DNA constructs for cancer diagnosis and treatment

JP7923573B2Active Publication Date: 2026-09-18CNCURE BIOTECH INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025035659
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-05-11
Filing Date
2025-03-06
Publication Date
2026-09-18
Estimated Expiration
2040-05-11

AI Technical Summary

Benefits of technology

【0108】 本発明によるDNAコンストラクトは、宿主菌株または細胞内で第1プロモーターと第2プロモーターの下流に作動可能に連結された遺伝子の発現レベルが均衡をなすようにして、癌の治療と診断を同時に行うことができる。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007923573000002
    Figure 0007923573000002
  • Figure 0007923573000003
    Figure 0007923573000003
  • Figure 0007923573000004
    Figure 0007923573000004
Patent Text Reader

Abstract

To provide DNA constructs for cancer diagnosis and treatment.SOLUTION: The invention relates to a DNA construct and a strain having an introduced recombinant vector comprising the DNA construct, where the DNA construct of the invention can carry out both treatment and diagnosis of cancer at the same time since the expression levels of a gene operably linked to the downstream of a first promoter and a gene operably linked to the downstream of a second promoter in a host strain or a cell are balanced. The DNA construct of the invention cannot express the anticancer protein and the reporter protein at all when doxycycline is not present so that by controlling the presence or absence of doxycycline treatment, it is possible to express the anticancer protein at a dose suitable for cancer treatment and at the same time to enable real time monitoring of the size of the cancer depending on the expression level of the reporter protein.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a DNA construct for the diagnosis and treatment of cancer, and to a bacterial strain into which a recombinant vector containing the DNA construct has been introduced. [Background technology]

[0002] Currently, most cancers are treated by individual methods or combinations thereof, such as surgery, radiation therapy, and chemotherapy. Surgical removal, which removes most of the cancerous tissue, can be very effective in removing cancerous tissue located in specific areas, such as the breast, colon, and skin, but it is difficult to use to treat cancerous tissue in certain areas, such as the spine. In addition, systemic chemotherapy, which is commonly used for breast, lung, and testicular cancers, can induce side effects that disrupt the replication or metabolic processes of normal cells, and may lead to resistance to the chemotherapy drugs used in patients.

[0003] On the other hand, when cancer develops in an individual, angiogenesis and cell growth proceed at a very rapid rate within the body, creating an environment within the cancerous tissue that is poorly angiogenic and oxygen-deficient, making it highly suitable for the growth of anaerobic bacteria such as Salmonella strains or E. coli. As a result, cancer treatment using cancer-targeting bacteria such as Salmonella and Clostridium strains currently relies on the function of specific bacteria that can target solid tumors and grow within them. However, by introducing oncolytic proteins or reporter proteins into these bacteria and administering the transformed bacteria to the individual, it is possible to treat cancer while specifically identifying cancerous tissue or minimizing side effects that are toxic to normal cells.

[0004] Diseases in humans are induced by toxins secreted by various bacterial pathogens that exist in nature. Among these diverse bacterial pathogens that can induce disease, Salmonella enterica, which is closely related to our diet, is known as an Enterobacteriaceae that inhabits the intestinal tract of primates, including humans, and secretes cytolysin, a known exotoxin. This secreted cytolysin is a cytotoxic protein with a molecular weight of approximately 34 kDa and is known to cause hemolysis by destroying red blood cells in the intestines of primates, including humans, and to induce cell lysis by forming pores in the membranes of normal cells, leading to severe vascular inflammation and local tissue necrosis, and ultimately death. However, recent research has shown that cytolysin isolated and purified from Salmonella enterica specifically reacts with cancerous tissue in the intestinal tract of the body, inducing the death of cancerous tissue, and is attracting attention as a next-generation anti-cancer treatment. Therefore, bacteria transformed with genes that secrete cytotoxic substances such as cytolysin have very high potential for use as anticancer agents targeting cancer tissue.

[0005] Despite the possibility of diagnosing or treating cancer using bacteria, there has been little research on expression vectors that enable the specific expression of diagnostic and therapeutic proteins in cancer tissue. After bacteria are injected into the body, they undergo a clearing process in the reticular endothelial system, such as the liver and spleen, for the first three days, and then rapidly increase in cancer tissue after a certain period. Therefore, for stability reasons, it is required that therapeutic proteins be expressed after a certain period. For this reason, the use of inducible promoters is recommended for the expression of therapeutic proteins, but currently, P is only used experimentally. BAD Inducible promoters, such as promoters, face high hurdles to clinical application because they must use L-arabinose, which is not permitted for human use, as the inducer. tetWhile promoters are relatively easy to use clinically and offer the advantage of enabling bidirectional transcription of two genes using the TetA and TetR promoters, they exhibit a difference in protein expression rates of 100:1 or more between the two promoters. Therefore, balancing this difference is crucial for their practical application. Currently, there is a need to develop new technologies for transformed bacteria that possess a clinically applicable expression system and achieve balanced protein expression levels. [Overview of the project] [Problems that the invention aims to solve]

[0006] One objective of the present invention is to provide a DNA construct.

[0007] Another object of the present invention is to provide a recombinant vector comprising the DNA construct.

[0008] A further object of the present invention is to provide a bacterial strain into which the recombinant vector has been introduced; and a cancer diagnostic composition comprising the same.

[0009] Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer, comprising the aforementioned bacterial strain as an active ingredient.

[0010] A further object of the present invention is to provide an informational method for cancer diagnosis, comprising the step of processing the bacterial strain.

[0011] However, the technical problems that this invention aims to solve are not limited to those described above, and any other problems not mentioned will be clearly understood by those with ordinary skill in the industry from the following description. [Means for solving the problem]

[0012] One embodiment of the present invention provides a DNA construct.

[0013] The DNA construct of the present invention comprises a gene that encodes a regulatory protein; and a first promoter and a second promoter induced by the regulatory protein.

[0014] Downstream of the first and second promoters of the present invention, one selected from the group consisting of genes encoding anti-cancer proteins; genes encoding cytokines; genes encoding chemokines; genes encoding immunomodulators; oligonucleotides specific to cancer antigens; and genes encoding reporter proteins is operably linked.

[0015] Since the first and second promoters of the present invention can be simultaneously induced by a single regulatory protein expressed by another promoter, the expression levels of proteins encoded by genes operably linked downstream of the first and second promoters in the host cell can be balanced compared to the case where a gene encoding the regulatory protein is operably linked downstream of the second promoter. Thus, when using the DNA construct according to the present invention, diagnosis and treatment can be performed simultaneously.

[0016] The "DNA construct" of the present invention is a structure that, when introduced into a host bacterial strain or cell by transformation, enables the expression of a target protein, and includes not only a gene that encodes the target protein, but also a base sequence corresponding to a promoter, which is an essential regulatory element operably linked to enable the expression of the gene.

[0017] The "promoter" in this invention refers to a base sequence located in the upstream region of a gene operably linked in a host bacterial strain or cell, which is a base sequence at a specific site of the DNA construct to which RNA polymerase can bind in order to initiate transcription.

[0018] Regulation of the expression of said regulatory protein of the present invention can be effected by cis-acting elements (Cis-regulatory elements; CRE) or trans-acting elements (Trans-regulatory elements; TRE).

[0019] In the present invention, said "regulation" or "expression regulation" can mean that the transcription and translation of a specific gene is activated or inhibited.

[0020] Said cis-acting element of the present invention is a region of non-coding DNA that regulates the transcription of an adjacent gene, is an essential component of a gene regulatory network, and controls gene expression. Said cis-acting element may be at least one selected from the group consisting of a ribosome binding site (RBS), a 5'-Untranslated Region (5'-UTR), a transcription factor binding site and terminators, but is not limited thereto.

[0021] In the present invention, said ribosome binding site (RBS) is also referred to as a Shine-Dalgarno sequence (SD sequence). After genetic information integrated in DNA is transcribed into messenger RNA (mRNA), a ribosome must bind to this mRNA for translation to occur. Said ribosome binding site refers to a short sequence present on mRNA that allows ribosomes to bind effectively.

[0022] In the present invention, the 5'-untranslated region (5'-UTR) is an untranslated region located on both sides of the coding region, which is the portion of the 5' region translated into amino acids of mRNA. It was previously considered to be junk that is discarded as unnecessary during evolution, but it is now known to play a major role in the regulation of gene expression.

[0023] In the present invention, the transcription factor binding site is a DNA region that functions to turn on and off specific nearby genes. The transcription factor binding site may be, but is not limited to, at least one selected from the group consisting of a promoter of the gene encoding the regulatory protein, an enhancer and a silencer.

[0024] The promoter of the gene encoding the regulatory protein of the present invention may include any promoter capable of inducing activity under environmental conditions, developmental status and the like of most host strains or cells, and is preferably a weak promoter.

[0025] The "weak promoter" of the present invention refers to a promoter that causes the expression level of a transcript transcribed from a gene operably linked downstream thereof to be 1×10 -2 below, preferably 1×10 -3 or lower, which is a promoter that induces expression to the above level, wherein the expression level of the transcript is adjusted to 1×10 -3The following promoters may be included, but are not limited to: E. coli σ70 promoter; E. coli σS promoter; E. coli σ32 promoter; B. subtilis σA promoter; B. subtilis σB promoter; Salmonella-derived promoters K112706 or K112707; bacteriophage T7 promoter; bacteriophage SP6 promoter; yeast-derived promoter; eukaryotic cell-derived promoters I712004 or K076017; OXB1 promoter; and at least one selected from the group consisting of plant-derived promoters.

[0026] The E. coli σ70 promoter of the present invention corresponds to I14018, I14033, I14034, I732021, I742126, J01006, J23103, J23109, J23112, J23113, J23117, J23119, J23150, J23151, J44002, J48104, J56015, J64951, K088007, K119000, K119001, K1330002, K137029, K137030, K137031, K137032, K137085, K137086, K137087, K137088, K137089, K137090, K137091, K1585100, K1585101, K1585102, K158510 3, K1585104, K1585105, K1585106, K1585110, K1585113, K1585115, K1585116, K1585117 , K1585118, K1585119, K2486171, K256002, K256018, K256020, K256033, K292000, K82300 7, K823010, K823013, M13101, M13102, M13103, M13104, M13105, M13106, M13108, M13110, M31519, R1074, R1075 and S03331 may be selected from, but are not limited to.

[0027] The E. coli σS promoter of the present invention may be J45992 or J45993, but is not limited thereto.

[0028] The E. coli σ32 promoter of the present invention may be J45504, K1895002, or K1895003, but is not limited thereto.

[0029] The B. subtilis σA promoter of the present invention may be at least one selected from the group consisting of K143012, K143013, K823000, K823002, and K823003, but is not limited thereto.

[0030] The B. subtilis σB promoter of the present invention may be K143010, K143011, or K143013, but is not limited thereto.

[0031] The bacteriophage T7 promoter of the present invention may be at least one selected from the group consisting of I719005, J34814, J64997, K113010, K113011, K113012, K1614000, R0085, R0180, R0181, R0182, R0183, Z0251, Z0252, and Z0253, but is not limited thereto.

[0032] The bacteriophage SP6 promoter of the present invention may be J64998, but is not limited thereto.

[0033] The yeast-derived promoter of the present invention may be at least one selected from the group consisting of I766557, J63005, K105027, K105028, K105029, K105030, K105031, K122000, K124000, K124002, K319005, M31201, K2365040, K2365036, K2365041, K2365042, K2365032, K2365051, K2365514, K2365515, and K2365516, but is not limited thereto.

[0034] In the present invention, the weak promoter may be, but is not limited to, the OXB1 promoter represented by Sequence ID No. 16.

[0035] The plant-derived promoter of the present invention may be at least one selected from the group consisting of PLPR0203, PLPR0210, PLPR0177, PLPR0193, PLPR0507, PLPR0422, PLPR0228, PLPR0226, PLPR0223, PLPR0040, PLPR0465, PLPR0232, PLPR0205, PLPR0247, PLPR0328, PLPR0525, AtREG383, AtREG415, AtREG416, OsREG438, OsREG443, OsREG501, PpREG186, PpREG194, and PpREG197, but is not limited thereto.

[0036] For the purposes of the present invention, when a gene encoding a regulatory protein is operably linked downstream of the weak promoter, the transcription of the gene located downstream of the first and second promoters can be regulated so that it occurs specifically only when a substance that suppresses the regulatory protein is administered, compared to when it is operably linked downstream of the first or second promoter.

[0037] The promoter of the gene encoding the regulatory protein of the present invention may, with respect to the gene encoding the regulatory protein, have the base sequence at the -35 position as SEQ ID NO: 8 and the base sequence at the -10 position as SEQ ID NO: 9, but is not limited thereto.

[0038] The enhancer of the present invention is a sequence found in both prokaryotes and eukaryotes, generally having a region of 50 to 1500 bp, and is located upstream or downstream of the origin of the neighboring gene to induce the binding of the transcription factor.

[0039] The silencer of the present invention maintains the same mechanism as the enhancer and acts as an antagonist to the enhancer. The transcription factor that binds to the silencer is a repressor. The enhancer and the silencer may be located in adjacent regions, or they may be in the same region but have different transcription factors in different regions.

[0040] The terminators of the present invention are also called transcription terminators, and they mediate the termination of transcription of genes or operons in a heritable organism. In prokaryotes, there are Rho-dependent terminators and Rho-independent terminators.

[0041] The trans-acting factor of the present invention is also called a trans-activating factor or trans-acting transcription factor, and is a factor that trans-activates gene transcription. The trans-acting factor may be at least one selected from the group consisting of the transcription factor, aptamer, sRNA, and antisense RNA (asRNA), but is not limited thereto.

[0042] In the present invention, the transcription factor is a protein that binds to the transcription factor binding site and helps to switch a specific gene on or off.

[0043] In the present invention, the aptamer is a part of a riboswitch and is a common name for an oligonucleotide or peptide substance that can bind to a specific target molecule. The aptamer may also be a peptide aptamer or a nucleic acid aptamer. The riboswitch is a type of mRNA that regulates gene expression and may include, but is not limited to, glmS riboswitches, FMN riboswitches, and Cobalamin riboswitches.

[0044] In this invention, the sRNA and antisense RNA (asRNA) refer to single-stranded RNA that can bind complementarily to a specific RNA. They bind complementarily to sense RNA, which is a messenger RNA (mRNA) that expresses a specific protein, and ultimately regulate the expression of that protein.

[0045] The first promoter and the second promoter of the present invention may be inducible promoters that are induced by the regulatory protein.

[0046] The "inducible promoter" of the present invention is a promoter that transcribes a gene so that it can be specifically expressed downstream under specific chemical or physical conditions. For example, it may be a promoter for the LacZ gene expressed in the presence of galactose such as IPTG (isopropyl-β-D-1-thiogalactopyranoside), an arabinose operon araBAD promoter expressed only in the presence of L-arabinose, or a tet promoter whose expression is regulated by tetracycline. Preferably, the first and second promoters may be tet promoters, and more preferably, the first promoter may be a tetA promoter and the second promoter may be a tetR promoter, but it is not limited thereto.

[0047] The gene encoding the regulatory protein of the present invention is a protein that binds to the first promoter and the second promoter and regulates so that RNA polymerase cannot bind to them. For the purposes of the present invention, if the first promoter and the second promoter are tet promoters, the protein may be a TetR protein that binds to the regulatory site of the tet promoter and suppresses the activity of the tet promoter, but is not limited thereto.

[0048] The term "operably linked" in this invention means that one target nucleic acid fragment is functionally linked to another nucleic acid fragment, thereby influencing the function or expression of the target nucleic acid fragment.

[0049] The "reporter protein" of the present invention is a protein that performs a function to enable the visual diagnosis of cancer, and may be, but is not limited to, at least one selected from the group consisting of, for example, fluorescent proteins, luciferases, and proteins used in nuclear medicine or MRI imaging.

[0050] The "fluorescent protein" of the present invention is a protein that emits fluorescence on its own so that cancer can be visually diagnosed, and may be, but is not limited to, at least one selected from the group consisting of, for example, green fluorescent protein (GFP), modified green fluorescent protein (MGFP), enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), enhanced red fluorescent protein (ERFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), yellow fluorescent protein (YFP), and enhanced yellow fluorescent protein (EYFP).

[0051] The protein used in nuclear medicine or MRI imaging according to the present invention may be, but is not limited to, at least one selected from the group consisting of, for example, herpes simplex virus thymidine kinsease, dopamine receptor, somatostatin receptor, sodium-iodide transporter, iron receptor, transferrin receptor, ferritin, and iron transporter (magA).

[0052] The term "cytokine" in this invention refers to a protein secreted by immune cells, and the cytokines in this invention may include any that can be used in cancer immunotherapy to regulate the host immune response and induce the death of disease-related cells, such as cancer cells, and are preferably, but not limited to, IFN-α2, IL-2, IL-15, IL-21, and IL-12.

[0053] The "chemokines" of the present invention refer to any substances that play a role in regulating cell migration between tissues and the position and interaction of cells within tissues, and that can induce leukocytes into the tumor microenvironment to mediate the host response to disease, such as cancer. Preferably, these include CXCR3, CCR5, etc., but are not limited thereto.

[0054] The "immunomodulator" of the present invention refers to any substance that enables diverse treatments by utilizing the unique immune system of an individual, and that can activate immune cells to induce the death of disease-related cells, such as cancer cells.

[0055] The "anti-cancer protein" of the present invention is a peptide having the function of directly or indirectly inducing the death of cancer cells, and may be, but is not limited to, at least one selected from the group consisting of, for example, toxin proteins, antibodies or fragments of such antibodies, tumor suppressor proteins, angiogenesis inhibitors, cancer antigens, prodrug-converting enzymes, and pro-apoptotic proteins.

[0056] The "toxin protein" of the present invention is a protein having the function of directly or indirectly inducing the death of cancer cells, and may be at least one selected from the group consisting of ricin, saporin, geronin, momordin, debouganin, diphtheria toxin, pseudomonas toxin, hemolysin (HlyA), FAS ligand (FASL), tumor necrosis factor-α (TNF-α), TNF-related apoptosis-inducing ligand (TRAIL), and cytolysin A (ClyA), and more preferably cytolysin A consisting of the amino acid sequence represented by Sequence ID No. 1, but is not limited thereto.

[0057] The "tumor suppressor protein" of the present invention is a gene that maintains its function while present in normal cells, but if its function is lost, it induces indiscriminate cell division and growth in normal cells, thereby converting them into cancer cells. Examples include, but are not limited to, RB (Retinoblastoma protein) protein, p53 protein, APC (Adenomatous polyposis coli) protein, PTEN (Phosphatase and tensin homologue) protein, and CDKN2A (cyclin dependent kinase inhibitor 2A) protein.

[0058] The antibody or fragment of the antibody specific to the cancer antigen of the present invention is an antibody that can specifically bind to an antigen, which is a protein that is specifically expressed at a high level on the surface or cytoplasm of cancer cells. For example, it may be an antibody specific to HER2, which is specifically expressed at a high level on breast cancer or gastric cancer cells, but is not limited thereto.

[0059] The antibody of the present invention refers to a protein molecule that can specifically bind to the antigenic site of a protein or peptide molecule. The form of the antibody is not particularly limited and may include polyclonal antibodies, monoclonal antibodies, or any antibody that has antigen-binding properties, even if it is only a part of an antibody, and may include all types of immunoglobulin antibodies. It may also include special antibodies such as humanized antibodies, and the antibody may include not only a complete form having two full-length light chains and two full-length heavy chains, but also functional fragments of the antibody molecule. A functional fragment of an antibody molecule means a fragment that possesses at least antigen-binding function, and may be Fab, F(ab'), F(ab')2, Fv, etc., but is not limited to these.

[0060] The "antibody" of the present invention can be produced by conventional methods after cloning the gene encoding the cancer antigen of the present invention into an expression vector by conventional methods to obtain the protein encoded by the gene.

[0061] The "angiogenic inhibitor" of the present invention means a protein or compound that has the function of directly or indirectly inducing the death of cancer cells by suppressing the generation of new blood vessels around cancer cells. Preferably, the angiogenic inhibitor may be angiostatin, endostatin, thrombospondin, or protease inhibitory protein, but is not limited to these.

[0062] The "cancer antigen" of the present invention refers to a protein that is expressed in cancer cells but hardly expressed in normal cells, and which can induce an antitumor immune response, thereby directly or indirectly inducing the death of cancer cells. The cancer antigen of the present invention may preferably be alpha-fetoprotein (AFP), vascular endothelial growth factor receptor 2 (VEGFR2), survivin, legumain, prostate cancer specific antigen (PCSA), etc., but is not limited to these.

[0063] The "precursor drug convertase" of the present invention is a protein that has the function of converting an inactive drug into an active drug through enzymatic metabolism. When such a precursor drug convertase is used, the inactive drug is metabolized and converted into an active drug that can directly or indirectly induce the death of cancer cells, making it extremely useful for the prevention or treatment of cancer. The precursor drug converting enzyme of the present invention may preferably be thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, herpes simplex virus type I thymidine kinase / ganciclovir (HSV1-TK / GCV), β-glucuronidase, etc., but is not limited to these.

[0064] The "total cell death protein" of the present invention refers to a protein that induces the direct or indirect death of cancer cells by depriving them of factors (proteins, nutrients, oligonucleotides, etc.) that are essential for the growth or maintenance of cancer cells. The total cell death protein of the present invention may preferably be L-ASNase, RNA-binding motif protein 5 (RBM5), etc., but is not limited to these.

[0065] The cancer antigen-specific oligonucleotide of the present invention is a nucleotide that can suppress the expression or function of the cancer antigen by binding complementarily to the gene or mRNA of the cancer antigen, and may be, but is not limited to, any one selected from the group consisting of antisense oligonucleotides, aptamers, siRNAs, and shRNAs.

[0066] The "antisense oligonucleotide" of the present invention means DNA, RNA, or derivatives thereof that contain a nucleic acid sequence complementary to the sequence of a specific mRNA, and can bind to the complementary sequence in mRNA and inhibit the translation of mRNA into protein. The antisense oligonucleotide may be synthesized in vitro using, for example, a conventional method using RNA polymerase I, and then administered into the body, or it may be synthesized in vivo by a method such as using a vector in which the origin of the recognition site (MCS) is in the opposite direction.

[0067] In this invention, the term "aptamer" refers to a small, single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity. For the purposes of this invention, the target substance may be a gene or mRNA of a cancer antigen.

[0068] The "siRNA" in this invention refers to a short double-stranded RNA capable of inducing RNA interference (RNAi) by cleaving a specific mRNA. It consists of a sense RNA strand having a sequence homologous to the mRNA of a target gene and an antisense RNA strand having a complementary sequence. For the purposes of this invention, the siRNA can specifically bind to mRNA transcribed from a gene encoding a cancer antigen, thereby effectively suppressing the expression of such a gene.

[0069] The "shRNA" in this invention refers to short hairpin RNA, which has the advantages of a higher cell phenotype infection rate and the ability to maintain RNA interference for a long period of time compared to siRNA. RNA interference can be induced by the process of transforming cells with an RNA polymerase III promoter and then expressing adenovirus, lentivirus, or plasmid expression vector system, but is not limited to this. For the purposes of this invention, the shRNA can specifically bind to mRNA transcribed from a gene encoding a cancer antigen, thereby effectively suppressing the expression of such a gene.

[0070] Another embodiment of the present invention provides a recombinant vector comprising the DNA construct of the present invention.

[0071] The recombinant vector of the present invention comprises the DNA construct of the present invention, and the regulatory protein is expressed by another promoter, thereby enabling the genes operably linked downstream of the first and second promoters to be expressed in a balanced manner only when a substance that suppresses the regulatory protein is administered externally.

[0072] In the recombinant vector of the present invention, the contents relating to the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific to cancer antigen, reporter protein, and promoter are the same as those described in the DNA construct, and are therefore omitted to avoid excessive complexity in this specification.

[0073] The recombinant vector of the present invention is a means for introducing a protein into a cell, and can use known recombinant vectors such as plasmid vectors, cosmid vectors, and bacteriophage vectors. The recombinant vector can be easily produced by a person skilled in the art by any known method utilizing DNA recombination technology.

[0074] In the present invention, specific examples of the recombinant vector may be selected from, but are not limited to, the group consisting of commercially widely used pCDNA vectors, F, R1, RP1, Col, pBR322, ToL, Ti vectors, cosmid, lambda, lambdoid, M13, Mu, p1 P22, Qμ, T-even, T2, T3, T7 and other phages and plant viruses. For the purposes of the present invention, a suitable recombinant vector can be selected depending on the properties of the host cell.

[0075] In yet another embodiment of the present invention, a host cell or bacterial strain into which a recombinant vector comprising the DNA construct of the present invention has been introduced is provided.

[0076] The host cells of the present invention include, but are not limited to, at least one selected from the group consisting of, for example, bacterial cells such as Escherichia coli, Streptomyces or Salmonella strains; fungal cells such as yeast cells and Pichia pastris; insect cells such as Drosophila and Spodoptera Sf9 cells; animal cells such as CHO (Chinese hamster ovary cells), SP2 / 0 (mouse myeloma), human lymphoblastoid, COS, NSO (mouse myeloma), 293T cells, Bows' melanoma cells, HT-1080 cells, BHK cells (Baby Hamster Kidney cells), HEK cells (Human Embryonic Kidney cells) or PERC.6 cells (human retinal cells); and plant cells. For the purposes of the present invention, the bacterial strain may be at least one selected from the group consisting of anaerobic bacterial strains, such as Salmonella strains, Clostridium strains, Bifidobacterium strains, and Escherichia coli strains, preferably at least one selected from the group consisting of Salmonella typhimurium, Salmonella choleraesuis, and Salmonella enteritidis, and more preferably Salmonella typhimurium, but is not limited thereto.

[0077] The bacterial strain of the present invention may be a weakened form.

[0078] In this invention, "attenuation" means modifying genes or other structures so that toxicity and other side effects can be reduced when the microorganism is administered to a patient. For the purposes of this invention, if the strain is a Salmonella strain, attenuation may involve modifying at least one gene selected from the group consisting of aroA, aroC, aroD, aroE, Rpur, htrA, ompR, ompF, ompC, galE, cya, crp, cyp, phoP, phoQ, rfaY, dksA, hupA, sipC, clpB, clpP, clpX, pab, nadA, pncB, pmi, rpsL, hemA, rfc, poxA, galU, cdt, pur, ssa, guaA, guaB, fliD, flgK, flgL, relA, and spoA.

[0079] The method for modifying the gene of the present invention is carried out by various gene deletion or disruption methods known in the art, for example, such deletion and disruption methods are carried out by homologous recombination, chemical mutagenesis, irradiation mutagenesis, or transposon mutagenesis.

[0080] In the present invention, since the bacterial strain targets the inside of cancerous tissue, which is an environment with incomplete angiogenesis and oxygen deficiency that is very suitable for the growth of anaerobic bacterial strains, if a recombinant vector is introduced into such a bacterial strain that can simultaneously and balancedly express a reporter protein and an anti-cancer protein that can be imaged in real time, cancer can be diagnosed and treated very effectively.

[0081] In the bacterial strain of the present invention, the details concerning the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific to cancer antigen, reporter protein, promoter, and recombinant vector are the same as those described in the DNA construct and recombinant vector, and are therefore omitted to avoid excessive complexity in this specification.

[0082] The recombinant vector of the present invention can be introduced into host cells or bacterial strains by transformation (or phenotypic infection), but any transformation method can be used in the present invention and can be easily carried out by methods commonly used in the art. Specifically, the recombinant vector can be introduced into the bacterial strain using, but is not limited to, methods for transforming bacteria such as the Salmonella strain that can be commonly used, the CaCl2 precipitation method, the Hanahan method which is an improved version of the CaCl2 method using the reducing agent DMSO (Dimethyl sulfoxide), electroporation, calcium phosphate precipitation, plasmofusion, stirring with silicon carbide fibers, agrobacteria-mediated transformation, PEG-mediated transformation, dextransphosphate, lipofectamine, and drying / inhibition-mediated transformation methods.

[0083] In yet another embodiment of the present invention, a pharmaceutical composition for the prevention or treatment of cancer is provided.

[0084] The pharmaceutical composition of the present invention contains the bacterial strain of the present invention as an active ingredient.

[0085] When the aforementioned bacterial strain of the present invention is transformed with the DNA construct according to the present invention and targets cancer in an organism, and then a substance that suppresses regulatory proteins is administered, a reporter protein and an anti-cancer protein that can be imaged in real time are simultaneously expressed in a balanced manner within the strain, making it possible to prevent or treat cancer very effectively, and at the same time, to diagnose cancer in real time.

[0086] The "cancer" of the present invention is a disease characterized by the rapid and uncontrolled growth of mutated cells, including melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymph node cancer, gallbladder cancer, hematological cancer, thyroid cancer, endocrine cancer, oral cancer, liver cancer, biliary tract cancer, colorectal cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, gastric cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, It may be at least one selected from the group consisting of acute osteomyelitis, chronic lymphocytic leukemia, chronic osteomyelitis, and solitary myeloma, and preferably at least one selected from the group consisting of liver cancer, biliary tract cancer, colorectal cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, gastric cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, and skin cancer, and more preferably, colon cancer, but is not limited thereto.

[0087] The term "prevention" in this invention may include, without limitation, any action that blocks, suppresses, or delays symptoms caused by cancer using the active ingredient of this invention.

[0088] The term "treatment" in this invention means all actions using the active ingredient of this invention that result in an improvement in symptoms caused by cancer or an individual benefit, and means an attempt to obtain useful or desirable results, including clinical outcomes. Useful or desirable clinical outcomes may include, but are not limited to, alleviation or improvement of one or more symptoms or conditions, reduction of disease extent, stabilization of disease state, suppression of disease onset, suppression of disease spread, delay or postponement of disease progression, delay or postponement of disease onset, improvement or reduction of disease state, and reduction (in part or in whole), whether detectable or not. Furthermore, "treatment" may mean that the patient's survival is extended beyond what would be predicted from the absence of treatment. In addition, "treatment" may mean suppression of disease progression, temporary postponement of disease progression, and more preferably, permanent cessation of disease progression. As is understood by those skilled in the art, while improving the state of a particular disease, if the treated patient produces an adverse outcome, i.e., an outcome that outweighs all the benefits affected by the treatment, then the outcome may be unfavorable or undesirable.

[0089] In the pharmaceutical composition of the present invention, the details concerning the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific to cancer antigen, reporter protein, promoter recombinant vector, bacterial strain, and transformation are the same as those described for the DNA construct, recombinant vector, and bacterial strain, and are therefore omitted to avoid excessive complexity in this specification.

[0090] The pharmaceutical composition of the present invention is characterized in that it is in the form of a capsule, tablet, granule, injection, ointment, powder, or beverage, and the pharmaceutical composition may be characterized in that it is intended for human use.

[0091] The pharmaceutical compositions of the present invention, while not limited to these, can be prepared by conventional methods into oral dosage forms such as powders, granules, capsules, tablets, and aqueous suspensions, as well as topical preparations, suppositories, and sterile injection solutions. The pharmaceutical compositions of the present invention may contain pharmaceutically acceptable carriers. For oral administration, pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, and fragrances. For injections, buffers, preservatives, analgesics, solubilizers, isotonic agents, and stabilizers may be mixed and used. For topical administration, bases, excipients, lubricants, and preservatives may be used. The dosage forms of the pharmaceutical compositions of the present invention can be manufactured in a variety of ways by mixing them with the pharmaceutically acceptable carriers described above. For example, when administered orally, it can be manufactured in the form of tablets, lozenges, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injectable preparations, it can be manufactured in single-dose ampoules or in multi-dose formulations. In addition, it can be formulated into other dosage forms such as solutions, suspensions, tablets, capsules, and sustained-release formulations.

[0092] On the other hand, examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil. Additionally, fillers, anti-flocculants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be included.

[0093] The administration routes of the pharmaceutical composition of the present invention are not limited to those listed above, but include oral, intravenous, intramuscular, intraarterial, intramuscular, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal administration. Oral or parenteral administration is preferred.

[0094] The term "parenteral" in this invention includes subcutaneous, intradermal, intravenous, intramuscular, intra-articular, intra-sacral, intrasternal, intradural, intrafocal, and intracranial injection or infusion techniques. The pharmaceutical compositions of this invention may be further administered in the form of suppositories for rectal administration.

[0095] The pharmaceutical compositions of the present invention can vary considerably depending on various factors, including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, route of administration, excretion rate, drug formulation, and the severity of the specific disease being prevented or treated. The dosage of the pharmaceutical compositions will vary depending on the patient's condition, weight, disease severity, drug form, route of administration, and duration, but can be appropriately selected by those skilled in the art, and can be administered at a dose of 0.0001 to 50 mg / kg or 0.001 to 50 mg / kg per day. The administration may be once a day or in several divided doses. The dosage does not limit the scope of the present invention in any way. The pharmaceutical compositions according to the present invention can be formulated into pills, sugar-coated tablets, capsules, liquids, gels, syrups, slurries, and suspensions.

[0096] In yet another embodiment of the present invention, a composition for diagnosing cancer is provided.

[0097] The diagnostic composition of the present invention contains the bacterial strain according to the present invention as an active ingredient.

[0098] When the aforementioned bacterial strain of the present invention is transformed with the DNA construct according to the present invention and targets cancer cells in an organism, and then a substance that suppresses regulatory proteins is administered, a reporter protein and an anti-cancer protein that can be imaged in real time are simultaneously expressed in a balanced manner within the strain, making it possible to prevent or treat cancer very effectively, and at the same time, to diagnose cancer in real time.

[0099] The term "diagnosis" in this invention means all actions to confirm in vivo cancerous tissue, including the ability to monitor the presence or absence of cancer in real time by a reporter protein expressed from a DNA construct introduced into the strain, when the strain of the invention is positioned to target cancer.

[0100] In the diagnostic composition of the present invention, the details relating to the DNA construct, anti-cancer protein, reporter protein, constitutive promoter, inducible promoter, recombinant vector, Salmonella strain, transformation, cancer, etc., are the same as those described in the DNA construct, recombinant vector, strain, and pharmaceutical composition, and are therefore omitted to avoid excessive complexity in this specification.

[0101] In yet another embodiment of the present invention, a method for providing information for the diagnosis of cancer is provided.

[0102] The method of the present invention includes the step of treating a biological sample isolated from a target individual with a bacterial strain into which the recombinant vector according to the present invention has been introduced.

[0103] The method for providing information for the diagnosis of cancer according to the present invention may further include the step of diagnosing cancer if a reporter protein is expressed from the bacterial strain.

[0104] The term "biological sample" in this invention means any substance, tissue, or cell obtained from or derived from an individual, and may include, but is not limited to, tissue, cell, or cell extract.

[0105] In the diagnostic information provision method of the present invention, the contents relating to the DNA construct, anti-cancer protein, cytokine, chemokine, immunomodulator, oligonucleotide specific to cancer antigen, reporter protein, promoter, recombinant vector, bacterial strain, transformation, cancer, diagnosis, etc., are the same as those described in the DNA construct, recombinant vector, bacterial strain, pharmaceutical composition, and diagnostic composition, and are therefore omitted to avoid excessive complexity in this specification.

[0106] In yet another embodiment of the present invention, the present invention relates to a method for diagnosing, preventing, or treating cancer, comprising the step of administering the bacterial strain according to the present invention to an individual in a pharmaceutically effective amount.

[0107] In the present invention, the term "individual" refers to an individual that requires cancer prevention or treatment, and may include, but is not limited to, primates such as humans, as well as mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, and cats. [Effects of the Invention]

[0108] The DNA construct according to the present invention enables simultaneous cancer treatment and diagnosis by balancing the expression levels of genes operably linked downstream of a first promoter and a second promoter within a host bacterial strain or cell.

[0109] Furthermore, since the DNA construct of the present invention cannot express the anti-cancer protein and reporter protein at all in the absence of doxycycline, by adjusting the presence or absence of doxycycline treatment, it is possible to express the anti-cancer protein at an appropriate dose for cancer treatment while simultaneously monitoring the size of the tumor in real time based on the expression level of the reporter protein. [Brief explanation of the drawing]

[0110] [Figure 1] This is a schematic diagram of a DNA construct according to one embodiment of the present invention. [Figure 2] This is a schematic diagram of a DNA construct according to one embodiment of the present invention. [Figure 3] This is a schematic diagram showing the base sequences of the promoter-35 and-10 sites of the terR protein as predicted by a DNA construct according to one embodiment of the present invention. [Figure 4] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 5] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 6] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 7] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 8] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 9] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 10] This shows the results of the analysis of the luciferase activity of a reporter protein according to one embodiment of the present invention. [Figure 11] The following are the results of Western blot analysis and Coomassie blue staining performed according to one embodiment of the present invention. [Figure 12] This shows the results of confirming the expression level of the reporter protein by analyzing luciferase activity. [Figure 13] This shows the results of confirming the degree of hemolytic activity of the bacterial strains in relation to blood agar. [Figure 14] The following are the results of Western blot analysis and Coomassie blue staining performed according to one embodiment of the present invention. [Figure 15]This shows the results of confirming the expression level of the reporter protein by analyzing luciferase activity. [Figure 16] This shows the results of confirming the expression level of the reporter protein by analyzing luciferase activity. [Figure 17] This shows the results of confirming the degree of reporter protein expression in a tumor animal model by analyzing luciferase activity according to one embodiment of the present invention. [Figure 18] This shows the results of confirming the degree of reporter protein expression in a tumor animal model by analyzing luciferase activity according to one embodiment of the present invention. [Figure 19] This shows the results of Western blot analysis, which confirmed the level of expression of cytolysin A (ClyA) protein in tumor tissue. [Figure 20] This is the result of evaluating the size of a tumor according to one embodiment of the present invention. [Figure 21] This shows the results of an analysis of the survival rate in tumor animal models treated with the bacterial strain according to the present invention. [Figure 22] This graph shows the luciferase activity between bacterial strains after introducing the pTetTac-RR, pTetJ23101-RR, and pTetJ23119-RR plasmids according to one embodiment of the present invention into the strains. [Figure 23] This figure shows the results of measuring the luciferase activity between bacterial strains after introducing the pTetTac-RR, pTetJ23101-RR, and pTetJ23119-RR plasmids according to one embodiment of the present invention into the strains. [Modes for carrying out the invention]

[0111] One embodiment of the present invention provides a DNA construct. [Examples]

[0112] The present invention will be described in more detail below through the examples. These examples are merely for the purpose of illustrating the present invention in more detail, and it will be obvious to those with ordinary skill in the art that the scope of the present invention is not limited by these examples, given the gist of the invention.

[0113] Examples [Preparation Example 1] Preparation of a DNA construct regulated by doxycycline [1-1] Construction of a DNA construct containing the OXB1 promoter Using the pJL39 plasmid (Mol Ther., 21(11), p.1985-1995, (2013)) as a template (Figure 1), the tetR gene was amplified using forward primers (5'-CGGAATTCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG-3'; SEQ ID NO: 2) designed to contain the restriction enzyme EcoRI site and reverse primers (5'-GCTCTAGACAGCTGTTAAGACCCACTTTCACATTTAAGTTGTTTTTCT-3'; SEQ ID NO: 3) designed to contain the restriction enzyme PvuII-XbaI site. Subsequently, the amplified product was cleaved with the restriction enzymes EcoRI and XbaI, purified, and then the tetR gene amplification product was obtained. This product was then used to obtain pBAD24 (catalog number ATCC○). R 87399 TM The pBAD-TetR plasmid was constructed by introducing it into a plasmid (ATCC, USA).

[0114] Subsequently, the pTetR-BAD plasmid was constructed by introducing a divergent promoter region containing multiple cloning sites into the pBAD-TetR plasmid using the PvuII and HindIII fragments of the pJL39 plasmid. The pTetII plasmid was constructed by removing the araC and araBAD promoters from the pTetR-BAD plasmid using NheI and Pcil restriction enzymes.

[0115] Using pSF-OXB1 (Oxford Genetics, England) as a template, the constitutive promoter OXB1 (SEQ ID NO: 16), amplified with forward-facing primers (5'-CTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTGCT-3'; SEQ ID NO: 4) and reverse-facing primers (5'-TGAATTCCTCCTGCTAGCTAGTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3'; SEQ ID NO: 5), was introduced into the pTetII plasmid using the Gibson assembly method to ultimately construct the pJH18 plasmid containing OXB1, tetA, and tetR promoters.

[0116] Using the aforementioned pJH18 plasmid as a backbone, the pJH18-RR, pJH18-AR, and pJH18-CR plasmids were constructed by introducing the genes encoding tetR, Rluc8, and cytolysin A (ClyA) downstream of the promoter in the combinations shown in Table 1 below (Figure 2).

[0117] [Table 1]

[0118] [1-2] Construction of DNA constructs containing OXB11, 13, and 20 promoters Using the same method as in the above preparation example [1-1], the constitutive promoters OXB11, OXB13, and OBX20, amplified with forward-facing primers (5'-TGCTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTG-3': SEQ ID NO: 6) and reverse-facing primers (5'-AGCTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3': SEQ ID NO: 7) using pSF-OXB11, pSF-OXB13, or pSF-OXB20 as templates, were introduced into the pJH18 plasmid prepared in the above preparation example [1-1] using the Gibson assembly method (pTetOXB11-AR, pTetOXB11-RR, pTetOXB13-AR, pTetOXB13-RR, pTetOXB20-AR, pTetOXB20-RR). Here, the protein expression efficiency by the plasmids is highest for OXB11, followed by OXB13 and OXB20, while OXB1 shows the weakest protein expression efficiency.

[0119] [1-3] Construction of DNA constructs containing the Tac promoter The constitutive promoter Tac was introduced into the pJH18 plasmid prepared in the above preparation example [1-1]. Specifically, the Tac promoter sequence, which is the constitutive promoter, was amplified using a forward Tac primer (5'-CCCTATGCTACTCCGTCAAGCCGTCAATTGTTGACAATTAATCATCGGCTCGTATAATGTCTGATTCGTTACCAAGCT-3': SEQ ID NO: 10) and a reverse Tac primer (5'-AGCTTGGTAACGAATCAGACATTATACGAGCCGATGATTAATTGTCAACAATTGACGGCTTGACGGAGTAGCATAGGG-3': SEQ ID NO: 11). Then, the Tac promoter was introduced into the pJH18 plasmid using the Gibson assembly method to prepare the pTetTac-RR plasmid.

[0120] [1-4] Construction of a DNA construct containing the J23101 promoter Similarly, the constitutive promoter J23101 was introduced into the pJH18 plasmid prepared in the above preparation example [1-1]. Specifically, the J23101 promoter sequence was amplified using a forward primer (5'-TGCTACTCCGTCAAGCCGTCTTTACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3': SEQ ID NO: 12) and a reverse primer (5'-GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTAAAGACGGCTTGACGGAGTAGCA-3': SEQ ID NO: 13). Then, the J23101 promoter was introduced into the pJH18 plasmid using the Gibson assembly method to prepare the pTetJ23101-RR plasmid.

[0121] [1-5] Construction of a DNA construct containing the J23119 promoter Similarly, the constitutive promoter J23119 was introduced into the pJH18 plasmid prepared in the above preparation example [1-1]. Specifically, the J23119 promoter sequence was amplified using a forward primer (5'-TGCTACTCCGTCAAGCCGTCTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3': SEQ ID NO: 14) and a reverse primer (5'-GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAGACGGCTTGACGGAGTAGCA-3': SEQ ID NO: 15). Then, the J23119 promoter was introduced into the pJH18 plasmid using the Gibson assembly method to prepare the pTetJ23119-RR plasmid.

[0122] [Preparation Example 2] Cancer cell line and culture conditions The CT26 colon cancer cell lines CRL-2638 and HB-8064 (ATCC, USA) and the mouse colorectal adenocarcinoma cell line MC38 (Massachusetts General Hospital and Harvard Medical School, USA, and Chonnam National University, South Korea) were used in the experiment.

[0123] The cells were cultured in a 5% CO2 incubator at 37°C using high-glucose DMEM (Dulbecco's Modified Eagles Medium) medium (catalog number: #LM001-05, Wellgin, Korea) containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin.

[0124] [Preparation Example 3] Creation of a Salmonella strain into which a plasmid has been introduced The Salmonella strain used was SHJ2037 (relA::cat, spoT::kan), a Salmonella typhimurium (S. typhimurium) deficient in ppGpp.

[0125] Salmonella strains were transformed with the plasmid prepared in Preparation Example 1 using electroporation. Each transformed strain was then cultured overnight in LB medium containing 100 μg / ml ampicillin. The culture solution was then diluted 1:100 with fresh LB medium containing ampicillin, and further culture was performed to induce OD (Oral Dissociation). 600 When the value reached 0.5 to 0.7, doxycycline diluted with ethanol was added to the culture medium so that the final concentrations were 0, 10, 50, 100, 300, and 500 ng / ml, and the culture was performed in a shaking incubator at 200 rpm and 37°C.

[0126] [Preparation Example 4] Preparation of experimental animal models C57BL / 6 and BALB / C mice aged 5 to 6 weeks, weighing 20 to 30 g (Orient Company, South Korea) were used. MC38 or CT26 obtained in Preparation Example 2 was subcutaneously injected into the flank of said mice to construct a tumor animal model.

[0127] For imaging the tumor animal model and evaluating tumor size, 2% isoflurane was used for anesthesia, and 200 mg / kg of ketamine and 10 mg / kg of xylazine were used during surgery.

[0128] The size of said tumor (mm 3 ) was calculated using the formula (length × height × width) / 2, and when the tumor size of the animal model reached 1500 mm 3 or more, the animal model was euthanized.

[0129] [Example 1] Prediction of tetR promoter in pTetII plasmid For the pTetII plasmid prepared as an intermediate product in said Preparation Example [1-1], the sequence of the promoter capable of regulating the expression of tetR protein was predicted using BPROM (Bacterial sigma 70 promoter prediction program), and the results are shown in Figure 3.

[0130] As shown in Figure 3, with reference to the tetR protein of the pTetII plasmid, the nucleotide sequence of SEQ ID NO: 6 was predicted at the -35 site, and the nucleotide sequence of SEQ ID NO: 7 was predicted at the -10 site.

[0131] Through the above results, it can be seen that the pTetII plasmid according to the present invention can naturally express tetR protein even when it does not contain an additional promoter such as OXB1, as long as SEQ ID NO: 6 and SEQ ID NO: 7 can be respectively located at the -35 and -10 sites.

[0132] [Example 2] Comparison of protein expression levels and luciferase activity in strains into which pJH18-RR and pJH18-AR plasmids have been introduced. [2-1] Comparison of protein expression levels by Western blot analysis and Coomassie Blue staining To confirm whether the expression levels of the genes introduced downstream of the tetA and tetR promoters in the plasmids prepared in Preparation Example [1-1] were in equilibrium, the Rluc8 protein expressed from the bacterial strains of Preparation Example 3, each of which the plasmids prepared in Preparation Example [1-1] were introduced, was stained with Coomassie blue stain or subjected to Western blotting analysis using an antibody specific to the protein.

[0133] Specifically, the culture solution of the bacterial strain from Preparation Example 3 is divided into 4 × 10 7 The sample was diluted with PBS to a CFU / ml concentration and centrifuged at 13,000 rpm for 5 minutes to collect the pellet. The pellet fraction was washed with PBS and mixed with SDS sample buffer containing 0.2% β-mercaptoethanol (catalog number: EBA-1052, ELPIS BIOTECH) to obtain a strain lysate. The strain lysate was then subjected to electrophoresis using 15% SDS-PAGE, and the gel was stained with Coomassie blue stain, or the protein was transferred from the gel to a nitrocellulose membrane and blocked at room temperature with 5% skim milk. Subsequently, the expression level of the Rluc8 protein was confirmed using Rluc8 antibody (catalog number: AB3256, Millipore, USA), and the results are shown in Figure 4.

[0134] As shown in Figure 4, the expression level of RLuc8 protein from the tetA promoter was 2 to 6 times higher than that of protein expressed from the tetR promoter, and it responded very sensitively to saturated inducer concentrations even at the lowest concentration of doxycycline (10 ng / ml).

[0135] [2-2] Comparison of functional expression levels of proteins by analysis of luciferase activity To measure the luciferase activity in the strains of Preparation Example 3, each of which had the plasmids prepared in Preparation Example [1-1] introduced, the strains were resuspended in 1 ml of PBS. Then, 1 μg / ml of coelenterazine diluted with ethanol, the substrate, was added to the resuspended strains, and the luciferase activity was measured using a NightOWL II LB 983 In Vivo imaging system (Berthold Technologies, GmbH & Co. KG, Germany) or a Bio-Rad imager ChemoDoc™ XRS+ system under a 1-second exposure condition. The measured values ​​were standardized by the CFU of each strain, and the relative luminescence units (RLU), which are normalized values ​​using the values ​​containing the control plasmid that did not contain Rluc8, were calculated, and the results are shown in Figures 5 and 6.

[0136] As shown in Figures 5 and 6, luciferase activity was only detected in the presence of doxycycline (Figure 5), and the activity levels of proteins regulated by the tetA and tetR promoters were found to be approximately three times higher with the tetA promoter compared to the tetR promoter (Figure 6).

[0137] The results above show that when the tetR protein, a regulatory protein that can suppress both the tetA and tetR promoters, is continuously expressed by another promoter, both the tetA and tetR promoters can be simultaneously induced only when a tetR protein inhibitor is present.

[0138] [2-3] Comparison of luciferase activity between pTetII plasmid and pJH18-CR plasmid The pTetII plasmid and pJH18-CR plasmid, which were prepared as intermediate products in the above preparation example [1-1], were introduced into the bacterial strains in the same manner as in the above preparation example 3. The luciferase activity between the bacterial strains was then measured in the same manner as in the above example [2-2], and the results are shown in Figures 7 and 8.

[0139] As shown in Figures 7 and 8, we confirmed that luciferase activity levels increase in a doxycycline concentration-dependent manner not only when the OXB1 promoter is present (pJH18-CR), but also when the nucleotide sequences represented by SEQ ID NOs. 8 and 9 are located at the -35 and -10 sites, respectively.

[0140] Through the results described above, it can be seen that in the case of a plasmid containing the DNA construct according to the present invention, the base sequence inherent in the plasmid acts as a promoter to induce the expression of the regulatory protein, and therefore the regulatory protein can be continuously expressed without artificially introducing another promoter upstream of the regulatory protein.

[0141] [2-4] Comparison of luciferase activity between DNA constructs containing OXB1 and OXB11 promoters The pTetOXB11 plasmid and pJH18 plasmid prepared in the above preparation example [1-2] were introduced into bacterial strains in the same manner as in the above preparation example 3. The luciferase activity between the bacterial strains was then measured in the same manner as in the above example [2-2], and the results are shown in Figures 9 and 10.

[0142] As shown in Figures 9 and 10, we confirmed that luciferase activity was higher in the presence of the weaker OXB1 promoter (pJH18) than in the presence of the OXB11 promoter (pTetOXB11).

[0143] The results above show that, compared to plasmids containing intermediate promoters, plasmids containing weak promoters effectively increase the expression level of target proteins by lowering the expression level of regulatory proteins downstream of the promoter, thereby making them sensitive to doxycycline concentration, and ultimately leading to a balance in the expression levels of genes downstream of the tetA and tetR promoters.

[0144] [Example 3] Comparison of protein expression and activity levels in strains into which the pJH18-CR plasmid has been introduced. [3-1] Comparison of protein expression and activity levels The pJH18-CR(P) from Preparation Example [1-1] was analyzed using the same method as described in Examples [2-1] and [2-2], including Western blot analysis, Coomassie blue staining, and luciferase activity analysis. OXB1 ::tetR,P tetA ::ClyA and P tetR ::Rluc8) performed an analysis of protein expression levels in the strain introduced by the method described in Preparation Example 3, and the results are shown in Figures 11 and 12.

[0145] As shown in Figures 11 and 12, when a strain of pJH18-CR was treated with doxycycline, we confirmed that the expression levels of cytolysin A protein and Rluc8 protein were expressed in a nearly equal and balanced manner.

[0146] [3-2] Confirmation of hemolytic activity The pJH18-CR strain from Preparation Example [1-1], diluted in PBS, was introduced using the method described in Preparation Example 3. This strain was then smeared onto a blood agar plate containing 0 or 20 ng / ml of doxycycline, incubated overnight at 37°C, and photographs of the plate were taken. The results are shown in Figure 13.

[0147] As shown in Figure 13, we confirmed that the hemolytic activity of the bacterial strain's blood agar appeared only when doxycycline was present (+), regardless of the type of promoter located upstream of the gene encoding cytolysin A.

[0148] The results described above show that the tetA and tetR promoters of the plasmid according to the present invention are activated solely by doxycycline, thereby effectively regulating the protein expression level at the same time.

[0149] [Example 4] Comparison of protein expression levels in strains into which pJH87 and pJH18-CR plasmids were introduced. The pJH87(P) was analyzed using the same method as described in Examples [2-1] and [2-2] above, including Western blot analysis, Coomassie blue staining, and luciferase activity analysis. tetA ::ClyA and P tetR ::TetR::Rluc8) and pJH18-CR(P OXB1 ::tetR,P tetA ::ClyA and P tetR In the strain introduced by the method described in Preparation Example 3, ::Rluc8) was administered doxycycline at a concentration of 20 ng / ml or higher to induce saturation of cytolysin A protein expression levels. Protein expression levels were then analyzed, and the results are shown in Figures 14-16.

[0150] As shown in Figures 14-16, we confirmed that the expression level of cytolysin A protein was approximately five times higher in strains into which the pJH18-CR plasmid was introduced compared to strains into which the pJH87 plasmid was introduced. Furthermore, we confirmed that the activity level of Rluc8 protein was approximately 80 times higher in strains into which the pJH18-CR plasmid was introduced compared to strains into which the pJH87 plasmid was introduced.

[0151] Through the results described above, it can be seen that, compared to plasmids configured so that the gene encoding tetR is located downstream of the tetR promoter, when the gene encoding tetR is regulated by another promoter, particularly a weak promoter, as in the present invention, not only can the anti-cancer protein and the reporter gene be simultaneously expressed and activated at high levels by the tetA and tetR promoters, which can be activated by a single regulator, but their expression and activation ratios can also be relatively balanced.

[0152] [Example 5] Tumor suppression ability and visualization analysis of recombinant bacterial strains in tumor animal models in which cancer was induced Using the method described in Preparation Example 3, a Salmonella strain containing pJH18-CR or pJH18 was injected into the tail vein of the tumor animal model constructed in Preparation Example 4. Subsequently, the luciferase activity analysis method and Western blot analysis method described in Examples [2-1] and [2-2] were used to visualize the strain within the tumor animal model and analyze the cytolysin A protein expression level. The results are shown in Figures 17-19.

[0153] Furthermore, in the tumor animal model described above, the tumor size was measured for 0 to 34 days as in Preparation Example 4, and the survival rate of the tumor animal model was measured for 50 days. The results are shown in Figures 20 and 21. In this case, as a control group, only PBS was injected into the tail vein of the tumor animal model.

[0154] As shown in Figures 17-18, luciferase activity was confirmed to be measured only in tumor tissue of tumor animal models injected with Salmonella strains containing pJH18-CR, compared to the control group. Furthermore, luciferase activity was also confirmed to be measured when tumor tissue from the tumor animal models injected with the aforementioned Salmonella strains containing pJH18-CR was excised. In addition, as shown in Figure 19, it was confirmed that in the case of Salmonella strains containing pJH18-CR, cytolysin A protein is specifically expressed only in (Dox+) strains when doxycycline is present.

[0155] As shown in Figures 20 and 21, we confirmed that tumor size was significantly reduced and survival rates increased in tumor animal models in which cytolysin A protein was expressed from Salmonella strains into which pJH18-CR was introduced, compared to cases in which PBS and pJH18 were injected.

[0156] Through the results described above, it can be seen that in the case of Salmonella strains into which pJH18-CR according to the present invention has been introduced, by activating promoters that regulate the expression of visualizeable proteins and anti-cancer proteins by a single regulatory factor, the location of tumors in individuals with tumors can be accurately visualized, and at the same time, tumor growth can be suppressed, significantly improving the survival rate of individuals with cancer.

[0157] [Example 6] Comparison of luciferase activity between DNA constructs containing promoters The pTetTac-RR, pTetJ23101-RR, and pTetJ23119-RR plasmids prepared in the above preparation examples [1-3] to [1-5] were introduced into bacterial strains in the same manner as in preparation example 3. The luciferase activity between the strains was then measured in the same manner as in example [2-2], and the results are shown in Figures 22 and 23.

[0158] As shown in Figures 22 and 23, we confirmed that the plasmid containing the OXB1 promoter (pJH18) exhibited higher sensitivity to doxycycline and higher luciferase activity compared to the plasmids containing the Tac, J23101, and J23119 promoters (pTetTac-RR, pTetJ23101-RR, pTetJ23119-RR).

[0159] Through the results described above, it can be seen that, compared to plasmids containing publicly available constitutive promoters, plasmids containing the weak promoter of the present invention effectively increase the expression level of the target protein by making it sensitive to doxycycline concentration, thereby reducing the expression level of the regulatory protein downstream of the promoter, and ultimately leading to a balance in the expression levels of the genes downstream of the tetA and tetR promoters.

[0160] Although specific parts of the present invention have been described in detail above, it is clear to those with ordinary skill in the art that such specific descriptions are merely preferred embodiments and therefore do not limit the scope of the present invention. Accordingly, the substantial scope of the present invention is defined by the appended claims and their equivalents. [Industrial applicability]

[0161] The present invention relates to a DNA construct for the diagnosis and treatment of cancer, and to a bacterial strain into which a recombinant vector containing the DNA construct has been introduced.

[0162] Array list free text Sequence ID 1: Amino acid sequence of cytolysin A 10 20 30 40 50 MIMTGIFAEQ TVEVVKSAIE TADGALDLYN KYLDQVIPWK TFDETIKELS 60 70 80 90 100 RFKQEYSQEA SVLVGDIKVL LMDSQDKYFE ATQTVYEWCG VVTQLLSAYI 110 120 130 140 150 LLFDEYNEKK ASAQKDILIR ILDDGVKKLN EAQKSLLTSS QSFNNASGKL 160 170 180 190 200 LALDSQLTND FSEKSSYFQS QVDRIRKEAY AGAAAGIVAG PFGLIISYSI 210 220 230 240 250 AAGVIEGKLI PELNNRLKTV QNFFTSLSAT VKQANKDIDA AKLKLATEIA 260 270 280 290 300 AIGEIKTETE TTRFYVDYDD LMLSLLKGAA KKMINTCNEY QQRHGKKTLF EVPDV

[0163] Sequence ID 2: Forward primer 5'-CGGAATTCACCATGTCTAGATTAGATAAAAGTAAAGTGATTAACAG-3'

[0164] Sequence ID 3: Reverse primer 5'-GCTCTAGACAGCTGTTAAGACCCACTTTCAATTTAAGTTGTTTTTCT-3'

[0165] Sequence ID 4: Forward primer 5'-CTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTGCT-3'

[0166] Sequence ID 5: Reverse primer 5'-TGAATTCCTCCTGCTAGCTAGTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3'

[0167] Sequence ID 6: Forward primer 5'-TGCTACTCCGTCAAGCCGTCAAGCTGTTGTGACCGCTTG-3'

[0168] Sequence ID 7: Reverse primer 5'-AGCTTGGTAACGAATCAGACGCCGGGTAATACCGGATAG-3'

[0169] Sequence ID 8: -35 promoter TTCGCG

[0170] Sequence ID 9: -10 promoter ATGCATAAT

[0171] Sequence ID 10: Forward primer 5'-CCCTATGCTACTCCGTCAAGCCGTCAATTGTTGACAATTAATCATCGGCTCGTATAATGTCTGATTCGTTACCAAGCT-3'

[0172] Sequence ID 11: Reverse primer 5'-AGCTTGGTAACGAATCAGACATTATACGAGCCGATGATTAATTGTCAACAATTGACGGCTTGACGGAGTAGCATAGGG-3'

[0173] Sequence ID 12: Forward primer 5'-TGCTACTCCGTCAAGCCGTCTTTACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3'

[0174] Sequence ID 13: Reverse primer 5'- GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTAAAGACGGCTTGACGGAGTAGCA-3'

[0175] Sequence ID 14: Forward primer 5'- TGCTACTCCGTCAAGCCGTCTTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGCCAATTGTCTGATTCGTTACC-3'

[0176] Sequence ID 15: Reverse primer 5’- GGTAACGAATCAGACAATTGGCTAGCATTATACCTAGGACTGAGCTAGCTGTCAAGACGGCTTGACGGAGTAGCA-3’

[0177] SEQ ID NO: 16: OXB1 promoter 5’- AAGCTGTTGTGACCGCTTGCTCTAGCCAGCTATCGAGTTGTGAACCGATCCATCTAGCAATTGGTCTCGATCTAGCGATAGGCTTCGATCTAGCTATGTAGAAACGCCGTGTGCTCGATCGCCTGACGCTTTTTATCGCAACTCTCTACTGTTGCTTCAACAGAACATATTGACTATCCGGTATTACCCGGC-3’

Claims

1. Genes that code for regulatory proteins, The promoter of the gene encoding the regulatory protein, the first promoter and the second promoter induced by the regulatory protein, and It includes one selected from the group consisting of genes encoding anti-cancer proteins; genes encoding cytokines; genes encoding chemokines; genes encoding immunomodulators; oligonucleotides specific to cancer antigens; and genes encoding reporter proteins. The regulatory protein is the TetR protein, The promoter of the gene encoding the regulatory protein is the OXB1 promoter. The first promoter is the tetA promoter, The second promoter is the tetR promoter, A DNA construct wherein one of the following genes, selected from the group consisting of genes encoding anti-cancer proteins; genes encoding cytokines; genes encoding chemokines; genes encoding immunomodulators; oligonucleotides specific to cancer antigens; and genes encoding reporter proteins, is operably linked downstream of the first promoter and the second promoter.

2. The DNA construct according to claim 1, wherein the anti-cancer protein is at least one selected from the group consisting of toxin proteins, antibodies or fragments of antibodies specific to cancer antigens, tumor suppressor proteins, angiogenesis inhibitors, cancer antigens, prodrug-converting enzymes, and pro-apoptotic proteins.

3. The DNA construct according to claim 2, wherein the toxin protein is at least one selected from the group consisting of lysine, saporin, geronin, momordin, debouganin, diphtheria toxin, pseudomonas toxin, hemolysin (HlyA), FAS ligand (FASL), tumor necrosis factor-α (TNF-α), and TNF-related apoptosis-inducing ligand (TRAIL).

4. The DNA construct according to claim 2, wherein the tumor suppressor protein is at least one selected from the group consisting of RB (Retinoblastoma protein) protein, p53 protein, APC (Adenomatous polyposis coli) protein, PTEN (Phosphatase and tensin homologue) protein, and CDKN2A (cyclin dependent kinase inhibitor 2A) protein.

5. The DNA construct according to claim 2, wherein the angiogenesis inhibitor is at least one selected from the group consisting of angiostatin, endostatin, thrombospondin, and protease inhibitory proteins.

6. The DNA construct according to claim 2, wherein the cancer antigen is at least one selected from the group consisting of alpha-fetoprotein (AFP), vascular endothelial growth factor receptor 2 (VEGFR2), survivin, legumain, and prostate cancer-specific antigen (PCSA).

7. The aforementioned precursor drug-converting enzymes include thymidine kinase, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, carboxypeptidase G2, chromate reductase YieF, and herpes simplex virus type I thymidine kinase / ganciclovir. The DNA construct according to claim 2, wherein the DNA construct is at least one selected from the group consisting of kinase / ganciclovir (HSV1-TK / GCV) and β-glucuronidase.

8. The DNA construct according to claim 2, wherein the total cell death protein is L-ASNase or RNA-binding motif protein 5 (RBM5).

9. The DNA construct according to claim 1, wherein the oligonucleotide specific to the cancer antigen is a base sequence encoding at least one selected from the group consisting of antisense oligonucleotides, aptamers, siRNAs, and shRNAs.

10. The reporter protein is at least one selected from the group consisting of fluorescent proteins, luciferases, and proteins used in nuclear medicine or MRI imaging. The DNA construct according to claim 1, wherein the protein used for nuclear medicine or MRI imaging is at least one selected from the group consisting of herpes simplex virus thymidine phosphate enzyme, dopamine receptor, somatostatin receptor, sodium-iodide transporter, iron receptor, transferrin receptor, ferritin, and iron transporter (magA).

11. The fluorescent proteins include Green Fluorescent Protein (GFP), Modified Green Fluorescent Protein (MGFP), Enhanced Green Fluorescent Protein (EGFP), Red Fluorescent Protein (RFP), Enhanced Red Fluorescent Protein (ERFP), Blue Fluorescent Protein (BFP), and Enhanced Blue Fluorescent Protein. The DNA construct according to claim 10, wherein the DNA construct is at least one selected from the group consisting of Protein (EBFP), Yellow Fluorescent Protein (YFP), and Enhanced Yellow Fluorescent Protein (EYFP).

12. A recombinant vector comprising the DNA construct described in claim 1.

13. A bacterial strain into which the recombinant vector described in claim 12 has been introduced.

14. The strain according to claim 13, wherein the strain is at least one selected from the group consisting of strains of the genus Salmonella, Clostridium, Bifidobacterium, and Escherichia coli.

15. A pharmaceutical composition for the diagnosis, prevention, or treatment of cancer, comprising the bacterial strain described in claim 13 as an active ingredient.

16. The pharmaceutical composition according to claim 15, wherein the cancer is at least one selected from the group consisting of melanoma, fallopian tube cancer, brain cancer, small intestine cancer, esophageal cancer, lymph node cancer, gallbladder cancer, hematological cancer, thyroid cancer, endocrine cancer, oral cancer, liver cancer, biliary tract cancer, colorectal cancer, rectal cancer, cervical cancer, ovarian cancer, kidney cancer, gastric cancer, duodenal cancer, prostate cancer, breast cancer, brain tumor, lung cancer, anaplastic thyroid cancer, uterine cancer, colon cancer, bladder cancer, ureteral cancer, pancreatic cancer, bone / soft tissue sarcoma, skin cancer, non-Hodgkin lymphoma, Hodgkin lymphoma, multiple myeloma, leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, acute osteomyelitis, chronic lymphocytic leukemia, chronic osteomyelitis, and solitary myeloma.

17. A diagnostic composition for cancer comprising the bacterial strain described in claim 13 as an active ingredient.

18. A method for providing information for cancer diagnosis, comprising the step of treating a biological sample isolated from a target individual with the strain described in claim 13.

Citation Information

Patent Citations

  • JPP7789355B