1 5'-CTGATAACTGTGGGTAGAGA (-)(Sequence No. 47), MBG NP 2nd F1 5'-AAACTGATTCAGGGGTGRCA (+)(Sequence ID 48), MBG NP 2nd R1 5'-CTCGAGGTTRTTRATCCCTGA (-)(Sequence ID 49) This sequence is known as a nucleic acid sequence for detecting enveloped viruses and is suitably used for detecting said enveloped viruses.
[0084] <Specific proteins used to detect enveloped viruses> SARS-CoV-2 virus (spike protein), influenza virus (hemagglutinin), Ebola virus (Ebola virus VP40 protein), hepatitis B virus (hepatitis B surface antigen), and Sendai virus (fusion protein) are suitably used as antigens when detecting enveloped viruses using antibodies.
[0085] <Virus sample collection kit for enveloped viruses> The virus sample collection kit having an envelope according to the present invention consists of a combination of a tip, which is one embodiment of the above-mentioned device and is used by attaching it to a pipette or the like for sample collection, a virus extraction container having an envelope, and a virus storage container having an envelope.
[0086] <Method for reducing the detection limit of enveloped viruses> When an enveloped virus test is performed using the instrument of the present invention, specifically using an enveloped virus test kit, the amount of enveloped virus adhering to the instrument is suppressed. As a result, trace amounts of enveloped virus present in the sample become detectable, and the detection limit can be lowered. For example, in the detection of the novel coronavirus from sewage through environmental water (sewage) surveys (https: / / www.niid.go.jp / niid / ja / diseases / ka / corona-virus / 2019-ncov / 2488-idsc / iasr-news / 9714-485p02.html), using the instrument of the present invention as the detection instrument for the above application lowers the lower limit of the detectable concentration of enveloped virus. This makes it possible to detect the novel coronavirus from an earlier stage of infection spread in environmental water (sewage) surveys. Furthermore, environmental water (sewage) samples are measured after being stored in refrigerators or freezes. By suppressing the adsorption of enveloped viruses, storage stability is enhanced, making it possible to detect enveloped viruses even when these storage temperature and storage period conditions are relaxed.
[0087] Furthermore, by using the instrument of the present invention, even in the case of viruses having an envelope that has come into contact with the envelope-destroying compounds described below, the reduction due to adsorption of viral nucleic acids (DNA or RNA) or viral antigens to the instrument is suppressed, making it possible to lower the detection limit of viral testing. In other words, the sensitivity of viral testing is improved.
[0088] The present invention also relates to the use of a hydrophilic coating film to reduce the detection limit of enveloped viruses. The meanings of each term are as described above.
[0089] <Methods for maintaining the infectivity of enveloped viruses> By using the apparatus of the present invention, the amount of enveloped viruses adhering to the apparatus is suppressed, and the infectivity of the adsorbed enveloped viruses is maintained. Therefore, the apparatus of the present invention is also an apparatus for maintaining the infectivity of enveloped viruses. By using the apparatus of the present invention, the infectivity of enveloped viruses is maintained, making it possible to properly preserve, study, and evaluate viruses. In this invention, "maintaining infectivity" means that the infectivity titer of enveloped viruses is maintained, and the infectivity titer can be measured by methods known to those skilled in the art, for example, by the method described in Example 6 below.
[0090] Therefore, the present invention also relates to the use of a hydrophilic coating film for maintaining the infectivity of an enveloped virus. The meanings of each term are as described above.
[0091] <Compounds that destroy the envelope> Viruses with an envelope are broken down into viral nucleic acids and viral antigen proteins present inside the envelope when they come into contact with certain compounds. However, by using the device of the present invention, the adhesion of the viral nucleic acids and viral antigen proteins is suppressed, improving the detection limit (sensitivity) during viral testing. Compounds that break down the envelope are not limited to those described below, but one example is the use of strong protein denaturants. Protein denaturants are also called chaotropic agents and destabilize the molecular structure of proteins by affecting hydrogen bonds, van der Waals forces, hydrophobic bonds, etc. Examples of strong protein denaturants include ionic surfactants, alcohols, basic compounds, reducing agents, proteases, and combinations thereof. Among these, ionic surfactants are preferred, and among ionic surfactants, salts containing guanidinium ions, such as guanidine hydrochloride and guanidine thiocyanate, are preferred. Urea is another example of a protein denaturant. [Examples]
[0092] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.
[0093] <Synthesis Example 1> 290g of acid phosphooxyethyl methacrylate (product name: Fosmer M, manufactured by Unichemical Co., Ltd.) was added to 297g of ethanol, and 350g of choline (48-50% aqueous solution, manufactured by Nippon Finechem Co., Ltd.), 243g of methacloylcholine chloride (80% aqueous solution, manufactured by Mitsubishi Chemical Corporation), and 360g of butyl methacrylate (manufactured by Mitsubishi Chemical Corporation) were added. An additional 435g of ethanol was added and the mixture was stirred. Furthermore, an aqueous solution of 25g of 2,2'-azobis(N-(2-carboxyethyl)-2-methylpropionamidine) n-hydrate (product name: VA-057, manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) dissolved in 262g of pure water was added to the above solution and stirred thoroughly to make a homogeneous mixture (mixture 1). Separately, 732g of pure water and 1099g of ethanol were heated to the reflux temperature while stirring (mixture 2). Mixture 1 was added dropwise to mixture 2 over 1.5 hours, and after heating and stirring for 3 hours, it was cooled to obtain 4069 g of copolymer-containing varnish with a solid content of approximately 25% by mass. The weight-average molecular weight of the obtained liquid in GFC was approximately 22,114.
[0094] <Preparation Example 1> To 425 g of the copolymer-containing varnish obtained in Synthesis Example 1 above, 145 g of 1 mol / L hydrochloric acid (1N) (manufactured by Kanto Chemical Co., Ltd.), 1269 g of pure water, and 3392 g of ethanol were added. Then, 27 g of a 1 mol / L hydrochloric acid-ethanol mixture was added to adjust the pH to 2.4, and a coating film-forming composition was prepared.
[0095] <Example 1> 200 μL / well of the coating film-forming composition obtained in Preparation Example 1 was placed in a Microamp® Optical 96-well Reaction Plate (manufactured by Applied Biosystems) made of polypropylene (PP), and allowed to stand at 25°C for 30 minutes. After removing the coating film-forming composition, the plate was dried at 25°C for 3 hours. Then, it was thoroughly washed with pure water to obtain a plate with a coated film formed on it. In this example, GenomONE®-CF (manufactured by Ishihara Sangyo Co., Ltd.), in which Sendai virus RNA was purified and inactivated, was used to measure the adsorption of Sendai virus. Freeze-dried HVJ-E in GenomONE®-CF was dissolved by adding 260 μL of the included HVJ-E Suspending Buffer. The solution was dissolved using the included Cell Fusion Buffer at a concentration of 1.25 × 10⁻⁶. 6 particles / mL, 2.5 × 10 6 particles / mL, 6.25 × 10 6 particles / mL, 1.25 × 10 7The solution was diluted to a particle / mL concentration. 100 μL / well of the diluted HVJ-E solution and Cell Fusion Buffer prepared above were added to a plate with a coated film and left to stand at 4°C for 24 hours. As a control, the same diluted HVJ-E solution and Cell Fusion Buffer were stored in a plate without a coated film. After 24 hours, the solution in the plate was discarded, and PBS-T was prepared by adding Tween 20 (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) to 0.05 v / v% in phosphate buffer (PBS). 120 μL / well of this PBS-T was added and blocked at room temperature for 1 hour, after which it was drained. Bovine Serum Albumins (BSA, manufactured by Sigma-Aldrich) were dissolved in PBS-T to 3 w / v% to prepare 3% BSA in PBS-T. As a primary antibody against HVJ-E, Anti-Sendai Virus pAb (manufactured by Medical & Biological Laboratories, Inc.) was diluted 1000-fold in 3% BSA in PBS-T, placed in a plate at 100 μL / well, incubated at room temperature for 1 hour, and then drained. Subsequently, the plates were washed three times with 120 μL / well of 3% BSA in PBS-T. As a secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (manufactured by abcam) was diluted 120,000-fold in 3% BSA in PBS-T, placed in a plate at 100 μL / well, incubated at room temperature for 45 minutes, and then drained. The samples were washed five times with 120 μL / well of 3% BSA in PBS-T, then 100 μL / well of TMB 1-Component Microwell Peroxidase Substrate, SureBlue (Funakoshi Co., Ltd.) was added and left at room temperature for 5 minutes, after which 100 μL / well of TMB Stop Solution (Funakoshi Co., Ltd.) was added. The absorbance of the TMB reaction solution at 450 nm was measured using a SpectraMax 190 plate reader (MOLECULAR DEVICES). The absorbance in Figure 1 represents the amount of HVJ-E adsorbed.
[0096] <Example 2> 200 μL / well of the coating film-forming composition obtained in Preparation Example 1 was placed in a Microamp® Optical 96-well Reaction Plate made of polypropylene (PP) (manufactured by Applied Biosystems) and left to stand at 25°C for 30 minutes. After removing the coating film-forming composition, the plate was dried at 25°C for 3 hours. Then, it was thoroughly washed with pure water to obtain a plate with a coated film formed. In this example, the spike protein (Cosmo Bio) present in the outermost layer of the SARS-CoV-2 virus envelope was used. The spike protein was diluted in phosphate buffer (PBS) to 10 ng / mL, 100 ng / mL, 1 μg / mL, and 10 μg / mL. 100 μL / well of the diluted spike protein and PBS prepared above were placed in the plate with the coated film formed and left to stand at 24°C for 24 hours. As a control, the diluted spike protein and PBS were similarly stored in a plate without a coated film. After 24 hours, the solution in the plate was discarded, and PBS-T was prepared by adding Tween 20 (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) to PBS to a concentration of 0.05 v / v%, adding 120 μL / well to the plate, blocking at room temperature for 1 hour, and then draining. Bovine Serum Albumins (BSA, manufactured by Sigma-Aldrich) was dissolved in PBS-T to a concentration of 3 w / v% to prepare 3% BSA in PBS-T. Anti SARS-CoV Spike (CosmoBio) was diluted 5000-fold in 3% BSA in PBS-T as the primary antibody against the spike protein, added 100 μL / well to the plate, incubated at room temperature for 1 hour, and then drained. Next, the plates were washed three times with 120 μL / well of 3% BSA in PBS-T. As a secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (abcam) was diluted 60,000-fold in 3% BSA in PBS-T, added to the plates at a concentration of 100 μL / well, incubated at room temperature for 45 minutes, and then drained.The samples were washed three times with 120 μL / well of 3% BSA in PBS-T, then 100 μL / well of TMB 1-Component Microwell Peroxidase Substrate, SureBlue (Funakoshi Co., Ltd.) was added and left at room temperature for 5 minutes. Subsequently, 100 μL / well of TMB Stop Solution (Funakoshi Co., Ltd.) was added. The absorbance of the TMB reaction solution at 450 nm was measured using a SpectraMax 190 plate reader (MOLECULAR DEVICES). The absorbance in Figure 2 represents the amount of spike protein adsorbed.
[0097] The results shown in Figures 1 and 2 confirm that coating suppresses the adsorption of enveloped viruses and spike proteins.
[0098] <Example 3> 1.5 mL of the coating film-forming composition obtained in Preparation Example 1 was placed in a 1.5 mL polypropylene (PP) sampling tube (manufactured by BM Instruments Co., Ltd.) and left to stand at 25°C for 30 minutes. After removing the coating film-forming composition, the tubes were dried at 25°C for 3 hours. Then, they were thoroughly washed with pure water to obtain tubes with a coated film formed on them. In this example, Albumin from Bovine Serum (BSA), FITC conjugate (BSA-FITC, manufactured by Thermo Fisher Scientific), which is BSA labeled with the fluorescent substance Fluorescein isothiocyanate (FITC), was used to measure the adsorption of bovine serum albumin (BSA). BSA-FITC was dissolved in PBS(-) (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) to a concentration of 1 μg / mL, and 100 μL / tube was placed in the tubes with the coated film formed on them. As a control, BSA-FITC solution was similarly added to tubes without a coating, MPC polymer-coated tubes (manufactured by Saalstat Co., Ltd.), and Protein LoBind tubes (manufactured by Eppendorf). Each tube was left to stand at room temperature under light shielding for 1 hour. After standing, the BSA-FITC solution was collected from each tube and the fluorescence intensity at ex. 494 nm and em. 521 nm was measured using a SpectraMax 190 plate reader (MOLECULAR DEVICES). As a control, the fluorescence intensity of BSA-FITC 1 μg / mL was measured and set to 100%, and the amount of BSA-FITC adsorbed onto each tube was calculated from the fluorescence intensity of each tube. The vertical axis in Figure 3 represents the amount of BSA-FITC adsorbed onto each tube.
[0099] <Example 4> 1.5 mL of the coating film-forming composition obtained in Preparation Example 1 was placed in a 1.5 mL polypropylene (PP) sampling tube (manufactured by BM Instruments Co., Ltd.) and left to stand at 25°C for 30 minutes. After removing the coating film-forming composition, the tube was dried at 25°C for 3 hours. Then, it was thoroughly washed with pure water to obtain a tube with a coated film formed on it. In this example, GenomONE™-CF (manufactured by Ishihara Sangyo Co., Ltd.), in which Sendai virus RNA was purified and inactivated, was used to measure the adsorption of Sendai virus. Freeze-dried HVJ-E in GenomONE™-CF was dissolved by adding 260 μL of the included HVJ-E Suspending Buffer. The dissolved solution was dissolved in the included Cell Fusion Buffer at a concentration of 1.25 × 10⁻⁶. 6The solution was diluted to a particle / mL concentration. 100 μL / tube of the diluted HVJ-E solution and Cell Fusion Buffer prepared above was added to tubes with a coated film. As a control, 100 μL / tube of the diluted HVJ-E solution and Cell Fusion Buffer was similarly added to tubes without a coated film, MPC polymer coated tubes (manufactured by Saalstat Co., Ltd.), and Protein LoBind tubes (manufactured by Eppendorf). Each tube was left to stand at room temperature for 24 hours. After standing, the solution in each tube was discarded, and PBS-T was prepared by adding Tween 20 (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) to 0.05 v / v% in phosphate buffer (PBS). 200 μL / tube was added to this PBS-T, blocked at room temperature for 1 hour, and then drained. Bovine Serum Albumins (BSA, manufactured by Sigma-Aldrich) were dissolved in PBS-T to 3 w / v% to prepare 3% BSA in PBS-T. As a primary antibody against HVJ-E, Anti-Sendai Virus pAb (manufactured by Medical & Biological Laboratories, Inc.) was diluted 1000-fold in 3% BSA in PBS-T, added to a tube at a concentration of 100 μL, incubated at room temperature for 1 hour, and then drained. Subsequently, the tubes were washed three times with 200 μL of 3% BSA in PBS-T. As a secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (manufactured by abcam) was diluted 120,000-fold in 3% BSA in PBS-T, added to a tube at a concentration of 100 μL, incubated at room temperature for 45 minutes, and then drained. The tubes were washed three times with 200 μL / tube of 3% BSA in PBS-T, and 100 μL / well of TMB 1-Component Microwell Peroxidase Substrate, SureBlue (Funakoshi Co., Ltd.) was added and left at room temperature for 5 minutes. Then, 100 μL / well of TMB Stop Solution (Funakoshi Co., Ltd.) was added. The absorbance of the TMB reaction solution at 450 nm was measured using a SpectraMax 190 plate reader (MOLECULAR DEVICES). The absorbance in Figure 4 represents the amount of HVJ-E adsorbed.
[0100] As shown in Figures 3 and 4, the MPC and LoBind products showed a weaker effect in inhibiting Sendai virus adsorption compared to the effect of inhibiting BSA adsorption compared to tubes without coating. On the other hand, the polymer of Preparation Example 1 showed a high adsorption inhibitory effect on both BSA and Sendai virus.
[0101] <Example 5> 1.5 mL of the coating film-forming composition obtained in Preparation Example 1 was placed in a 1.5 mL polypropylene (PP) sampling tube (manufactured by BM Instruments Co., Ltd.) and left to stand at 25°C for 30 minutes. After removing the coating film-forming composition, the tube was dried at 25°C for 3 hours. Then, it was thoroughly washed with pure water to obtain a tube with a coated film formed on it. In this example, GenomONE®-CF (manufactured by Ishihara Sangyo Co., Ltd.), in which Sendai virus RNA was purified and inactivated, was used to measure the adsorption of Sendai virus. In addition, Tris-buffered saline-Guanidinium chloride (TBS-G), contained in cobas® PCR Media (manufactured by Roche Molecular Systems), was used as the solution to suspend the Freeze-dried HVJ-E in GenomONE®-CF. As a control, Tris-buffered saline (TBS) was prepared by dissolving Trizma® base (manufactured by SIGMA Corporation) in pure water to a concentration of 10 mM and adjusting the pH to 7.4 with 1 mol / L hydrochloric acid (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.). Freeze-dried HVJ-E was dissolved by adding 260 μL of the included HVJ-E Suspending Buffer, and 2.5 × 10⁻⁶ samples were taken using TBS or TBS-G. 6The solution was diluted to a particle / mL concentration. 100 μL / tube of the diluted HVJ-E solution or TBS, TBS-G prepared above was added to tubes with a coated film. As a control, 100 μL / tube of the diluted HVJ-E solution or TBS, TBS-G was similarly added to tubes without a coated film. Each tube was left to stand at room temperature for 24 hours. After standing, the solution in each tube was discarded, and PBS-T was prepared by adding Tween 20 (manufactured by Fujifilm Wako Pure Chemical Industries, Ltd.) to 0.05 v / v% in phosphate buffer (PBS). 200 μL / tube was added to this PBS-T, blocked at room temperature for 1 hour, and then drained. 3% BSA in PBS-T was prepared by dissolving Bovine Serum Albumins (BSA, manufactured by Sigma-Aldrich) in PBS-T to 3 w / v%. As a primary antibody against HVJ-E, Anti-Sendai Virus pAb (manufactured by Medical & Biological Laboratories, Inc.) was diluted 1000-fold in 3% BSA in PBS-T, added to a tube at a concentration of 100 μL, incubated at room temperature for 1 hour, and then drained. Subsequently, the tubes were washed three times with 200 μL of 3% BSA in PBS-T. As a secondary antibody, Goat Anti-Rabbit IgG H&L (HRP) (manufactured by abcam) was diluted 120,000-fold in 3% BSA in PBS-T, added to a tube at a concentration of 100 μL, incubated at room temperature for 45 minutes, and then drained. The tubes were washed three times with 200 μL of 3% BSA in PBS-T, and 100 μL / well of TMB 1-Component Microwell Peroxidase Substrate, SureBlue (Funakoshi Co., Ltd.) was added and left at room temperature for 5 minutes. Then, 100 μL / well of TMB Stop Solution (Funakoshi Co., Ltd.) was added. The absorbance of the TMB reaction solution at 450 nm was measured using a SpectraMax 190 plate reader (MOLECULAR DEVICES). The absorbance in Figure 5 represents the amount of HVJ-E adsorbed.
[0102] From the results in Figure 5, it was shown that the polymer of Preparation Example 1 has the effect of suppressing adsorption of viruses or degradation products of viruses such as their antigenic proteins even in the presence of guanidine hydrochloride, which is a protein denaturant.
[0103] <Example 6> Influenza virus adsorption evaluation test (a) Virus solution preparation MDCK cells (JCRB 9029 strain) were infected with influenza virus (Influenza A virus (H1N1) A / PR / 8 / 34 ATCC VR-1469), and after culturing, cell debris was removed by centrifugation, and the resulting solution was used as a virus solution.
[0104] (b) TCID 50 (Tissue Culture Infectious Dose 50) measurement 1.8 mL of the coating film-forming composition obtained in Preparation Example 1 above was placed into a 1.8 mL polypropylene (PP) screw-cap tube (manufactured by Nippon Genetics Co., Ltd.), and left to stand at 25°C for 30 minutes. After removing the coating film-forming composition, the tube was dried at 25°C for 3 hours. Thereafter, the tube was sufficiently washed with pure water to obtain a tube on which a coating film was formed. In this example, the adsorption of influenza virus was determined by TCID 50 For the purpose of evaluation in , three types of tubes were used: coated PP tubes, uncoated PP tubes, and glass tubes. Using the virus solution prepared in the three types of tubes as a stock solution, a 10-fold serial dilution series (×10 1 ~×10 10Ten different concentrations were prepared and stored at room temperature for 6 hours. After culturing MDCK cells in a monolayer in a 96-well plate, the cell growth medium (Eagle MEM medium "Nissui" with 10% fetal bovine serum) was removed, and 0.1 mL of cell maintenance medium (a mixture of 1000 mL of Eagle MEM medium "Nissui", 14 mL of 10% NaHCO3, 9.8 mL of L-glutamine (30 g / L), 30 mL of 100×MEM vitamin solution, 40 mL of 10% albumin, and 20 mL of 0.25% trypsin) was added to each well. Next, 0.1 mL of each diluted virus solution was inoculated into four wells, and after culturing, the viral infectivity titer was measured (performed with N=3). After culturing and observation for 1 week, the number of wells in which a cytopathic effect (CPE) was observed at each viral dilution concentration was used to determine the TCID using the Reed-Muench method. 50 The viral infectivity titer was calculated and measured. The results are shown in Table 1.
[0105] [Table 1]
[0106] As shown in Table 1, the PP tube coated with the coating film-forming composition of Preparation Example 1 maintained a virus concentration 10^(8.90-8.67) ≈ 1.7 times higher than that of an uncoated PP tube due to adsorption inhibition, and maintained a virus concentration 10^(8.90-8.43) ≈ 3.0 times higher than that of a glass tube due to adsorption inhibition. Therefore, the coating film-forming composition of Preparation Example 1 is TCID 50 Evaluations using this indicator also showed that it has the effect of suppressing virus adsorption. Furthermore, it was shown that the viruses whose adsorption was suppressed retained their infectivity. [Industrial applicability]
[0107] According to the present invention, it is possible to provide an instrument in which the attachment of enveloped viruses is suppressed, and a method for reducing the attachment of enveloped viruses using the instrument. Specifically, it is possible to provide a virus storage container for enveloped viruses with low loss, and a virus testing kit for enveloped viruses with improved detection sensitivity for enveloped viruses.
Claims
1. A method for reducing the attachment of enveloped viruses, using an instrument that has a hydrophilic coating film on at least a portion of its surface, thereby suppressing the attachment of enveloped viruses, The enveloped viruses are selected from the Flaviviridae, Togaviridae, Retroviridae, Coronaviridae, Filoviridae, Rhabdoviridae, Bunyaviridae, Orthomyxoviridae, Paramyxoviridae, Arenaviridae, Hepadnaviridae, Herpesviridae, and Poxviridae families. The coating film is a copolymer comprising repeating units containing a group represented by the following formula (a) and repeating units containing a group represented by the following formula (b): 【Chemistry 1】 (In the formula, U a1, U a2, U b1, U b2, and U b3 each independently represent a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms, and An- represents an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions. A method comprising a coating film containing the above.
2. The copolymer further comprises the following formula (c): 【Chemistry 2】 [In the formula, R c This represents a linear or branched alkyl group having 1 to 18 carbon atoms, an alicyclic hydrocarbon group having 3 to 10 carbon atoms, an aryl group having 6 to 10 carbon atoms, an aralkyl group having 7 to 15 carbon atoms, or an aryloxyalkyl group having 7 to 15 carbon atoms (wherein the aryl portion may be substituted with a linear or branched alkyl group having 1 to 5 carbon atoms, which may be substituted with a halogen atom). The method according to claim 1, including the method described in claim 1.
3. The method of claim 1 or 2, wherein the apparatus is a virus storage container having an envelope.
4. The method according to any one of claims 1 to 3, wherein the device is a virus testing kit having an envelope.
5. A method for reducing the detection limit of an enveloped virus test, using an instrument that has a hydrophilic coating film on at least a portion of its surface and has suppressed attachment of enveloped viruses, The enveloped viruses are selected from the Flaviviridae, Togaviridae, Retroviridae, Coronaviridae, Filoviridae, Rhabdoviridae, Bunyaviridae, Orthomyxoviridae, Paramyxoviridae, Arenaviridae, Hepadnaviridae, Herpesviridae, and Poxviridae families. The coating film is a copolymer comprising repeating units containing a group represented by the following formula (a) and repeating units containing a group represented by the following formula (b): 【Transformation 3】 (In the formula, U a1, U a2, U b1, U b2, and U b3 each independently represent a hydrogen atom or a linear or branched alkyl group having 1 to 5 carbon atoms, and An- represents an anion selected from the group consisting of halide ions, inorganic acid ions, hydroxide ions, and isothiocyanate ions. A method comprising a coating film containing the above.
6. The method according to claim 5, carried out in the presence of a compound that disrupts the envelope.
Citation Information
Patent Citations
Virus envelope vector for gene transfer
JP2001286282A
Microbial detection and characterization
JP2002505866A
Block copolymers containing heparin coated on stent-like implants
JP2008500104A
Microorganism adhesion-preventing material, microorganism adhesion-preventing base material, bioreactor, and coating material for agriculture
JP2012001694A
Therapeutic / prophylactic agent for prostate cancer
WO2010032764A1