Large sequence pan-coronavirus vaccine composition

Abstract

A pan-coronavirus vaccine for inducing efficient, potent, and long-lasting protection against all coronavirus infections and diseases, comprising multiple highly conserved large sequences that may contain one or more conserved B cell, CD4 cell, and CDS T cell epitopes that help provide multiple targets for the body to generate an immune response to prevent coronavirus infection and / or disease. In certain embodiments, the large sequences are conserved proteins or large sequences, e.g., sequences highly conserved among human coronaviruses and / or animal coronaviruses (e.g., coronaviruses isolated from animals susceptible to coronavirus infection).

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the interests of U.S. Provisional Patent Application No. 63 / 009,907, filed on 14 April 2020, and U.S. Provisional Patent Application No. 63 / 084,421, filed on 28 September 2020, the specifications of which are incorporated herein by reference in their entirety.

[0002] Sequence listing reference The applicant asserts that the information titled UCI_20_06B_PCT_Sequence_Listing_ST25, recorded in the form of the Annex C / ST.25 text file submitted pursuant to Rule 13ter.1(a), is identical to that which forms part of the international application at the time of filing. The contents of the sequence listing are incorporated herein by reference in their entirety.

[0003] This invention relates to vaccines, such as viral vaccines, such as vaccines for coronaviruses, such as pan-coronavirus vaccines. [Background technology]

[0004] Over the past 20 years, there have been human outbreaks of three deadly coronaviruses (CoVs) caused by newly emerging zoonotic CoVs: SARS-CoV, MERS-CoV, and the latest, highly transmissible and deadly SARS-CoV-2, which is causing the current global pandemic of COVID-19. All three deadly CoVs originated in bats, their natural host, and were transmitted to humans through various intermediate animal host populations (e.g., pangolins, civet cats, and camels). Currently, there is no universal pan-coronavirus vaccine available, so it remains highly likely that another global COVID-like pandemic will emerge in the coming years, caused by further transmission of an unknown zoonotic bat-derived SARS-like coronavirus (SL-CoV) to an unvaccinated human population.

[0005] Neutralizing antibodies and antiviral effectors CD4 + and CD8 + T cells appear to be important in reducing viral load in the majority of asymptomatic and recovering infected patients. However, B cell epitopes and CD4 are conserved among human and bat coronavirus strains. + and CD8 + There is very little information available regarding the antigenic landscape and repertoire of T cell epitopes. [Overview of the project]

[0006] Investigating the antigenic, immunogenic, and protective antigen and epitope landscapes conserved among human and animal coronaviruses, as well as the repertoire, phenotype, and function of B cells and CD4+ and CD8+ T cells correlated with resistance observed in asymptomatic COVID-19 patients, could provide information for the future development of pan-coronavirus vaccines. The present invention describes the identification of several highly conserved large sequences with antigenicity, immunogenicity, and protective properties, including human B cell, CD4+ and CD8+ T cell epitopes, which are highly conserved in human B cell, CD4+ and CD8+ T cell epitopes, for example, in (i) more than 81,000 human SARS-CoV-2 strains identified in 190 countries across six continents, (ii) six prevalent CoVs that caused previous human outbreaks of the "flu," (iii) nine SL-CoVs isolated from bats, (iv) nine SL-CoVs isolated from pangolins, (v) three SL-CoVs isolated from civet cats, and (vi) four MERS strains isolated from camels, using several immunoinformatics and sequence alignment approaches as well as several immunoassays, both in vitro in humans and in vivo in animal modes (e.g., mice, hamsters, and monkeys). Furthermore, the present invention describes the identification of cross-reactive epitopes that evoke B cells, CD4+ and CD8+ T cells from both COVID-19 patients and healthy individuals who have never been exposed to SARS-CoV-2, and that induced strong B-cell and T-cell responses in "humanized" human leukocyte antigen (HLA)-DR1 / HLA-A*02:01 dual-gene mice and in humans who do not express the HLA-DR-1 or HLA-A*02:01 haplotype. Unlike small epitopes that are limited to specific HLA haplotypes, large sequences encompass several epitopes that are limited to multiple HLA haplotypes, and therefore have been shown to have a broad vaccine scope in human populations, regardless of HLA haplotype, race, or ethnicity.

[0007] The present invention is not limited to vaccine compositions for use in humans. The present invention includes vaccine compositions for use in other pet animals such as dogs and cats.

[0008] The vaccine compositions described herein have the potential to provide sustained B-cell and T-cell immunity regardless of coronavirus mutations. This is at least to some extent natural, as the vaccine compositions target highly conserved structural and non-structural coronavirus antigens, such as coronavirus nucleoproteins (also known as nucleocapsids), in combination with other coronavirus structural and non-structural antigens that have low mutation rates, presumably found in all human and animal coronavirus variants and strains.

[0009] The present invention also relates to selecting highly conserved structural coronavirus antigens within the virus (e.g., spike proteins) and non-structural coronavirus antigens that may be viral proteins not normally subject to mutational pressure by the immune system (e.g., non-spike proteins such as nucleocapsids).

[0010] The present invention provides a pan-coronavirus recombinant vaccine composition that induces a board-type, potent, and long-lasting B-cell and T-cell protective immune response in humans, pets, and animals.

[0011] In certain embodiments, the vaccine composition is intended for use in humans. In certain embodiments, the vaccine composition is intended for use in animals such as mice, cats, dogs, non-human primates, other animals susceptible to coronavirus infection, and other animals that can serve as preclinical animal models for coronavirus infection.

[0012] As used herein, the term "multiepitope" refers to a composition comprising two or more B cell and T cell epitopes, wherein at least one CD4 and / or CD8 T cell epitope is MHC-restricted and recognized by the TCR, and at least one epitope is a B cell epitope. For example, the vaccine composition herein may be a multiepitope pan-coronavirus vaccine composition.

[0013] As used herein, the term “recombinant vaccine composition” may refer to one or more recombinant genes, for example, one or more proteins or peptides that support the expression of such genes, encoded by genes cloned into one or more systems. The term “recombinant vaccine composition” may refer to a recombinant gene or a system that supports the expression of such recombinant gene.

[0014] For example, the present invention provides a pan-coronavirus recombinant vaccine composition comprising one or more large sequences, wherein each of the one or more large sequences comprises at least one of one or more conserved coronavirus B cell target epitopes, one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes, and at least one epitope is derived from a non-spike protein.

[0015] The present invention also features a pan-coronavirus recombinant vaccine composition comprising two or more large sequences, wherein each of the two or more large sequences comprises at least one of one or more conserved coronavirus B cell target epitopes, one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes, and at least one epitope is derived from a non-spike protein.

[0016] The present invention also features a pan-coronavirus recombinant vaccine composition comprising a whole spike protein and one or both of one or more conserved coronavirus CD4+ T cell target epitopes and / or one or more conserved coronavirus CD8+ T cell target epitopes, wherein at least one epitope is derived from a non-spike protein.

[0017] The present invention also features a pan-coronavirus recombinant vaccine composition comprising at least a portion of a spike protein, which includes a trimerized SARS-CoV-2 receptor-binding domain (RBD), and one or both of one or more conserved coronavirus CD4+ T cell-targeting epitopes and one or more conserved coronavirus CD8+ T cell-targeting epitopes, wherein at least one epitope is derived from a non-spike protein.

[0018] The present invention also features a pan-coronavirus recombinant vaccine composition comprising a whole spike protein, one or more conserved coronavirus CD4+ T cell target epitopes, and one or more conserved coronavirus CD8+ T cell target epitopes, wherein at least one epitope is derived from a non-spike protein.

[0019] The present invention also features a pan-coronavirus recombinant vaccine composition comprising at least a portion of a spike protein, which includes a trimerized SARS-CoV-2 receptor-binding domain (RBD); one or more conserved coronavirus CD4+ T cell-targeting epitopes; and one or more conserved coronavirus CD8+ T cell-targeting epitopes, wherein at least one epitope is derived from a non-spike protein.

[0020] The present invention also features a pan-coronavirus recombinant vaccine composition comprising an antigen delivery system encoding one or more large sequences, wherein each of the one or more large sequences comprises at least one of one or more conserved coronavirus B cell target epitopes, one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes, and at least one epitope is derived from a non-spike protein.

[0021] The present invention also features a pan-coronavirus recombinant vaccine composition comprising an antigen delivery system encoding two or more large sequences, wherein each of the two or more large sequences comprises at least one of one or more conserved coronavirus B cell-targeted epitopes, one or more conserved coronavirus CD4+ T cell-targeted epitopes, and / or one or more conserved coronavirus CD8+ T cell-targeted epitopes, and at least one epitope is derived from a non-spike protein.

[0022] The present invention also features a pan-coronavirus recombinant vaccine composition comprising an antigen delivery system encoding a whole spike protein, and one or both of one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes, wherein at least one epitope is derived from a non-spike protein.

[0023] The present invention also features a pan-coronavirus recombinant vaccine composition comprising an antigen delivery system encoding at least a portion of a spike protein, wherein at least a portion of the spike protein comprises a trimerized SARS-CoV-2 receptor-binding domain (RBD); and one or both of one or more conserved coronavirus CD4+ T cell-targeting epitopes and one or more conserved coronavirus CD8+ T cell-targeting epitopes, wherein at least one epitope is derived from a non-spike protein.

[0024] The present invention also features a pan-coronavirus recombinant vaccine composition comprising an antigen delivery system encoding a whole spike protein, one or more conserved coronavirus CD4+ T cell target epitopes, and one or more conserved coronavirus CD8+ T cell target epitopes, wherein at least one epitope is derived from a non-spike protein.

[0025] The present invention also features a pan-coronavirus recombinant vaccine composition comprising: an antigen delivery system encoding at least a portion of a spike protein, wherein at least a portion of the spike protein comprises a trimerized SARS-CoV-2 receptor-binding domain (RBD); one or more conserved coronavirus CD4+ T cell-targeting epitopes; and one or more conserved coronavirus CD8+ T cell-targeting epitopes, wherein at least one epitope is derived from a non-spike protein.

[0026] With respect to the compositions and embodiments described herein, in some embodiments, the non-spike proteins are ORF1ab protein, ORF3a protein, envelope protein, membrane glycoprotein, ORF6 protein, ORF7a protein, ORF7b protein, ORF8 protein, nucleocapsid protein, and ORF10 protein.

[0027] In some embodiments, one or more large sequences are highly conserved among human and animal coronaviruses. In some embodiments, one or more large sequences are derived from at least one SARS-CoV-2 protein. In some embodiments, one or more large sequences are derived from one or more currently circulating human SARS-CoV-2 strains or variants, one or more coronaviruses that caused previous human outbreaks, one or more coronaviruses isolated from animals selected from a group consisting of bats, pangolins, civet cats, mink, camels, and other animals that accept coronaviruses, or one or more coronaviruses that cause the common cold. In some embodiments, one or more currently circulating human SARS-CoV-2 strains or variants are selected from strains B.1.177, B.1.160, B.1.1.7, B.1.351, P.1, B.1.427 / B.1.429, B.1.258, B.1.221, B.1.367, B.1.1.277, B.1.1.302, B.1.525, B.1.526, S:677H, and S:677P. In some embodiments, one or more coronaviruses causing the common cold are selected from 229E alpha-coronavirus, NL63 alpha-coronavirus, OC43 beta-coronavirus, and HKU1 beta-coronavirus. In some embodiments, a conserved large sequence is selected from a variant of concern or a variant of interest.

[0028] In some embodiments, the composition includes two or more large arrays. In some embodiments, the composition includes three or more large arrays. In some embodiments, the composition includes two large arrays. In some embodiments, the composition includes three large arrays. In some embodiments, the composition includes four large arrays. In some embodiments, the composition includes five large arrays.

[0029] In some embodiments, the large sequence is derived from a structural protein, a non-structural protein, or a combination thereof. In some embodiments, the large sequence or target epitope is derived from a SARS-CoV-2 protein selected from the group consisting of ORF1ab protein, spike glycoprotein, ORF3a protein, envelope protein, membrane glycoprotein, ORF6 protein, ORF7a protein, ORF7b protein, ORF8 protein, nucleocapsid protein, and ORF10 protein.

[0030] In some embodiments, the large sequence or target epitope derived from the spike glycoprotein is an RBD. In some embodiments, the large sequence or target epitope derived from the spike glycoprotein is an NTD. In some embodiments, the large sequence or target epitope derived from the spike glycoprotein includes both an RBD region and an NTD region. In some embodiments, the large sequence or target epitope derived from the spike glycoprotein is recognized by neutralizing and blocking antibodies. In some embodiments, the large sequence or target epitope derived from the spike glycoprotein induces neutralizing and blocking antibodies. In some embodiments, the large sequence or target epitope derived from the spike glycoprotein induces neutralizing and blocking antibodies that recognize and neutralize the virus.

[0031] In some embodiments, a large sequence or target epitope derived from the spike glycoprotein induces neutralizing and blocking antibodies that recognize the spike protein.

[0032] In some embodiments, the ORF1ab protein comprises non-structural protein (Nsp)1, Nsp2, Nsp3, Nsp4, Nsp5, Nsp6, Nsp7, Nsp8, Nsp9, Nsp10, Nsp11, Nsp12, Nsp13, Nsp14, Nsp15 and Nsp16. In some embodiments, the one or more conserved coronavirus CD8+T cell target epitopes are selected from spike glycoprotein, envelope protein, ORF1ab protein, ORF7a protein, ORF8a protein, ORF10 protein, or combinations thereof. In some embodiments, the one or more conserved coronavirus CD8+T cell target epitopes are S 2-10 , S 1220-1228 , S 1000-1008 , S 958-966 , E 20-28 , ORF1ab 1675-1683 , ORF1ab 2363-2371 , ORF1ab 3013-3021 , ORF1ab 3183-3191 , ORF1ab 5470-5478 , ORF1ab 6749-6757 , ORF7b 26-34 , ORF8a 73-81 , ORF1 03-11 and ORF1 05-13 In some embodiments, the one or more conserved coronavirus CD8+T cell target epitopes are selected from SEQ ID NOs: 2 to 29. In some embodiments, the one or more conserved coronavirus CD8+T cell target epitopes are selected from SEQ ID NOs: 30 to 57. In some embodiments, the one or more conserved coronavirus CD4+T cell target epitopes are selected from spike glycoprotein, envelope protein, membrane protein, nucleocapsid protein, ORF1a protein, ORF1ab protein, ORF6 protein, ORF7a protein, ORF7b protein, ORF8 protein, or combinations thereof. In some embodiments, the one or more conserved coronavirus CD4+T cell target epitopes are ORF1a 1350-1365 , ORF1ab 5019-5033 , ORF6 12-26 , ORF1ab 6088-6102ORF1ab 6420-6434 ORF1a 1801-1815 S 1-13 , E 26-40 , E 20-34 M 176-190 , N 388-403 ORF7a 3-17 ORF7a 1-15 ORF7b 8-22 ORF7a 98-112 and ORF8 1-15 Selected from. In some embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 58-73. In some embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 74-105. In some embodiments, one or more conserved coronavirus B cell target epitopes are selected from spike glycoproteins. In some embodiments, one or more conserved coronavirus B cell target epitopes are S 287-317 S 524-598 S 601-640 S 802-819 S 888-909 S 369-393 S 440-501 S 1133-1172 S 329-363 and S 13-37 Selected from. In some embodiments, one or more coronavirus B cell target epitopes are selected from SEQ ID NOs: 106-116. In some embodiments, one or more coronavirus B cell target epitopes are selected from SEQ ID NOs: 117-138.

[0033] In some embodiments, one or more conserved coronavirus B cell target epitopes are in the form of a large sequence. In some embodiments, the large sequence is a full-length spike glycoprotein. In some embodiments, the large sequence is a partial spike glycoprotein. In some embodiments, the spike glycoprotein has two consecutive proline substitutions at amino acid positions 986 and 987. In some embodiments, the spike glycoprotein has single amino acid substitutions at amino acid positions including Tyr-83 and Tyr-489, Gln-24 and Asn-487. In some embodiments, the transmembrane anchor of the spike protein has an intact S1-S2 cleavage site. In some embodiments, the spike protein is in its stabilized conformation. In some embodiments, the spike protein is stabilized by proline substitutions at amino acid positions 986 and 987 at the top of the central helix in the S2 subunit.

[0034] In some embodiments, one or more large sequences are derived from the whole protein sequence expressed by SARS-CoV-2. In some embodiments, one or more large sequences are derived from a partial protein sequence expressed by SARS-CoV-2. In some embodiments, one or more large conserved sequences derived from the spike protein are derived from the full-length spike glycoprotein. In some embodiments, one or more large conserved sequences derived from the spike protein are derived from a partial spike glycoprotein. In some embodiments, one or more large sequences include spike glycoprotein(S) or a portion thereof, a nucleoprotein or a portion thereof, a membrane protein or a portion thereof, and ORF1a / b or a portion thereof. In some embodiments, one or more large sequences include spike glycoprotein(S) or a portion thereof, a nucleoprotein or a portion thereof, and ORF1a / b or a portion thereof. In some embodiments, a portion of the spike glycoprotein is RBD. In some embodiments, one or more large sequences are selected from the group consisting of ORF1ab protein, spike glycoprotein, ORF3a protein, envelope protein, membrane glycoprotein, ORF6 protein, ORF7a protein, ORF7b protein, ORF8 protein, nucleocapsid protein, and ORF10 protein. In some embodiments, the ORF1ab protein includes non-structural proteins (Nsp)1, Nsp2, Nsp3, Nsp4, Nsp5, Nsp6, Nsp7, Nsp8, Nsp9, Nsp10, Nsp11, Nsp12, Nsp13, Nsp14, Nsp15, and Nsp16. In some embodiments, one or more large sequences include T cell epitopes limited to a number of human class 1 and class 2 HLA haplotypes, not limited to HLA-0201 for class 1, or not limited to HLA-DR for class 2.

[0035] In some embodiments, the large sequence is derived from structural proteins, non-structural proteins, or a combination thereof.

[0036] The present invention also features a recombinant vaccine composition comprising a full-length spike protein. The present invention also features a recombinant vaccine composition comprising a full-length spike protein or a partial spike protein.

[0037] In some embodiments, the spike protein includes Tyr-489 and Asn-487. In some embodiments, Tyr-489 and Asn-487 facilitate interaction with Tyr83 and Gln-24 on ACE-2. In some embodiments, the spike protein includes Gln-493. In some embodiments, Gln-493 facilitates interaction with Glu-35 and Lys-31 on ACE-2. In some embodiments, the spike protein includes Tyr-505. In some embodiments, Tyr-505 facilitates interaction with Glu-37 and Arg-393 on ACE-2.

[0038] In some embodiments, the composition comprises a trimerized SARS-CoV-2 receptor-binding domain (RBD) sequence. In some embodiments, the trimerized SARS-CoV-2 receptor-binding domain (RBD) sequence is modified by the addition of a T4 fibrintin-derived Foldon trimer domain. In some embodiments, the addition of the T4 fibrintin-derived Foldon trimer domain increases immunogenicity by multivalent display. In some embodiments, the composition encodes a trimerized SARS-CoV-2 spike glycoprotein RBD antigen, along with one or more highly conserved structural and non-structural SARS-CoV-2 antigens. In some embodiments, the sequence of this antigen is GenBank accession number MN908947.3. In some embodiments, the conserved large sequence is selected from variants of concern and variants of interest. In some embodiments, the composition comprises a mutation at the S1-S2 cleavage site 682-RRAR-685 → 682-QQAQ-685.

[0039] In some embodiments, the composition includes at least one proline substitution. In some embodiments, the composition includes at least two proline substitutions. In some embodiments, the proline substitutions are located at the K986 and V987 positions. In some embodiments, the composition includes K986P and V987P mutations.

[0040] In some embodiments, the larger sequence is selected from sequence numbers 182-185 (Table 1) or sequence numbers 148-159 (Table 10).

[0041] In some embodiments, the composition further comprises a pharmaceutical carrier.

[0042] In some embodiments, the linker includes T2A. In some embodiments, the linker is selected from T2A, E2A, and P2A. In some embodiments, different linkers are placed between each open reading frame.

[0043] In some embodiments, the vaccine construct is for human use. In some embodiments, the composition comprises human CXCL-11 and IL-7 or IL-2 or IL-15. In some embodiments, the vaccine construct is for animal use. In some embodiments, the composition comprises animal CXCL-11 and IL-7 or IL-2 or IL-15. In some embodiments, the animals are cats and dogs.

[0044] In some embodiments, the delivery system is an adenovirus system. In some embodiments, the adenovirus delivery system is Ad26, Ad5, Ad35, or a combination thereof. In some embodiments, one or more large sequences are operably linked to a general promoter. In some embodiments, the general promoter is a CMV or CAG promoter. In some embodiments, one or more large sequences are operably linked to a lung-specific promoter. In some embodiments, the lung-specific promoter is SpB or CD144. In some embodiments, the composition further comprises a T cell attracting chemokine.

[0045] In some embodiments, the antigen delivery system further encodes a T cell attracting chemokine. In some embodiments, the antigen delivery system comprises two delivery systems, the second of which encodes a T cell attracting chemokine. In some embodiments, the T cell attracting chemokine is CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof. In some embodiments, the T cell attracting chemokine is operably linked to a lung-specific promoter. In some embodiments, the T cell attracting chemokine is operably linked to a general-purpose promoter. In some embodiments, the composition further comprises a composition that promotes T cell proliferation.

[0046] In some embodiments, the antigen delivery system further encodes a composition that promotes T cell proliferation. In some embodiments, the antigen delivery system comprises two delivery systems, the second of which encodes a composition that promotes T cell proliferation. In some embodiments, the composition that promotes T cell proliferation is IL-7, IL-2, or IL-15. In some embodiments, the composition that promotes T cell proliferation is operably linked to a lung-specific promoter. In some embodiments, the composition that promotes T cell proliferation is operably linked to a general-purpose promoter. In some embodiments, the T cell-attracting chemokine and the composition that promotes T cell proliferation are driven by the same promoter. In some embodiments, the vaccine further encodes a peptide comprising a T cell-attracting chemokine and a composition that promotes T cell proliferation. In some embodiments, this peptide is operably linked to a lung-specific promoter. In some embodiments, this peptide is operably linked to a general-purpose promoter. In some embodiments, the lung-specific promoter is SpB or CD144. In some embodiments, the general-purpose promoter is CMV or CAG promoter.

[0047] In some embodiments, the antigen delivery system further encodes a molecular adjuvant. In some embodiments, the antigen delivery system comprises two delivery systems, the second of which encodes a molecular adjuvant. In some embodiments, the molecular adjuvant is CpG. In some embodiments, the molecular adjuvant is a CpG polymer. In some embodiments, the molecular adjuvant is flagellin. In some embodiments, the molecular adjuvant is operably linked to a promoter. In some embodiments, the promoter is a lung-specific promoter or a general-purpose promoter.

[0048] In some embodiments, one or more sequences of a large sequence are separated by linkers. In some embodiments, each of the large sequences is separated by a linker. In some embodiments, the linkers are 2 to 10 amino acid long.

[0049] In some embodiments, the recombinant vaccine composition includes a tag, for example, one or more of the large sequences include the tag. In some embodiments, the tag is a His tag.

[0050] The present invention also includes an rVSV-panCoV recombinant vaccine composition comprising any of the vaccine compositions herein.

[0051] The present invention also includes rAdV-panCoV recombinant vaccine compositions comprising any of the vaccine compositions described herein.

[0052] In some embodiments, the composition is intended for use as a vaccine. In some embodiments, the composition is intended for use as an immunotherapy for the prevention and treatment of coronavirus infection and disease. In some embodiments, the composition is used to prevent coronavirus disease in a subject. In some embodiments, the composition is used to prevent coronavirus infection in a subject. In some embodiments, the composition induces an immune response in a subject. In some embodiments, the composition prolongs the immune response induced by a pan-coronavirus recombinant vaccine composition and increases T cell migration to the lungs.

[0053] The present invention also includes a pan-coronavirus recombinant vaccine composition comprising SEQ ID NOs. 139-147 (Table 10).

[0054] Non-spike proteins include, but are not limited to, any coronavirus proteins other than spike proteins, such as envelope proteins, membrane proteins, nucleocapsid proteins, ORF1a proteins, ORF1ab proteins, ORF6 proteins, ORF7a proteins, ORF7b proteins, and ORF8 proteins.

[0055] In certain embodiments, the composition of the present invention, for example, a large sequence, comprises one or more conserved target epitopes, e.g., one or more conserved coronavirus B cell target epitopes, one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes. In some embodiments, the conserved target epitope is an epitope that is one of the five most conserved epitopes (for its epitope type, e.g., B cell, CD4 T cell, CD8 T cell) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the ten most conserved epitopes (for its epitope type, e.g., B cell, CD4 T cell, CD8 T cell) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the 15 most conserved epitopes (for their epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the 20 most conserved epitopes (for their epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the 25 most conserved epitopes (for their epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the 30 most conserved epitopes (for its epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the 35 most conserved epitopes (for its epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis.In some embodiments, the conserved target epitope is an epitope that is one of the 40 most conserved epitopes (for its epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis. In some embodiments, the conserved target epitope is an epitope that is one of the 50 most conserved epitopes (for its epitope type, e.g., B cells, CD4 T cells, CD8 T cells) identified by sequence alignment and analysis. Examples of sequence alignment and analysis are described herein. For example, a step or method for selecting or identifying a large conserved sequence may first involve performing sequence alignment and analysis on a certain number of coronavirus sequences to determine sequence similarity or identity between the group of sequences analyzed. In some embodiments, the sequences used for alignment may include human and animal sequences. In some embodiments, sequences used for alignment may include one or more currently circulating human SARS-CoV-2 strains or variants, one or more coronaviruses that caused previous human outbreaks, one or more coronaviruses isolated from animals selected from a group consisting of bats, pangolins, civet cats, mink, camels, and other animals that accept coronaviruses, or one or more coronaviruses that cause the common cold. In some embodiments, a conserved large sequence is identified by performing sequence alignment and analysis of a specific number of coronavirus sequences to determine sequence similarity or identity between the group of sequences analyzed. A conserved large sequence is a sequence that lies among the most highly conserved sequences identified in the analysis. For example, a conserved large sequence may be two of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be five of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be eight of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be ten of the most highly conserved sequences identified.In some embodiments, the conserved large sequence may be 15 of the most highly conserved sequences identified. In some embodiments, the conserved large sequence may be 20 of the most highly conserved sequences identified. In some embodiments, the conserved large sequence may be 30 of the most highly conserved sequences identified. In some embodiments, the conserved large sequence may be 40 of the most highly conserved sequences identified. The present invention is not limited to the aforementioned thresholds. In some embodiments, alignment and analysis of 50 or more sequences, 100 or more sequences, 200 or more sequences, 300 or more sequences, 400 or more sequences, 500 or more sequences, 1000 or more sequences, 2000 or more sequences, 3000 or more sequences, 4000 or more sequences, 5000 or more sequences, 10,000 or more sequences, 15,000 or more sequences, etc., and in some embodiments, the sequences used for alignment may include human and animal sequences. In some embodiments, sequences used for alignment include one or more currently circulating human SARS-CoV-2 strains or variants, one or more coronaviruses that caused previous human outbreaks, one or more coronaviruses isolated from animals selected from a group consisting of bats, pangolins, civet cats, mink, camels, and other animals that accept coronaviruses, or one or more coronaviruses that cause the common cold. In some embodiments, one or more currently circulating human SARS-CoV-2 strains or variants are selected from strains B.1.177, B.1.160, B.1.1.7, B.1.351, P.1, B.1.427 / B.1.429, B.1.258, B.1.221, B.1.367, B.1.1.277, B.1.1.302, B.1.525, B.1.526, S:677H, and S:677P. In some embodiments, one or more coronaviruses that cause the common cold are selected from 229E alpha-coronavirus, NL63 alpha-coronavirus, OC43 beta-coronavirus, and HKU1 beta-coronavirus.As discussed herein, one or more conserved large sequences containing a target epitope are highly conserved among human and animal coronaviruses. In any embodiment of this specification, the selected epitope may be one that achieves outstanding scores in binding assays (e.g., for binding to HLA molecules).

[0056] In certain embodiments, one or more conserved coronavirus CD8+ T cell target epitopes are selected from spike glycoproteins, envelope proteins, ORF1ab proteins, ORF7a proteins, ORF8a proteins, ORF10 proteins, or combinations thereof. In certain embodiments, one or more conserved coronavirus CD8+ T cell target epitopes are S 2-10 S 1220-1228 S 1000-1008 S 958-966 , E 20-28 ORF1ab 1675-1683 ORF1ab 2363-2371 ORF1ab 3013-3021 ORF1ab 3183-3191 ORF1ab 5470-5478 ORF1ab 6749-6757 ORF7b 26-34 ORF8a 73-81 ORF1 03-11 and ORF1 05-13 Selected from: In a particular embodiment, one or more conserved coronavirus CD8+ T cell target epitopes are selected from SEQ ID NOs: 2-29. In a particular embodiment, one or more conserved coronavirus CD8+ T cell target epitopes are selected from SEQ ID NOs: 30-57.

[0057] In certain embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are selected from spike glycoproteins, envelope proteins, membrane proteins, nucleocapsid proteins, ORF1a proteins, ORF1ab proteins, ORF6 proteins, ORF7a proteins, ORF7b proteins, ORF8 proteins, or combinations thereof. In certain embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are ORF1a 1350-1365 ORF1ab 5019-5033 ORF6 12-26 ORF1ab 6088-6102 ORF1ab 6420-6434 ORF1a 1801-1815 S 1-13 , E 26-40 , E 20-34 M 176-190 , N 388-403 ORF7a 3-17 ORF7a 1-15 ORF7b 8-22 ORF7a 98-112 and ORF8 1-15 Selected from: In a particular embodiment, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 58-73. In a particular embodiment, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 74-105.

[0058] In certain embodiments, one or more conserved coronavirus B cell target epitopes are selected from spike glycoproteins. In certain embodiments, one or more conserved coronavirus B cell target epitopes are S 287-317 S 524-598 S 601-640 S 802-819 S 888-909 S 369-393 S 440-501 S 1133-1172 S 329-363 and S 13-37Selected from. In a particular embodiment, one or more coronavirus B cell target epitopes are selected from SEQ ID NOs: 106-116. In a particular embodiment, one or more coronavirus B cell target epitopes are selected from SEQ ID NOs: 117-138.

[0059] As described above, in certain embodiments, one or more conserved coronavirus B cell target epitopes are in the form of a large sequence, e.g., the whole spike protein or a partial spike protein (e.g., a portion of the whole spike protein). In some embodiments, the whole spike protein or a portion thereof is in its stabilized conformation. In certain embodiments, the transmembrane anchor of the spike protein (or a portion thereof) has an intact S1-S2 cleavage site. In certain embodiments, the spike glycoprotein has, for example, two consecutive proline substitutions at amino acid positions 986 and 987 for stabilization. In certain embodiments, the spike protein or a portion thereof has an amino acid substitution at amino acid position Tyr-83. In certain embodiments, the spike protein or a portion thereof has an amino acid substitution at amino acid position Tyr-489. In certain embodiments, the spike protein or a portion thereof has an amino acid substitution at amino acid position Gln-24. In certain embodiments, the spike protein or a portion thereof has an amino acid substitution at amino acid position Asn-487. In certain embodiments, the spike protein or a portion thereof has one or more amino acid substitutions among Tyr-83, Tyr-489, Gln-24, Gln-493, and Asn-487. For example, the spike protein or a portion thereof may include Tyr-489 and Asn-487, the spike protein or a portion thereof may include Gln-493, the spike protein or a portion thereof may include Tyr-505, and so on. Tyr-489 and Asn-487 facilitate interaction with Tyr83 and Gln-24 on ACE-2. Gln-493 facilitates interaction with Glu-35 and Lys-31 on ACE-2. Tyr-505 facilitates interaction with Glu-37 and Arg-393 on ACE-2.

[0060] In certain embodiments, the composition contains the mutation 682-RRAR-685 → 682-QQAQ-685 at the S1-S2 cleavage site. In certain embodiments, the composition contains at least one proline substitution. In certain embodiments, the composition contains at least two proline substitutions, for example, at positions K986 and V987.

[0061] In certain embodiments, the large sequence derived from the spike glycoprotein is an RBD. In certain embodiments, the large sequence derived from the spike glycoprotein is an NTD. In certain embodiments, the large sequence derived from the spike glycoprotein is, for example, one or more large sequences containing both an RBD region and an NTD region. In certain embodiments, the large sequence derived from the spike glycoprotein is recognized by neutralizing and blocking antibodies. In certain embodiments, the large sequence derived from the spike glycoprotein induces neutralizing and blocking antibodies. In certain embodiments, the large sequence derived from the spike glycoprotein induces neutralizing and blocking antibodies that recognize and neutralize the virus. In certain embodiments, the large sequence derived from the spike glycoprotein induces neutralizing and blocking antibodies that recognize the spike protein.

[0062] In certain embodiments, linkers are used, for example, between epitopes or between large sequences. In certain embodiments, linkers are 2 to 10 amino acid long. In certain embodiments, linkers are 3 to 12 amino acid long. In certain embodiments, linkers are 5 to 15 amino acid long. In certain embodiments, linkers are 10 amino acid long or more. Non-limiting examples of linkers include AAY, KK, and GPGPG (SEQ ID NO: 186).

[0063] In some embodiments, the composition includes the addition of a Foldon trimerizing domain derived from T4 fibrintin. In some embodiments, the addition of a Foldon trimerizing domain derived from T4 fibrintin increases immunogenicity by polyvalent display.

[0064] In certain embodiments, the composition further comprises a T cell attracting chemokine. For example, the composition may further comprise one of CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof.

[0065] In certain embodiments, the composition further comprises a composition that promotes T cell proliferation. For example, the composition may further comprise IL-7, IL-15, IL-2, or a combination thereof.

[0066] In certain embodiments, the composition further comprises a molecular adjuvant. For example, the composition may further comprise one or a combination thereof of CpG (e.g., a CpG polymer) or flagellin.

[0067] In certain embodiments, the composition includes a tag. For example, one or more elements of a large sequence may include a tag. In certain embodiments, the epitope is in the form of two or more antigens, where one or more antigens include a tag. A non-limiting example of a tag is the His tag.

[0068] In certain embodiments, the “antigen delivery system” may refer to two delivery systems, for example, one delivery system may encode part of a large sequence (or other components, such as a chemokine), and the other delivery system (or a third delivery system, etc.) may encode part of the large sequence (or other components).

[0069] Regarding the antigen delivery system, in certain embodiments, the antigen delivery system is a vesicular stomatitis virus (VSV) vector. In certain embodiments, the antigen delivery system is an adenovirus (e.g., Ad26, Ad5, Ad35, etc.).

[0070] Large sequences are operably linked to promoters. In certain embodiments, the promoter is a general-purpose promoter (e.g., CMV, CAG, etc.). In certain embodiments, the promoter is a lung-specific promoter (e.g., SpB, CD144). In certain embodiments, large sequences are operably linked to the same promoter. In certain embodiments, one or more large sequences are operably linked to a first promoter, and one or more large sequences are operably linked to a second promoter. In certain embodiments, a large sequence is operably linked to two or more promoters, for example, one portion of which is operably linked to a first promoter, and another portion of which is operably linked to a second promoter. In certain embodiments, a large sequence is operably linked to three or more promoters, for example, one portion of which is operably linked to a first promoter, one portion of which is operably linked to a second promoter, and another portion of which is operably linked to a third promoter. In certain embodiments, the first promoter is the same as the second promoter. In certain embodiments, the second promoter is different from the first promoter. In certain embodiments, the promoter is a general-purpose promoter (e.g., CMV, CAG, etc.). In certain embodiments, the promoter is a lung-specific promoter (e.g., SpB, CD144) promoter.

[0071] In certain embodiments, the antigen delivery system or a separate antigen delivery system encodes a T cell-attracting chemokine. In certain embodiments, the antigen delivery system or a separate antigen delivery system encodes a composition that promotes T cell proliferation. In certain embodiments, the antigen delivery system or a separate antigen delivery system encodes both a T cell-attracting chemokine and a composition that promotes T cell proliferation. In certain embodiments, the antigen delivery system or a separate antigen delivery system encodes a molecular adjuvant. In certain embodiments, the antigen delivery system or a separate antigen delivery system encodes a T cell-attracting chemokine, a composition that promotes T cell proliferation, and a molecular adjuvant. In certain embodiments, the antigen delivery system or a separate antigen delivery system encodes a T cell-attracting chemokine and a molecular adjuvant. In some embodiments, the antigen delivery system or a separate antigen delivery system encodes a composition that promotes T cell proliferation and a molecular adjuvant.

[0072] In certain embodiments, the T cell attracting chemokine is CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof. In certain embodiments, the composition that promotes T cell proliferation is IL-7, IL-15, or IL-2. In some embodiments, the molecular adjuvant is CpG (e.g., CpG polymer), flagellin, etc.

[0073] In certain embodiments, the T cell-attracting chemokine is operably linked to a lung-specific promoter (e.g., SpB, CD144). In certain embodiments, the T cell-attracting chemokine is operably linked to a general-purpose promoter (e.g., CMV, CAG, etc.). In certain embodiments, the T cell proliferation-promoting composition is operably linked to a lung-specific promoter (e.g., SpB, CD144). In certain embodiments, the T cell proliferation-promoting composition is operably linked to a general-purpose promoter (e.g., CMV, CAG, etc.). In certain embodiments, the molecular adjuvant is operably linked to a lung-specific promoter (e.g., SpB, CD144). In certain embodiments, the molecular adjuvant is operably linked to a general-purpose promoter (e.g., CMV, CAG, etc.). In certain embodiments, the T cell-attracting chemokine and the T cell proliferation-promoting composition are driven by the same promoter. In certain embodiments, the T cell-attracting chemokine and the T cell proliferation-promoting composition are driven by different promoters. In certain embodiments, the molecular adjuvant, the T cell-attracting chemokine, and the T cell proliferation-promoting composition are driven by the same promoter. In certain embodiments, the molecular adjuvant, the T cell-attracting chemokine, and the T cell proliferation-promoting composition are driven by different promoters. In certain embodiments, the molecular adjuvant and the T cell proliferation-promoting composition are driven by different promoters. In certain embodiments, the molecular adjuvant and the T cell-attracting chemokine are driven by different promoters.

[0074] In certain embodiments, T cell-attracting chemokines and compositions that promote T cell proliferation are separated by a linker. In certain embodiments, the linker comprises T2A. In certain embodiments, the linker comprises E2A. In certain embodiments, the linker comprises P2A. In certain embodiments, the linker is selected from T2A, E2A, and P2A.

[0075] With respect to the antigen delivery system, in certain embodiments, linkers are placed between each open reading frame. In certain embodiments, different linkers are placed between each open reading frame. In certain embodiments, the same linker may be used between certain open reading frames, and different linkers may be used between other open reading frames.

[0076] In some embodiments, the vaccine composition is administered using adenovirus.

[0077] The compositions herein may be used to prevent coronavirus disease in a subject. The compositions herein may be used to prevent coronavirus infection in a subject. The compositions herein may be used to induce an immune response in a subject. The term “subject” herein may refer to humans, non-human primates, animals such as mice, rats, cats, dogs, other animals susceptible to coronavirus infection, or other animals used for preclinical modeling. The compositions herein may prolong the immune response induced by a pan-coronavirus recombinant vaccine composition and increase T cell migration to the lungs. In certain embodiments, the composition induces resident memory T cells (Trm). In some embodiments, the vaccine composition induces efficient and robust protection against coronavirus disease or infection. In some embodiments, the vaccine composition induces the production of antibodies (Abs), CD4+ T helper (Th1) cells, and CD8+ cytotoxic T cells (CTLs). In some embodiments, compositions that promote T cell proliferation help promote long-term immunity. In some embodiments, T cell attracting chemokines help draw T cells from the bloodstream into the lungs.

[0078] In certain embodiments, the composition further comprises a pharmaceutical carrier.

[0079] The present invention includes any vaccine composition described herein, for example, the above-mentioned vaccine composition for delivery using nanoparticles, for example, lipid nanoparticles. For example, the present invention includes the vaccine composition described herein encapsulated in lipid nanoparticles.

[0080] The present invention includes compositions described herein that comprise and / or encode a trimerized SARS-CoV-2 receptor-binding domain (RBD) and one or more highly conserved SARS-CoV-2 sequences selected from structural proteins (e.g., nucleoproteins, etc.) and non-structural proteins (e.g., Nsp4, etc.). In some embodiments, the trimerized SARS-CoV-2 receptor-binding domain (RBD) sequence is modified by the addition of a T4 fibrintin-derived Foldon trimerization domain. In some embodiments, the addition of a T4 fibrintin-derived Foldon trimerization domain increases immunogenicity by multivalent display.

[0081] The present invention also features a method for producing the pan-coronavirus recombinant vaccine composition of the present invention.

[0082] For example, in some embodiments, the method includes selecting a conserved large sequence comprising at least one coronavirus B cell epitope, one or more coronavirus CD4+ T cell epitopes, and one or more coronavirus CD8+ T cell epitopes. In other embodiments, the method includes selecting at least two conserved large sequences comprising one or more coronavirus B cell epitopes, one or more coronavirus CD4+ T cell epitopes, and one or more coronavirus CD8+ T cell epitopes. At least one large sequence is derived from a non-spike protein. The method further includes synthesizing one or more antigens comprising the selected large sequences. In some embodiments, the method includes selecting one or more conserved large sequences comprising one or more coronavirus B cell epitopes, one or more coronavirus CD4+ T cell epitopes, and one or more coronavirus CD8+ T cell epitopes. At least one large sequence is derived from a non-spike protein. The method further includes synthesizing one or more antigens comprising the selected large sequences. In some embodiments, the method further includes introducing the vaccine composition onto a pharmaceutical carrier. A step for selecting one or more conserved large sequences is disclosed herein. Methods for synthesizing recombinant proteins are well known to those skilled in the art. The vaccine composition is disclosed herein. In some embodiments, the vaccine composition is in the form of DNA, RNA, modified RNA, protein (or peptide), or a combination thereof.

[0083] In some embodiments, the method comprises selecting at least one conserved large sequence comprising one or more coronavirus B cell epitopes, one or more coronavirus CD4+ T cell epitopes, and one or more coronavirus CD8+ T cell epitopes. The at least one large sequence is derived from a non-spike protein. The method further comprises synthesizing an antigen delivery system encoding the selected large sequence. In some embodiments, the method further comprises introducing the vaccine composition onto a pharmaceutical carrier. The steps for selecting one or more conserved large sequences are disclosed herein. Methods for synthesizing the antigen delivery system are well known to those skilled in the art. The vaccine composition is disclosed herein. In some embodiments, the vaccine composition is in the form of DNA, RNA, modified RNA, protein (or peptide), or a combination thereof.

[0084] As an example, a process or method for selecting or identifying a large number of stored sequences may first involve sequence alignment and analysis of a specific number of coronavirus sequences, such as 50 or more sequences, 100 or more sequences, 200 or more sequences, 300 or more sequences, 400 or more sequences, 500 or more sequences, 1000 or more sequences, 2000 or more sequences, 3000 or more sequences, 4000 or more sequences, 5000 or more sequences, 10,000 or more sequences, 15,000 or more sequences, etc., to determine the sequence similarity or identity between the analyzed group of sequences. In some embodiments, the sequences used for alignment may include human and animal sequences. In some embodiments, sequences used for alignment include one or more currently circulating human SARS-CoV-2 strains or variants, one or more coronaviruses that caused previous human outbreaks, one or more coronaviruses isolated from animals selected from a group consisting of bats, pangolins, civet cats, mink, camels, and other animals that accept coronaviruses, or one or more coronaviruses that cause the common cold. In some embodiments, one or more currently circulating human SARS-CoV-2 strains or variants are selected from strains B.1.177, B.1.160, B.1.1.7, B.1.351, P.1, B.1.427 / B.1.429, B.1.258, B.1.221, B.1.367, B.1.1.277, B.1.1.302, B.1.525, B.1.526, S:677H, and S:677P. In some embodiments, one or more coronaviruses that cause the common cold are selected from 229E alpha-coronavirus, NL63 alpha-coronavirus, OC43 beta-coronavirus, and HKU1 beta-coronavirus. In some embodiments, the conserved large sequences may be considered to be the two most highly conserved sequences among the large sequences identified during alignment. In some embodiments, the conserved large sequences may be considered to be the five most highly conserved sequences among the large sequences identified during alignment.In some embodiments, the conserved large sequences may be considered to be the 10 most highly conserved sequences among the large sequences identified during alignment. In some embodiments, the conserved large sequences may be considered to be the 15 most highly conserved sequences among the large sequences identified during alignment.

[0085] The present invention also features a method for preventing coronavirus disease. The method comprises administering a therapeutically effective amount of the pan-coronavirus recombinant vaccine composition according to the present invention to a subject, the composition in which an immune response is induced in the subject and helps prevent coronavirus disease.

[0086] The present invention also features a method for the preventive prevention of coronavirus infection in a subject. In some embodiments, the method comprises administering a preventively effective amount of the pan-coronavirus recombinant vaccine composition according to the present invention to a subject, the vaccine composition preventing coronavirus infection.

[0087] The present invention also comprises a method for inducing an immune response in a subject, comprising administering a composition according to the present invention to the subject, wherein the vaccine composition induces an immune response in the subject. The present invention also comprises a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention to a subject, wherein the composition prevents viral replication in the lungs, brain, and other parts where the virus replicates. The present invention also comprises a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention to a subject, wherein the composition prevents a cytokine storm in the lungs, brain, and other parts where the virus replicates. The present invention also comprises a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention to a subject, wherein the composition prevents inflammation or an inflammatory response in the lungs, brain, and other parts where the virus replicates. The present invention also comprises a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention to a subject, wherein the composition improves T cell homing and retention in the lungs, brain, and other parts where the virus replicates. The present invention also provides a method for preventing coronavirus disease in a subject, comprising administering the pan-coronavirus recombinant vaccine composition according to the present invention to the subject, wherein the composition induces memory B cells and T cells. The present invention also provides a method for extending the immune response induced by a pan-coronavirus recombinant vaccine and increasing T cell migration to the lungs, comprising co-expression of a T cell attracting chemokine, a composition that promotes T cell proliferation, and the pan-coronavirus recombinant vaccine according to the present invention. The present invention also provides a method for extending the retention of memory T cells induced by a pan-coronavirus vaccine in the lungs and increasing virus-specific tissue-resident memory T cells (TRM cells), comprising co-expression of a T cell attracting chemokine, a composition that promotes T cell proliferation, and the pan-coronavirus recombinant vaccine according to the present invention. The present invention also provides a method for administering the pan-coronavirus recombinant vaccine composition according to the present invention to a subject, wherein the composition prevents the generation of coronavirus mutants and variants.

[0088] For the sake of brevity, it should be noted that the vaccine compositions referred to in the manner described above include the aforementioned vaccine compositions, the embodiments described below, and the embodiments shown in the figures.

[0089] In some embodiments, the vaccine composition is administered via an intravenous route (iv), an intranasal route (in), or a sublingual route (sl).

[0090] In some embodiments, the vaccine composition is administered using adenovirus or other suitable delivery systems.

[0091] As described above, the compositions herein may be used to prevent coronavirus disease in a subject. The compositions herein may be used to preventively prevent coronavirus infection in a subject. The compositions herein may be used to induce an immune response in a subject. The term “subject” herein may refer to humans, non-human primates, animals such as mice, rats, cats, dogs, other animals susceptible to coronavirus infection, or other animals used for preclinical modeling. The compositions herein may prolong the immune response induced by a pan-coronavirus recombinant vaccine composition and increase T cell migration to the lungs. In certain embodiments, the composition induces resident memory T cells (Trm). In some embodiments, the vaccine composition induces efficient and robust protection against coronavirus disease or infection. In some embodiments, the vaccine composition induces the production of antibodies (Abs), CD4+ T helper (Th1) cells, and CD8+ cytotoxic T cells (CTLs). In some embodiments, compositions that promote T cell proliferation help promote long-term immunity. In some embodiments, T cell attracting chemokines help draw T cells from the bloodstream into the lungs.

[0092] The present invention also features oligonucleotide compositions. For example, the present invention includes oligonucleotides disclosed in sequence listings. The present invention also includes oligonucleotides in the form of antigen delivery systems. The present invention also includes oligonucleotides encoding conserved large sequences disclosed herein. The present invention also includes oligonucleotide compositions comprising one or more oligonucleotides encoding any of the vaccine compositions according to the present invention. In some embodiments, the oligonucleotide comprises DNA. In some embodiments, the oligonucleotide comprises modified DNA. In some embodiments, the oligonucleotide comprises RNA. In some embodiments, the oligonucleotide comprises modified RNA. In some embodiments, the oligonucleotide comprises mRNA. In some embodiments, the oligonucleotide comprises modified mRNA.

[0093] The present invention also features peptide compositions. For example, the present invention includes peptides disclosed in sequence listings. The present invention also includes peptide compositions comprising any of the vaccine compositions according to the present invention. The present invention also includes peptide compositions comprising any of the conserved large sequences according to the present invention.

[0094] For the sake of brevity, please note that the vaccine compositions referred to in the aforementioned oligonucleotide and peptide compositions include the aforementioned vaccine compositions, the embodiments described below, and the embodiments shown in the figures.

[0095] The present invention also features a pan-coronavirus recombinant vaccine composition comprising Sequence IDs 139-147 (Table 9).

[0096] The present invention also features a pan-coronavirus recombinant vaccine composition that is at least 99% identical to Sequence IDs 139-147 (Table 9).

[0097] The present invention also features a method comprising administering a first whole coronavirus recombinant vaccine dose using a first delivery system and administering a second vaccine dose using a second delivery system, wherein the first and second delivery systems are different. In some embodiments, the first delivery system may include an RNA, modified mRNA, or peptide delivery system. In some embodiments, the second delivery system may include an RNA, modified mRNA, or peptide delivery system. In some embodiments, the peptide delivery system is an adenovirus. In some embodiments, the adenovirus delivery system is Ad26, Ad5, Ad35, or a combination thereof. In some embodiments, the peptide delivery system is a vesicular stomatitis virus (VSV) vector. In some embodiments, the second vaccine dose is administered 14 days after the first vaccine dose.

[0098] The present invention also features a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention, and administering at least one T-cell attracting chemokine after administering the pan-coronavirus recombinant vaccine composition. In some embodiments, the vaccine composition is administered via RNA, modified mRNA, or a peptide delivery system. In some embodiments, the T-cell attracting chemokine is administered via RNA, modified mRNA, or a peptide delivery system. In some embodiments, the peptide delivery system is an adenovirus. In some embodiments, the adenovirus delivery system is Ad26, Ad5, Ad35, or a combination thereof. In some embodiments, the peptide delivery system is a vesicular stomatitis virus (VSV) vector. In some embodiments, the T-cell attracting chemokine is administered 8 days after administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 14 days after administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 30 days after administration of the vaccine composition. In some embodiments, the T cell attracting chemokine is CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof.

[0099] The present invention also features a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention, administering at least one T-cell attracting chemokine after administering the pan-coronavirus recombinant vaccine composition, and administering at least one cytokine after administering the T-cell attracting chemokine. In some embodiments, the vaccine composition is administered via RNA, modified mRNA, or peptide delivery systems. In some embodiments, the T-cell attracting chemokine is administered via RNA, modified mRNA, or peptide delivery systems. In some embodiments, the cytokine is administered via RNA, modified mRNA, or peptide delivery systems. In some embodiments, the peptide delivery system is an adenovirus. In some embodiments, the adenovirus delivery system is Ad26, Ad5, Ad35, or a combination thereof. In some embodiments, the peptide delivery system is a vesicular stomatitis virus (VSV) vector. In some embodiments, the T-cell attracting chemokine is administered 14 days after administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof. In some embodiments, the cytokine is administered 10 days after the administration of the T-cell attracting chemokine. In some embodiments, the cytokine is IL-7, IL-15, IL-2, or a combination thereof.

[0100] The present invention also features a method comprising administering a pan-coronavirus recombinant vaccine composition according to the present invention, administering one or more T-cell attracting chemokines after administering the pan-coronavirus recombinant vaccine composition, and administering one or more mucosal chemokines. In some embodiments, the vaccine composition is administered using an adenovirus. In some embodiments, the T-cell attracting chemokines are administered via RNA, modified mRNA, or peptide delivery systems, or other delivery systems. In some embodiments, the mucosal chemokines are administered via RNA, modified mRNA, or peptide delivery systems, or other delivery systems. In some embodiments, the adenovirus is Ad26, Ad5, Ad35, or a combination thereof. In some embodiments, the T-cell attracting chemokines are administered 14 days after administration of the vaccine composition. In some embodiments, the T-cell attracting chemokines are CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof. In some embodiments, the mucosal chemokines are administered 10 days after administration of the T-cell attracting chemokines. In some embodiments, the mucosal chemokine is CCL25, CCL28, CXCL14, or CXCL17, or a combination thereof.

[0101] For the sake of brevity, it should be noted that the vaccine compositions referred to in the manner described above include the aforementioned vaccine compositions, the embodiments described below, and the embodiments shown in the figures.

[0102] As described above, in some embodiments, the vaccine composition is for use in humans. In some embodiments, the vaccine composition is for use in animals, such as cats and dogs. In some embodiments, the vaccine composition comprises human CXCL-11 and / or human IL-7 (or IL-15, IL-2). In some embodiments, the vaccine composition comprises animal CLCL-11 and / or animal IL-7 (or IL-15, IL-2).

[0103] The present invention includes a vaccine composition in the form of an rVSV-pan-CoV vaccine composition. The present invention also includes a vaccine composition in the form of an rAdV-pan-CoV vaccine composition.

[0104] The present invention also includes nucleic acids for use in the vaccine compositions specified herein. The present invention also includes vectors for use in the vaccine compositions specified herein. The present invention also includes fusion proteins for use in the vaccine compositions specified herein. The present invention also includes immunogenic compositions for use in the vaccine compositions specified herein.

[0105] The vaccine compositions described herein may be designed to induce high levels of viral blocking and viral neutralizing antibodies, as well as both CD4+ T cells and CD8+ T cells, in adults aged 18 to 55 years. The vaccine compositions described herein may be designed to induce high levels of viral blocking and viral neutralizing antibodies, as well as both CD4+ T cells and CD8+ T cells, in adults aged 55 to 65 years. The vaccine compositions described herein may be designed to induce high levels of viral blocking and viral neutralizing antibodies, as well as both CD4+ T cells and CD8+ T cells, in adults aged 65 to 85 years. The vaccine compositions described herein may be designed to induce high levels of viral blocking and viral neutralizing antibodies, as well as both CD4+ T cells and CD8+ T cells, in adults aged 85 to 100 years. The vaccine compositions described herein may be designed to induce high levels of viral blocking and viral neutralizing antibodies, as well as both CD4+ T cells and CD8+ T cells, in children aged 12 to 18 years. The vaccine compositions described herein may be designed to induce high levels of viral blocking antibodies and viral neutralizing antibodies, as well as both CD4+ T cells and CD8+ T cells, in children under 12 years of age.

[0106] The present invention is not limited to vaccine compositions. For example, in certain embodiments, one or more conserved large sequences are used for the detection of coronaviruses and / or for the diagnosis of coronavirus infections.

[0107] As described above, in some embodiments, one or more conserved large sequences are highly conserved among human and animal coronaviruses. In some embodiments, a conserved large sequence is one of the most highly conserved large sequences identified in sequence alignment and analysis of a particular number of coronavirus sequences. For example, a conserved large sequence may be two most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be five most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be eight most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be ten most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be fifteen most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be twenty most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be thirty most highly conserved large sequences identified. In some embodiments, a conserved large sequence may be forty most highly conserved large sequences identified. In some embodiments, the conserved large sequences may be five of the most highly conserved large sequences identified and derived from at least one SARS-CoV-2 protein.In some embodiments, one or more currently circulating human SARS-CoV-2 strains or variants are selected from strains B.1.177, B.1.160, B.1.1.7, B.1.351, P.1, B.1.427 / B.1.429, B.1.258, B.1.221, B.1.367, B.1.1.277, B.1.1.302, B.1.525, B.1.526, S:677H, and S:677P. In some embodiments, one or more coronaviruses that cause the common cold are selected from 229E alpha-coronavirus, NL63 alpha-coronavirus, OC43 beta-coronavirus, and HKU1 beta-coronavirus. In some embodiments, the vaccine composition is for human use. In some embodiments, the vaccine composition is for animal use.

[0108] The present invention also features a method for preparing a pan-coronavirus composition, comprising selecting at least one large sequence according to the present invention and synthesizing one or more antigens comprising the selected large sequence. The present invention also features a method for preparing a pan-coronavirus composition, comprising selecting at least one conserved large sequence and synthesizing an antigen delivery system encoding the selected large sequence.

[0109] The present invention also comprises a pan-coronavirus recombinant vaccine composition comprising one or more large sequences, each of which comprises at least one of the following: a whole spike protein or a portion thereof, one or more conserved coronavirus CD4+ T cell target epitopes, and one or more conserved coronavirus CD8+ T cell target epitopes, wherein at least one epitope is derived from a non-spike protein.

[0110] In some embodiments, one or more conserved epitopes are highly conserved among human and animal coronaviruses. In some embodiments, one or more conserved epitopes are derived from at least one SARS-CoV-2 protein. In some embodiments, the composition contains 2 to 20 CD8+ T cell target epitopes. In some embodiments, the composition contains 2 to 20 CD4+ T cell target epitopes. In some embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 58-105 (ORF1a1350-1365, ORF1ab5019-5033, ORF612-26, ORF1ab6088-6102, ORF1ab6420-6434, ORF1a1801-1815, S1-13, E26-40, E20-34, M176-190, N388-403, ORF7a3-17, ORF7a1-15, ORF7b8-22, ORF7a98-112, and ORF81-15). In some embodiments, one or more conserved coronavirus CD8+ T cell target epitopes are selected from SEQ ID NOs: 106-138 (S287-317, S524-598, S601-640, S802-819, S888-909, S369-393, S440-501, S1133-1172, S329-363, and S13-37).

[0111] The present invention also features a pan-coronavirus recombinant vaccine composition comprising one or more large sequences, wherein each of the one or more large sequences comprises at least one of one or more conserved coronavirus B cell target epitopes, one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes, and at least one epitope is derived from a non-spike protein.

[0112] In some embodiments, one or more conserved epitopes are derived from at least one SARS-CoV-2 protein. In some embodiments, the composition contains 2 to 20 CD8+ T cell target epitopes. In some embodiments, the composition contains 2 to 20 CD4+ T cell target epitopes. In some embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 58-105 (ORF1a1350-1365, ORF1ab5019-5033, ORF612-26, ORF1ab6088-6102, ORF1ab6420-6434, ORF1a1801-1815, S1-13, E26-40, E20-34, M176-190, N388-403, ORF7a3-17, ORF7a1-15, ORF7b8-22, ORF7a98-112, and ORF81-15).

[0113] In some embodiments, one or more conserved coronavirus CD8+ T cell target epitopes are selected from SEQ ID NOs: 106-138 (S287-317, S524-598, S601-640, S802-819, S888-909, S369-393, S440-501, S1133-1172, S329-363, and S13-37).

[0114] In some embodiments, one or more conserved coronavirus B cell target epitopes are selected from SEQ ID NOs: 2-57 (S2-10, S1220-1228, S1000-1008, S958-966, E20-28, ORF1ab1675-1683, ORF1ab2363-2371, ORF1ab3013-3021, ORF1ab3183-3191, ORF1ab5470-5478, ORF1ab6749-6757, ORF7b26-34, ORF8a73-81, ORF103-11, and ORF105-13).

[0115] The present invention also features a pan-coronavirus recombinant vaccine composition comprising an antigen delivery system encoding one or more large sequences, wherein the large sequences comprise at least one of one or more conserved coronavirus B cell target epitopes, one or more conserved coronavirus CD4+ T cell target epitopes, and / or one or more conserved coronavirus CD8+ T cell target epitopes, and at least one epitope is derived from a non-spike protein.

[0116] In some embodiments, the antigen delivery system is an adenovirus-based antigen delivery system. In some embodiments, the adenovirus-based antigen delivery system is Ad26, Ad5, Ad35, or a combination thereof. In some embodiments, the antigen delivery system further encodes a T cell-attracting chemokine. In some embodiments, the antigen delivery system further encodes a composition that promotes T cell proliferation. In some embodiments, the antigen delivery system further encodes a molecular adjuvant. In some embodiments, a large sequence is operably linked to a lung-specific promoter.

[0117] In some embodiments, one or more conserved coronavirus B cell target epitopes are selected from SEQ ID NOs: 2-57 (S2-10, S1220-1228, S1000-1008, S958-966, E20-28, ORF1ab1675-1683, ORF1ab2363-2371, ORF1ab3013-3021, ORF1ab3183-3191, ORF1ab5470-5478, ORF1ab6749-6757, ORF7b26-34, ORF8a73-81, ORF103-11, and ORF105-13). In some embodiments, one or more conserved coronavirus CD4+ T cell target epitopes are selected from SEQ ID NOs. 58-105 (ORF1a1350-1365, ORF1ab5019-5033, ORF612-26, ORF1ab6088-6102, ORF1ab6420-6434, ORF1a1801-1815, S1-13, E26-40, E20-34, M176-190, N388-403, ORF7a3-17, ORF7a1-15, ORF7b8-22, ORF7a98-112, and ORF81-15). In some embodiments, one or more conserved coronavirus CD8+ T cell target epitopes are selected from SEQ ID NOs: 106-138 (S287-317, S524-598, S601-640, S802-819, S888-909, S369-393, S440-501, S1133-1172, S329-363, and S13-37).

[0118] In some embodiments, the partial spike protein contains a trimerized SARS-CoV-2 receptor-binding domain (RBD). In some embodiments, the whole or partial spike protein has an intact S1-S2 cleavage site. In some embodiments, the spike protein is stabilized by proline substitution at amino acid positions 986 and 987.

[0119] The present invention also features a pan-coronavirus recombinant vaccine composition comprising one of sequence numbers 139-147.

[0120] The present invention also includes a corresponding nucleic acid sequence for any of the protein sequences herein.

[0121] Embodiments of this specification may include the whole spike protein or a portion of the spike protein. The whole spike protein and its portion are not limited to the wild type or original sequence, and may include the spike protein or its portion having, for example, one or more modifications and / or mutations such as point mutations, deletions, or mutations described herein, such as mutations for improving stability.

[0122] The embodiments of the present invention can be freely combined with each other if they are not mutually exclusive.

[0123] Any feature or combination of features described herein is included within the scope of the invention, provided that the features included in any such combination do not contradict each other in a manner that is evident from the context, this specification, and the knowledge of those skilled in the art. Further advantages and aspects of the invention are evident in the following detailed description and claims.

[0124] The features and advantages of the present invention will become apparent from the consideration of the following detailed description presented in conjunction with the accompanying drawings. [Brief explanation of the drawing]

[0125] [Figure 1] Figure 1 shows a schematic diagram of an example of a large-sequence pan-coronavirus recombinant vaccine composition. Each large sequence in the recombinant vaccine composition may contain an epitope. CD8+ T cell epitopes are shown as squares, CD4+ T cell epitopes as circles, and B cell epitopes as diamonds. Each shape (square, circle, or diamond) may represent a variety of different epitopes and is not limited to a single epitope. Multi-epitope pan-coronavirus vaccines are not limited to specific combinations of large sequences as shown. Large-sequence pan-coronavirus vaccines may contain a variety of large sequences.

[0126] [Figure 2A] Figure 2A shows an evolutionary comparison of genome sequences between betacoronavirus strains isolated from humans and animals. Phylogenetic analysis was performed between the SARS-CoV-2 strain obtained from humans (Homo sapiens (black)) and the genome sequences (SL-CoVs) of SARS-like coronaviruses from animals (Rhinolophus affinis, Rhinolophus malayanus (red)), pangolins (Malayan pangolin (blue)), civet cats (masked palm civet (green)), and camels (Dromedary camel (brown)). The included SARS-CoV / MERS-CoV strains were obtained from previous outbreaks (from humans (Urbani, MERS-CoV, OC43, NL63, 229E, HKU1 genotype-B), bats (WIV16, WIV1, YNLF-31C, Rs672 recombinant), camels (Dromedary camels (KT368891.1, MN514967.1, KF917527.1, NC_028752.1), and civets (Civet007, A022, B039)). Human SARS-CoV-2 genome sequences have been reported from six continents.

[0127] [Figure 2B] Figure 2B shows an evolutionary analysis comparing human-SARS-CoV-2 genome sequences reported from six continents with SARS-CoV-2 genome sequences obtained from bats (Rhinolophus affinis, Rhinolophus malayanus) and pangolins (Malayan pangolin).

[0128] [Figure 3A] Figure 3A shows that the lungs, heart, kidneys, intestines, brain, and testes express ACE2 receptors and are targeted by the SARS-CoV-2 virus. The SARS-CoV-2 virus docks to the angiotensin-converting enzyme 2 (ACE2) receptor via its spike surface protein.

[0129] [Figure 3B] Figure 3B shows the systems biological analysis techniques used in the present invention.

[0130] [Figure 4] Figure 4 shows sequence homology analysis of SARS-CoV-2, common cold (CoV) strains, MERS, SARS-CoV-Urbani, and animal CoVs, and SARS-CoV-2 Wuhan strain (query strain, hCoV-19 / batYN01). Five fragments of the SARS-CoV-2 genome were found to be highly conserved (1 bp to 1580 bp (fragment 1), 3547 bp to 12830 bp (fragment 2), 17472 bp to 21156 bp (fragment 3), 22584 bp to 24682 bp (fragment 4), and 26193 bp to 27421 bp (fragment 5)).

[0131] [Figure 5] Figure 5 shows the sequence homology analysis of fragment 1 (1 bp to 1580 bp), which includes a portion of ORF1a / b. The query sequence (hCoV-19 / batYN01 from 1 to 1580 bp) was BLAST against all SARS-CoV-2 VOCs, human CoV strains, and CoV strains derived from bats, pangolins, and civet cats. Twenty-eight variants / strains with significant homology to this queried region were found.

[0132] [Figure 6] Figure 6 shows the sequence homology analysis of fragment 2 (3547 bp to 12830 bp). The query sequence (hCoV-19 / batYN01 from 3547 to 12830 bp) was BLAST against all SARS-CoV-2 VOCs, human CoV strains, and CoV strains from bats, pangolins, and civet cats. Thirty variants / strains with significant homology to this queried region were found.

[0133] [Figure 7]Figure 7 shows the sequence homology analysis of fragment 3 (17472 bp to 21156 bp). The query sequence (hCoV-19 / batYN01 from 17472 to 21156 bp) was BLAST against all SARS-CoV-2 VOCs, human CoV strains, and CoV strains from bats, pangolins, and civet cats. Twenty-nine variants / strains with significant homology to this queried region were found.

[0134] [Figure 8] Figure 8 shows the sequence homology analysis of fragment 4 (22584 bp–24682 bp) containing the spike protein. The query sequence (hCoV-19 / batYN01 from 22584–24682 bp) was BLAST against all SARS-CoV-2 VOCs, human CoV strains, and CoV strains from bats, pangolins, and civet cats. Twenty-nine variants / strains with significant homology to this queried region were found.

[0135] [Figure 9] Figure 9 shows the sequence homology analysis of fragment 5 (26193 bp to 27421 bp). The query sequence (hCoV-19 / batYN01 from 26193 to 27421 bp) was BLAST against all SARS-CoV-2 VOCs, human CoV strains, and CoV strains derived from bats, pangolins, and civet cats. Thirty-one variants / strains with significant homology to this queried region were found.

[0136] [Figure 10]Figure 10 shows sequence homology analysis to screen for conservation of candidate human CD8+ T cell epitopes derived from SARS-CoV-2. It shows a comparison of sequence homology of candidate CD8+ T cell epitopes among 81,963 SARS-CoV-2 strains (currently circulating in 190 countries across six continents), four major "cold" coronaviruses that caused previous outbreaks (e.g., hCoV-OC43, hCoV-229E, hCoV-HKU1 genotype B, and hCoV-NL63), and SL-CoVs isolated from bats, civet cats, pangolins, and camels. The epitope sequences highlighted in yellow exhibit a high degree of homology among the 81,963 currently circulating SARS-CoV-2 strains, as described herein, as well as at least 50% conservation between two or more human SARS-CoV strains from previous outbreaks and SL-CoV strains isolated from bats, civet cats, pangolins, and camels. Homo sapiens - black, bats (Rhinolophus affinis, Rhinolophus malayanus - red), pangolins (Malayan pangolin - blue), civet cats (masked palm civet - green), and camels (Dromedary camel - brown).

[0137] [Figure 11A] Figure 11A shows the docking of highly conserved SARS-CoV-2-derived human CD8+ T cell epitopes to HLA-A*02:01 molecules, for example, the docking of 27 high-affinity CD8+ T cell binder peptides to the grooves of HLA-A*02:01 molecules.

[0138] [Figure 11B] Figure 11B shows a summary of the interaction similarity scores of 27 high-affinity CD8+ T cell epitope peptides to the HLA-A*02:01 molecule, determined by protein-peptide molecule docking analysis. The black column indicates CD8+ T cell epitope peptides with high interaction similarity scores.

[0139] [Figure 12A] Figure 12A shows an experimental design demonstrating that CD8+ T cells are specific to highly conserved SARS-CoV-2 epitopes detected in COVID-19 patients and unexposed healthy controls. PBMCs were isolated from HLA-A*02:01-positive COVID-19 patients (n=30) and unexposed healthy controls (n=10) and stimulated overnight with 10 μM each of 27 SARS-CoV-2-derived CD8+ T cell epitopes. The number of IFN-γ-producing cells was quantified using the ELISpot assay.

[0140] [Figure 12B] Figure 12B shows the results from Figure 12A. The dotted line represents the threshold for evaluating the relative magnitude of the response. An average SFC between 25 and 50 corresponds to a moderate / severe response, while an average SFC > 50 defines a strong response.

[0141] [Figure 12C] Figure 12C shows the results obtained from experiments in which PBMCs derived from HLA-A*02:01-positive COVID-19 patients were further stimulated for 5 hours in the presence of mAbs specific to CD107a and CD107b, as well as Golgi-plug and Golgi-stop. Subsequently, spike epitope-specific tetramer, CD107a / b, CD69, and TNF- expression were measured by FACS. Representative FACS plots showing the frequencies of tetramer+CD8+T cells, CD107a / b+CD8+T cells, CD69+CD8+T cells, and TNF-+CD8+T cells after priming in groups of four spike CD8+ T cell epitope peptides. Mean frequencies of tetramer+CD8+T cells, CD107a / b+CD8+T cells, CD69+CD8+T cells, and TNF-+CD8+T cells.

[0142] [Figure 13A]Figure 13A shows the timeline of immunization and immunological analysis for an experiment to test the immunogenicity of genome-wide identified human SARS-CoV-2 CD8+ T epitopes in HLA-A*02:01 / HLA-DRB1 dual transgenic mice. Eight groups (n=3) of age-matched HLA-A*02:01 transgenic mice were subcutaneously immunized on days 0 and 14 with a mixture of four SARS-CoV-2-derived human CD8+ T cell peptide epitopes mixed with a PADRE CD4+ T helper epitope, delivered in alum and CpG1826 adjuvant. As a negative control, mice were administered only the adjuvant (pseudoimmunization).

[0143] [Figure 13B] Figure 13B shows the gating method used to characterize spleen-derived CD8+ T cells. Lymphocytes were identified by low forward scattering (FSC) and low side scattering (SSC) gating. Singlet cells were selected by plotting forward scattering area (FSC-A) versus forward scattering height (FSC-H). CD8-positive cells were then gated by the expression of CD8 and CD3 markers.

[0144] [Figure 13C] Figure 13C shows representative ELISpot images (left panel) and mean frequency (right panel) of IFN-γ producing cell spots from splenocytes (10⁶ cells / well) stimulated for 48 hours with 10 μM of 10 immunodominant CD8+ T cell peptides and 1 subdominant CD8+ T cell peptide, out of a total pool of 27 CD8+ T cell peptides derived from SARS-CoV-2 structural and non-structural proteins. The numbers on each ELISpot image represent the number of IFN-γ producing spot-forming T cells (SFCs) per million splenocytes.

[0145] [Figure 13D]Figure 13D shows representative FACS plots (left panel) and mean frequencies (right panel) of IFN-γ and TNF- production, as well as CD107a / b and CD69 expression, from a total pool of 27 CD8+ T cell peptides derived from SARS-CoV-2 structural and non-structural proteins, as determined by FACS. This includes 10 immunodominant CD8+ T cell peptides and 1 subdominant CD8+ T cell peptide. The numbers indicate the frequencies of IFN-γ+CD8+ T cells, CD107+CD8+ T cells, CD69+CD8+ T cells, and TNF-+CD8+ T cells detected in three immunized mice.

[0146] [Figure 14] Figure 14 shows that the SARS-CoV / SARS-CoV-2 genome encodes two large non-structural genes, ORF1a (green) and ORF1b (gray), which encode 16 non-structural proteins (NSP1-NSP16). This genome encodes at least six accessory proteins (light gray) that are unique to SARS-CoV / SARS-CoV-2 in terms of number, genomic composition, sequence, and function. Common SARS-CoV, SARS-CoV-2, and SL-CoV-derived human B (blue), CD4+ (green), and CD8+ (black) T cell epitopes are shown. The structural and non-structural open reading frames used in this experiment were derived from the SARS-CoV-2-Wuhan-Hu-1 strain (NCBI accession number MN908947.3, SEQ ID NO: 1). Using various computational algorithms described herein, the amino acid sequences of SARS-CoV-2-Wuhan-Hu-1 structural and non-structural proteins were screened for human B, CD4+, and CD8+ T cell epitopes. Highly conserved across human and animal coronaviruses, the genome-wide identified SARS-CoV-2 human B cell epitopes (blue), CD4+ T cell epitopes (green), and CD8+ T cell epitopes (black) are shown.

[0147] [Figure 15]Figure 15 shows the identification of highly conserved candidate human CD4+ T cell epitopes derived from SARS-CoV-2 that bind with high affinity to the HLA-DR molecule. From a total of 9,594 candidate HLA-DR-restricted CD4+ T cell epitopes from the whole genome sequence of SARS-CoV-2-Wuhan-Hu-1 strain (MN908947.3), 16 epitopes that bind with high affinity to the HLA-DRB1 molecule were selected. The conservation of these 16 CD4+ T cell epitopes was analyzed among human and animal coronaviruses. A comparison of the sequence homology of 16 CD4+ T cell epitopes is shown among 81,963 SARS-CoV-2 strains (currently circulating across six continents), four major "cold" coronaviruses that caused previous outbreaks (i.e., hCoV-OC43, hCoV-229E, hCoV-HKU1, and hCoV-NL63), and SL-CoVs isolated from bats, civet cats, pangolins, and camels. The epitope sequences highlighted in green show a high degree of homology among the 81,963 currently circulating SARS-CoV-2 strains, as described in Materials and Methods, as well as at least 50% conservation between two or more human SARS-CoV strains from previous outbreaks and SL-CoV strains isolated from bats, civet cats, pangolins, and camels. Homo sapiens - black, bats (Rhinolophus affinis, Rhinolophus malayanus - red), pangolins (Malayan pangolin - blue), civet cats (masked palm civet - green), and camels (Dromedary camel - brown).

[0148] [Figure 16A]Molecular docking of highly conserved SARS-CoV-2 CD4+ T cell epitopes to the HLA-DRB1 molecule. Molecular docking of 16 CD4+ T cell epitopes conserved among human SARS-CoV-2 strains, earlier human SARS / MERS-CoV, and bat SL-CoVs to the groove of the HLA-DRB1 protein crystal structure (PDB accession number: 4UQ3) was determined using the GalaxyPepDock server. The 16 CD4+ T cell epitopes are indiscriminately limited to the HLA-DRB1*01:01, HLA-DRB1*11:01, HLA-DRB1*15:01, HLA-DRB1*03:01, and HLA-DRB1*04:01 alleles. CD4+ T cell peptides are shown in sphere and rod structures, with the HLA-DRB1 protein crystal structure as a template. Prediction accuracy is estimated from a linear model, which is the relationship between the percentage of correctly predicted binding site residues and template-target similarity measured by the protein structure similarity score (TM score) and the interaction similarity score (SInter) obtained by linear regression. SInter indicates the similarity of amino acids in the CD8+ T cell peptide aligned to the contact residues in the amino acids of the HLA-DRB1 template structure.

[0149] [Figure 16B] Figure 16B shows a histogram representing the interaction similarity scores of CD4+ T cell-specific epitopes observed from protein-peptide molecule docking analysis.

[0150] [Figure 17A] Figure 17A shows an experimental design demonstrating that CD4+ T cells are specific to highly conserved SARS-CoV-2 epitopes detected in COVID-19 patients and unexposed healthy controls. PBMCs were isolated from HLA-DRB1-positive COVID-19 patients (n=30) and unexposed healthy controls (n=10) and stimulated for 48 hours with 10 μM of each of 16 SARS-CoV-2-derived CD4+ T cell epitopes. The number of IFN-producing cells was quantified using the ELISpot assay.

[0151] [Figure 17B] Figure 17B shows the results from Figure 17A. The dotted line represents the threshold for evaluating the relative magnitude of the response. An average SFC between 25 and 50 corresponds to a moderate / severe response, while an average SFC > 50 defines a strong response. PBMCs derived from HLA-DRB1-positive COVID-19 patients.

[0152] [Figure 17C] Figure 17C shows the results of further stimulation for 5 hours in the presence of mAbs specific to CD107a and CD107b, as well as Golgi-plug and Golgi-stop. Subsequently, tetramer, CD107a / b, and CD69, as well as TNF-alpha expression, specific to the two spike epitopes, were measured by FACS. A representative FACS plot shows the frequency of tetramer+CD4+T cells, CD107a / b+CD4+T cells, CD69+CD4+T cells, and TNF-+CD4+T cells after priming with the two spike CD4+ T cell epitope peptide groups. The mean frequencies for tetramer+CD4+T cells, CD107a / b+CD4+T cells, CD69+CD4+T cells, and TNF-+CD4+T cells are shown.

[0153] [Figure 18A] Figure 18A shows the timeline of immunization and immunological analysis to test the immunogenicity of genome-wide identified human SARS-CoV-2 CD4+ T epitopes in HLA-A*02:01 / HLA-DRB1 dual transgenic mice. Four groups (n=3) of age-matched HLA-DRB1 transgenic mice were subcutaneously immunized on days 0 and 14 with a mixture of four SARS-CoV-2-derived human CD4+ T cell peptide epitopes delivered in alum and CpG1826 adjuvants. As a negative control, mice were administered only the adjuvant (pseudoimmunization).

[0154] [Figure 18B]Figure 18B shows the gating method used to characterize spleen-derived CD4+ T cells. CD4-positive cells were gated using CD4 and CD3 expression markers.

[0155] [Figure 18C] Figure 18C shows representative ELISpot images (left panel) and mean frequency (right panel) of IFN-γ producing cell spots from splenocytes (10⁶ cells / well) stimulated for 48 hours with 7 immunodominant CD4+ T cell peptides and 1 subdominant CD4+ T cell peptide at 10 μM concentrations, out of a total pool of 16 CD4+ T cell peptides derived from SARS-CoV-2 structural and non-structural proteins. The number of IFN-γ producing spot-forming T cells (SFCs) per million total cells is shown at the top of each ELISpot image.

[0156] [Figure 18D] Figure 18D shows representative FACS plots (left panel) and mean frequencies (right panel) of IFN-γ and TNF-α production, as well as CD107a / b and CD69 expression, from a total pool of 16 CD4+ T cell peptides derived from SARS-CoV-2, as determined by FACS. These figures represent the proportions of IFN-γ+CD4+T cells, CD107+CD4+T cells, CD69+CD4+T cells, and TNF-α+CD4+T cells detected in three immunized mice.

[0157] [Figure 19]Figure 19 shows the preservation of spike-derived B cell epitopes in human, bat, civet cats, pangolin, and camel coronavirus strains, i.e., multiple sequence alignments performed using ClustalW in 29 strains of SARS coronavirus (SARS-CoV) obtained from humans, bats, civets, pangolins, and camels.This includes seven human SARS / MERS-CoV strains (SARS-CoV-2-Wuhan (MN908947.3), SARS-HCoV-Urbani (AY278741.1), CoV-HKU1-Genotype B (AY884001), CoV-OC43 (KF923903), CoV-NL63 (NC005831), CoV-229E (KY983587), MERS (NC019843)) and eight bat SARS-CoV strains (BAT-SL-CoV-WIV16 (KT444582), BAT-SL -CoV-WIV1(KF367457.1), BAT-SL-CoV-YNLF31C(KP886808.1), BAT-SARS-CoV-RS672(FJ588686.1), BAT-CoV-RATG13(MN996532.1), BAT- CoV-YN01 (EPIISL412976), BAT-CoV-YN02 (EPIISL412977), BAT-CoV-19-ZXC21 (MG772934.1), and three civet SARS-CoV strains (SARS-CoV-Civet007). (AY572034.1), SARS-CoV-A022(AY686863.1), SARS-CoV-B039(AY686864.1)), nine pangolin SARS-CoV strains (PCoV-GX-P2V(MT072864.1), PCoV-G X-P5E (MT040336.1), PCoV-GX-P5L (MT040335.1), PCoV-GX-P1E (MT040334.1), PCoV-GX-P4L (MT040333.1), PCoV-MP789 (MT084071.1), PC This includes oV-GX-P3B (MT072865.1), PCoV-Guangdong-P2S (EPIISL410544), PCoV-Guangdong (EPIISL410721), four camel SARS-CoV strains (camel-CoV-HKU23 (KT368891.1), DcCoV-HKU23 (MN514967.1), MERS-CoV-Jeddah (KF917527.1), Riyadh / RY141 (NC028752.1)), and one recombinant strain (FJ211859.1). Regions highlighted in blue indicate sequence homology.Candidate epitopes were selected that are B cell epitopes that exhibit at least 50% conservation among two or more strains of SARS coronavirus, or that have receptor-binding domain (RBD) specific amino acids.

[0158] [Figure 20A] Figure 20A shows the docking of SARS-CoV-2 spike glycoprotein-derived B cell epitopes to the human ACE2 receptor, for example, the molecular docking of 22 B cell epitopes identified from the SARS-CoV-2 spike glycoprotein to the ACE2 receptor. The B cell epitope peptides are shown in ball and stick structures, with the ACE2 receptor protein as the template. The S471-501 and S369-393 peptide epitopes have receptor-binding domain region-specific amino acid residues. Predictive accuracy is estimated from a linear model, which is the relationship between the percentage of correctly predicted binding site residues and template-target similarity measured by the protein structure similarity score and the interaction similarity score (SInter) obtained by linear regression. SInter indicates the amino acid similarity of B cell peptides aligned to contact residues in the amino acids of the ACE2 template structure. A higher SInter score represents a more significant binding affinity between the ACE2 molecule and the B cell peptides.

[0159] [Figure 20B] Figure 20B shows a summary of the interaction similarity scores of 22 B cell-specific epitopes observed from protein-peptide molecule docking analysis. B cell epitopes with high interaction similarity scores are shown in black.

[0160] [Figure 21A]Figure 21A shows the timeline of immunization and immunological analysis of a test to demonstrate that IgG antibodies are specific to SARS-CoV-2 spike protein-derived B cell epitopes in immunized B6 mice and convalescent COVID-19 patients. A total of 22 SARS-CoV-2-derived B cell epitope peptides selected from the SARS-CoV-2 spike protein and tested in B6 mice were able to induce an antibody response. Four groups (n=3) of age-matched B6 mice were subcutaneously immunized on days 0 and 14 with a mixture of 4 or 5 SARS-CoV-2-derived B cell peptide epitopes emulsified in alum and CpG1826 adjuvant. Alum / CpG1826 adjuvant alone was used as a negative control (pseudoimmunization).

[0161] [Figure 21B] Figure 21B shows the frequency of IgG-producing CD3(-)CD138(+)B220(+) plasma B cells in the spleen of immunized mice determined by flow cytometry. For example, Figure 21B shows that the gating method was as follows: Lymphocytes were identified by low forward scattering (FSC) and low side scattering (SSC) gates. Singlet cells were selected by plotting forward scattering area (FSC-A) versus forward scattering height (FSC-H). B cells were then gated by the expression of CD3(-) and B220(+) cells to confirm CD138 expression on plasma B cells.

[0162] [Figure 21C] Figure 21C shows the frequency of IgG-producing CD3(-)CD138(+)B220(+) plasma B cells in the spleen of immunized mice, determined by flow cytometry. For example, FG15C shows representative FACS plots (left panel) and mean frequencies (right panel) of plasma B cells detected in the spleen of immunized mice. The percentage of plasma CD138(-)B220(+) B cells is shown in the upper left of each dot plot.

[0163] [Figure 21D]Figure 21D shows the quantification of SARS-CoV-2-derived B cell epitope-specific IgG response in immunoserum 14 days after the second immunization (i.e., day 28) using ELISpot (number of IgG(+) spots). Representative ELISpot images (left panel) and mean frequency (right panel) of antipeptide-specific IgG-producing B cell spots (1 × 10⁶ splenocytes / well) after 4 days of in vitro polyclonal stimulation of B cells with mouse Poly-S (Immunospot). The top / left of each ELISpot image shows the number of IgG-producing B cells per 500,000 cells. ELISA plates were coated with each individual immunization peptide.

[0164] [Figure 21E] Figure 21E shows the B-cell epitope-specific IgG concentration (μg / mL) measured by ELISA in peptide-immunized B6 mice after subtracting background levels measured from sham-vaccinated mice. The dashed horizontal line indicates the detection limit.

[0165] [Figure 21F] Figure 21F shows the B-cell epitope-specific IgG concentrations (μg / mL) measured by ELISA at IgG levels specific to each of the 22 spike peptides detected in SARS-CoV-2 infected patients (n=40), after subtracting background levels measured from healthy, unexposed individuals (n=10). [Figure 21G] Figure 21G shows the B-cell epitope-specific IgG concentrations (μg / mL) measured by ELISA at levels of IgG specific to each of the 22 spike peptides detected in SARS-CoV-2 infected patients (n=40), after subtracting background levels measured from healthy, unexposed individuals (n=10). Black and gray bars represent highly immunogenic and moderately immunogenic B-cell peptides, respectively. Dashed horizontal lines indicate the detection limit.

[0166] [Figure 22]Figure 22 shows an example of the entire spike protein containing mutations including six proline mutations. The six proline mutations include single point mutations F817P, A892P, A899P, A942P, K986P, and V987P. In addition, the spike protein contains the 682-QQAQ-685 mutation at the fulin cleavage site for protease resistance. In some embodiments, the K986P and V987P mutations enable perfusion stabilization. Figure 22 also shows the following sequences, namely MFVFLVLLPLVSS (SEQ ID NO: 188), ATGTTCGTGTTCCTGGTGCTGCTGCCCCTGGTGAGCAGC (SEQ ID NO: 175), CAGCAGGCCCAG (SEQ ID NO: 189), and CCCCCC (SEQ ID NO: 190).

[0167] [Figure 23] Figure 23 shows a non-limiting example of how a large array of the compositions described herein may be arranged.

[0168] [Figure 24] Figure 24 shows a schematic diagram of the prototype coronavirus vaccine of the present invention. The present invention is not limited to the prototype coronavirus vaccine shown.

[0169] [Figure 25A] Figure 25A shows a non-limiting example of a method for delivering the vaccine composition described herein in humans using a "prime / pull" regimen. This method comprises administering a pan-coronavirus recombinant vaccine composition and further administering at least one T-cell attracting chemokine (e.g., CXCL11) after administration of the pan-coronavirus recombinant vaccine composition.

[0170] [Figure 25B]Figure 25B shows a non-limiting example of a method for delivering the vaccine composition described herein in humans using a “prime / boost” regimen. This method includes administering a dose of the first composition, e.g., a first pan-coronavirus recombinant vaccine composition, using a first delivery system, and further administering a dose of the second composition, e.g., a second vaccine composition, using a second delivery system. In some embodiments, the first and second delivery systems are different.

[0171] [Figure 25C] Figure 25C shows a non-limiting example of a method for delivering the vaccine composition described herein to increase the size and persistence of lung commensal B cells, CD4+ T cells, and CD8+ T cells in humans using a “prime / pull / keep” regimen to increase maintenance and protect against SARS-CoV-2. The method comprises administering a pan-coronavirus recombinant vaccine composition and administering at least one T cell attracting chemokine (e.g., CXCL11 or CXCL17) after administration of the pan-coronavirus recombinant vaccine composition.

[0172] [Figure 25D] Figure 25D shows a non-limiting example of a method for delivering the vaccine composition described herein to increase the size and persistence of lung commensal B cells, CD4+ T cells, and CD8+ T cells in humans using a "prime / pull / boost" regimen to increase maintenance and protect against SARS-CoV-2. The method comprises administering a pan-coronavirus recombinant vaccine composition and administering at least one T cell attracting chemokine (e.g., CXCL11 or CXCL17) after administration of the pan-coronavirus recombinant vaccine composition. The method further comprises administering at least one cytokine after administration of the T cell attracting chemokine (e.g., IL-7, IL-5, or IL-2).

[0173] [Figure 26A]Figure 26A shows a non-limiting example of a method for delivering the vaccine composition described herein using a "prime / pull" regimen in livestock (e.g., cats or dogs). This method comprises administering a pan-coronavirus recombinant vaccine composition and further administering at least one T-cell attracting chemokine (e.g., CXCL11) after administration of the pan-coronavirus recombinant vaccine composition.

[0174] [Figure 26B] Figure 26B shows a non-limiting example of a method for delivering the vaccine composition described herein using a “prime / boost” regimen in livestock (e.g., cats or dogs). This method includes administering a first composition, e.g., a dose of a first pan-coronavirus recombinant vaccine composition, using a first delivery system, and further administering a second composition, e.g., a dose of a second vaccine composition, using a second delivery system. In some embodiments, the first and second delivery systems are different.

[0175] [Figure 26C] Figure 26C shows a non-limiting example of a method for delivering the vaccine composition described herein to protect against SARS-CoV-2 by increasing the size and persistence of lung commensal B cells, CD4+ T cells, and CD8+ T cells using a “prime / pull / keep” regimen in livestock (e.g., cats or dogs). The method comprises administering a pan-coronavirus recombinant vaccine composition and administering at least one T cell attracting chemokine (e.g., CXCL11 or CXCL17) after administration of the pan-coronavirus recombinant vaccine composition.

[0176] [Figure 26D]Figure 26D shows a non-limiting example of a method for delivering the vaccine composition described herein to increase the size and persistence of lung commensal B cells, CD4+ T cells, and CD8+ T cells in livestock (e.g., cats or dogs) using a "prime / pull / boost" regimen to protect against SARS-CoV-2. The method comprises administering a pan-coronavirus recombinant vaccine composition and administering at least one T cell attracting chemokine (e.g., CXCL11 or CXCL17) after administration of the pan-coronavirus recombinant vaccine composition. The method further comprises administering at least one cytokine after administration of the T cell attracting chemokine (e.g., IL-7, IL-5, or IL-2).

[0177] term Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art in the field to which the disclosed invention pertains. The singular terms “a,” “an,” and “the” include plural referents unless the context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. The term “comprising” means that other elements may be present in addition to the defined elements presented. The use of “comprising” indicates inclusion, not limitation. In other words, the term “comprising” means “primarily including, but not necessarily required.” Furthermore, variations of the word “comprising,” such as “comprise” and “comprises,” have correspondingly the same meaning. In some respects, the art described herein relates to the compositions, methods, and their respective components described herein as essential to the invention, but is open to including unspecified elements, whether essential or not ("comprising").

[0178] Appropriate methods and materials for carrying out and / or testing embodiments of the embodiments of this disclosure are described below. Such methods and materials are illustrative and not intended to limit the scope. Other methods and materials similar or equivalent to those described herein may be used. For example, conventional methods well known in the art relating to this disclosure include, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, 1989; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Press, 2001; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates, 1992 (and supplement in 2000); Ausubel et al., Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology, 4th ed., Wiley & Sons, 1999; Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1990; and Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999; and Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, Calif.), ``Guide to Protein Purification'' in Methods in Enzymology (MP Deutshcer, ed., (1990) Academic Press, Inc.), PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), Culture of Animal Cells: A Manual of Basic Technique, 2. nd Various general and more specific references, such as Ed. (RIFreshney, 1987, Liss, Inc., New York, NY), Gene Transfer and Expression Protocols, pp. 109–128, ed. EJ Murray, The Humana Press Inc., Clifton, NJ), and the Ambion 1998 Catalog (Ambion, Austin, Tex.), are included herein by reference.

[0179] The disclosed technology can be carried out or tested using methods and materials similar or equivalent to those described herein, but suitable methods and materials are listed below. The materials, methods, and examples are illustrative and not intended to limit the scope of the disclosed technology.

[0180] As used herein, the terms “immunogenic protein, polypeptide, or peptide” or “antigen” refer to a polypeptide or other molecule (or a combination of polypeptides and other molecules) that, when administered to a host, is immunologically active in the sense that it can induce humoral and / or cellular immune responses to a protein. In some embodiments, a protein fragment has substantially the same immunological activity as the total protein. Thus, a protein fragment according to this disclosure may contain, be essentially, or consist of at least one epitope or antigenic determinant. As used herein, “immunogenic” protein or polypeptide may include the full-length sequence of a protein, its analogues, or an immunogenic fragment thereof. “Immunogenic fragment” refers to a fragment of a protein that contains one or more epitopes and thereby induces the immunological response described above.

[0181] Synthetic antigens, such as polyepitopes, adjacent epitopes, and other recombinant or synthetically derived antigens, are also included in this definition. Immunogenic fragments in this disclosure may be characterized by at least about 1 amino acid, at least about 3 amino acids, at least about 5 amino acids, at least about 10 to 15 amino acids, or about 15 to 25 amino acids or more of a molecule. There is no critical upper limit to the length of the fragment, and it may consist of nearly the entire length of a protein sequence, or the entire length of a protein sequence, or even a fusion protein containing at least one epitope of a protein.

[0182] As used herein, the term “epitope” refers to a site on an antigen or hapten to which specific B cells and / or T cells respond. This term is also used interchangeably with “antigenic determinant” or “antigenic determinant site.” Antibodies that recognize the same epitope can be identified by a simple immunoassay demonstrating the ability of one antibody to block the binding of another antibody to its target antigen.

[0183] As used herein, the term “immunological response” to a composition or vaccine refers to the occurrence of a cellular and / or antibody-mediated immune response in a host to the composition or vaccine of interest. Typically, “immunological response” includes, but is not limited to, one or more of the following effects: production of antibodies specifically directed to one or more antigens contained in the composition or vaccine of interest, production of B cells, production of helper T cells, and / or production of cytotoxic T cells. The host may exhibit either a therapeutic or protective immunological response, thereby enhancing resistance to new infections and / or reducing the clinical severity of the disease. Such protection is manifested by either a reduction or absence of symptoms typically exhibited by an infected host, a faster recovery time, and / or a decrease in viral titers in the infected host.

[0184] As used herein, the term "variant" refers to a substantially similar sequence. In the case of a polynucleotide, a variant comprises deletion and / or addition and / or substitution of one or more nucleotides at one or more sites within the native polynucleotide, and / or substitution of one or more nucleotides at one or more sites within the native polynucleotide. As used herein, a "native" polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. Variants of a particular polynucleotide of the present disclosure (e.g., a reference polynucleotide) can be assessed by comparing percent sequence identity between the polypeptide encoded by the variant polynucleotide and the polypeptide encoded by the reference polynucleotide. A "variant" protein is intended to mean a protein derived from a native protein by deletion or addition of one or more amino acids at one or more sites in the native protein, and / or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the present disclosure are biologically active, that is, they have the ability to elicit an immune response.

[0185] The HLA-DR / HLA-A*0201 / hACE2 triple transgenic mouse model referred to herein is a novel susceptible animal model for preclinical trials of human COVID-19 vaccine candidates obtained by crossing ACE2 transgenic mice with unique HLA-DR / HLA-A*0201 double transgenic mice. The ACE2 transgenic mouse is an hACE2 transgenic mouse model expressing the human ACE2 receptor in the lungs, heart, kidneys, and intestines (Jackson Laboratory, Bar Harbor, ME). The HLA-DR / HLA-A*0201 double transgenic mouse is a “humanized” HLA double transgenic mouse expressing the human leukocyte antigens HLA-A*0201 class I and HLA-DR*0101 class II instead of the corresponding mouse MHC molecule (knocked out). The HLA-A*0201 haplotype was selected because it is highly representative (over 50%) in the human population, regardless of race or ethnicity. The HLA-DR / HLA-A*0201 / hACE2 triple transgenic mouse model is a "humanized" transgenic mouse model with three advantages: (1) susceptibility to human SARS-CoV-2 infection, (2) developing symptoms similar to those seen in human COVID-19, and (3) CD4 against human epitopes. + T cells and CD8 + The present invention has the ability to develop a T cell response. The novel HLA-DR / HLA-A*0201 / hACE2 triple transgenic mouse model can be used in preclinical trials for the safety, immunogenicity, and prophylactic efficacy of the human multiepitope COVID-19 vaccine candidate of the present invention.

[0186] As used herein, the term "treating", "treat" or "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, the objectives of which are to prevent or delay the onset of a disease, for example, to delay the onset of a disorder, or to alleviate at least one adverse effect or symptom of a condition, disease or disorder, for example, any disorder characterized by insufficient or undesirable organ or tissue function. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced as the term is defined herein. Alternatively, treatment is "effective" if the progression of a disease is slowed or stopped. That is, "treatment" includes not only amelioration of symptoms or reduction of disease markers, but also stopping or slowing the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, whether detectable or undetectable, diminishment of the extent of a disease, stabilization (i.e., not worsening) of the disease state, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total). "Treatment" may also mean prolonging survival as compared to expected survival if not receiving treatment. "Treatment" also includes ameliorating the disease, reducing the severity of its complications, preventing its occurrence, preventing its recurrence, simply preventing its worsening, alleviating the inflammatory response involved therein, or includes therapeutic efforts that affect any of the foregoing even if such therapeutic efforts ultimately fail.

[0187] As used herein, the term "carrier", "pharmaceutically acceptable carrier" or "pharmaceutically acceptable vehicle" refers to any suitable or useful carrier or vehicle for introducing a composition into a subject. A pharmaceutically acceptable carrier or vehicle can be, but is not limited to, a conventional vehicle. See, for example, E.W. Martin, Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 15th Edition (1975), and D.B. Troy, ed. Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore MD and Philadelphia, PA, 21 stEdition (2006) describes compositions and formulations suitable for the pharmaceutical delivery of one or more therapeutic compounds or molecules. Carriers (e.g., pharmaceutical carriers, pharmaceutical vehicles, pharmaceutical compositions, pharmaceutical molecules, etc.) are materials generally known to deliver molecules, proteins, cells and / or drugs and / or other suitable materials into the body. Generally, the properties of the carrier depend on the properties of the composition to be delivered and the specific mode of administration used. In addition to a biologically neutral carrier, the pharmaceutical composition to be administered may contain small amounts of non-toxic auxiliary substances such as wetting agents or emulsifiers, preservatives and pH buffers. Patents describing pharmaceutical carriers include, but are not limited to, U.S. Patents 6,667,371, 6,613,355, 6,596,296, 6,413,536, 5,968,543, 4,079,038, 4,093,709, 4,131,648, 4,138,344, 4,180,646, 4,304,767, and 4,946,931, the disclosures of which are incorporated herein by reference in their entirety. The carrier may be, for example, a solid, a liquid (e.g., a solution), a foam, a gel, or a combination thereof. In some embodiments, the carrier includes a biological matrix (e.g., biological fibers). In some embodiments, the carrier includes a synthetic matrix (e.g., synthetic fibers). In certain embodiments, part of the support may include a biological matrix, and part may include a synthetic matrix.

[0188] As used herein, “coronavirus” may refer to, but is not limited to, a group of viruses including severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS), and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). All coronaviruses cause respiratory infections in mammals ranging from mild to fatal. Several non-exclusive examples of coronavirus strains are described herein.

[0189] As used herein, “Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)” is the beta-coronavirus that causes coronavirus disease 19 (COVID-19).

[0190] "Subject" refers to an individual and includes, but is not limited to, mammals (e.g., humans, horses, pigs, rabbits, dogs, sheep, goats, non-human primates, cattle, cats, guinea pigs, or rodents), fish, birds, reptiles, or amphibians. This term does not indicate a specific age or sex. Therefore, it is intended to include adult and newborn subjects, as well as fetuses (whether male or female). "Patient" refers to a subject suffering from a disease or disorder. The term "patient" includes human and veterinary subjects.

[0191] The terms "administer" and "dosage" refer to methods of providing a pharmaceutical preparation to a subject. Such methods are well known to those skilled in the art and are not limited thereto, but include administering the composition orally, parenterally (e.g., intravenously and subcutaneously), by intramuscular injection, intraperitoneal injection, intrathecal, percutaneously, extracorporeally, or topically.

[0192] The composition may also be administered by topical intranasal administration (intranasal) or by inhalation. As used herein, “topical intranasal administration” means delivery of the composition to the nose and nasal cavity through one or both nostrils, and may include delivery by a spray mechanism (device) or droplet mechanism (device), or by aerosolization of the composition. Inhalation of the composition may be done through the nose or mouth via delivery by spray or droplet mechanism. As used herein, “inhaler” may be a spray or droplet device for delivering a composition containing the vaccine composition in a pharmaceutically acceptable carrier to the nasal cavity and upper and / or lower respiratory tract of a subject. Delivery may also be done directly to any area of ​​the respiratory system (e.g., lungs) via endotracheal intubation. The exact amount of the composition required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the disorder being treated, the specific composition used, and its mode of administration. Therefore, it is not possible to specify an exact amount for each composition. However, those skilled in the art can determine the appropriate amount using only routine experiments, taking into account the teachings herein.

[0193] The composition may also be administered by buccal or sublingual delivery. As used herein, “buccal delivery” may refer to a method of administration in which the compound is delivered through the mucous membrane covering the inside of the cheek. In some embodiments, for buccal delivery, the vaccine composition is placed between the patient's gums and cheek. As used herein, “sublingual delivery” may refer to a method of administration in which the compound is delivered through the mucous membrane beneath the tongue. In some embodiments, for sublingual delivery, the vaccine composition is administered under the patient's tongue.

[0194] Parenteral administration of this composition, when used, is generally characterized by injection. Injectable preparations can be prepared in any of the conventional forms, namely liquid solutions or suspensions, solid forms suitable for dissolution in a suspension in a liquid before injection, or emulsions. More recently revised approaches for parenteral administration involve the use of sustained-release or sustained-release systems to maintain a constant dose. See, for example, U.S. Patent No. 3,610,795, incorporated herein by reference. [Modes for carrying out the invention]

[0195] Prior to disclosing and describing the compounds, compositions, and / or methods of the present invention, it should be understood that the present invention is not limited to any particular synthesis method or composition, and therefore may naturally be different. It should also be understood that the terms used herein are intended solely to describe and not to limit any particular embodiment. Embodiments of the present invention can be freely combined with each other if they are not mutually exclusive.

[0196] Pan-coronavirus vaccine The present invention features a pioneering pan-coronavirus vaccine, methods of use, methods for manufacturing the vaccine, and methods for preventing coronavirus infection. The present invention also provides methods for testing the vaccine, for example, using specific animal models and clinical trials. The vaccine compositions herein can induce efficient and potent protection against coronavirus disease or infection, for example, by inducing the production of antibodies (Ab), CD4+ T helper (Th1) cells, and CD8+ cytotoxic T cells (CTLs).

[0197] The vaccine composition, for example, the antigens herein, are characterized by multiple large sequences that may contain multiple conserved epitopes, which help provide multiple opportunities for the body to produce an immune response to prevent infection. Furthermore, the vaccines herein may be designed to be effective against past, present, and future coronavirus pandemics.

[0198] This vaccine composition contains multiple large sequences. In certain embodiments, the large sequences are conserved large sequences, such as those highly conserved among human coronaviruses and / or animal coronaviruses (e.g., coronaviruses isolated from animals susceptible to coronavirus infections).

[0199] This invention describes the identification of conserved large sequences including B cell epitopes, CD4+ T cell epitopes, and CD8+ T cell epitopes. For example, Figure 1 shows multiple B cell epitopes and multiple conserved CD8+ T cell epitopes. + This diagram outlines the development of a pioneering pan-coronavirus vaccine featuring multiple conserved large sequences, including T cell epitopes and multiple CD4+ T cell epitopes. These large sequences are derived from sequence analyses of numerous coronaviruses.

[0200] The coronaviruses used to determine the conserved large sequences may include human SARS-CoV and animal CoVs (e.g., bats, pangolins, civet cats, mink, camels, etc.) as described herein. As an example, Figures 2A and 2B show an evolutionary comparison of genomic sequences between betacoronavirus strains isolated from humans and animals. Figure 2A shows a phylogenetic analysis performed between the SARS-CoV-2 strain obtained from humans (Homo sapiens (black)) and the genomic sequences (SL-CoVs) of animal SARS-like coronaviruses obtained from bats (Rhinolophus affinis, Rhinolophus malayanus (red)), pangolins (Malayan pangolin (blue)), civet cats (masked palm civet (green)), and camels (Dromedary camel (brown)). The included SARS-CoV / MERS-CoV strains were obtained from previous outbreaks (human (Urbani, MERS-CoV, OC43, NL63, 229E, HKU1 genotype-B), bat (WIV16, WIV1, YNLF-31C, Rs672 recombinant), camel (Dromedary camel (KT368891.1, MN514967.1, KF917527.1, NC_028752.1), and civet (Civet007, A022, B039)). Human SARS-CoV-2 genome sequences have been reported from six continents. Figure 2B shows the human-SARS-CoV-2 genome sequences reported from the six continents and bat (Rhinolophus affinis, Rhinolophus) This shows an evolutionary analysis performed between SARS-CoV-2 genome sequences obtained from *Pangolina malayanus* and pangolins (Malayan pangolin).

[0201] Furthermore, other coronaviruses may be used to determine conserved large sequences (including human SARS-CoV and animal CoVs (e.g., bats, pangolins, civet cats, mink, camels, etc.)) that meet the criteria for being classified as “variants of concern” or “variants of interest.” Coronavirus variants that appear to meet one or more of the following criteria may be classified as “variants of interest” or “variants under investigation,” with verification and validation of these characteristics pending. In some embodiments, these criteria may include increased infectivity, increased morbidity, increased mortality, increased risk of “long-term COVID,” ability to evade detection by diagnostic tests, decreased susceptibility to antiviral drugs (if such drugs are available), decreased susceptibility to neutralizing antibodies (e.g., convalescent plasma or monoclonal antibodies) in either therapeutic or laboratory experiments, ability to evade innate immunity (e.g., causing reinfection), ability to infect vaccinated individuals, increased risk of certain conditions such as multisystem inflammatory syndrome or long-term COVID, or increased affinity for certain demographic or clinical groups such as children or immunocompromised individuals. Once a variant of interest has been identified, it is renamed "mutant of concern" by monitoring organizations such as the CDC.

[0202] The conserved large sequences may originate from coronavirus structural proteins (e.g., spike glycoprotein, envelope protein, membrane protein, nucleoprotein) or non-structural proteins (e.g., any of the 16 NSPs encoded by ORF1a / b).

[0203] In some embodiments, the large sequences are highly conserved among one or a combination of the following: human SARS-CoV-2 strains, SL-CoVs isolated from bats, SL-CoVs isolated from pangolins, SL-CoVs isolated from civet cats, and MERS strains isolated from camels. For example, in certain embodiments, the large sequences are highly conserved among at least 50,000 human SARS-CoV-2 strains, five SL-CoVs isolated from bats, five SL-CoVs isolated from pangolins, three SL-CoVs isolated from civet cats, and four MERS strains isolated from camels, or a combination of these. In certain embodiments, each large sequence is conserved among at least 80,000 human SARS-CoV-2 strains, five SL-CoVs isolated from bats, five SL-CoVs isolated from pangolins, three SL-CoVs isolated from civet cats, and four MERS strains isolated from camels, or a combination thereof. In certain embodiments, each large sequence is highly conserved among at least 50,000 human SARS-CoV-2 strains circulating during this COVID-19 pandemic, at least one CoV that caused a previous human outbreak, five SL-CoVs isolated from bats, five SL-CoVs isolated from pangolins, three SL-CoVs isolated from civet cats, and four MERS strains isolated from camels, or a combination thereof. In certain embodiments, the large sequences are highly conserved among at least one currently circulating human SARS-CoV-2 strain, at least one CoV that caused a previous human outbreak, at least one SL-CoV isolated from bats, at least one SL-CoV isolated from pangolins, at least one SL-CoV isolated from civet cats, and at least one MERS strain isolated from camels.In certain embodiments, each large sequence is highly conserved among at least 1,000 currently circulating human SARS-CoV-2 strains, at least 2 CoVs that caused previous human outbreaks, at least 2 SL-CoVs isolated from bats, at least 2 SL-CoVs isolated from pangolins, at least 2 SL-CoVs isolated from civet cats, and at least 2 MERS strains isolated from camels. In certain embodiments, each large sequence is highly conserved among at least 1 currently circulating human SARS-CoV-2 strain, at least 1 CoV that caused previous human outbreaks, at least 1 SL-CoV isolated from bats, at least 1 SL-CoV isolated from pangolins, at least 1 SL-CoV isolated from civet cats, and at least 1 MERS strain isolated from camels, or a combination thereof. The present invention is not limited to the above coronavirus strains that may be used to identify conserved large sequences.

[0204] In certain embodiments, one or more conserved large sequences are derived from one or more currently circulating human SARS-CoV-2 strains or variants, one or more coronaviruses that caused previous human outbreaks, one or more coronaviruses isolated from animals selected from a group consisting of bats, pangolins, civet cats, mink, camels, and other animals that are receptive to coronaviruses, or one or more coronaviruses that cause the common cold. Currently circulating human SARS-CoV-2 strains and variants may include the original SARS-CoV-2 strain (SARS-CoV-2 isolate Wuhan-Hu-1), as well as several variants of SARS-CoV-2, including, but not limited to, Spanish strain B.1.177, Australian strain B.1.160, British strain B.1.1.7, South African strain B.1.351, Brazilian strain P.1, Californian strain B.1.427 / B.1.429, Scottish strain B.1.258, Belgian / Netherlands strain B.1.221, Norwegian / French strain B.1.367, Norwegian / Denmark / UK strain B.1.1.277, Swedish strain B.1.1.302, North American, European, Asian, African, and Australian strains B.1.525, and New York strain B.1.526. The present invention is not limited to the aforementioned SARS-CoV-2 variants and includes variants to be identified in the future. One or more coronaviruses that cause the common cold include, but are not limited to, the 229E strain (alpha coronavirus), the NL63 strain (alpha coronavirus), the OC43 strain (beta coronavirus), and the HKU1 strain (beta coronavirus).

[0205] As used herein, the term “conserved” refers to a large sequence that is among the most highly conserved large sequences identified by sequence alignment and analysis. For example, a conserved large sequence may be two of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be three of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be four of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be five of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be six of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be seven of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be eight of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be nine of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be ten of the most highly conserved sequences identified. In some embodiments, a conserved large sequence may be fifteen of the most highly conserved sequences identified. In some embodiments, the conserved large sequence may be the 20 most highly conserved sequences identified. In some embodiments, the conserved large sequence may be the 25 most highly conserved sequences identified. In some embodiments, the conserved large sequence may be the 30 most highly conserved sequences identified. In some embodiments, the conserved large sequence may be the 40 most highly conserved sequences identified. In some embodiments, the conserved large sequence may be the 50 most highly conserved sequences identified. In some embodiments, the conserved sequence may be 50% of the most highly conserved large sequences identified. In some embodiments, the conserved large sequence may be 60% of the most highly conserved sequences identified. In some embodiments, the conserved sequence may be 70% of the most highly conserved sequences identified.In some embodiments, the conserved large sequences may be the top 80% of the most highly conserved sequences identified. In some embodiments, the conserved large sequences may be the top 90% of the most highly conserved sequences identified. In some embodiments, the conserved large sequences may be the top 95% of the most highly conserved sequences identified. In some embodiments, the conserved large sequences may be the top 99% of the most highly conserved sequences identified. The present invention is not limited to the aforementioned thresholds.

[0206] Figure 3A shows an example of the systems biological approach used in the present invention.

[0207] In some embodiments, the composition comprises one or more large sequences. In some embodiments, the one or more large sequences comprise one or more conserved coronavirus B-cell target epitopes, one or more conserved coronavirus CD4 + T-cell target epitopes, and at least one of one or more conserved coronavirus CD8 + T-cell target epitopes.

[0208] In other embodiments, the vaccine composition comprises two or more large sequences. In some embodiments, the two or more large sequences comprise one or more conserved coronavirus B-cell target epitopes, one or more conserved coronavirus CD4 + T-cell target epitopes, and at least one of one or more conserved coronavirus CD8 + T-cell target epitopes.

[0209] In some embodiments, the large sequence comprises one or more conserved coronavirus B-cell target epitopes and one or more conserved coronavirus CD4 + T-cell target epitopes. In some embodiments, the large sequence comprises one or more conserved coronavirus B-cell target epitopes and one or more conserved coronavirus CD8 +The large sequence includes a T cell target epitope. In some embodiments, the large sequence includes one or more conserved coronavirus CD8 + Target epitope and one or more preserved coronavirus CD4 + The large sequence includes a T cell target epitope. In some embodiments, the large sequence includes one or more conserved coronavirus CD8 + It contains a target epitope. In some embodiments, the large sequence contains one or more conserved coronavirus CD4 + It contains a target epitope. In some embodiments, the large sequence contains one or more conserved coronavirus B cell target epitopes.

[0210] In some embodiments, the vaccine composition contains one or more stored coronavirus CD8 + Contains a targeted epitope. In some embodiments, the vaccine composition contains one or more preserved coronavirus CD4 + It contains a targeted epitope. In some embodiments, the vaccine composition contains one or more conserved coronavirus B cell targeted epitopes.

[0211] As discussed herein, in certain embodiments, the vaccine composition comprises a whole spike protein, one or more coronavirus CD4+ T cell targeting epitopes, and one or more coronavirus CD8+ T cell targeting epitopes. In certain embodiments, the vaccine composition comprises at least a portion of the spike protein (for example, a portion comprising a trimerized SARS-CoV-2 receptor-binding domain (RBD)), one or more coronavirus CD4+ T cell targeting epitopes, and one or more coronavirus CD8+ T cell targeting epitopes. In some embodiments, one or more coronavirus CD4+ T cell targeting epitopes and one or more coronavirus CD8+ T cell targeting epitopes may be in the form of large sequences.

[0212] Each large sequence can be separated by a linker. In certain embodiments, the linker allows the enzyme to cleave between the large sequences. The present invention is not limited to a particular linker or a particular length of linker. For example, in certain embodiments, one or more large sequences can be separated by a 2-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 3-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 4-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 5-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 6-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 7-amino acid length linker. In certain embodiments, one or more large sequences can be separated by an 8-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 9-amino acid length linker. In certain embodiments, one or more large sequences can be separated by a 10-amino acid length linker. In certain embodiments, one or more large sequences may be separated by linkers with a length of 2 to 10 amino acids.

[0213] Linkers are well known to those skilled in the art. Non-limiting examples of linkers include AAY, KK, and GPGPG.

[0214] Large sequences can originate from structural proteins, non-structural proteins, or combinations thereof. For example, structural proteins may include spike proteins (S), envelope proteins (E), membrane proteins (M), or nucleoproteins (N).

[0215] In some embodiments, the large sequence is derived from at least one SARS-CoV-2 protein. The SARS-CoV-2 protein may include ORF1ab protein, spike glycoprotein, ORF3a protein, envelope protein, membrane glycoprotein, ORF6 protein, ORF7a protein, ORF7b protein, ORF8 protein, nucleocapsid protein, and ORF10 protein. The ORF1ab protein forms non-structural proteins (Nsp) such as Nsp1, Nsp2, Nsp3 (papain-like protease), Nsp4, Nsp5 (3C-like protease), Nsp6, Nsp7, Nsp8, Nsp9, Nsp10, Nsp11, Nsp12 (RNA polymerase), Nsp13 (5' RNA triphothphatase enzyme), Nsp14 (guanosine N7-methyltransferase), Nsp15 (endoribonuclease), and Nsp16 (2'-O-ribose-methyltransferase).

[0216] SARS-CoV-2 has an ssRNA (SEQ ID NO: 1) with a genome length of 29,903 base pairs (bps). Generally, the region between 266 and 21555 bps encodes the ORF1ab polypeptide, the region between 21563 and 25384 bps encodes one of the structural proteins (spike protein or surface glycoprotein), the region between 25393 and 26220 bps encodes the ORF3a gene, the region between 26245 and 26472 bps encodes an envelope protein, and the region between 26523 and 27191 encodes a membrane glycoprotein (or membrane protein). The region between 27202 and 27387 bps codes for the ORF6 gene, the region between 27394 and 27759 bps codes for the ORF7a gene, the region between 27894 and 28259 bps codes for the ORF8 gene, the region between 28274 and 29533 bps codes for the nucleocapsid phosphoprotein (or nucleocapsid protein), and the region between 29558 and 29674 bps codes for the ORF10 gene.

[0217] The large sequences may include T cell epitopes limited to a large number of human class 1 and class 2 HLA haplotypes, not limited to HLA-0201 for class 1, or not limited to HLA-DR for class 2. The conserved large sequences may be limited to human HLA class 1 and 2 haplotypes. In some embodiments, the conserved epitopes are limited to feline and canine MHC class 1 and 2 haplotypes.

[0218] Large array Antigens may include large sequences, such as conserved large sequences that are highly conserved among human and animal coronaviruses. As used herein, the term large sequence refers to a sequence having at least 25 amino acids or at least 75 nucleotides. Large sequences include epitopes, such as the conserved epitopes described herein.

[0219] To identify the conserved large sequences, sequence alignment and analysis were performed as described herein and below.

[0220] Sequence comparison between SARS-CoV-2 strains and previous coronavirus strains: Sequence homology analysis was performed to compare the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) isolate Wuhan-Hu-1 with SARS-CoV-2 variants, common cold coronavirus strains (HKU1 genotype B, CoV-OC43, CoV-NL63, and CoV-229E), SARS-CoV-Urbani, MERS, and coronavirus strains derived from bats (Rhinolophus affinis and R. malayanus), pangolins (Malayan pangolin), civet cats (masked palm civet), and camels (dromedary and Bactrian camels) to complete the genomes.

[0221] We searched the GISAID database for human SARS-CoV-2 variant genome sequences representing major concern variants known for their high infectivity and pathogenicity. The sequences used in this experiment were 20A.EU1 from Spain (EPI_ISL_691726-hCoV-19-VOC-20A.EU1), 20A.EU2 from Australia (EPI_ISL_418799-hCoV-19-VOC-20A.EU2), B.1.1.7 from the UK (EPI_ISL_581117-hCoV-19-VOC-B.1.1.7), B.1.351 from South Africa (EPI_ISL_660615-hCoV-19-VOC-B.1.351), P.1 from Brazil (EPI_ISL_581117-hCoV-19-VOC-P.1), and CAL.20C from California (EPI_ISL_730092-hCoV- These include B.1.427 / B.1.429), B.1.258 (EPI_ISL_858559-hCoV-19-VOC-B.1.258) of Scottish origin, B.1.221 (EPI_ISL_734790-hCoV-19-VOC-B.1.221) of Belgian / Netherlandish origin, B.1.367 (EPI_ISL_541518-hCoV-19-VOC-B.1.367) of Norwegian / French origin, B.1.1.277 (EPI_ISL_500783-hCoV-19-VOC-B.1.1.277) of Dutch / Denmark / United Kingdom origin, and B.1.1.302 (EPI_ISL_717929-hCoV-19-VOC-B.1.1.302) of Swedish origin. Similarly, these include HKU1 genotype B (AY884001), CoV-OC43 (KF923903), CoV-NL63 (NC_005831), and CoV-229E (KY983587), SARS-CoV-Urbani (AY278741.1), and MERS (NC_019843).

[0222] The bat CoV strains used in this analysis include RaTG13 (MN996532.2), Rs672 / 2006 (FJ588686.1), YNLF_31C (KP886808.1), WIV1 (KF367457.1), WIV16 (KT444582.1), ZXC21 (MG772934.1), RmYN02 (EPI_ISL_412977), bat-RmYN01 (EPI_ISL_412976), and MERS-Bat-CoV / P.khulii / Italy / 206645-63 / 2011 (MG596803.1). Furthermore, five genome sequences representing pangolins (MT040333.1-PCoV_GX-P4L, MT040334.1-PCoV_GX-P1E, MT040335.1-PCoV_GX-P5L, MT040336.1-PCoV_GX-P5E, MT072864.1-PCoV_GX-P2V, MT121216.1-PCoV-MP789), and three civet cat genome sequences were also identified. Allegorical genome sequences (AY572034.1, AY686864.1, AY686863.1) and four camel-derived CoV sequences (NC_028752.1, KF917527.1, MN514967.1, KT368891.1) were included in this sequence homology analysis, which aimed to evaluate the most conserved regions in different structural and non-structural proteins within the CoV genome. These sequences were obtained from either the National Center for Biotechnology Information (NCBI) or the Global initiative on sharing all influenza data (GISAID). For phylogenetic analysis, the SARS-CoV-2 whole genome sequence was aligned with CLUSTAL W using MEGAX. All SARS-CoV-2 sequences were compared to existing genomes using online NCBI BLAST.

[0223] Determination of SARS-CoV-2 sequence conservation: Each Wuhan-Hu-1 (GeneBank:NC_045512.2) specific structure (spike glycoprotein (YP_009724390.1), membrane protein (YP_009724393.1), envelope protein (YP_009724392.1), nucleocapsid phosphoprotein (YP_009724397.2)), as well as non-structural proteins (ORF1a / b polyprotein (YP_009724389.1), ORF3a (YP_009724391.1), ORF6 (YP_009 The protein sequences of ORF7a (YP_009724395.1), ORF7b (YP_009725318.1), ORF8 (YP_009724396.1), and ORF10 (YP_009725255.1)) were compared with consensus protein sequences from SARSCoV and MERS-CoV, as well as protein sequences from the nearest relative heterologous CoV strain, using the nucleotide BLAST (blastn) algorithm to calculate pairwise identity between the Wuhan-Hu-1 protein and their comparison targets.

[0224] Furthermore, since the present invention is interested in sequences that are very similar across CoV strains, a megablast was performed. For each queried sequence, the query range, E value, and identity percentage were determined. The queried homology obtained for one bat CoV strain, RmYN01, which was previously found to be less phylogenetically similar to SARS-CoV-2 but more genetically similar to SARS-CoV-Urbani, was used as a standard for confirming homologous sequences across CoV strains. This method was useful in finding how genetically more conserved a region is between different CoVs. This sequence has a 59% query range and a 78.73% identity percentage when compared to the SARS-CoV-2 genome sequence. It has five matching regions that further showed sequence homology among other CoVs. Matching region 1, spanning between 1 bp and 1580 bp (fragment), showed sequence homology with nsp1 (leader protein), nsp2, and nsp3, while matching region 2, spanning between 3547 bp and 7096 bp (fragment 2), showed sequence homology with multiple subunits of ORF1a / b, such as 3CLpro, nsp6, nsp7, nsp8, nsp9, nsp10, RNA-dependent RNA polymerase, helicase, nsp14, nsp15, and nsp16. Interestingly, the major region spanning the unannotated region of ORF1a / b between 17472 bp and 21156 bp (fragment 3) also showed sequence identity. A fourth stretch of sequence identity spanned 22584 bp to 24682 bp (fragment 4), covering a section of the spike glycoprotein, which, importantly, also covers the major receptor-binding domain in SARS-CoV-2. The final segment of the homologous sequence showed percent identity with regions specific to ORF3a, envelope proteins, membrane proteins, ORF6, and ORF7a (26193 bp to 27421 bp, fragment 5).

[0225] In some embodiments, five fragments derived from the SARS-CoV-2 Wuhan strain were found to be highly conserved (1 bp to 1580 bp (fragment 1), 3547 bp to 12830 bp (fragment 2), 17472 bp to 21156 bp (fragment 3), 22584 bp to 24682 bp (fragment 4), and 26193 bp to 27421 bp (fragment 5)). Each fragment was then subjected to sequence homology analysis once more.

[0226] In some embodiments, the vaccine composition contains one large sequence. In some embodiments, the vaccine composition contains one or more large sequences. In some embodiments, the vaccine composition contains two or more large sequences. In some embodiments, the vaccine composition contains three or more large sequences. In some embodiments, the vaccine composition contains four or more large sequences. In some embodiments, the vaccine composition contains five or more large sequences (e.g., five, six, seven, eight, etc.).

[0227] In some embodiments, the large sequence is derived from the whole protein sequence expressed by SARS-CoV-2. In other embodiments, the large sequence is derived from a partial protein sequence expressed by SARS-CoV-2. In some embodiments, the large sequence of the protein is not limited to HLA-0201 of class 1 or HLA-DR1 of class 2, as it includes B cell epitopes and T cell epitopes limited to a number of human class 1 and class 2 HLA haplotypes (e.g., 3 to 10, different haplotypes encompassing 100% of the population regardless of race and ethnicity).

[0228] As mentioned above, large sequences may be highly conserved among human and animal coronaviruses. In some embodiments, the large sequence is derived from one or more currently circulating human SARS-CoV-2 strains or variants, one or more coronaviruses that caused previous human outbreaks, one or more coronaviruses isolated from animals selected from a group consisting of bats, pangolins, civet cats, mink, camels, and other animals that accept coronaviruses, and / or one or more coronaviruses that cause the common cold, or a combination thereof.

[0229] As mentioned above, currently circulating SARS-CoV-2 human strains or variants include strains B.1.177, B.1.160, B.1.1.7, B.1.351, P.1, B.1.427 / B.1.429, B.1.258, B.1.221, B.1.367, B.1.1.277, B.1.1.302, B.1.525, B.1.526, S:677H, and S:677P. Coronaviruses that cause the common cold can be selected from 229E alpha-coronavirus, NL63 alpha-coronavirus, OC43 beta-coronavirus, and HKU1 beta-coronavirus.

[0230] Large sequences may originate from structural proteins, non-structural proteins, or combinations thereof. Large sequences may be selected from ORF1ab protein, spike glycoprotein (e.g., RBD), ORF3a protein, envelope protein, membrane glycoprotein, ORF6 protein, ORF7a protein, ORF7b protein, ORF8 protein, nucleocapsid protein, and / or ORF10 protein. Note that ORF1ab protein includes non-structural proteins (Nsp)1, Nsp2, Nsp3, Nsp4, Nsp5, Nsp6, Nsp7, Nsp8, Nsp9, Nsp10, Nsp11, Nsp12, Nsp13, Nsp14, Nsp15, and Nsp16.

[0231] In some embodiments, the large sequence contains conserved fragments derived from over 150,000 CoV strains prevalent in the vast majority of countries worldwide (Table 1, Figure 4). In some embodiments, fragment 1 contains base pairs 1–1580. In some embodiments, fragment 1 may contain proteins Nsp1, Nsp2, and Nsp3, as well as a non-annotation region (Figure 5). In some embodiments, fragment 2 contains base pairs 3547–12830. In some embodiments, fragment 2 may contain proteins Nsp5, Nsp6, Nsp7, Nsp8, Nsp9, Nsp10, Nsp11, Nsp12, Nsp13, Nsp14, Nsp15, Nsp16, as well as a non-annotation region (Figure 6). In some embodiments, fragment 3 contains base pairs 17472–21156. In some embodiments, fragment 3 contains a non-annotation region (Figure 7). In some embodiments, fragment 4 contains base pairs 22584–24682. In some embodiments, fragment 4 contains a spike glycoprotein (Figure 8). In some embodiments, fragment 5 contains base pairs 26193–27421. In some embodiments, fragment 5 contains protein ORF3a, envelope (E), membrane (M), ORF6, ORF7a, and a non-annotation region (Figure 9).

[0232] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0233] In some embodiments, the larger array is not limited to the saved fragments described above.

[0234] In certain embodiments, the large sequence includes spike glycoprotein (S) or a portion thereof (e.g., RBD), nucleoprotein or a portion thereof, membrane protein or a portion thereof, and / or ORF1a / b or a portion thereof (see Table 9, SEQ ID NO: 139). In certain embodiments, the large sequence includes spike glycoprotein (S) or a portion thereof (e.g., RBD), nucleoprotein or a portion thereof, and ORF1a / b or a portion thereof. In further embodiments, the large sequence includes spike glycoprotein (S) or a portion thereof (e.g., RBD), and nucleocapsid protein or a portion thereof (see Table 9, SEQ ID NO: 140).

[0235] As discussed herein, in certain embodiments, the vaccine composition comprises a whole spike protein, one or more coronavirus CD4+ T cell target epitopes, and one or more coronavirus CD8+ T cell target epitopes. In certain embodiments, the vaccine composition comprises at least a portion of the spike protein (for example, a portion comprising a trimerized SARS-CoV-2 receptor-binding domain (RBD)), one or more coronavirus CD4+ T cell target epitopes, and one or more coronavirus CD8+ T cell target epitopes. In some embodiments, one or more coronavirus CD4+ T cell target epitopes and one or more coronavirus CD8+ T cell target epitopes are in the form of large sequences.

[0236] In some embodiments, the large sequence is derived from the full-length spike glycoprotein. In other embodiments, the large sequence is derived from a portion of the spike glycoprotein. In some embodiments, the transmembrane anchor of the spike protein has an intact S1-S2 cleavage site. In some embodiments, the spike protein is in its stabilized conformation. In some embodiments, the spike protein is stabilized by proline substitution at amino acid positions 986 and 987 above the central helix in the S2 subunit. In some embodiments, the composition comprises a SARS-CoV-2 receptor-binding domain (RBD). In some embodiments, the composition comprises a trimerized SARS-CoV-2 receptor-binding domain (RBD). In some embodiments, the trimerized SARS-CoV-2 receptor-binding domain (RBD) sequence is modified by the addition of a Foldon trimerized domain derived from T4 fibrintin. In some embodiments, the addition of a Foldon trimerized domain derived from T4 fibrintin increases immunogenicity by multivalent display.

[0237] In some embodiments, the spike protein comprises Tyr-489 and Asn-487 (for example, Tyr-489 and Asn-487 facilitate interaction with Tyr83 and Gln-24 on ACE-2). In some embodiments, the spike protein comprises Gln-493 (for example, Gln-493 facilitates interaction with Glu-35 and Lys-31 on ACE-2). In some embodiments, the spike protein comprises Tyr-505 (for example, Tyr-505 facilitates interaction with Glu-37 and Arg-393 on ACE-2). In some embodiments, the composition comprises a mutation at the S1-S2 cleavage site 682-RRAR-685 → 682-QQAQ-685.

[0238] In some embodiments, the spike protein containing the large sequence contains at least one proline substitution. In some embodiments, the spike protein containing the large sequence contains at least two proline substitutions. For example, the proline substitutions may be at the K986 and V987 positions.

[0239] Table 2 discloses non-restrictive examples of sequences. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

[0240] As mentioned above, each of the large sequences is separated by a linker. In some embodiments, the linkers are the same E-linker. In some embodiments, one or more linkers are different. For example, in some embodiments, different linkers are used between each of the large sequences. As mentioned above, non-limiting examples of linkers include T2A, E2A, P2A, etc.

[0241] As described above, in certain embodiments, the vaccine delivery system includes, but is not limited to, adenoviruses such as Ad5, Ad26, and Ad35, as well as carriers such as lipid nanoparticles, polymers, and peptides.

[0242] CD8+ Epitope This specification describes examples of methods for identifying candidate CD8+ T cell epitopes and screening their conservation. The present invention is not limited to the specific software system disclosed, and other software systems are accessible to those skilled in the art for such methods. The present invention is not limited to the specific haplotypes used herein. For example, those skilled in the art may select alternative molecules (e.g., HLA molecules) for molecular docking experiments.

[0243] Figure 10 shows a comparison of sequence homology of CD8+ T cell epitope candidates among 81,963 SARS-CoV-2 strains (currently circulating in 190 countries across 6 continents), four major "cold" coronaviruses that caused previous outbreaks (e.g., hCoV-OC43, hCoV-229E, hCoV-HKU1 genotype B, and hCoV-NL63), and SL-CoVs isolated from bats, civet cats, pangolins, and camels, for sequence homology analysis to screen for conservation of CD8+ T cell epitope candidates. The epitope sequences highlighted in yellow demonstrate a high degree of homology among the 81,963 currently circulating SARS-CoV-2 strains, as well as at least 50% conservation between two or more human SARS-CoV strains from previous outbreaks and SL-CoV strains isolated from bats, civet cats, pangolins, and camels.

[0244] Analysis revealed that 27 CD8+ T cell epitopes were selected as highly conserved. Figures 11A and 11B show the docking of HLA-A*02:01 molecules into the grooves of the conserved epitopes, as well as the interaction scores determined by protein-peptide molecule docking analysis.

[0245] Figures 12A, 12B, and 12C show that CD8+ T cells specific to several highly conserved SARS-CoV-2 epitopes disclosed herein were detected in COVID-19 patients and unexposed healthy individuals. Figures 13A, 13B, 13C, and 13D show the immunogenicity of the identified SARS-CoV-2 CD8+ T cell epitopes.

[0246] The above CD8 + As for T cell target epitopes, S 2-10 S 1220-1228 S 1000-1008 S 958-966 , E 20-28 ORF1ab 1675-1683 ORF1ab 2363-2371 ORF1ab 3013-3021 ORF1ab 3183-3191 ORF1ab 5470-5478 ORF1ab 6749-6757 ORF7b 26-34 ORF8a 73-81 ORF10 3-11 and ORF10 5-13 These are examples. Figure 14 shows the location of the epitope throughout the genome. Thus, in certain embodiments, the vaccine composition is S 2-10 S 1220-1228 S 1000-1008 S 958-966 , E 20-28 ORF1ab 1675-1683 ORF1ab 2363-2371 ORF1ab 3013-3021 ORF1ab 3183-3191 ORF1ab 5470-5478 ORF1ab 6749-6757 ORF7b 26-34 ORF8a 73-81 ORF10 3-11 ORF10 5-13 , or one or more CD8 selected from a combination thereof + It may contain T cell epitopes. Table 3 below lists the sequences of the aforementioned epitope regions. [Table 3-1] [Table 3-2]

[0247] The present invention relates to the aforementioned CD8 + The present invention is not limited to T cell epitopes. For example, the present invention also applies to the aforementioned CD8 + Mutants to T cell epitopes, such as the aforementioned CD8 + This also includes sequences in which the T cell epitope is cleaved by a single amino acid (examples shown in Table 4 below). [Table 4-1] [Table 4-2]

[0248] The present invention relates to the aforementioned CD8 + It is not limited to T cell epitopes.

[0249] In certain embodiments, the vaccine composition contains 1 to 10 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 2 to 10 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 2 to 15 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 2 to 20 CD8 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 2 to 30 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 2 to 15 CD8 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 2 to 5 CD8 + It contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 10 CD8 +It contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 15 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 5 to 20 CD8 + It contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 25 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 5 to 30 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 10 to 20 CD8 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 10 to 30 CD8 + Includes T cell target epitopes.

[0250] CD4+ Epitope This specification describes examples of methods for identifying candidate CD4+ T cell epitopes and screening their conservation. The present invention is not limited to the specific software system disclosed, and other software systems are accessible to those skilled in the art for such methods. The present invention is not limited to the specific haplotypes used herein. For example, those skilled in the art may select alternative molecules (e.g., HLA molecules) for molecular docking experiments.

[0251] Figure 15 shows the identification of highly conserved candidate human CD4+ T cell epitopes derived from SARS-CoV-2 that bind with high affinity to the HLA-DR molecule. From a total of 9,594 candidate HLA-DR-restricted CD4+ T cell epitopes from the whole genome sequence of SARS-CoV-2-Wuhan-Hu-1 strain (MN908947.3), 16 epitopes that bind with high affinity to the HLA-DRB1 molecule were selected. The conservation of these 16 CD4+ T cell epitopes was analyzed among human and animal coronaviruses. The image shows a comparison of sequence homology of 16 CD4+ T cell epitopes among 81,963 SARS-CoV-2 strains (currently circulating across six continents), four major "cold" coronaviruses that caused previous outbreaks (i.e., hCoV-OC43, hCoV-229E, hCoV-HKU1, and hCoV-NL63), and SL-CoVs isolated from bats, civet cats, pangolins, and camels. Epitope sequences highlighted in green show a high degree of homology among the 81,963 currently circulating SARS-CoV-2 strains, as well as at least 50% conservation between two or more human SARS-CoV strains from previous outbreaks and SL-CoV strains isolated from bats, civet cats, pangolins, and camels.

[0252] Analysis revealed that 16 CD4+ T cell epitopes were selected as highly conserved. Figures 16A and 16B show the docking of HLA-A*02:01 molecules into the grooves of the conserved epitopes, as well as the interaction scores determined by protein-peptide molecule docking analysis.

[0253] Figures 17A, 17B, and 17C show that CD4+ T cells specific to several highly conserved SARS-CoV-2 epitopes disclosed herein were detected in COVID-19 patients and unexposed healthy individuals. Figures 18A, 18B, 18C, and 18D show the immunogenicity of the identified SARS-CoV-2 CD4+ T cell epitopes.

[0254] The above CD4 + ORF1a is a T cell target epitope. 1350-1365 ORF1ab 5019-5033 ORF6 12-26 ORF1ab 6088-6102 ORF1ab 6420-6434 ORF1a 1801-1815 S 1-13 , E 26-40 , E 20-34 M 176-190 , N 388-403 ORF7a 3-17 ORF7a 1-15 ORF7b 8-22 ORF7a 98-112 and ORF8 1-15 These include Figure 14, which shows the location of the epitope across the entire genome. Thus, in certain embodiments, the vaccine composition is ORF1a 1350-1365 ORF1ab 5019-5033 ORF6 12-26 ORF1ab 6088-6102 ORF1ab 6420-6434 ORF1a 1801-1815 S 1-13 , E 26-40 , E 20-34 M 176-190 , N 388-403 ORF7a 3-17 ORF7a 1-15 ORF7b 8-22 ORF7a 98-112 and ORF8 1-15 Or one or more CD4 selected from those combinations + It may contain T cell target epitopes. Table 5 below lists the sequences of the epitope regions mentioned above. [Table 5]

[0255] The present invention relates to the above-mentioned CD4 + The present invention is not limited to T cell epitopes. For example, the present invention also applies to the aforementioned CD4 + Mutants of T cell epitopes, such as the aforementioned CD4 +This also includes sequences in which a T cell epitope is cleaved by one or more amino acids or extended by one or more amino acids (examples shown in Table 6 below). [Table 6-1] [Table 6-2]

[0256] The present invention relates to the above-mentioned CD4 + It is not limited to T cell epitopes.

[0257] In certain embodiments, the vaccine composition contains 1 to 10 CD4 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 2 to 10 CD4 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 2 to 15 CD4 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 2 to 20 CD4 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 2 to 30 CD4 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 2 to 15 CD4 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 2 to 5 CD4 + It contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 10 CD4 + It contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 15 CD4 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 5 to 20 CD4 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 25 CD4 + Contains a T cell target epitope. In certain embodiments, the vaccine composition contains 5 to 30 CD4 +It contains a T cell target epitope. In certain embodiments, the vaccine composition contains 10 to 20 CD4 + It contains a T cell-targeting epitope. In certain embodiments, the vaccine composition contains 10 to 30 CD4 + Includes T cell target epitopes.

[0258] B-cell epitope This specification describes examples of methods for identifying candidate B cell epitopes and screening their conservation. The present invention is not limited to the specific software system disclosed, and other software systems are accessible to those skilled in the art for such methods.

[0259] Figure 19 shows the conservation of spike-derived B cell epitopes among coronavirus strains from humans, bats, civet cats, pangolins, and camels. Multiplex sequence alignment was performed using ClustalW on 29 SARS coronavirus (SARS-CoV) strains obtained from humans, bats, civet cats, pangolins, and camels.This includes seven human SARS / MERS-CoV strains (SARS-CoV-2-Wuhan (MN908947.3), SARS-HCoV-Urbani (AY278741.1), CoV-HKU1-Genotype B (AY884001), CoV-OC43 (KF923903), CoV-NL63 (NC005831), CoV-229E (KY983587), MERS (NC019843)) and eight bat SARS-CoV strains (BAT-SL-CoV-WIV16 (KT444582), BAT-SL-C oV-WIV1 (KF367457.1), BAT-SL-CoV-YNLF31C (KP886808.1), BAT-SARS-CoV-RS672 (FJ588686.1), BAT-CoV-RATG13 (MN996532.1), BAT-Co Three civet SARS-CoV strains (SARS-CoV-Civet007(A Y572034.1), SARS-CoV-A022(AY686863.1), SARS-CoV-B039(AY686864.1)), nine pangolin SARS-CoV strains (PCoV-GX-P2V(MT072864.1), PCoV-GX- P5E(MT040336.1), PCoV-GX-P5L(MT040335.1), PCoV-GX-P1E(MT040334.1), PCoV-GX-P4L(MT040333.1), PCoV-MP789(MT084071.1), PCoV This includes GX-P3B (MT072865.1), PCoV-Guangdong-P2S (EPIISL410544), PCoV-Guangdong (EPIISL410721), four camel SARS-CoV strains (Camel-CoV-HKU23 (KT368891.1), DcCoV-HKU23 (MN514967.1), MERS-CoV-Jeddah (KF917527.1), Riyadh / RY141 (NC028752.1)), and one recombinant strain (FJ211859.1). Regions highlighted in blue indicate sequence homology.Candidate epitopes were selected that are B cell epitopes that exhibit at least 50% conservation among two or more strains of SARS coronavirus, or that have receptor-binding domain (RBD) specific amino acids.

[0260] Analysis revealed that 22 B cell epitopes were selected as highly conserved. Figures 20A and 20B show the docking of the conserved epitopes to the ACE2 receptor, as well as the interaction scores determined by protein-peptide molecule docking analysis. Figures 21A, 21B, 21C, 21D, 21E, 21F, and 21G show the immunogenicity of the identified SARS-CoV-2 B cell epitopes.

[0261] The above-mentioned B cell target epitopes include S 287-317 S 524-598 S 601-640 S 802-819 S 888-909 S 369-393 S 440-501 S 1133-1172 S 329-363 S 59-81 and S 13-37 These are examples. Figure 2B shows the location of the epitope throughout the genome. Thus, in certain embodiments, the vaccine composition is S 287-317 S 524-598 S 601-640 S 802-819 S 888-909 S 369-393 S 440-501 S 1133-1172 S 329-363 S 59-81 , and S 13-37 It may include one or more B cell target epitopes selected from the following. In some embodiments, the B cell epitope is the whole spike protein. In some embodiments, the B cell epitope is a portion of the spike protein. Table 7 below lists the sequences of the epitope regions described above. [Table 7]

[0262] The present invention is not limited to the B cell epitopes described above. For example, the present invention also includes variants of the aforementioned B cell epitopes, such as sequences in which the aforementioned B cell epitopes are cleaved by one or more amino acids or extended by one or more amino acids (examples shown in Table 8 below). [Table 8-1] [Table 8-2]

[0263] As described above, in some embodiments, the B cell epitope is in the form of the whole spike protein. In some embodiments, the B cell epitope is in the form of a portion of the spike protein. In some embodiments, the transmembrane anchor of the spike protein has an intact S1-S2 cleavage site. In some embodiments, the spike protein is in its stabilized conformation. In some embodiments, the spike protein is stabilized by proline substitution at amino acid positions 986 and 987 above the central helix in the S2 subunit. In some embodiments, the composition includes a trimerized SARS-CoV-2 receptor-binding domain (RBD). In some embodiments, the trimerized SARS-CoV-2 receptor-binding domain (RBD) sequence is modified by the addition of a Foldon trimerizing domain derived from T4 fibrintin. In some embodiments, the addition of a Foldon trimerizing domain derived from T4 fibrintin increases immunogenicity by multivalent display. Figure 22 shows a non-limiting example of a spike protein containing one or more mutations.

[0264] In some embodiments, the spike protein comprises Tyr-489 and Asn-487 (for example, Tyr-489 and Asn-487 facilitate interaction with Tyr83 and Gln-24 on ACE-2). In some embodiments, the spike protein comprises Gln-493 (for example, Gln-493 facilitates interaction with Glu-35 and Lys-31 on ACE-2). In some embodiments, the spike protein comprises Tyr-505 (for example, Tyr-505 facilitates interaction with Glu-37 and Arg-393 on ACE-2). In some embodiments, the composition comprises a mutation at the S1-S2 cleavage site 682-RRAR-685 → 682-QQAQ-685.

[0265] In some embodiments, the composition includes at least one proline substitution. In some embodiments, the composition includes at least two proline substitutions. For example, the proline substitutions may be at the K986 and V987 positions.

[0266] In certain embodiments, the vaccine composition contains 1 to 10 B-cell target epitopes. In certain embodiments, the vaccine composition contains 2 to 10 B-cell target epitopes. In certain embodiments, the vaccine composition contains 2 to 15 B-cell target epitopes. In certain embodiments, the vaccine composition contains 2 to 20 B-cell target epitopes. In certain embodiments, the vaccine composition contains 2 to 30 B-cell target epitopes. In certain embodiments, the vaccine composition contains 2 to 15 B-cell target epitopes. In certain embodiments, the vaccine composition contains 2 to 5 B-cell target epitopes. In certain embodiments, the vaccine composition contains 5 to 10 B-cell target epitopes. In certain embodiments, the vaccine composition contains 5 to 15 B-cell target epitopes. In certain embodiments, the vaccine composition contains 5 to 20 B-cell target epitopes. In certain embodiments, the vaccine composition contains 5 to 25 B-cell target epitopes. In certain embodiments, the vaccine composition contains 5 to 30 B-cell target epitopes. In certain embodiments, the vaccine composition contains 10 to 20 B-cell target epitopes. In certain embodiments, the vaccine composition contains 10 to 30 B-cell target epitopes.

[0267] In certain embodiments, the selected epitope may be one that achieves outstanding scores in binding assays (e.g., for binding to HLA molecules). For example, in some embodiments, the selected epitope may have an IC50 or less in an ELISA binding assay (e.g., an ELISA binding assay specific to an HLA-DR / peptide combination, an HLA-A*0201 / peptide combination, etc.). 50 The IC score is either present or less than 250 in different binding assays. 50 It has a value equivalent to the score. The binding assay is well known to those skilled in the art.

[0268] Large array arrangement The large sequence of the composition described can be arranged in various configurations (see Figure 23). In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by an ORF1a / b protein or a portion thereof, followed by a nucleoprotein or a portion thereof. In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by an ORF1a / b protein or a portion thereof, followed by a nucleoprotein or a portion thereof, followed by a membrane (M) or a portion thereof.

[0269] In some embodiments, the large sequence may be arranged such that an ORF1a / b protein or a portion thereof is followed by a nucleoprotein (N) or a portion thereof. In some embodiments, the large sequence may be arranged such that an ORF1a / b protein or a portion thereof is followed by a nucleoprotein (N) or a portion thereof, and then by a membrane (M) or a portion thereof.

[0270] In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by fragment 1 or a portion thereof. In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by fragment 2 or a portion thereof. In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by fragment 4 or a portion thereof. In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by fragment 5 or a portion thereof. In further embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by fragment 1 or a portion thereof, and then fragment 5 or a portion thereof.

[0271] In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by a nucleocapsid protein or a portion thereof. In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by an ORF1ab protein or a portion thereof, followed by an ORF3 protein or a portion thereof, followed by an envelope protein or a portion thereof, followed by a membrane protein or a portion thereof, followed by an ORF6 protein or a portion thereof, followed by an ORF7a protein or a portion thereof. In some embodiments, the large sequence may be arranged such that a spike glycoprotein (S) or a portion thereof (e.g., RBD) is followed by a membrane protein or a portion thereof, followed by an envelope protein or a portion thereof, followed by an Nsp3 protein or a portion thereof, followed by an Nsp5 protein or a portion thereof, followed by an Nsp12 protein or a portion thereof.

[0272] In some embodiments, the large sequences may be arranged such that one large sequence follows the spike glycoprotein (S) or a part thereof (e.g., RBD). In some embodiments, the large sequences may be arranged such that two large sequences follow the spike glycoprotein (S) or a part thereof (e.g., RBD). In some embodiments, the large sequences may be arranged such that three large sequences follow the spike glycoprotein (S) or a part thereof (e.g., RBD). In some embodiments, the large sequences may be arranged such that four large sequences follow the spike glycoprotein (S) or a part thereof (e.g., RBD). In some embodiments, the large sequences may be arranged such that five large sequences follow the spike glycoprotein (S) or a part thereof (e.g., RBD).

[0273] In some embodiments, a large sequence may be arranged such that one large sequence follows a spike glycoprotein (S) or a portion thereof (e.g., RBD), and both are driven by promoters, or both are driven by a single promoter, but separated by linkers as shown in Figures x, y, and z.

[0274] Vaccine candidates As described above, the present invention provides a vaccine composition comprising an antigen characterized by one or more large sequences, two or more large sequences, three or more large sequences, four or more large sequences, or five or more large sequences. In some embodiments, the large sequences include at least one B cell epitope and at least one CD4+ T cell epitope, at least one B cell epitope and at least one CD8+ T cell epitope, at least one CD4+ T cell epitope and at least one CD8+ T cell epitope, or at least one B cell epitope, at least one CD4+ T cell epitope, and at least one CD8+ T cell epitope.

[0275] Table 9 and Figure 24 show examples of vaccine compositions described herein. The present invention is not limited to the examples in Table 9. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6] Table 9-7 Table 9-8 Table 9-9 Table 9-10 Table 9-11 Table 9-12 Table 9-13 Table 9-14 Table 9-15 Table 9-16 Table 9-17 Table 9-18 Table 9-19 Table 9-20 [Table 9-21] [Table 9-22] [Table 9-23] [Table 9-24] [Table 9-25] [Table 9-26] [Table 9-27] [Table 9-28]

[0276] As described above, the present invention is not limited to the examples in Table 9. In some embodiments, the vaccine candidate may include various elements (e.g., promoters, proteins, adjuvants) as described herein.

[0277] Table 10 shows non-limiting examples of proteins that may be used to prepare the vaccine compositions described herein. In some embodiments, the proteins listed below may be arranged in multiple combinations. In some embodiments, the proteins may be directly linked to one another. In other embodiments, the proteins are linked together via linkers.

[0278] Table 10 shows non-specific examples of spike proteins. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7] [Table 10-8] [Table 10-9] [Table 10-10]

[0279] Molecular adjuvants and T cell enhancement In certain embodiments, the vaccine composition comprises a molecular adjuvant and / or one or more T-cell enhancing compositions. The adjuvant and / or enhancing compositions help improve the immunogenicity and / or long-term memory of the vaccine composition. Non-limiting examples of molecular adjuvants include CpGs such as CpG polymers and flagellin.

[0280] In some embodiments, the vaccine composition includes a T-cell attracting chemokine. The T-cell attracting chemokine helps to draw T cells from the bloodstream to appropriate tissues, such as the lungs, heart, kidneys, and brain. Non-limiting examples of T-cell attracting chemokines include CCL5, CXCL9, CXCL10, CXCL11, CCL25, CCL28, CXCL14, CXCL17, or combinations thereof.

[0281] In some embodiments, the vaccine composition includes a composition that promotes T cell proliferation. Non-limiting examples of compositions that promote T cell proliferation include IL-7, IL-15, IL-2, or combinations thereof.

[0282] In some embodiments, the vaccine composition includes a composition that promotes T-cell homing in the lungs. Non-limiting examples of compositions that promote T-cell homing include CCL25, CCL28, CXCL14, CXCL17, or combinations thereof.

[0283] In certain embodiments, molecular adjuvants and / or T cell-attracting chemokines and / or compositions that promote T cell proliferation are delivered from a large sequence via a separate antigen delivery system.

[0284] Table 11 shows non-limiting examples of T cell enhancements that may be used to prepare the vaccine compositions described herein. [Table 11-1] [Table 11-2]

[0285] In preferred embodiments, the T cell-enhancing compositions described herein (e.g., CXCL9, CXCL10, IL-7, IL-2) may be incorporated into a delivery system separate from that of the vaccine composition. In some embodiments, the T cell-enhancing compositions described herein (e.g., CXCL9, CXCL10, IL-7, IL-2) may be incorporated into the same delivery system as the vaccine composition.

[0286] In certain embodiments, the vaccine composition includes a tag. For example, in some embodiments, the vaccine composition includes a His tag. The present invention is not limited to the His tag and includes other tags known to those skilled in the art, such as fluorescent tags (e.g., GFP, YFP, etc.).

[0287] antigen delivery system The present invention also features a vaccine composition in the form of an antigen delivery system. Any suitable antigen delivery system may be considered for the delivery of the antigen described herein. The present invention is not limited to the antigen delivery systems described herein.

[0288] In certain embodiments, the antigen delivery system is for targeted delivery of the vaccine composition, for example, to target body tissues where the virus replicates.

[0289] In certain embodiments, the antigen delivery system includes, but is not limited to, adenoviruses such as Ad5, Ad26, and Ad35, as well as carriers such as lipid nanoparticles, polymers, and peptides. In other embodiments, the antigen delivery system includes a vesicular stomatitis virus (VSV) vector.

[0290] The present invention is not limited to adenovirus vector-based antigen delivery systems. In certain embodiments, the antigen delivery system includes, but is not limited to, adeno-associated virus vector-based antigen delivery systems such as adeno-associated virus vector type 9 (AAV9 serotype) and AAV type 8 (AAV8 serotype). In certain embodiments, the adeno-associated virus vector used is tropic to body tissues that express the ACE2 receptor, such as the lungs, brain, heart, and kidneys (Figure 3A). For example, AAV9 is known to be neurotropic, which would help the vaccine composition be expressed in the brain.

[0291] In the antigen delivery system, one or more large sequences are operably ligated to a promoter. In certain embodiments, one or more large sequences are operably ligated to a general-purpose promoter. For example, in certain embodiments, one or more large sequences are operably ligated to a CMV promoter. In certain embodiments, one or more large sequences are operably ligated to a CAG, EFIA, EFS, CBh, SFFV, MSCV, mPGK, hPGK, SV40, UBC, or other suitable promoter.

[0292] In some embodiments, one or more large sequences are operably ligated to a tissue-specific promoter (e.g., a lung-specific promoter). For example, an antigen may be operably ligated to a SpB promoter or a CD144 promoter.

[0293] As previously stated, in certain embodiments, the vaccine composition includes a molecular adjuvant. In certain embodiments, the molecular adjuvant is operably linked to a general-purpose promoter, for example, as described above. In certain embodiments, the molecular adjuvant is operably linked to a tissue-specific promoter, for example, a lung-specific promoter, for example, SpB or CD144.

[0294] As previously stated, in certain embodiments, the vaccine composition includes a T cell attracting chemokine. In certain embodiments, the T cell attracting chemokine is operably linked to a general-purpose promoter, for example, as described above. In certain embodiments, the T cell attracting chemokine is operably linked to a tissue-specific promoter, for example, a lung-specific promoter, for example, SpB or CD144.

[0295] As previously stated, in certain embodiments, the vaccine composition includes a composition for promoting T cell proliferation. In certain embodiments, the composition for promoting T cell proliferation is operably coupled to a general-purpose promoter, for example, as described above. In certain embodiments, the composition for promoting T cell proliferation is operably coupled to a tissue-specific promoter, for example, a lung-specific promoter, for example, SpB or CD144.

[0296] Table 12 shows non-limiting examples of promoters that may be used to prepare the vaccine compositions described herein. [Table 12-1] [Table 12-2]

[0297] In certain embodiments, the T cell-attracting chemokine and the T cell proliferation-promoting composition are driven by the same promoter (for example, the T cell-attracting chemokine and the T cell proliferation-promoting composition are synthesized as peptides). In certain embodiments, the T cell-attracting chemokine and the T cell proliferation-promoting composition are driven by different promoters. In certain embodiments, the antigen, the T cell-attracting chemokine, and the T cell proliferation-promoting composition are driven by the same promoter. In certain embodiments, the antigen, the T cell-attracting chemokine, and the T cell proliferation-promoting composition are driven by different promoters. In certain embodiments, the T cell-attracting chemokine and the T cell proliferation-promoting composition are driven by the same promoter, and one or more large sequences are driven by different promoters.

[0298] In some embodiments, the antigen delivery system includes one or more linkers between a T cell attracting chemokine and a composition that promotes T cell proliferation. In certain embodiments, the linker is used between one or more epitopes. The linker may allow cleavage of another molecule (e.g., a chemokine). For example, in some embodiments, the linker is positioned between IL-7 (or IL-2) and CCL5, CXCL9, CXCL10, CXCL11, CCL25, CCL28, CXCL14, CXCL17, etc. In some embodiments, the linker is positioned between IL-15 and CCL5, CXCL9, CXCL10, CXCL11, CCL25, CCL28, CXCL14, CXCL17, etc. In some embodiments, the linker is positioned between the antigen or large sequence and another composition, such as IL-15, IL-7, CCL5, CXCL9, CXCL10, CXCL11, CCL25, CCL28, CXCL14, CXCL17, etc. Non-limiting examples of linkers include T2A, E2A, P2A (see Table 13), etc. The composition may feature different linkers between each open reading frame. [Table 13]

[0299] The present invention comprises an mRNA sequence encoding one or more of the vaccine composition herein, for example, a molecular adjuvant, a T cell enhancer, etc. The present invention also comprises a modified mRNA sequence encoding one or more of the vaccine composition herein. The present invention also comprises a DNA sequence encoding one or more of the vaccine composition herein.

[0300] In certain embodiments, the nucleic acids in the vaccine compositions herein are chemically modified. In some embodiments, the nucleic acids in the vaccine compositions are unmodified. In some embodiments, all or part of the uracil in the open reading frame has a chemical modification. In some embodiments, the chemical modification is at position 5 of the uracil. In some embodiments, the chemical modification is N1-methylpsoidouridine. In some embodiments, all or part of the uracil in the open reading frame has N1-methylpsoidouridine at position 5 of the uracil.

[0301] In certain embodiments, the open reading frame of the vaccine composition herein encodes one antigen or epitope. In some embodiments, the open reading frame of the vaccine composition herein encodes two or more antigens or epitopes. In some embodiments, the open reading frame of the vaccine composition herein encodes five or more antigens or epitopes. In some embodiments, the open reading frame of the vaccine composition herein encodes ten or more antigens or epitopes. In some embodiments, the open reading frame of the vaccine composition herein encodes fifty or more antigens or epitopes.

[0302] method In some embodiments, the method comprises determining one or more conserved large sequences derived from coronavirus sequences (e.g., SARS-CoV-2, variants, common cold coronaviruses, previously known coronavirus strains, animal coronaviruses, etc.). The method may comprise selecting at least one large conserved sequence and synthesizing one or more antigens comprising the selected large conserved sequence. The method may comprise synthesizing nucleotide compositions encoding antigens comprising the selected large conserved sequence (e.g., DNA, modified DNA, mRNA, modified mRNA, antigen delivery systems, etc.). In some embodiments, the method further comprises preparing a vaccine composition comprising the antigen, nucleotide composition and / or antigen delivery system and a pharmaceutical carrier. In some embodiments, the large sequences comprise one or more conserved epitopes described herein, e.g., one or more conserved B-cell target epitopes and / or one or more conserved CD4+ T-cell target epitopes and / or one or more conserved CD8+ T-cell target epitopes.

[0303] In some embodiments, each of the large sequences is conserved among two or a combination thereof from among at least two currently circulating human SARS-CoV-2 strains, at least one coronavirus that caused a previous human outbreak, at least one coronavirus isolated from bats, at least one coronavirus isolated from pangolins, at least one coronavirus isolated from civet cats, at least one coronavirus strain isolated from mink, and at least one coronavirus strain isolated from camels or any other animal that accepts coronaviruses.

[0304] As described above, the compositions described herein, such as antigens, vaccine compositions, antigen delivery systems, chemokines, and adjuvants, may be used to prevent coronavirus disease in a subject. In some embodiments, the compositions described herein, such as antigens, vaccine compositions, antigen delivery systems, chemokines, and adjuvants, may be used to prevent coronavirus infection in a subject. In some embodiments, the compositions described herein, such as antigens, vaccine compositions, antigen delivery systems, chemokines, and adjuvants, may induce an immune response in a subject. In some embodiments, the compositions described herein, such as antigens, vaccine compositions, antigen delivery systems, chemokines, and adjuvants, may prolong the immune response induced by the multiepitope pan-coronavirus vaccine composition and increase T cell migration to the lungs.

[0305] A method for preventing coronavirus disease in a subject may include administering a therapeutically effective amount of the pan-coronavirus vaccine composition according to the present invention to the subject. In some embodiments, the composition induces an immune response in the subject. In some embodiments, the composition induces memory B cells and memory T cells. In some embodiments, the composition induces resident memory T cells (Trm). In some embodiments, the composition prevents viral replication in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition prevents cytokine storms in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition prevents inflammation or inflammatory responses in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition improves T cell homing and retention in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys.

[0306] A method for preventively preventing coronavirus infection in a subject may include administering a prophylactically effective amount of the pan-coronavirus vaccine composition according to the present invention to the subject. In some embodiments, the composition induces an immune response in the subject. In some embodiments, the composition induces memory B cells and memory T cells. In some embodiments, the composition induces resident memory T cells (Trm). In some embodiments, the composition prevents viral replication in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition prevents cytokine storms in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition prevents inflammation or inflammatory responses in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition improves T cell homing and retention in areas where the virus normally replicates, such as the lungs, brain, heart, and kidneys.

[0307] A method for inducing an immune response in a subject may include administering the vaccine composition according to the present invention to the subject, wherein the composition induces an immune response in the subject. In some embodiments, the composition induces memory B cells and memory T cells. In some embodiments, the composition induces resident memory T cells (Trm). In some embodiments, the composition prevents viral replication in areas where viruses normally replicate, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition prevents cytokine storms in areas where viruses normally replicate, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition prevents inflammation or inflammatory responses in areas where viruses normally replicate, such as the lungs, brain, heart, and kidneys. In some embodiments, the composition improves T cell homing and retention in areas where viruses normally replicate, such as the lungs, brain, heart, and kidneys.

[0308] A method for extending the immune response induced by the vaccine composition of the present invention and increasing T cell migration to specific tissues (e.g., lungs, brain, heart, kidneys, etc.) may include co-expressing a T cell attracting chemokine, a composition that promotes T cell proliferation, and the vaccine composition according to the present invention (e.g., an antigen).

[0309] The vaccine composition of the present invention extends the retention of memory T cells induced in the lungs, and virus-specific tissue-resident memory T cells (T RM A method for increasing T cells may include co-expressing a T cell attracting chemokine, a composition that promotes T cell proliferation, and a vaccine composition (e.g., an antigen) according to the present invention.

[0310] This vaccine composition is administered by standard means, such as via the intravenous route (iv), the intranasal route (in), or the sublingual route (sl).

[0311] In certain embodiments, the method includes administering a second (e.g., booster) dose to a subject. The second dose may comprise the same vaccine composition or a different vaccine composition. Further doses of one or more vaccine compositions may be administered.

[0312] Sequential vaccine delivery method In some embodiments, the present invention features a method for delivering a vaccine to induce heterologous immunity in a subject (see, e.g., prime / boost, Figures 25B and 26B). In some embodiments, the method includes administering a dose of a first pan-coronavirus vaccine composition using a first delivery system. In further embodiments, the method includes administering a dose of a second vaccine composition using a second delivery system. In some embodiments, the second composition is administered 8 days after administration of the first composition. In some embodiments, the second composition is administered 9 days after administration of the first composition. In some embodiments, the second composition is administered 10 days after administration of the first composition. In some embodiments, the second composition is administered 11 days after administration of the first composition. In some embodiments, the second composition is administered 12 days after administration of the first composition. In some embodiments, the second composition is administered 13 days after administration of the first composition. In some embodiments, the second composition is administered 14 days after administration of the first composition. In some embodiments, the second composition is administered 14 to 30 days after the administration of the first composition. In some embodiments, the second composition is administered 30 to 60 days after the administration of the first composition. In other embodiments, the first and second delivery systems are different. In some embodiments, the peptide vaccine composition is administered 14 days after the administration of the dose of the first vaccine composition. In some embodiments, the peptide vaccine composition is administered 30 or 60 days after the administration of the dose of the first vaccine composition.

[0313] In some embodiments, the first or second delivery system includes mRNA, modified mRNA, or a peptide vector. In other embodiments, the peptide vector includes an adenovirus or an adeno-associated virus vector.

[0314] In some embodiments, the present invention features a method for delivering a vaccine to induce heterologous immunity in a subject (i.e., prime / pull, see Figures 25A and 26A). In some embodiments, the method comprises administering a pan-coronavirus vaccine composition. In further embodiments, the method comprises administering at least one T-cell attracting chemokine after administering the pan-coronavirus vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 8 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 9 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 10 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 11 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 12 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 13 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 14 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 14 to 30 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine is administered 30 to 60 days after the administration of the vaccine composition. In some embodiments, the T-cell attracting chemokine composition is administered 8 to 14 days after the administration of the last dose of the vaccine composition. In some embodiments, the cell attracting chemokine composition is administered 30 or 60 days after the administration of the last dose of the vaccine composition.

[0315] The present invention also features a novel “priming, pull, and boost” method. In other embodiments, the present invention features a method for increasing the size and prolonging the lifespan of pulmonary commensal B cells, CD4+ T cells, and CD8+ T cells to protect against SARS-CoV-2 (Figures 25D and 26D). In some embodiments, the method comprises administering a pan-coronavirus vaccine composition. In other embodiments, the method comprises administering at least one T-cell attracting chemokine after administering the pan-coronavirus vaccine composition. In further embodiments, the method comprises administering at least one cytokine after administering the T-cell attracting chemokine. In some embodiments, the T-cell attracting chemokine is administered 14 days after administration of the pan-coronavirus composition. In other embodiments, the cytokine is administered 10 days after administration of the T-cell attracting chemokine. In some embodiments, the T-cell attracting chemokine is administered 8 days after administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 9 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 10 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 11 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 12 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 13 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 14 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 14 to 30 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 30 to 60 days after the administration of the vaccine composition. In some embodiments, the cytokine is administered 8 days after the administration of the T-cell induced chemokine. In some embodiments, cytokines are administered 9 days after the administration of T cell-inducing chemokines. In some embodiments, cytokines are administered 10 days after the administration of T cell-inducing chemokines.In some embodiments, cytokines are administered 11 days after administration of T-cell induced chemokines. In some embodiments, cytokines are administered 12 days after administration of T-cell induced chemokines. In some embodiments, cytokines are administered 13 days after administration of T-cell induced chemokines. In some embodiments, cytokines are administered 14 days after administration of T-cell induced chemokines. In some embodiments, cytokines are administered 14 to 30 days after administration of T-cell induced chemokines. In some embodiments, cytokines are administered 30 to 60 days after administration of T-cell induced chemokines. In some embodiments, cytokine compositions are administered 8 to 14 days after administration of T-cell induced chemokines. In some embodiments, cytokine compositions are administered 30 or 60 days after administration of T-cell induced chemokines.

[0316] The present invention further features a novel "priming, pull, and retention" strategy (Figures 25C and 26C). In further embodiments, the present invention features a method for increasing the size and persistence of pulmonary commensal B cells, CD4+ T cells, and CD8+ T cells to protect against SARS-CoV-2. In some embodiments, the method comprises administering a pan-coronavirus vaccine composition. In other embodiments, the method comprises administering at least one T-cell attracting chemokine after administering the pan-coronavirus vaccine composition. In further embodiments, the method comprises administering at least one mucosal chemokine after administering the T-cell attracting chemokine. In some embodiments, the T-cell attracting chemokine is administered 14 days after administration of the pan-coronavirus composition. In other embodiments, the mucosal chemokine is administered 10 days after administration of the T-cell attracting chemokine. In some embodiments, the T-cell attracting chemokine is administered 8 days after administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 9 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 10 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 11 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 12 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 13 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 14 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 14 to 30 days after the administration of the vaccine composition. In some embodiments, the T-cell induced chemokine is administered 30 to 60 days after the administration of the vaccine composition. In some embodiments, the mucosal chemokine is administered 8 days after the administration of the T-cell induced chemokine. In some embodiments, mucosal chemokines are administered 9 days after the administration of T-cell-inducing chemokines. In some embodiments, mucosal chemokines are administered 10 days after the administration of T-cell-inducing chemokines.In some embodiments, mucosal chemokines are administered 11 days after the administration of T-cell induced chemokines. In some embodiments, mucosal chemokines are administered 12 days after the administration of T-cell induced chemokines. In some embodiments, mucosal chemokines are administered 13 days after the administration of T-cell induced chemokines. In some embodiments, mucosal chemokines are administered 14 days after the administration of T-cell induced chemokines. In some embodiments, mucosal chemokines are administered 14 to 30 days after the administration of T-cell induced chemokines. In some embodiments, mucosal chemokines are administered 30 to 60 days after the administration of T-cell induced chemokines. In some embodiments, mucosal chemokine compositions are administered 8 to 14 days after the administration of T-cell induced chemokines. In some embodiments, mucosal cytokine compositions are administered 30 or 60 days after the administration of T-cell induced chemokines.

[0317] In some embodiments, the mucosal chemokines may include CCL25, CCL28, CXCL14, CXCL17, or a combination thereof. In some embodiments, the T cell attracting chemokines may include CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof. In some embodiments, the cytokines may include IL-15, IL-2, IL-7, or a combination thereof.

[0318] In some embodiments, the efficacy (or effectiveness) of the vaccine composition herein exceeds 60%. In some embodiments, the efficacy (or effectiveness) of the vaccine composition herein exceeds 70%. In some embodiments, the efficacy (or effectiveness) of the vaccine composition herein exceeds 80%. In some embodiments, the efficacy (or effectiveness) of the vaccine composition herein exceeds 90%. In some embodiments, the efficacy (or effectiveness) of the vaccine composition herein exceeds 95%.

[0319] The effectiveness of a vaccine can be evaluated using standard analyses (e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201(11): 1607-10). For example, the effectiveness of a vaccine can be measured by a double-blind, randomized, controlled clinical trial. The effectiveness of a vaccine can be expressed as a proportional reduction in disease incidence (AR) between an unvaccinated (ARU) study cohort and an vaccinated (ARV) study cohort, and can be calculated from the relative risk (RR) of disease between the vaccinated groups using the following formulas: Effectiveness = (ARU - ARV) / ARU × 100, and Effectiveness = (1 - RR) × 100.

[0320] Similarly, vaccine efficacy can be evaluated using standard analyses (e.g., Weinberg et al., J Infect Dis. 2010 Jun. 1; 201(11): 1607-10). Vaccine efficacy is an assessment of how a vaccine reduces disease in a population (which may have already been proven to have high efficacy). This measure can assess the net balance of benefits and adverse effects of the vaccination program as well as the vaccine itself, under natural conditions rather than controlled clinical trials. Vaccine efficacy is proportional to the vaccine's effect (potency), but is also influenced by the extent to which the target group in the population is immunized, and other non-vaccine-related factors that affect "real-world" hospitalization, outpatient care, or cost outcomes. For example, retrospective case-control analyses can be used to compare vaccination rates between a set of infection cases and appropriate controls. Vaccine efficacy can be expressed as a rate difference using the odds ratio (OR) for developing an infection despite vaccination. Efficacy = (1-OR) × 100.

[0321] In some embodiments, the vaccine immunizes subjects against coronavirus for up to one year. In some embodiments, the vaccine immunizes subjects against coronavirus for up to two years. In some embodiments, the vaccine immunizes subjects against coronavirus for more than one year, more than two years, more than three years, more than four years, or five to ten years.

[0322] In some embodiments, the target audience is young adults aged approximately 20 to 50 years (for example, approximately 20, 25, 30, 35, 40, 45, or 50 years).

[0323] In some embodiments, the target population consists of elderly individuals aged approximately 60, 70, or older (e.g., approximately 60, 65, 70, 75, 80, 85, or 90 years).

[0324] In some embodiments, the target age is approximately 5 years or younger. For example, the target age may be approximately 1 to 5 years (e.g., approximately 1, 2, 3, 5, or 5 years), or approximately 6 months to 1 year (e.g., approximately 6, 7, 8, 9, 10, 11, or 12 months). In some embodiments, the target age is approximately 12 months or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 month). In some embodiments, the target age is approximately 6 months or younger.

[0325] In some embodiments, subjects were full-term (e.g., about 37–42 weeks). In some embodiments, subjects were born prematurely, for example, at about 36 weeks of gestation or earlier (e.g., about 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 weeks). For example, subjects may be born at about 32 weeks of gestation or earlier. In some embodiments, subjects were born prematurely between about 32 and about 36 weeks of gestation. In such subjects, the vaccine may be administered in later years, for example, at about 6 months to about 5 years of age or older.

[0326] In some embodiments, the subjects are pregnant at the time of vaccine administration (e.g., first, second, or third trimester).

[0327] In some embodiments, subjects have or are at risk of having a chronic lung disease (e.g., chronic obstructive pulmonary disease (COPD) or asthma). Two forms of COPD include chronic bronchitis with a persistent cough accompanied by mucus, and emphysema with progressive lung damage. Thus, subjects who receive the vaccine may have chronic bronchitis or emphysema.

[0328] In some embodiments, the subject is exposed to the coronavirus. In some embodiments, the subject is infected with the coronavirus. In some embodiments, the subject is at risk of infection by the coronavirus.

[0329] In some embodiments, the subjects are in an immunocompromised state (their immune system is impaired, for example, they have an immune disorder or autoimmune disorder).

[0330] Pharmaceutical carriers In certain embodiments, the vaccine composition further comprises a pharmaceutical carrier. Pharmaceutical carriers are well known to those skilled in the art. For example, in certain embodiments, the pharmaceutical carrier is selected from the group consisting of water, alcohol, natural or hydrogenated oil, natural or hydrogenated wax, calcium carbonate, sodium carbonate, calcium phosphate, kaolin, talc, lactose, and combinations thereof. In some embodiments, the pharmaceutical carrier may comprise lipid nanoparticles, an adenovirus vector, or an adeno-associated virus vector. In some embodiments, the vaccine composition is constructed using an antigen delivery system based on an adeno-associated virus vector.

[0331] Vaccines of any one of the preceding paragraphs, formulated in the form of nanoparticles (e.g., lipid nanoparticles), are also provided herein. In some embodiments, the nanoparticles have an average diameter of 50–200 nm. In some embodiments, the nanoparticles are lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols, and non-cationic lipids. In some embodiments, the lipid nanoparticles have a molar ratio of about 20–60% cationic lipids, 0.5–15% PEG-modified lipids, 25–55% sterols, and 25% non-cationic lipids. In some embodiments, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol. In some embodiments, the cationic lipid is selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-nonano-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319).

[0332] While preferred embodiments of the present invention have been described, it will be readily apparent to those skilled in the art that modifications can be made that do not exceed the scope of the appended claims. Therefore, the scope of the present invention should be limited only by the scope of the appended claims. In some embodiments, the drawings presented in this patent application are drawn to scale, including angles, dimensional ratios, etc. In some embodiments, the drawings are representative only, and the scope of the claims is not limited by the dimensions of the drawings. In some embodiments, the description of the invention described herein using the phrase "comprising" includes embodiments that may be described as "consisting essentially of" or "consisting of," and thus the specification requirements for claiming one or more embodiments of the present invention using the phrase "consisting essentially of" or "consisting of" are met. [Sequence Listing Free Text]

[0333] Sequence ID 1 <223> Severe Acute Respiratory Syndrome Coronavirus 2 Sequence ID 139 <223> Synthetic vaccine candidate 1 Sequence ID 140 <223> Synthetic vaccine candidate 2 Sequence ID 141 <223> Synthetic vaccine candidate 3 Sequence ID 142 <223> Synthetic vaccine candidate 4 Sequence ID 143 <223> 5 synthetic vaccine candidates Sequence ID 144 <223> Six synthetic vaccine candidates Sequence ID 145 <223> Synthetic vaccine candidate 7 Sequence ID 146 <223> Synthetic vaccine candidate 8 Sequence ID 147 <223> Synthetic vaccine candidate 9 Sequence ID 148 <223> Synthetic spike glycoprotein with 6 stabilization mutations Sequence ID 149 <223> Synthetic spike glycoprotein with one stabilizing mutation Sequence ID 150 <223> SARS-CoV-2-derived nucleocapsid protein Sequence ID 151 <223> SARS-CoV-2-derived ORF1ab protein (unannotated) Sequence ID 152 <223> SARS-CoV-2-derived ORF3a protein Sequence ID 153 <223> SARS-CoV-2-derived envelope protein Sequence ID 154 <223> SARS-CoV-2-derived membrane protein Sequence ID 155 <223> SARS-CoV-2-derived ORF6 protein Sequence ID 156 <223> SARS-CoV-2-derived ORF7a protein Sequence ID 157 <223> Nsp3 derived from SARS-CoV-2 Sequence ID 158 <223> Nsp5 derived from SARS-CoV-2 Sequence ID 159 <223> Nsp12 derived from SARS-CoV-2 Sequence ID 171 <223> CAG Promoter Sequence ID 172 <223> CMV Promoter Sequence ID 175 <223> Wild-type natural leader sequence derived from SARS-CoV-2 spike protein Sequence ID 176 <223> T2A Linker Sequence ID 177 <223> E2A Linker Sequence ID 178 <223> P2A Linker Sequence IDs 179-180 <223> Linker Sequence ID 181 <223> 6-His tag Sequence ID 182 <223> SARS-CoV-2-derived Nsp1, Nsp2, and Nsp3 Sequence ID 183 <223> Nsp5, Nsp6, Nsp7, Nsp8, Nsp9, Nsp10, Nsp11, Nsp12, Nsp13, Nsp14, Nsp15 and Nsp16 derived from SARS-CoV-2 Sequence ID 184 <223> SARS-CoV-2-derived spike glycoprotein Sequence ID 185 <223> ORF3a, envelope (E), membrane (M), ORF6 and ORF7a derived from SARS-CoV-2 Sequence ID 186 <223> SARS-CoV-like Spikes - S1-NTD Sequence ID 187 <223> SARS-CoV-2 Spike-S1-RBD Sequence ID 188 <223> Wild-type signal sequence of the spike protein derived from SARS-CoV-2 Sequence ID 189 <223> 682-QQAQ-685 mutation Sequence ID 190 <223> K986P mutation and V987P mutation Sequence ID 191 <223> SARS-CoV-2-derived spike glycoprotein with the 682-QQAQ-685 mutation in S1-S2 Sequence ID 192 <223> Spike glycoprotein with two proline substitutions (K986P, V987P) Sequence ID 193 <223> Spike glycoprotein with four proline substitutions (F817P, A892P, A899P, A942P) Sequence ID 194 <223> Spike glycoprotein with six proline substitutions (F817P, A892P, A899P, A942P, K986P, V987P) Sequence ID 195 <223> A spike glycoprotein with six proline substitutions (F817P, A892P, A899P, A942P, K986P, V987P) and the 682-QQAQ-685 mutation. Sequence ID 196 <223> CoV Spike S1-S2_S2 Sequence ID 197 <223> Epitot Plinker

Claims

1. A coronavirus vaccine composition comprising one or more proteins encoded by one or more nucleic acids having sequences independently selected from SEQ ID NOs: 139 to 147.

2. The composition according to claim 1, further comprising a T cell attracting chemokine, wherein the T cell attracting chemokine is CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof.

3. The composition according to claim 1 or 2, further comprising a composition that promotes T cell proliferation and T cell memory, wherein the composition that promotes T cell proliferation and memory is IL-7, IL-2, or IL-15.

4. The composition according to any one of claims 1 to 3, wherein each of the one or more proteins has at least 25 amino acids.

5. A coronavirus vaccine composition comprising two or more different proteins encoded by two or more different nucleic acids independently selected from SEQ ID NOs: 139 to 147.

6. The composition according to claim 5, wherein each of the two or more different proteins has at least 25 amino acids.

7. The composition according to claim 5 or 6, further comprising a T cell attracting chemokine, wherein the T cell attracting chemokine is CCL5, CXCL9, CXCL10, CXCL11, or a combination thereof.

8. The composition according to any one of claims 5 to 7, further comprising a composition that promotes T cell proliferation and T cell memory, wherein the composition that promotes T cell proliferation and memory is IL-7, IL-2, or IL-15.

9. The composition according to any one of claims 1 to 8, wherein the composition is formulated in a peptide delivery system or in a viral vector.

Images