Metabolite sensor and enzyme activity screening method
Patent Information
- Application Number
- JP2024150625
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-09-02
- Publication Date
- 2026-09-30
- Estimated Expiration
- 2040-02-29
AI Technical Summary
【0008】 本発明は、新規な代謝物センサ、並びに、新規な酵素活性のスクリーニング方法を提供することができた。
Smart Images

Figure 0007926784000012 
Figure 0007926784000013 
Figure 0007926784000014
Abstract
Description
[Technical Field]
[0001] (Current status of biosensors) The ability to monitor the intracellular concentrations of any substance, such as metabolites or environmental monitoring substances, in real time would greatly contribute to the advancement of life sciences. However, adjusting the performance (sensitivity) of metabolite sensors is difficult.
[0002] (Metabolite sensor) While there is a very high demand for metabolite sensors, on-demand sensor fabrication for specific metabolites is extremely difficult. For physiologically vital metabolites (such as ATP, pyruvate, and some amino acids), organisms (cells) themselves possess sensors. Improving these naturally occurring sensors makes it possible to monitor these metabolites. However, creating sensors for new metabolites has required highly complex and time-consuming technologies.
[0003] (prior art) The present inventors have already disclosed a "multi-input, multi-output gene switch and method for manufacturing the same (Patent Document 1)" that differs from conventional sensor fabrication methods. However, Patent Document 1 does not disclose the metabolite sensor and enzyme activity screening method of the present invention. [Prior art documents] [Patent Documents]
[0004] [Patent Document 1] WO2019 / 182156 publication [Overview of the Initiative] [Problems that the invention aims to solve]
[0005] The objective is to provide a novel metabolite sensor and a novel method for screening enzyme activity. [Means for solving the problem]
[0006] The inventors have completed a novel metabolite sensor using their newly developed "method for manufacturing a multi-input, multi-output gene switch," and have further developed a novel enzyme activity screening method, thereby completing the present invention.
[0007] In other words, the present invention is as follows: 1. CODM variants identified by any one of the following amino acid sequences or genes (1) to (7): (1) The amino acid sequence shown in Sequence ID No. 51 has amino acid substitutions at positions 121 and 346. (2) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, (3) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitution Q121L or R346H and has substantially equivalent devine and / or codeine detection activity to that of (2) above. (4) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 121 and 346, and has substantially the same devine and / or codeine detection activity as (2) above. (5) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, has 90% or more homology to the amino acid sequence described in Sequence ID No. 51, and has substantially equivalent devine and / or codeine detection activity to that of (2) above. (6) A gene encoding a polypeptide having substantially equivalent devine and / or codeine detection activity to that of (2) above, in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above, and (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent devine and / or codeine detection activity to that of (2) above. 2. The CODM variant described in item 1 above, for the detection of devine and / or codeine. 3. LuxR variants identified by any one of the following amino acid sequences or genes (1) to (11): (1) The amino acid sequence shown in Sequence ID No. 11 has amino acid substitutions at N86K and C245W, and further has amino acid substitutions at positions 33 and 57. (2) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K and C245W, and further has the amino acid substitutions T33A and S57T, (3) The amino acid sequence shown in Sequence ID No. 11 has 3 or 4 amino acid substitutions selected from N86K, C245W, T33A and S57T, and has substantially equivalent transcriptional enhancement activity or AHL detection sensitivity to that of (2) above. (4) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 86, 245, 33 and 57, and has substantially the same transcriptional enhancement activity or AHL detection sensitivity as (2) above. (5) The amino acid sequence shown in SEQ ID NO: 11 has the amino acid substitutions N86K, C245W, T33A and S57T, has 90% or more homology to the amino acid sequence described in SEQ ID NO: 11, and has substantially equivalent transcriptional enhancement activity or AHL detection sensitivity to that of (2) above. (6) A gene encoding a polypeptide having substantially equivalent transcriptional enhancement activity or AHL detection sensitivity to that of (2) above, in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent transcriptional enhancement activity or AHL detection sensitivity to (2) above. (8) A gene consisting of DNA with the base sequence described in Sequence ID No. 77, (9) A gene encoding a polypeptide that hybridizes under stringent conditions with DNA consisting of a DNA sequence complementary to the DNA sequence described in Sequence ID No. 77, and which has substantially equivalent transcriptional enhancement activity or AHL detection sensitivity to that of (2) above. (10) A gene consisting of DNA in which 1 to 50 base sequences are substituted, deleted, inserted and / or added in the DNA consisting of the base sequence described in Sequence ID No. 77, and (11) A gene consisting of DNA that has 90% or more homology to the DNA consisting of the base sequence described in Sequence ID No. 77. 4. The LuxR mutant described in paragraph 3 above, characterized in that the LuxR mutant has higher transcriptional enhancement activity or AHL detection sensitivity compared to wild-type LuxR. 5. LuxR variants identified by any one of the following amino acid sequences or genes (1) to (11): (1) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and further has amino acid substitutions at positions 42, 93, 99 and 100. (2) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and further has the amino acid substitutions L42S, N93K, N99D and N100S. (3) The amino acid sequence shown in Sequence ID No. 11 has 5, 6, 7 or 8 amino acid substitutions selected from N86K, C245W, T33A, S57T and L42S, N93K, N99D and N100S, and has substantially the same transcriptional enhancement activity as (2) above. (4) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions 86K, C245W, T33A, S57T and L42S, N93K, N99D and N100S, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 86, 245, 33, 57, 42, 93, 99 and 100, and has substantially the same transcriptional enhancement activity as (2) above. (5) In the amino acid sequence represented by SEQ ID NO: 11, the polypeptide has amino acid substitutions of 86K, C245W, T33A, S57T, L42S, N93K, N99D and N100S, has 90% or more homology with the amino acid sequence set forth in SEQ ID NO: 11, and has transcription enhancement activity substantially equivalent to that of (2) above, (6) A gene encoding a polypeptide, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above, and the polypeptide has transcription enhancement activity substantially equivalent to that of (2) above, (7) A gene encoding a polypeptide that has 90% or more homology with the amino acid sequence of (2) above and has transcription enhancement activity substantially equivalent to that of (2) above, (8) A gene consisting of DNA comprising the base sequence set forth in SEQ ID NO: 78, (9) A gene that hybridizes under stringent conditions with DNA consisting of a base sequence complementary to DNA consisting of the base sequence set forth in SEQ ID NO: 78, and encodes a polypeptide having transcription enhancement activity substantially equivalent to that of (2) above, (10) A gene consisting of DNA in which 1 to 50 bases are substituted, deleted, inserted and / or added in DNA consisting of the base sequence set forth in SEQ ID NO: 78, and (11) A gene consisting of DNA having 90% or more homology with DNA consisting of the base sequence set forth in SEQ ID NO: 78. 6. The LuxR variant according to item 5 above, wherein the LuxR variant has transcription enhancement activity under a condition where no AHL is added. 7. A COR variant identified by the amino acid sequence or gene of any one of (1) to (7) below: (1) In the amino acid sequence represented by SEQ ID NO: 50, the polypeptide has amino acid substitutions at positions 11 and 276, (2) In the amino acid sequence represented by SEQ ID NO: 50, the polypeptide has amino acid substitutions of S11G and F276Y, (3) In the amino acid sequence represented by SEQ ID NO: 50, the polypeptide has an amino acid substitution of S11G or F276Y, and has reticulin detection activity substantially equivalent to that of (2) above, (4) In the amino acid sequence represented by SEQ ID NO: 50, the polypeptide has amino acid substitutions of S11G and F276Y, further has 1 to 20 amino acid substitutions, deletions, insertions and / or additions at positions other than position 11 and position 276, and has reticuline detection activity substantially equivalent to that of (2) above, (5) In the amino acid sequence represented by SEQ ID NO: 50, the polypeptide has amino acid substitutions of S11G and F276Y, has at least 90% homology with the amino acid sequence set forth in SEQ ID NO: 50, and has reticuline detection activity substantially equivalent to that of (2) above, (6) A gene encoding a polypeptide that has 1 to 20 amino acid substitutions, deletions, insertions and / or additions in the amino acid sequence of (2) above, and has reticuline detection activity substantially equivalent to that of (2) above, and (7) A gene encoding a polypeptide that has at least 90% homology with the amino acid sequence of (2) above, and has reticuline detection activity substantially equivalent to that of (2) above. 8. The COR variant according to the preceding item 7, which is for detecting reticuline. 9. An IDI variant identified by the amino acid sequence or gene of any one of (1) to (7) below: (1) In the amino acid sequence represented by SEQ ID NO: 76, the polypeptide has an amino acid substitution at a position represented by any one of the following, ●19 ●28, 19 ●66, 82, 28, 19 ●85, 82, 28, 19 (2) In the amino acid sequence represented by SEQ ID NO: 76, the polypeptide has an amino acid substitution represented by any one of the following, ●L19P ●D28H, L19P ●V66A, G82C, D28H, L19P ●R85C, G82C, D28H, L19P (3) In the amino acid sequence represented by SEQ ID NO: 76, the polypeptide has 2, 3, 4 or 5 amino acid substitutions selected from R85C, V66A, G82C, D28H and L19P, and has mevalonic acid detection activity substantially equivalent to that of (2) above, (4) The amino acid sequence shown in Sequence ID No. 76 has an amino acid substitution represented by any one of the following, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at locations other than 85, 66, 82, 28 and 19, and has mevalonic acid detection activity substantially equivalent to that of (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (5) The amino acid sequence shown in Sequence ID No. 76 has an amino acid substitution represented by any one of the following, has 90% or more homology to the amino acid sequence described in Sequence ID No. 76, and has substantially the same mevalonic acid detection activity as (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (6) A gene encoding a polypeptide having substantially equivalent mevalonic acid detection activity to that of (2) above, in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above, and (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent mevalonic acid detection activity to that of (2) above. 10. An IDI variant described in item 9 above, for the detection of dimethyl diphosphate (DMAOH) or isopentenyl diphosphate (IOH). 11. DXR variants identified by any one of the following amino acid sequences or genes (1) to (7): (1) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution at any of the positions represented by 1 below: 〇111, 297 〇120, 144, 283, 295 〇362 58, 118, 279 〇15, 254, 362 〇279 〇362 (2) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution represented by any one of the following: L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T 〇D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (3) The amino acid sequence shown in Sequence ID No. 75 has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid substitutions selected from C15R, D58H, L111F, I120T, K118R, A144E, P279T, L297P, T283S, K295R, S362T, and S254T, and has DOXP detection activity substantially equivalent to that of (2) above. (4) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution represented by any one of the following, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at locations other than 15, 58, 111, 120, 118, 144, 279, 297, 283, 295, 362 and 254, and has DOXP detection activity substantially equivalent to that of (2) above. L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T 〇D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (5) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution represented by any one of the following, has 90% or more homology to the amino acid sequence described in Sequence ID No. 75, and has substantially the same DOXP detection activity as (2) above. L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T 〇D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (6) A gene encoding a polypeptide having substantially equivalent DOXP detection activity to that of (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above, and (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent DOXP detection activity to (2) above. 12. A DXR variant as described in item 11 above, for DOXP detection. 13. A method for screening enzyme activity, including the following steps: (1) A nucleic acid library of enzyme E-actuator A fusion mutants obtained by introducing mutations, insertions, and / or deletions into a gene construct carrying a gene sequence encoding all or part of enzyme E and a gene sequence encoding actuator A, and a reporter expression vector carrying a gene sequence encoding promoter P controlled by actuator A and a gene sequence encoding reporter R functionally linked to promoter P, either by introducing these into cells or adding them to a cell-free protein synthesis system. (2) The step of adding metabolite M to the cells or cell-free protein synthesis system of (1), and (3) A step of selecting enzyme E variants using the expression level of reporter R, which is under the control of actuator A, as an indicator. 14. The enzyme activity screening method described in paragraph 13, further comprising the step of identifying the mutation site of the enzyme E mutant selected in (3) above. 15. The enzyme activity screening method according to paragraph 13 or 14, further comprising the step of determining that the enzyme E mutant has higher enzyme activity or substrate affinity than the wild-type enzyme E if the M concentration-dependent change in reporter R of the enzyme E mutant is higher than that of the wild-type enzyme E. 16. The screening method according to any one of the preceding paragraphs 13 to 15, wherein the actuator A is a LuxR variant according to any one of claims 3 to 6. 17. A method for determining the structure of an enzyme E mutant that has higher enzyme activity or substrate affinity than wild-type enzyme E, comprising the following steps; (1) A nucleic acid library of fusion mutants of enzyme E and actuator A obtained by introducing mutations, insertions, and / or deletions into a gene construct carrying a gene sequence encoding all or part of enzyme E and a gene sequence encoding actuator A, and a reporter expression vector carrying a gene sequence encoding promoter P controlled by actuator A and a gene sequence encoding reporter R functionally linked to promoter P, either by introducing these into cells or adding them to a cell-free protein synthesis system. (2) Adding metabolite M to the cells or cell-free protein synthesis system of (1), (3) A step of selecting enzyme E variants using the expression level of reporter R under the control of actuator A as an indicator. (4) In (3) above, if the concentration-dependent change in reporter R of the enzyme E mutant is higher than that of wild-type enzyme E, it is determined that the enzyme E mutant has higher enzyme activity than wild-type enzyme E, and (5) A step to identify the mutation site of the enzyme E mutant that was determined to have high enzyme activity in (4) above. 18. A method for producing an enzyme E mutant based on the sequence of the enzyme E mutant identified in the previous section 17(5). 19. Method for using the enzyme E mutant obtained by the preparation method described in item 18 above. [Effects of the Invention]
[0008] The present invention has been able to provide a novel metabolite sensor and a novel method for screening enzyme activity. [Brief explanation of the drawing]
[0009] [Figure 1]An overview of plasmid construction by fusing the target gene (sensor element E: enzyme) with LuxR. [Figure 2] Overview of the plasmid structure of pHRA-TetR-LuxRv2. [Figure 3] Functional distribution of TetR-LuxR mutants with and without aTc (100 ng / mL) in the absence of AHL. Mutants indicated by arrows were recovered. Blue represents the library, black represents the parent TetR-Lv2, and white represents the negative control LacZ. The dotted line corresponds to an on / off ratio (slope) of 1. [Figure 4] The amino acid mutation sites in the LuxR mutant. [Figure 5] Confirmation of the function of LuxRv3 (experimental procedure to obtain the T-curve). The experiment was performed using steps (1) to (7). Regarding the compound numbers, (1) is aTc (anhydro-tetracycline) and (2) is AHL (N-(β-ketocaproyl)-DL-homoserine lactone). [Figure 6] Dose-response curves of TetR-LuxR for aTc(a) and AHL(b). Light blue represents TetR-Lv1, blue represents TetR-Lv2, dark blue represents TetR-Lv3, and gray represents LacZa (negative control). Each plot is the mean of three parallel experiments, and the error bars indicate its standard deviation. The TetR-LuxRs curve is a curve obtained by fitting each plot to the Hill equation. [Figure 7] Predicted stability changes of LuxR mutants. The stability changes after introducing the mutant were calculated using FoldX, with the LuxR structure created using MODELLER as a template. [Figure 8] An overview of the morphine biosynthesis pathway. [Figure 9] Overview of the reporter plasmid (Plux-GFP-hsvTK / aph). [Figure 10] Workflow diagram for plasmid fabrication of the prototype sensor. [Figure 11] Overview of the CODM-LuxR sensor plasmid. [Figure 12] Evaluation results of the Lux promoter-enhancing activity of various enzymes-LuxR. [Figure 13] Evaluation results of the codeine responsiveness of various enzymes-LuxR. [Figure 14] Evaluation results of the morphine responsiveness of various enzymes-LuxR. [Figure 15] Evaluation results of the reticulin responsiveness of various enzymes-LuxR. [Figure 16] Workflow diagram for creating a COR-LuxRv3 library. [Figure 17] Reticulin response results from the COR-LuxR library (pink: fluorescence distribution in the presence of 100 μM reticulin, blue: fluorescence distribution in its absence). [Figure 18] Reticulin response results of COR-LuxRv3 mutants obtained from the library (experiments were conducted without AHL addition. Each data point represents the mean value of an experiment conducted with N=3, and the error bars indicate the standard deviation). [Figure 19] Mutation sites in COR-LuxRv3 mutants (mut5 / mut6). [Figure 20] Workflow for acquiring CODM-LuxRv3 variants. [Figure 21] Results confirming the specificity of the CODM-LuxRv3 mutant. [Figure 22] Mutation site found in the CODM-LuxRv3 variant. [Figure 23] Overview of the TrpR-LuxR plasmid. [Figure 24] Overview of the TyrR-LuxR plasmid. [Figure 25] Tryptophan sensor and tyrosine sensor. (A) Overview of the reaction, (B) Results of the tryptophan response of TrpR-LuxR, (C) Results of the tyrosine response of TyrR-LuxR. [Figure 26] Overview of the TyrB-LuxR plasmid. [Figure 27]A tyrosine sensor using an enzyme as a molecular recognition element. (A) Ligand used ★, (B) Tryptophan responsiveness of TrpR-LuxR. As a control, cells lacking TrpB-LuxR (instead, a plasmid expressing lacZa was introduced) were used. Gray = fluorescence intensity distribution per cell in the absence of tyrosine, blue = fluorescence intensity distribution analysis in culture medium supplemented with tyrosine (500 μM). [Figure 28] Overview of the IDI-LuxRv3 plasmid. [Figure 29] Overview of the DXR-LuxRv3 plasmid. [Figure 30] Overview of the BFP-MEVbottom plasmid. [Figure 31] Overview of the DXS plasmid. [Figure 32] Construction of a metabolite sensor by tandem fusion of enzyme and LuxR. In the cell population data, gray represents the distribution when cultured under conditions without substrate supply, and blue represents the distribution when cultured under conditions with the addition of a compound for substrate supply. The photographs of the culture medium were taken after centrifuging 200 μL of the culture medium after the end of cultivation, removing the culture medium, and then resuspending it in the same volume of physiological saline. Low represents the conditions when cultured without substrate supply, and High represents the conditions when cultured with substrate supply. The compounds added to the medium were (7) isopentenyl pyrophosphate, (8) dimethylallyl pyrophosphate, (9) mevalonic acid, and (10) 1-deoxy-D-xylulose 5-phosphate (DOXP). [Figure 33] Confirmation of the effect of the V162I mutation introduced into LuxRv3 on sensor function. Dark represents IDI-Lv3V162I, blue represents G1P2D4, light blue represents IDI-Lv3, and white represents sensors in cells expressing IDI. Each plot is the mean of three parallel experiments, and the error bars indicate its standard deviation. [Figure 34]Dose-response curves for mevalonate in IDI-Lv3 G2P3D9 and G1P2D4 mutants. Blue represents G2P3D9, gray represents G1P2D4, and white represents the function of IDI-expressing cells. Each plot represents the mean of three parallel experiments, and the error bars indicate its standard deviation. [Figure 35] Dose-response curves for mevalonate in IDI-LuxRv3 mutants (third generation). Blue represents mutants (a, G3P1D3; b, G3P1F4), gray represents G2P3D9, and white represents the function of IDI-expressing cells. Each plot represents the mean of three parallel experiments, and the error bars indicate its standard deviation. [Figure 36] Transcriptional enhancement activity of the first-generation mutant of DXR-Lv3. Each bar represents the average value of four parallel experiments, and the error bars indicate the standard deviation. [Figure 37] Confirmation of transcriptional enhancement activity of second-generation mutants of DXR-Lv3. Each bar represents the average value of a single experiment conducted in parallel. For comparison, data from first-generation mutants and negative controls are from three parallel experiments, and the error bars indicate their standard deviation. [Figure 38] Confirmation of the ON / OFF performance of the second-generation mutant of DXR-Lv3. Each bar represents the value of three experiments conducted in parallel, and the error bars indicate the standard deviation. [Figure 39] A conceptual diagram showing how to non-destructively, in real-time, and with high throughput, confirm the substrate recognition characteristics of an enzyme. Top to middle section: By fusing the enzyme with LuxR and moderately destabilizing it, the LuxR output value when the enzyme substrate is absent can be reduced, thereby creating behavior as a metabolite sensor. Middle to bottom section: By searching for mutants with high output values under substrate-added conditions, mutants that bind strongly to the substrate (low Km) can be obtained. [Figure 40]This graph compares the transcriptional enhancement activity of the DXR-Lv3 mutant with the lycopene synthesis of the DXR mutant. The horizontal axis represents the difference between the average fluorescence intensity per cell density shown under DXS overexpression conditions and the average fluorescence intensity per cell density shown under DXSE370A mutant overexpression conditions. The vertical axis represents the lycopene synthesis of cells expressing the DXR mutant with LuxRv3 cleaved. Blue represents the mutant, black represents the parent DXR-Lv3 or DXR, and white represents the negative control LacZa-expressing cells. The three plots indicated by arrows represent mutants with lycopene synthesis increased by more than 10% compared to the wild type. Each experiment was performed three times in parallel, and the average values were plotted. The error bars on the vertical axis represent the standard deviation. [Figure 41] Outline of the "Manufacturing Method for Multi-Input, Multi-Output Gene Switches": This method systematically creates proteins that fold in a target molecule-dependent manner by introducing random mutations to "just the right amount of destabilization." The cellular function of the protein fused with this "addiction module" will reflect the cellular concentration of its target molecule. This method eliminates the need to design complex molecular dynamics such as allosteric effects. Step 1: Prepare two "binding motifs" for different biomolecules and fuse them in-frame at the gene level to form a single protein. Step 2: Introduce random mutations into the entire gene of this fusion protein. Functionally select proteins that are "appropriately" destabilized so that they cannot maintain a stable structure without interaction with their respective target molecules. Step 3: Constantly express the resulting mutant fusion proteins in cells. Since they can only exist in cells when the target molecule is present, a fluorescence signal corresponding to the concentration of the target molecule is obtained. [Figure 42] An overview of the method for fabricating the metabolite sensor of the present invention. [Modes for carrying out the invention]
[0010] This invention relates to a "metabolite sensor" and a "method for screening enzyme activity."
[0011] (Method for fabricating metabolite sensors) The metabolite sensor of the present invention is manufactured based on the "method for manufacturing a multi-input, multi-output gene switch" developed by the inventors. While the method can be found in Patent Document 1, an overview is provided below.
[0012] The ability to test the intracellular concentration of any metabolite in real time would greatly contribute to the development of cell engineering, fermentation production, and breeding technologies. Traditionally, biosensors have been constructed based on two main operating principles. One is the "gene-induced" sensor. In this type, a reporter such as a fluorescent protein is placed downstream of a transcriptional regulatory mechanism that turns the target compound on / off as an inducer. While transcription factors that respond to various molecules exist in nature, sensor motifs for the vast majority of metabolites are unknown. The inventors focused on the phenomenon of "stabilization," which inevitably occurs when molecules such as sensors and receptors bind to target molecules. They proposed a sensor method that "reads out" this stabilization phenomenon using a unified standard, and completed a technology that enables the ultra-high-speed fabrication of any sensor (see Figure 41). Using the principle of this method (measuring stabilization), tens of thousands of known enzymes can be used as molecular recognition elements for sensors, regardless of the type of reaction they perform.
[0013] (Outline of the method for fabricating the metabolite sensor of the present invention) Figure 42 shows an overview of the method for fabricating the metabolite sensor of the present invention. A sensor element S for metabolite M is fabricated. [Step-1] Search for an enzyme that uses metabolite M as a substrate in a database or other search engine, and synthesize its gene. If necessary, the catalytic active group of the enzyme may be removed. [Step-2] The transcription factor, whose stability has been reduced by amino acid mutations (in this example, a mutant of LuxR is used), is fused in-frame at the gene level. In some cases, it may already behave as a sensor at this stage. [Step-3] The overall stability of the fusion protein is modified downwards by random mutations. Specifically, random mutations can be introduced into the genes of the entire fusion protein using error-prone PCR, or several destabilizing mutations derived by calculation can be introduced. [Step-4] Select cells that exhibit LuxR function (expression of Plux downstream reporter genes) in the presence of the substrate, and from these, select cells that lose LuxR function in the absence of the substrate.
[0014] (Ligands and metabolites) In this invention, "ligand L" refers to a substance, such as a compound, that, by binding to a transcription factor, alters the function of a gene switch, thereby inducing the direct or indirect regulation of the expression of a gene or a group of genes. "Ligand" can also be described as "a compound that activates a gene switch." The activating substance varies depending on the gene switch. The metabolite M of this invention is a substrate for enzyme E, which is the material for the sensor element E, or a substance that becomes a substrate for E within a cell by metabolic enzymes.
[0015] (Actuator) In this invention, "actuator A" is selected from transcription factors, enzymes, antibodies, histones, chaperones, or ribosomes, but is preferably a transcription factor, and in this example, LuxR was used. However, it is not limited to LuxR, and for example, AraC, XylR, TetR, ArsR, LacI, etc. can be used.
[0016] (Sensor element) In this invention, "sensor element E" refers to an element that detects metabolite M in a metabolite sensor. Specifically, it is a mutant derived from a conventional enzyme obtained by a method for fabricating a metabolite sensor.
[0017] (Promoter) In this invention, "promoter P" refers to a nucleic acid sequence having promoter activity controlled by a transcription factor (actuator A). The promoter refers to a nucleic acid sequence located 5' upstream of the translation initiation of the gene encoding the reporter R gene or its active portion, and which controls the transcription of reporter R. The promoter is selected appropriately depending on the type of host cell used. When bacteria are used as the host, the promoter is not particularly limited as long as it can be expressed in host cells such as E. coli, and any can be used. For example, promoters derived from E. coli or phages, such as the λPR promoter, PL promoter, trp promoter, and lac promoter, can be used. Artificially designed and modified promoters such as the tac promoter may also be used. When yeast is used as the host, the promoter is not particularly limited as long as it can be expressed in yeast, and any can be used. For example, gal1 promoter, gal10 promoter, heat shock protein promoter, MFα1 promoter, PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, and AOX1 promoter can be used. When animal cells are used as the host, it is preferable that the recombinant vector is capable of autonomous replication in the cells and is composed of a promoter, RNA splice site, target gene, polyadenylation site, and transcription termination sequence. A replication origin may also be included if desired. As promoters, SRα promoters, SV40 promoters, LTR promoters, and CMV promoters can be used, and early gene promoters of cytomegalovirus may also be used.
[0018] (Combination of ligand L, transcription factor T (actuator A), and promoter P) Examples of combinations of ligand L, transcription factor T that responds to ligand L, and promoter P controlled by transcription factor T include the following: Activator-type promoter Arabinose, AraC, PBAD (Arabinose Operon) Transcription does not occur if the activator protein is not bound to the operator DNA. When arabinose is present in the environment, the conformation of the arabinose activator changes. The conformed arabinose activator then binds to the operator. This allows RNA polymerase to transcribe the operon, leading to the expression of the PBAD-downstream reporter R gene. AHL, LuxR, Plux When AHL is present in the environment, it binds to the transcription factor (transcription regulator) LuxR. The AHL-LUxR complex then activates the pluX promoter, leading to the expression of the downstream reporter gene R. Xylose, XylR, Pxyl ○Repressor-type Promotor aTc, TetR, Ptet Arsenic, ArsR, Pars IPTG, Laci, Plac In this example, the above-mentioned "AHL, LuxR, and Plux" were used.
[0019] (Library of fusion mutant nucleic acids) The "library of fusion mutant nucleic acids" in the present invention is a fusion mutant of transcription factor T or actuator A and enzyme E having multiple types of mutations, obtained by introducing known mutations (e.g., random mutations, site-directed mutations using stability prediction software such as Fold-X) into a gene construct (including an expression vector) carrying a gene sequence encoding a transcription factor T or actuator A that responds to ligand L and a gene sequence encoding enzyme E that responds to metabolite M. Furthermore, the method of fusing transcription factor T and enzyme E is not particularly limited; tandem in-frame fusion, or fusion in which the gene for E is inserted into the loop portion of T (or in which the gene for T is inserted into the loop portion of E) are also acceptable. In addition, a preferred example of the mutation in the present invention is to cause destabilization of a protein (fusion mutant). First, protein stability refers to the stability of the folding state, that is, the change in free energy (ΔGfold) that occurs when the polypeptide chain that makes up the protein forms a functional structure (folds). "Destabilization" means reducing and ultimately canceling the change in free energy (ΔGfold) associated with the folding energy. For example, if a certain amino acid substitution reduces the stability of the functional structure (fold), that amino acid substitution is a "mutation that causes destabilization (destabilizing mutation)." More specifically, if a moderate level of destabilization can be induced by the mutation, the folded state of the fusion mutant can be maintained (i.e., ΔGfold < 0) only when a substrate for enzyme E or a metabolite M that can be converted to it is present.
[0020] (Reporter) The "reporter R" in this invention is not particularly limited as long as it serves as an indicator for selecting fusion mutants, but examples include fluorescent proteins (GFP), pigment proteins (amilCP), luciferase, thymidine kinase (see: JP 2013-17473 A), alkyladenine DNA glycosidase (see: International Publication WO2012 / 060407), pigment biosynthesis gene operons (see: JP 2014-223038 A A), etc. For more details, when using fluorescent proteins or pigment proteins, fusion mutants are selected based on the color change of the culture medium when metabolite M is added to or removed from the culture medium. When using thymidine kinase, alkyladenine DNA glycosylase, various drug transporters, drug resistance markers, or toxin / antitoxin pairs, fusion mutants are selected based on the viability and proliferation of cells. Furthermore, while the reporter R is not particularly limited as long as it is functionally linked to each promoter P, the type of reporter R can be changed for each promoter P. For example, combinations such as promoter P1-reporter R1, promoter P2-reporter R2, promoter P3-reporter R3 can be given.
[0021] (Reporter expression vector) The "reporter expression vector" in this invention carries a gene sequence encoding promoter P, which is controlled by the transcription factor T, and a gene sequence encoding reporter R, which is functionally linked to the promoter P sequence. Note that there may be multiple types of reporter R, and one or more reporter Rs may be present downstream of each promoter.
[0022] An expression vector is DNA that carries an external gene to a host cell, in other words, vector DNA that can express a target gene in the host cell. Vector DNA is not particularly limited as long as it is replicable in the host, and is appropriately selected depending on the type of host and the purpose of use. Vector DNA can be obtained by extracting naturally occurring DNA, or it can be vector DNA in which parts of the DNA other than those necessary for replication are missing. Representative vector DNAs include plasmids, bacteriophages, and virus-derived vector DNA. Examples of plasmid DNA include plasmids derived from E. coli, Bacillus subtilis, and yeast. Examples of bacteriophage DNA include λ phage. Examples of virus-derived vector DNA include vectors derived from animal viruses such as retroviruses, vaccinia viruses, adenoviruses, papovaviruses, SV40, fowlpox virus, and pseudorabies virus, or vectors derived from insect viruses such as baculoviruses. Other examples include vector DNA derived from transposons, inserted elements, and yeast chromosome elements. Alternatively, vector DNA created by combining these elements, such as vector DNA created by combining the genetic elements of plasmids and bacteriophages (e.g., cosmids and phagemids), can be exemplified. The vector DNA must incorporate the target gene so that the target gene is expressed, and its components must consist of at least the target gene and regulatory DNA elements, such as promoters. In addition to these elements, gene sequences carrying information about replication and regulation can optionally be incorporated into the vector DNA by known methods. Examples of such gene sequences include cis-elements such as ribosome-binding sequences, terminators, signal sequences, and enhancers, as well as splicing signals and selection markers (selectors: dihydrofolate reductase genes, ampicillin resistance genes, neomycin resistance genes, kanamycin resistance genes, etc.). One or more selected gene sequences from these can be incorporated into the vector DNA. Methods for incorporating a target gene into vector DNA can be based on already known genetic engineering techniques. For example, the target gene can be treated with an appropriate restriction enzyme to cleave it at a specific site, then mixed with similarly treated vector DNA, and rejoined using ligase. Alternatively, the desired vector DNA can be obtained by ligating an appropriate linker to the target gene and inserting it into a multi-cloning site of a suitable vector. The method for introducing an expression vector into host cells is not particularly limited as long as it is a method that can introduce vector DNA into host cells and express the target gene in the host cells, and any known method appropriately selected depending on the host cell species may be used. Examples include electroporation, calcium phosphate method, and lipofection method.
[0023] (Cellular or cell-free protein synthesis system) The "cell or cell-free protein synthesis system" in this invention is not particularly limited as long as it provides an environment in which the transcription factor T(N), promoter P, and reporter RX can express proteins. For example, the cell may be either a prokaryotic cell or an isolated eukaryotic cell, but prokaryotic cells with a short cell cycle and rapid proliferation rate are preferred. Cells with such properties are useful for a rapid method of producing gene switches. For example, a known cell-free protein synthesis system containing components essential for protein synthesis (wheat, E. coli, etc.) can be used as an example. Furthermore, the "step of adding ligand L and / or metabolite M to cells or a cell-free protein synthesis system" means that the addition of ligand L and / or metabolite M to cells or a cell-free protein synthesis system may be before, after, or substantially simultaneously with the addition of the fusion mutant nucleic acid library and / or reporter expression vector to the cells.
[0024] (Select sensor element S) In this invention, fusion mutants possessing the function of the target sensor are selected using the expression level of reporter R as an indicator. Furthermore, the gene sequence and / or amino acid sequence of the selected fusion is analyzed using a known method. This allows us to obtain information (nucleotide sequence, amino acid sequence) of a multi-input, multi-output gene switch or transcription factor. Furthermore, this information makes it possible to easily obtain multi-input, multi-output gene switches or transcription factors using a known protein synthesis system.
[0025] (Linker) In this invention, a linker L is preferably introduced between the sensor element E and the actuator A. The arrangement of the linker L can be one of a known arrangement.
[0026] (tag) In this invention, a known tag T may be introduced to the sensor element S. The tag may also be a binding label used when purifying the sensor element using a column or the like.
[0027] (Configuration of the metabolite sensor) The metabolite sensors obtained in this embodiment are illustrated below, but mutants and derivatives that maintain the following characteristics and properties are included within the scope of the present invention. The sensor element S, actuator A, and metabolite M (target of detection) are as follows: (1) SalAT, LuxRv2 (or LuxRv3), codeine (2) THS, LuxRv2 (or LuxRv3), codeine (3) T6ODM, LuxRv2 (or LuxRv3), codeine (4) CODM, LuxRv2 (or LuxRv3), codeine (5) SalR, LuxRv2 (or LuxRv3), morphine (6) COR, LuxRv2 (or LuxRv3), morphine (7) T6ODM, LuxRv2 (or LuxRv3), rectilin (8) COR, LuxRv2 (or LuxRv3), rectilin (9) COR{mut5(S11G, F276Y)} mutant, LuxRv3, rectilin (10) COR{mut5(S11G, F276Y)} mutant, LuxRv3((K16R)) mutant, rectilin (11) CODM(Q121L, R346H) variant, LuxRv3, Divine and / or Codeine (12) TrpR, LuxRv3, Tryptophan (13) TyrR, LuxRv3, Tryptophan (14) TyrB, LuxRv3, tyrosine (15) IDI, LuxRLv3, mevalonic acid, and its metabolites dimethylallyl diphosphate (DMAOH) and isopentenyl diphosphate (IOH) (16) IDI-LuxRLv3(V162I) mutant, mevalonic acid, DMAOH / IOH (17) IDI (mutated to L19P) mutant - LuxRv3 (V162I) mutant {G1P2D4}, mevalonic acid, DMAOH / IOH (18) IDI (mutated to D28H, L19P) mutant - LuxRv3 (V162I) mutant {G2P3D9}, mevalonic acid, DMAOH / IOH (19) IDI (mutated in V66A, G82C, D28H, L19P) mutant - LuxRv3 (V162I) mutant {G3P1D3}, mevalonic acid, DMAOH / IOH (20) IDI (mutated in R85C, G82C, D28H, L19P) mutant - LuxRv3 (V162I) mutant {G3P1F4}, mevalonate, DMAOH / IOH (21) DXR (mutated to L111F, L297P), LuxRv3{G1P1A2}, DOXP (22) DXR (mutated to I120T, A144E, T283S, K295R), LuxRv3{G1P1B3}, DOXP (23) DXR (mutated to S362T), LuxRv3{G1P1E2}, DOXP (24) DXR (mutated to D58H, K118R, P279T), LuxRv3{G1P1F2}, DOXP (25) DXR (mutated to C15R, S254T, S362T), LuxRv3{G2P1F4}, DOXP (26) DXR (mutated to P279T), LuxRv3{G2P1C11}, DOXP (27) DXR (mutated to S362T), LuxRv3{G2P1D7}, DOXP
[0028] (LuxR variant of actuator A of the present invention) In this example, we created a superior LuxR mutant compared to conventional LuxR and LuxRv1 (LuxR(with mutations in N86K and C245W: Kimura et al., J.Gen. Appl. Microbiol., 62, 240-247 (2016)) developed by the inventors.
[0029] (LuxRv2) LuxRv2 can detect AHL with higher sensitivity compared to LuxRv1. The amino acid structure of LuxRv2 can be determined as follows. (1) The amino acid sequence shown in Sequence ID No. 11 has amino acid substitutions at N86K and C245W, and further has amino acid substitutions at positions 33 and 57. (2) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K and C245W, and further has the amino acid substitutions T33A and S57T. (3) The amino acid sequence shown in Sequence ID No. 11 has 3 or 4 amino acid substitutions selected from N86K, C245W, T33A and S57T, and has substantially the same AHL detection sensitivity as (2) above. (4) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 86, 245, 33 and 57, and has substantially the same AHL detection sensitivity as (2) above. (5) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, has 90% or more homology to the amino acid sequence described in Sequence ID No. 11, and has substantially the same AHL detection sensitivity as (2) above. The nucleotide sequence structure of LuxRv2 can be identified as follows. (6) A gene encoding a polypeptide having substantially the same AHL detection sensitivity as (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above and having substantially equivalent AHL detection sensitivity to (2) above. (8) A gene consisting of DNA with the base sequence described in Sequence ID No. 77, (9) A gene encoding a polypeptide that hybridizes under stringent conditions with DNA having a base sequence complementary to the DNA having the base sequence described in Sequence ID No. 77, and having substantially the same AHL detection sensitivity as (2) above. (10) A gene consisting of DNA in which 1 to 50 base sequences are substituted, deleted, inserted and / or added in the DNA consisting of the base sequence described in Sequence ID No. 77. (11) A gene consisting of DNA that has 90% or more homology to the DNA consisting of the base sequence described in Sequence ID No. 77.
[0030] (LuxRv3) LuxRv3 exhibits transcriptional enhancement activity even without the addition of ligand L such as AHL. The amino acid structure of LuxRv3 can be identified as follows. (1) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and further has amino acid substitutions at positions 42, 93, 99 and 100. (2) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions N86K, C245W, T33A and S57T, and further has the amino acid substitutions L42S, N93K, N99D and N100S. (3) The amino acid sequence shown in Sequence ID No. 11 has 5, 6, 7 or 8 amino acid substitutions selected from N86K, C245W, T33A, S57T and L42S, N93K, N99D and N100S, and has substantially the same transcriptional enhancement activity as (2) above. (4) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions 86K, C245W, T33A, S57T and L42S, N93K, N99D and N100S, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 86, 245, 33, 57, 42, 93, 99 and 100, and has substantially the same transcriptional enhancement activity as (2) above. (5) The amino acid sequence shown in Sequence ID No. 11 has the amino acid substitutions 86K, C245W, T33A, S57T and L42S, N93K, N99D and N100S, has 90% or more homology to the amino acid sequence described in Sequence ID No. 11, and has substantially the same transcriptional enhancement activity as (2) above. The nucleotide sequence structure of LuxRv3 can be identified as follows. (6) A gene encoding a polypeptide having substantially the same transcriptional enhancement activity as (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above and substantially equivalent transcriptional enhancement activity to that of (2) above. (8) A gene consisting of DNA with the base sequence described in Sequence ID No. 78, (9) A gene encoding a polypeptide that hybridizes under stringent conditions with DNA having a nucleotide sequence complementary to the nucleotide sequence described in Sequence ID No. 78, and has substantially the same transcriptional enhancement activity as (2) above. (10) A gene consisting of DNA in which 1 to 50 base sequences are substituted, deleted, inserted and / or added in the DNA consisting of the base sequence described in Sequence ID No. 78. (11) A gene consisting of DNA that has 90% or more homology to the DNA consisting of the base sequence described in Sequence ID No. 78.
[0031] (Morphinan alkaloid sensor) This embodiment provides a sensor including a sensor element S and actuator A used in the following morphinan alkaloid sensor.
[0032] (Codeine detection sensor) SalAT-LuxRv2 (or LuxRv3) THS-LuxRv2 (or LuxRv3) T6ODM-LuxRv2 (or LuxRv3) CODM-LuxRv2 (or LuxRv3)
[0033] (Morphine detection sensor) SalR-LuxRv2 (or LuxRv3) COR-LuxRv2 (or LuxRv3) Furthermore, a linker sequence L may be inserted between each enzyme and LuxRv3 (or LuxRv2), and a tag T sequence may be inserted after the start codon of each enzyme.
[0034] (Reticulin detection sensor) T6ODM-LuxRv2 (or LuxRv3) COR -LuxRv2 (or LuxRv3) COR{mut5(S11G, F276Y)} mutant-LuxRv3 COR{mut5(S11G, F276Y)} mutant - LuxRv3{(mutated to K16R)} mutant Furthermore, a linker sequence L may be inserted between each enzyme and LuxRv3 (or LuxRv2), and a tag T sequence may be inserted after the start codon of each enzyme. The amino acid structure of the COR mutant (mut5) can be identified as follows. (1) The amino acid sequence shown in Sequence ID No. 50 has amino acid substitutions at positions 11 and 276. (2) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y. (3) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitution S11G or F276Y and has substantially the same reticulin detection activity as (2) above. (4) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 11 and 276, and has substantially the same reticulin detection activity as (2) above. (5) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, has 90% or more homology to the amino acid sequence described in Sequence ID No. 50, and has substantially the same reticulin detection activity as (2) above. The base sequence structure of the COR mutant (mut5) can be identified as follows. (6) A gene encoding a polypeptide having substantially equivalent reticulin detection activity to that of (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent reticulin detection activity to (2) above.
[0035] (Devine and / or codeine detection sensor) CODM (Q121L, R346H mutation) mutant - LuxRv3 Furthermore, a linker sequence L may be inserted between the CODM mutant and LuxRv3, and a tag T sequence may be inserted after the start codon of each enzyme. The amino acid structure of the CODM mutant can be identified as follows. (1) The amino acid sequence shown in Sequence ID No. 51 has amino acid substitutions at positions 121 and 346. (2) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H. (3) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitution Q121L or R346H and has substantially the same devine and / or codeine detection activity as (2) above. (4) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 121 and 346, and has substantially the same devine and / or codeine detection activity as (2) above. (5) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, has 90% or more homology to the amino acid sequence described in Sequence ID No. 51, and has substantially equivalent devine and / or codeine detection activity to that of (2) above. The nucleotide sequence structure of the CODM mutant can be identified as follows. (6) A gene encoding a polypeptide having substantially equivalent devine and / or codeine detection activity to that of (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent devine and / or codeine detection activity to that of (2) above.
[0036] (Tryptophan and / or tyrosine sensor) This embodiment provides a sensor including a sensor element S and an actuator A for use in a tryptophan and / or tyrosine sensor. TrpR-LuxRv3 The above sensor is a tryptophan sensor capable of detecting an increase in tryptophan concentration. TyrR-LuxRv3 TyrB-LuxRv3 The above sensor is a tyrosine sensor capable of detecting an increase in tyrosine concentration. Furthermore, a linker sequence L may be inserted between TrpR, TyrR, or TyrB and LuxRv3, and a tag sequence T may be inserted after the start codon of TrpR, TyrR, or TyrB.
[0037] (Isoprenoid precursor sensor) This embodiment provides a sensor including a sensor element S and actuator A for use in the following isoprenoid precursor sensor.
[0038] (Mevalonate sensor) IDI-LuxRLv3 IDI-LuxRLv3(V162I) mutant IDI (mutated to L19P) mutant - LuxRv3 (V162I) mutant {G1P2D4} IDI (mutated to D28H, L19P) mutant - LuxRv3 (V162I) mutant {G2P3D9} IDI (mutated in V66A, G82C, D28H, and L19P) mutant - LuxRv3 (V162I) mutant {G3P1D3} IDI (mutated in R85C, G82C, D28H, and L19P) mutant - LuxRv3 (V162I) mutant {G3P1F4} The amino acid structure of the IDI mutant can be identified as follows. Furthermore, a linker sequence L may be inserted between IDI or the IDI variant and the LuxRLv3 or LuxRv3(V162I) variant, and a tag sequence T may be inserted after the start codon of IDI or the IDI variant. The structure of the IDI variant is identified by the following amino acid sequence. (1) The amino acid sequence shown in Sequence ID No. 76 has an amino acid substitution at the position represented by any one of the following 1. 〇19 〇28, 19 66, 82, 28, 19 85, 82, 28, 19 (2) The amino acid sequence shown in Sequence ID No. 76 has an amino acid substitution represented by any one of the following: 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (3) The amino acid sequence shown in Sequence ID No. 76 has 2, 3, 4 or 5 amino acid substitutions selected from R85C, V66A, G82C, D28H and L19P, and has mevalonic acid detection activity substantially equivalent to that of (2) above. (4) The amino acid sequence shown in Sequence ID No. 76 has an amino acid substitution represented by any one of the following, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at locations other than 85, 66, 82, 28 and 19, and has mevalonic acid detection activity substantially equivalent to that of (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P (5) The amino acid sequence shown in Sequence ID No. 76 has an amino acid substitution represented by any one of the following, has 90% or more homology to the amino acid sequence described in Sequence ID No. 76, and has substantially the same mevalonic acid detection activity as (2) above. 〇L19P 〇D28H, L19P 〇V66A, G82C, D28H, L19P 〇R85C, G82C, D28H, L19P The nucleotide sequence structure of the IDI variant can be identified as follows. (6) A gene encoding a polypeptide having substantially equivalent mevalonic acid detection activity to that of (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent mevalonic acid detection activity to that of (2) above.
[0039] (DOXP sensor) DXR (mutated to L111F and L297P) mutant - LuxRv3{G1P1A2} DXR (mutated with I120T, A144E, T283S, K295R) mutant - LuxRv3{G1P1B3} DXR (mutated at S362T) mutant - LuxRv3{G1P1E2} DXR (mutated to D58H, K118R, P279T) mutant - LuxRv3{G1P1F2} DXR (mutated to C15R, S254T, S362T) mutant - LuxRv3{G2P1F4} DXR (mutated to P279T) mutant - LuxRv3{G2P1C11} DXR (mutated to S362T) mutant - LuxRv3{G2P1D7} Furthermore, a linker sequence L may be inserted between the DXR mutant and LuxRLv3, and a tag sequence T may be inserted after the start codon of the DXR mutant. The structure of the DXR mutant is identified by the following amino acid sequence. (1) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution at the position represented by any one of the following 1. 〇111, 297 〇120, 144, 283, 295 〇362 58, 118, 279 〇15, 254, 362 〇279 〇362 (2) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution represented by any one of the following: L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T 〇D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (3) The amino acid sequence shown in Sequence ID No. 75 has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 amino acid substitutions selected from C15R, D58H, L111F, I120T, K118R, A144E, P279T, L297P, T283S, K295R, S362T, and S254T, and has substantially the same DOXP detection activity as (2) above. (4) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution represented by any one of the following, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at locations other than 15, 58, 111, 120, 118, 144, 279, 297, 283, 295, 362 and 254, and has DOXP detection activity substantially equivalent to that of (2) above. L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T 〇D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T (5) The amino acid sequence shown in Sequence ID No. 75 has an amino acid substitution represented by any one of the following, has 90% or more homology to the amino acid sequence described in Sequence ID No. 75, and has substantially the same DOXP detection activity as (2) above. L111F, L297P 〇I120T, A144E, T283S, K295R 〇S362T 〇D58H, K118R, P279T 〇C15R, S254T, S362T 〇P279T 〇S362T The nucleotide sequence structure of the DXR mutant can be identified as follows. (6) A gene encoding a polypeptide having substantially equivalent DOXP detection activity to that of (2) above, wherein 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (2) above. (7) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (2) above, and having substantially equivalent DOXP detection activity to (2) above.
[0040] (Method for screening enzyme activity) The present invention provides an enzyme activity screening method that allows for the acquisition of enzyme variants with superior enzyme activity compared to wild-type enzymes, without screening for actual enzyme activity. This method includes the following steps. (1) A nucleic acid library of fusion mutants of enzyme E and actuator A obtained by introducing a mutation into a gene construct carrying a gene sequence encoding all or part of enzyme E that uses metabolite M or its metabolite as a substrate and a gene sequence encoding actuator A that responds to ligand L, and a reporter expression vector carrying a gene sequence encoding promoter P controlled by actuator A and a gene sequence encoding reporter R functionally linked to promoter sequence P1, either by introducing these into cells or adding them to a cell-free protein synthesis system. (2) Adding metabolite M to the cells or cell-free protein synthesis system of (1), (3) A step of selecting fusion mutants of enzyme E and actuator A using the expression level of the reporter as an indicator. In addition, during the selection process, if the reporter expression level of the enzyme E-actuator A fusion mutant is higher than that of the wild-type enzyme E-actuator A fusion under conditions of coexistence with metabolite M or high concentration of metabolite M, then it can be determined that the enzyme E mutant has higher enzyme activity (especially affinity and substrate selectivity) than the wild-type enzyme E. In addition, it is preferable, but not limited to, that actuator A use LuxRv1, LuxRv2, or LuxRv3.
[0041] The present invention will be described below with reference to examples, but the present invention is not limited in any way by these examples. [Examples]
[0042] (Creation of LuxR mutant as actuator A) When the sensor element enzyme E is fused to actuator A, LuxR, the stabilization associated with substrate binding of the enzyme increases the effective intracellular concentration of the sensor protein. In conjunction with this, the cellular function of LuxR increases, and the expression level of reporter genes (such as GFP), which are downstream of promoter P (Plux), increases. While it is possible to destabilize the enzyme later through gene mutations, by setting the stability in the unbound state as low as possible, it is expected that some degree of sensor behavior can be observed simply by fusing the enzyme with LuxR. Furthermore, for practical purposes, it is desirable for LuxR to function without the addition of the ligand AHL, and the binding of metabolites to the AHL-binding cavity of LuxR is also undesirable. We created a LuxR mutant actuator A that behaves as a so-called "super activator," capable of enhancing transcription even without binding to AHL.
[0043] (Expression system) To search for mutants that behave as superactivators in a fused state and are moderately destabilized, we constructed a plasmid in which the aTc (anhydrotetracycline)-responsive repressive transcription factor TetR was fused with LuxR (Figure 1). The following modifications were made to the nucleotide sequence when constructing this plasmid. (1) Insertion of restriction enzyme recognition sequences: To facilitate cloning by genetically fusing the enzyme with LuxR (with N86K, C245W mutations: Kimura et al., J.Gen. Appl. Microbiol., 62, 240-247 (2016), LuxRv1) and the creation of a random mutation library, sequences recognized by different restriction enzymes were inserted at the N-terminus of the enzyme, between the enzyme and LuxR, and at the C-terminus of LuxR. (2) Insertion of histidine hexamer: Translation initiation efficiency is influenced by the higher-order structure of mRNA consisting of approximately 35 bases within the ORF from the transcription start site. To enable the development of various metabolite sensors without RBS design, a base sequence (18 bases) encoding a histidine hexamer was inserted between the start codon and the enzyme's ORF. Since 27 bases are common to all motifs, including the start codon (3 bases) and restriction enzyme recognition sequence (6 bases), the translation initiation efficiency will be nearly similar for all motifs. By positioning a histidine hexamer downstream of the RBS, it is believed that translation initiation efficiency will not change significantly even if the gene of interest sequence is altered. Unique restriction enzyme recognition sequences, BamHI, SpeI, and HindIII, were inserted upstream of the gene of interest, between the gene of interest and luxR, and downstream of luxR, respectively, allowing for easy removal of any desired region by restriction enzyme digestion. More specifically, a TS (threonine and serine) derived from the recognition sequence of the restriction enzyme SpeI, which is the linker L, was inserted between the enzyme and LuxR. Furthermore, at the N-terminus of the enzyme, a histag (T) and the polypeptide HHHHHHGS, derived from the recognition sequence of the restriction enzyme BamHI, were added between the start codon and the enzyme. This sequence design is the same in the following examples.
[0044] (Fabrication of TetR-LuxR) Referring to the expression construct shown in Figure 1, the tetracycline-responsive transcription factor TetR from E. coli was fused with a known LuxRv1 mutant (WO2019182156). Specifically, to amplify the tetR gene from the genomic DNA of E. coli strain XL10G while rewriting the sequence recognized by the restriction enzyme HindIII contained in the tetR gene, PCR amplification was performed by separating the upstream (primer sequence 1 (sequence number 1) / sequence number 2 (sequence number 2)) and downstream (primer sequence 3 (sequence number 3) / sequence number 4 (sequence number 4)) of the HindIII site. Furthermore, to confer the restriction enzyme recognition sequence to the upstream side of the tetR gene, the PCR product of the upstream side was further amplified by PCR (primer sequence 5 (sequence number 5) / sequence number 2 (sequence number 2)). These were then treated with the restriction enzymes ApaI, BsaI, and SpeI. On the other hand, the LuxR mutant (WO2019182156), amplified by PCR using primer sequences 6 (SEQ ID NO: 6) and 7 (SEQ ID NO: 7), was treated with restriction enzymes SpeI and HindIII. These three fragments were closed into a pHRA vector treated with ApaI and HindIII to obtain pHRA-TetR-LuxRv2 (SEQ ID NO: 77) (Figure 2, see SEQ ID NO: 8).
[0045] (LuxR evolution) To obtain a LuxR mutant whose transcriptional enhancement activity is increased by aTc binding, the following procedure was performed. Creating TetR-[LuxRv2]: A library was created using TetR-LuxRv1 as a template, with random mutations introduced only into the luxR gene region. The conditions were as follows: Template: 5 ng fragments PCR-amplified with primer sequence 8 (sequence number 9) / sequence number 9 (sequence number 10) Reaction volume: 50 μL PCR Buffer NEB 10× Thermo Pol Reaction Buffer dNTP concentration 0.2 mM each, Mg concentration 0.2 mM, Mn concentration 50 μM NEB Taq DNA Polymerase, 5 units Final yield: 5000 ng, amplification factor: 1000x. The obtained DNA was gel-extracted, further purified, and then ligated into a vector. Vector: 100 ng, Insert: 72 ng, Reaction volume: 10 μL Reaction time: 16 hours, reaction temperature: 16°C, NEB T4 DNA Ligase, 400 units The obtained ligation solution was desalted and electoporized to E. coli strain BW25113. 60 μL of competent cells were mixed with 3 mL of SOC and cured at 37°C for 1 hour. 1 μL (1 / 3000th) of this mixture was plated on an agar plate. The remaining 2999 μL was diluted in 40 mL of LB and cultured overnight (12 hours) at 37°C with shaking. 2 mL of the resulting bacterial suspension was miniprepped. Thus, we obtained the TetR-[LuxRv2] library (with random mutations introduced only into the [LuxR Rv1] portion) (library size: 2.3 × 10⁻¹⁰). 5 ). Selection 1: From the TetR-[LuxRv2] library, mutants exhibiting higher transcriptional enhancement activity in the presence of anhydrous tetracycline (aTc), a ligand for TetR, without the addition of AHL, were isolated. Specifically, the above plasmid library was transformed into E. coli strain BW25113 along with a reporter plasmid (Plux-sfGFP-hsvTK / aph, reference: WO2019182156), cultured at 37°C for 1 hour in LB medium supplemented with aTc (100 ng / mL), and then cultured for 3 hours with the addition of 0-120 μg / mL of kanamycin (positive selection). Since the reporter plasmid contains hsvTK / aph along with GFP under Plux, mutants with high expression levels of this aph (kanamycin resistance gene) were preferentially grown and enriched. Functional Selection 1: The libraries after Selection 1 were inoculated onto solid culture media containing 100 ng / mL aTc (but without AHL), and the concentration efficiency by selection was compared based on the ratio of fluorescent colonies to the total number of colonies (Table 1).
[0046] [Table 1] Mutants enriched in the first positive selection of the TetR-[LuxRv2] library. a) The number of colonies formed on a solid medium containing 100 ng / mL aTc after selection. b) The number of colonies that showed fluorescence out of the formed colonies. The number in parentheses represents the percentage of all colonies that showed fluorescence.
[0047] In libraries that had not undergone selection, no colonies exhibiting fluorescence in aTc-supplemented medium were found. In other words, even in the presence of the TetR ligand (aTc), very few colonies exhibiting LuxR function were found under conditions without AHL. However, in batches to which Kanamycin had been added, i.e., in which selection had been performed, colonies exhibiting high fluorescence were found.
[0048] (Functional Selection 2) Since the above results showed less than 10%, further enrichment of the desired mutants was performed. The enriched library was collected and cultured again in the presence of kanamycin (120 μg / mL) to enrich clones that enhanced Plux even in the absence of AHL. This time, 71% showed fluorescence in aTC plates. By performing positive selection twice, the proportion of fluorescent colonies on the solid medium containing aTc was sufficiently increased. This cell mixture was collected, and plasmids were then recovered.
[0049] (5) Functional distribution analysis: Escherichia coli strain BW25113, which had previously been introduced with a reporter plasmid, was transformed with the plasmid (mixture) solution obtained above and inoculated onto solid culture media. 44 colonies were randomly selected from each group of transformants and cultured separately in medium containing 100 ng / mL aTc and LB medium without aTc. After culturing at 37°C for 12 hours, the fluorescence intensity per cell density was examined (Figure 3). As shown in Figure 3, most of the enriched mutants were plotted to the right of the parent (black dot) in both X and Y values. In other words, those that showed clear fluorescence even in the absence of AHL were enriched. However, for most mutants, there was no significant difference in output values between those with aTc (On value, Y-axis) and those without aTc (Off value, X-axis). A plasmid with excellent aTc dependence (arrow in Figure 3) was recovered as LuxRv3 (SEQ ID NO: 78).
[0050] (6) Genotype: The genotype of LuxRv3 obtained in this example was examined (see Figure 4). Compared to LuxRv1 and LuxRv2, LuxRv3 had a new amino acid mutation, L42S-N93K-N99D-N100S. LuxR N86K-C245W (LuxRv1: a mutation of LuxR (sequence number: 11)) exhibits high leakage expression even in the absence of AHL. In other words, it behaves as a superactivator on its own. LuxR N86K-C245W-T33A-S57T(LuxRv2) exhibits high transcriptional enhancement activity even when fused with multiple transcription factors.
[0051] (Checking the functionality of LuxRv3) To confirm the function of LuxRv3, the dose-response of TetR-Lv3 to aTc and AHL was evaluated (see Figure 5). Specifically, E. coli strain BW25113, into which Plux-sfGFP-HSVtk-aph (see WO2019182156) was introduced, was transformed with various TetR-LuxR expression plasmids. Three isolated colonies were randomly selected, and the fluorescence intensity per cell density was examined when cultured in liquid medium containing various concentrations of aTc or AHL (Figure 6). Similar experiments were performed using plasmids encoding the α-peptide of LacZ instead of LuxR.
[0052] (Results of testing LuxRv3 functionality) TetR-LuxRv1 and TetR-LuxRv2 did not show a significant response to aTc in the absence of AHL (Figure 6a), but showed high fluorescence intensity in response to AHL as the added concentration increased (Figure 6b). Although LuxRv1 has been reported as a superactivator type that emits even in the absence of AHL, its transcriptional enhancement activity was only increased with the addition of high concentrations of AHL. It is thought that LuxRv1 lost its characteristics upon fusion with TetR. TetR-LuxRv2 showed almost no fluorescence in the absence of AHL, but exhibited significantly higher fluorescence intensity than LuxRv1 under conditions of 10 μM AHL addition. It is thought that the two amino acid mutations (T33A, S57T) introduced into LuxRv2 increased fusion tolerance, enabling it to exhibit high transcriptional enhancement activity upon AHL binding. TetR-LuxRv3 exhibited transcriptional enhancement activity even without the addition of either ligand. This indicates that it has recovered its "superactivator" properties, which were lost due to TetR fusion. On the other hand, transcriptional enhancement activity increased 2.4-fold with the addition of 100 ng / mL aTc and 2.2-fold with the addition of 10 μM AHL. Since transcriptional enhancement activity can be increased not only by AHL but also by aTc binding, the stability of the sensor protein was reduced to the point where fluctuations in its effective concentration were more easily reflected in the transcriptional enhancement level. All four amino acid mutations added to LuxRv3 were located near the AHL binding site, which is the LuxR ligand. This may reduce its affinity for AHL. Its inflection point (AHL response sensitivity) was 3190 nM, 10 times higher than that of the parent (TetR-LuxRv2) (317 nM). Furthermore, the signal intensity increased and stopped rising at a low level with AHL addition.
[0053] (Confirmation of changes in stability) The stability changes resulting from four newly added amino acid mutations in LuxRv3 were calculated using FoldX 13. These mutations were predicted to destabilize LuxRv3 by 3.4 kcal / mol compared to LuxRv2 (Figure 7). LuxRv3 appears to have improved fusion tolerance and a moderately unstable state compared to LuxRv1 and LuxRv2. Therefore, when creating metabolite sensors, it is expected that some degree of on / off switching can be observed simply by fusing the enzyme. Therefore, we confirmed that LuxRv3 is an actuator A that exhibits transcriptional enhancement activity even without the addition of ligand L such as AHL. [Examples]
[0054] (Fabrication of morphinan alkaloid sensors) Morphinan-type alkaloids, which are secondary metabolites, include compounds that can be used as high-value pharmaceuticals such as analgesics (morphine) and cough suppressants (codeine). These have extremely complex chemical structures, making their chemical synthesis difficult. Therefore, they are supplied through extraction from plants. Furthermore, some intermediate alkaloids, such as thebaine, are valuable and can be chemically modified to produce various physiologically active substances, but these are currently rarely found in extracts from plants like poppies. Many components of the morphine biosynthesis pathway (Figure 8) are difficult to express heterologously, requiring extensive efforts in enzyme and metabolic engineering. Analysis of intermediates is limited to low-throughput methods such as HPLC, making library-based breeding difficult. Despite considerable effort, an efficient biosynthetic pathway has not yet been established.
[0055] In general, detecting intermediates in the biosynthetic pathways of secondary metabolites (natural products) is difficult. The complexity and instability of their structures, coupled with the lack of receptors for their rare structures, makes the development of biosensor-based detection systems for them more challenging compared to ATP or key metabolites in the central metabolic pathway (for which natural receptors are known in nature). However, even if secondary metabolic intermediates lack their receptors, enzymes that use them as substrates still exist, as they are metabolites. These enzymes specifically bind to these metabolic intermediates prior to their catalytic action. If these biosynthetic enzymes can be used as sensor elements (receptors), then the biosynthetic intermediates become specific recognition targets for them. The receptor proteins that make up sensors undergo structural changes upon binding to a target, and there is a mechanism to read these structural changes. Some enzymes undergo significant structural changes upon substrate binding, but most undergo little to no structural change, or even if they do, reading the changes is difficult. This has made the development of sensors such as morphinan alkaloids challenging. In this example, instead of structural changes, we used a method of "reading out" changes that are inevitably caused by substrate binding, known as "stabilization," to create multiple sensors for biosynthetic intermediates. In particular, the following work was carried out to develop sensors for morphinan alkaloids and their biosynthetic intermediates. (1) Fusion of morphinan alkaloid biosynthetic enzymes with the transcription factor protein LuxR (2) Evolutionary engineering of the obtained fusion protein (random mutation and functional selection) Sensors were fabricated to detect morphine biosynthesis intermediates (reticulin, thebaine, and codeine) obtained through the above process.
[0056] (Construction of a prototype sensor) -1 As a sensor unit, a plasmid encoding Plux-GFP (see Figure 9) was used, as previously reported (WO2019182156). The activator transcription factor LuxR caused sfGFP expression from this plasmid, resulting in fluorescence in the cells. -2 Eleven types of morphine biosynthesis enzymes (Table 2) were selected. -3 We created plasmids expressing a total of 22 "enzyme-LuxR fusions" by in-frame fusion at the gene level with two types of LuxR mutants (v2 and v3). One of these, the CODM-LuxR(v3) expression plasmid, is shown in Figure 11. The above manufacturing procedure is shown in Figure 10.
[0057] -1 Restriction enzyme BamHI and SpeI sites were attached to each "enzyme-side" fragment (sequences 3 to 13) shown in Table 2 by PCR. The primer sets used are shown in Table 2. -2 The obtained DNA fragments were treated with restriction enzymes BamHI and SpeI and purified by column (inserts). -3 The idi portion of pHRA-idi-LuxR(WO2019182156) was excised using restriction enzymes BamHI and SpeI, and then purified by column (vector). -4 The Insert / Vector prepared in (-2) and (-3) above was mixed and ligated with T4DNA Ligase. The resulting ligation product was then used to analyze the E. coli strain XL10-Gold (Kan R The plasmid was introduced into the organism, colony formation was allowed, and the plasmid was cloned, then recovered from those colonies. -5 In all cases, sequencing analysis confirmed the absence of mutations.
[0058] [Table 2] The morphinan biosynthesis enzyme-LuxR fusion protein that was created. *1: Of the STORR (901 amino acids in total length), the 33-580 aa portion was used after removing the N-terminal portion (1-32 aa) of the part encoding CYP80Y2. *2: Of the total 505 amino acids in SalS, the portion from 91-1515 aa was used after removing the N-terminal portion (1-90 aa).
[0059] [Table 3] The primer used for fusion with LuxR.
[0060] (Evaluation of sensor functionality) The functions of each sensor created as described above were investigated for (1) responsiveness to AHL (acylhomoserine lactone), (2) responsiveness to morphine / codeine, and (3) responsiveness to reticuline.
[0061] (AHL responsiveness (exfer curve)) First, it was necessary to confirm that LuxR retained its reporter function (Plux-enhancing function) upon fusion with the biosynthetic enzyme. Expression plasmids of each prepared enzyme-LuxR fusion were introduced into E. coli strain BW25113 along with Plux-sfGFP (reference: WO2019182156). Each transformant was cultured overnight (12 hours) in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) with shaking (preculture). This preculture was inoculated into 0.5 mL of fresh medium (0-10 μM AHL) in a 96 deep well plate to a 100-fold dilution and cultured with shaking at 37°C for 12 hours. The resulting bacterial suspension was measured for OD595 and fluorescence (Ex: 485 nm / Em: 535 nm filter configuration) using a plate reader (FilterMax F5, Molecular Devices) (Figure 12). LuxR retained its LuxP-enhancing activity when fused with any enzyme other than MorA. In other words, GFP fluorescence increased as the concentration of AHL added to the culture medium increased. However, the shape of the response curve was unique for each case. In many motifs, LuxRv2 was more AHL-dependent and had higher response sensitivity than LuxRv3. The LuxRv3 series had a response sensitivity to AHL that was about an order of magnitude lower than LuxRv2, but it was superior in that it exhibited GFP fluorescence even in the absence of AHL (indicating LuxR function).
[0062] (Checking the codeine / morphine sensor) Each transformant was cultured overnight (12 hours) in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) with shaking (preculture). From this preculture, the cells were inoculated into 0.5 mL of fresh medium (containing 0-1 mM morphine or codeine) in a 96 deep well plate to a 100-fold dilution, and cultured with shaking at 37°C for 12 hours. The AHL concentration added to the medium was fixed at 1 μM or 0 (Ver-3) and 0.1 μM (Ver-2). The obtained bacterial suspension was measured for OD595 and fluorescence (Ex: 485 nm / Em: 535 nm filter configuration) using a plate reader (FilterMax F5, Molecular Devices) (Figures 13 and 14). Regarding the codeine response in Figure 13, it was confirmed that four LuxR fusions—SalAT, THS, T6ODM, and CODM—responded. Specifically, it was confirmed that SalAT-LuxRv2 (or LuxRv3), THS-LuxRv2 (or LuxRv3), T6ODM-LuxRv2 (or LuxRv3), and CODM-LuxRv2 (or LuxRv3) are codeine sensors. Regarding the morphine response in Figure 14, it was confirmed that the LuxR fusions of SalAT, CODM, SalR, and COR were responsible for the response. In other words, it was confirmed that SalR-LuxRv2 (or LuxRv3) and COR-LuxRv2 (or LuxRv3) are morphine sensors. Furthermore, a TS sequence is inserted between each enzyme and LuxRv3 (or LuxRv2), and an HHHHHHGS sequence is inserted after the start codon of each enzyme.
[0063] (Checking the reticuline sensor) The response to S-reticuline, an important intermediate in morphine biosynthesis, was investigated. Each transformant was pre-cultured in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) with shaking overnight (12 hours). From this pre-culture, the cells were inoculated in 0.5 mL of fresh medium (0–50 μM (S)-reticuline) in a 96-deep well plate to a 100-fold dilution, and cultured with shaking at 37°C for 12 hours. The obtained bacterial suspension was measured for OD595 and fluorescence (Ex: 485 nm / Em: 535 nm filter configuration) using a plate reader (FilterMax F5, Molecular Devices) (Figure 15). Regarding the reticulin response shown in Figure 15, it was confirmed that the LuxR fusion of T6ODM and COR was responding. In other words, it was confirmed that T6ODM-LuxRv2 (or LuxRv3) and COR-LuxRv2 (or LuxRv3) are reticulin sensors. Furthermore, a TS sequence is inserted between each enzyme and LuxRv3 (or LuxRv2), and an HHHHHHGS sequence is inserted after the start codon of each enzyme.
[0064] (Evolutionary engineering-based rectirin sensor) We introduced random mutations into COR-LuxRv3 (COR: an enzyme that reduces codeinone to codeine [UniPlot: Q9SQ68]), which showed good (S)-retuiculine responsiveness, and created a library to obtain mutants with better reticulin sensor properties. The library was created as follows, based on the description in Figure 16. -1 pHRA-PN25-his-optCOR-LuxRv3 was used as a template, and the vector portion was amplified by Fidelity PCR using KOD plus. The reaction conditions were as follows: Template plasmaid quantity: 5 ng / reaction volume 50 μL PCR Buffer TOYOBO 10×KOD plus Buffer dNTP concentration 2mM each, Mg concentration 25mM KOD plus Polymerase, 1 unit Primer set (vector side) 5'-TTTTACTAGTGAAAACATAAATGCCGACGACACA -3'(Sequence ID 53) 5'-TTTTGGATCCGTGGTGATGGTGATG -3' '(Sequence ID 54) Primer set (insert side) 5'-TTTTGGTCTCtCCAGGCATCAAATAAAACGAAAGG -3' (Sequence ID 55) 5'-CACCAGCGTTTCTGGGTGAG -3' (Sequence ID 56) Thermal cycle: 94°C (2 min) → {94°C (15 sec) / 52°C (30 sec) / 68°C (3.5 min)} x 25 → 68°C (4 min) Both PCR products were purified by gel extraction after DpnI treatment. -2 Using the PCR fragment (COR-LuxR, 2271 base pairs) obtained in "-1" above as a template, the gene in the COR-LuxRv3 region was amplified by epPCR. The reaction conditions were as follows: Template plasmaid quantity: 5 ng / reaction volume 50 μL PCR Buffer NEB 10× Thermo Pol Reaction Buffer dNTP concentration 2 mM each, Mg concentration 25 mM, Mn concentrations 10 and 50 μM NEB Taq DNA Polymerase, 1.25 units Final yield: 5000 ng, amplification factor: 1000x. Primer: 5'-TTTTGGTCTCtCCAGGCATCAAATAAAACGAAAGG -3' (Sequence ID 57) 5'-CACCAGCGTTTCTGGGTGAG -3' (Sequence ID 58) -3 The purified PCR products were purified by digestion reactions using BamHI-HF, HindIII-HF, and rSAP for the vectors, and BamHI-HF and HindIII-HF for the inserts, with 3 hours at 37°C followed by 30 minutes of thermal inactivation at 80°C. These were then ligated under the following conditions. Vector: 100 ng, Insert: 217 ng, Reaction volume: 10 μL Reaction time: 16 hours, reaction temperature: 16°C, NEB T4 DNA Ligase, 200 units -4 E. coli BW25113 was transformed with the obtained ligation product, and the transformation solution was inoculated into 60 mL of LB liquid medium and cultured in a 300 mL baffled Erlenmeyer flask at 37°C for 12 hours to recover the plasmid library. The library size was as follows: [COR-LuxRv3] 10 : 2.8×10 4 [COR-LuxRv3] 50 : 5.4×10 4 -5 The behavior of the prepared libraries was observed under conditions with and without the addition of 100 μM of (S)-reticuline (Figure 17). E. coli strain BW25113 into which the reporter gene (pPlux-sfgfp) has been introduced [COR-LuxR] 10 [COR-LuxR] 50 The cells were transformed and inoculated into LB solid medium to form colonies. Additionally, 10 mL of LB liquid medium was placed in a centrifuge tube, and 1 / 100 of the transformation solution was inoculated into it and incubated overnight at 37°C (pre-culture). The pre-culture solution was then inoculated into 500 μL of LB liquid medium at 1 / 100 of the volume and incubated at 37°C for 12 hours. The distribution of fluorescence intensity after ON-selection at each (S)-reticuline concentration was then measured by FCM (FCS: Trig log3 320V, SSC: Trig log3 230V, B1: Trig log5 490V, Trigger 2.00). Before randomization, there appeared to be a slight reticuline response. This "difference" was amplified by libraryization (randomization). The fluorescence distribution in the On state was slightly reduced, while that in the Off state was significantly shifted to the low-signal side. This change suggests that many (or all) of the mutants bound to S-reticuline with significant strength, and the introduction of random mutations caused a broad downward redistribution of the stability of fusion proteins in the absence of reticuline.
[0065] (Acquisition of rectirin sensors through evolutionary engineering) E. coli strain BW25113 into which the reporter gene (pPlux-sfgfp) has been introduced [COR-LuxR] 10 [COR-LuxR] 50 The cells were transformed and inoculated into LB solid medium containing 100 μM (S)-reticulin to form colonies. 91 cells showing high fluorescence output were selected and cultured in 500 μL of LB liquid medium at 37°C for 12 hours with shaking to obtain a pre-culture. The pre-culture medium was subpoenaed in 5 μL each of LB medium containing reticulin (100 μM) and LB medium without reticulin (96 deep well plate, 500 μL), and the fluorescence intensity distribution was measured. Six clones were selected in which the fluorescence value per cell was significantly higher in the reticulin-containing medium than in the reticulin-free medium, and plasmids were recovered. When these were re-transformed, two of them (mut-5 and mut-6) reproduced the difference in fluorescence values depending on the presence or absence of reticulin (Figure 18). Although leakage was observed in the absence of reticulin, a clear reticulin response was confirmed. Furthermore, sequencing analysis of the two mutants revealed that mut5 had two amino acid mutations (S11G, F276Y) on the enzyme side, while mut6 had two amino acid mutations (S11G, F276Y) on the enzyme side and one mutation (K16R) on LuxRv3 (Figure 19). From the above, it was confirmed that mut5(S11G, F276Y)-LuxRv3 and mut6(S11G, F276Y)-LuxRv3(K16R) are reticuline sensors. Note that a TS sequence is inserted between mut5 or mut6 and LuxRv3, and an HHHHHHGS sequence is inserted after the start codon of mut5 or mut6.
[0066] (Production of thebaine / codeine sensors by evolutionary engineering) CODM-LuxRv3, which showed favorable codeine responsiveness, is an enzyme that also uses thebaine, a key substance in morphine synthesis, as a substrate. Attempts were made to obtain mutants with better responsiveness from this random mutation library of CODM-LuxRv3.
[0067] 10 or 50 μM Mn 2+ was used for EP-PCR to introduce random gene mutations across the entire region of CODM-LuxR while amplifying by 10 3 -fold amplification. The obtained PCR product was ligated with a vector, replicated in Escherichia coli strain BW25113, and a plasmid library was recovered.
[0068] In accordance with the workflow shown in Figure 20, Escherichia coli strain BW25113 harboring a reporter plasmid (pPlux-sfgfp) was transformed with the CODM-LuxR library. The pCODM-LuxR library was inoculated onto LB solid medium containing various codeine concentrations to allow colony formation. Luminescent colonies were picked from the formed colonies and subjected to pre-culture in 500 μL of LB (Amp / Cm) liquid medium at 37°C for 12 hours. The pre-culture was inoculated at a 1 / 100 dilution into LB liquid medium containing 0 / 100 μM codeine, and cultured at 37°C for 12 hours. The main culture was diluted 10-fold with physiological saline, and cell density (OD595) and green fluorescence intensity (Ex: 485 nm / Em: 535 nm) were measured using FilterMax F5.
[0069] (Specificity analysis of mutants) Three transformant colonies were randomly selected and cultured in 500 μL of LB liquid medium at 37°C for 12 hours with shaking (pre-culture). The pre-culture solution was inoculated into LB liquid medium at a 1 / 100 volume and cultured at 37°C for 12 hours with shaking in liquid medium containing various concentrations of thebaine, codeine, (S)-reticulin, and morphine under conditions without AHL addition (main culture). The main culture solution was diluted 10-fold with physiological saline and the cell density (OD) was measured using FilterMax F5. 595 ) and green fluorescence intensity (Ex: 485 nm / Em: 535 nm) were measured. The results shown in Figures 21 and 22 confirm that the CODM(Q121L and R346H)-LuxRv3 mutant, in which two amino acid mutations (Q121L and R346H) are introduced into the enzyme CODM, functions as a divine codeine sensor. Furthermore, a TS sequence is inserted between CODM(Q121L and R346H) and LuxRv3, and an HHHHHHGS sequence is inserted after the start codon of CODM(Q121L and R346H). [Examples]
[0070] (Fabrication of tryptophan sensors and tyrosine sensors) Many microorganisms possess transcription factors that respond to tryptophan and tyrosine, enabling precise and dynamic regulation of the biosynthetic pathway of aromatic amino acids. For example, *E. coli* possesses repressors called TyrR and TrpR, which have long been used in gene expression systems that use amino acids as inducers. Both TyrR and TrpR are so-called "corepressor-type" transcription regulatory proteins. That is, they have a mechanism to increase their affinity for TyrO and TrpO (their respective binding sites) by binding to their ligands, tyrosine and tryptophan. Therefore, the addition of tryptophan or tyrosine to the culture medium represses, rather than induces, the gene expression downstream of TyrP and TrpP (an ON→OFF type response). For this reason, methods have been developed to use these as gene expression induction systems by adding TrpR and TyrR antagonists (such as indoleacetic acid) to the culture medium. On the other hand, the method reported by the present inventors (reference: WO2019182156) fabricated a sensor that senses stability through ligand binding. In other words, it was possible to induce an OFF→ON response in molecules that bound with sufficient stability (affinity) without the presence of agonists or antagonists. In this example, a sensor that exhibits an OFF→ON type response using tryptophan, tyrosine, etc., was fabricated by the following method.
[0071] (TrpR-LuxR) The TrpR gene (EG11029: 108 amino acids, 333 bases total: SEQ ID NO: 59) from Escherichia coli was PCR-amplified from the genomic DNA of E. coli strain MG1655 (SEQ ID NOs: 60, 61). This was treated with restriction enzymes BamHI and SpeI, and ligated with the tetR portion of pHRA-TetR-LuxR (also treated with BamHI and SpeI) to obtain pHRA-TrpR-LuxR (Figure 23: SEQ ID NO: 62). In this construct, TrpR-LuxR (full length 367 amino acids) was expressed under the control of the N25 promoter (RBS score). 4 (is 9537, setting). Sequence ID 60: TTTTGGATCCGCCCAACAATCACCCTATTCAG Sequence ID 61: TTTTACTAGTATCGCTTTTCAGCAACACCTCTTC TyrR-LuxR: The TyrR gene (EG11042: 513 amino acids, 1548 bases total: SEQ ID NO: 63) from Escherichia coli was PCR amplified from the genomic DNA of E. coli strain MG1655 (SEQ ID NOs: 64, 65). This was treated with restriction enzymes BamHI and SpeI, and ligated with the TetR portion of pHRA-TetR-LuxR (also treated with BamHI and SpeI) to obtain pHRA-TyrR-LuxR (Figure 24, SEQ ID NO: 66). In this construct, TyrR-LuxR (full length 772 amino acids) was expressed under the control of the N25 promoter (RBS score 13670, set). Sequence ID 64: TTTTGGATCCCGTCTGGAAGTCTTTTGTGAAG Sequence ID 65: TTTTACTAGTCTCTTCGTTCTTCTTCTGACTC
[0072] (Functional analysis (Exfer curve)) TrpR-LuxRv3 and TyrR-LuxRv3 were introduced into E. coli strain BW25113 along with Plux-GFP (WO2019182156). The transformants were then shaken and cultured overnight (12 hours) in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). These precultures were then diluted 100-fold in 0.5 mL of fresh medium (0-10) in a 96 deep well plate. 3 The cells were inoculated with μM L-tryptophan or L-tyrosine and cultured with shaking at 37°C for 12 hours. The resulting bacterial suspension was measured for OD595 and fluorescence (485 nm / 535 nm filter configuration) using a plate reader (FilterMax F5, Molecular Devices) (Figure 25). As shown in Figure 25, both the tyrosine sensor and the tryptophan sensor emitted a higher fluorescence signal as the tryptophan concentration added to the culture medium increased, allowing us to develop an Off→ON type sensor. The EC50 values of the sensors were 61 μM (TyrR-LuxR) and 32 μM (TrpR-LuxR), respectively, which generally reflected the reported Kd values (24-330 μM (TyrR) and 16 μM (TrpR)). Based on the above, we have confirmed that TrpR-LuxRv3 and TyrR-LuxR v3 are tryptophan sensors that, unlike conventional ones, are capable of detecting increases in tryptophan concentration. Furthermore, a TS sequence is inserted between TrpR or TyrR and LuxRv3, and an HHHHHHGS sequence is inserted after the start codon of TrpR or TyrR.
[0073] (Fabrication of a tyrosine sensor using TyrB) The biosensor in this embodiment reads out stabilization by ligand (small molecule binding), and therefore has the advantage of being able to use enzymes as molecular recognition elements. Thus, a tyrosine sensor was fabricated by binding TyrB (2.6.1.57: an enzyme that transfers the amino group of tyrosine to ketoglutaric acid), which is involved in tyrosine biosynthesis, to LuxR.
[0074] (TyrB-LuxR) The gene for TyrB (EG11040: 397 amino acids, 1200 bases total: SEQ ID NO: 67) derived from Escherichia coli was PCR-amplified from the genomic DNA of E. coli strain MG1655 (SEQ ID NOs: 68, 69). This was treated with the restriction enzymes BamHI and SpeI, and ligated with the TetR portion of pHRA-TetR-LuxR (also treated with BamHI and SpeI) to obtain pHRA-TyrB-LuxR (SEQ ID NO: 70, Figure 26). In this construct, TyrB-LuxR (full length 656 amino acids) was expressed under the control of the N25 promoter (RBS score 10916, set). Sequence ID 68: TAAAGGATCCTTTCAAAAAGTTGACGCCTACGC Sequence ID 69: TTTTACTAGTCATCACCGCAGCAAACGCC
[0075] (Functional analysis (flow cytometer analysis)) This sensor (TyrB-LuxRv3) was introduced into E. coli strain BW25113 along with Plux-GFP (reference: WO2019182156). The transformants were each shaken and cultured overnight (12 hours) in LB medium (0.5 mL, 100 μg / mL Amp, 30 μg / mL Cm) (preculture). Cells from this preculture were inoculated into 0.5 mL of fresh medium (containing 0 / 500 μM L-tyrosine) in a 96 deep well plate to a 100-fold dilution, shaken and cultured at 37°C for 12 hours, and analyzed by flow cytometry (FSC, 320 V (trigger, 2.00); SSC, 230 V (secondary trigger, 2.00); B1, 400 V) (Figure 27). As shown in Figure 27, both the tyrosine sensor and the tryptophan sensor emitted a higher fluorescence signal as the tyrosine concentration added to the culture medium increased, allowing us to develop an Off→ON type sensor. The sensor's EC50 value was 115 μM, which generally reflected the reported Kd value (42–625 μM). Based on the above, we have confirmed that TyrB-LuxRv3 is a tyrosine sensor that, unlike conventional sensors, is capable of detecting increases in tyrosine concentration. Furthermore, a TS sequence is inserted between TyrB and LuxRv3, and an HHHHHHGS sequence is inserted after the start codon of TyrB. [Examples]
[0076] (Fabrication of isoprenoid precursor sensors) IPP and DMAPP are the final biosynthetic products of metabolic pathways called the MEP pathway in E. coli and the MEV pathway in yeast. They are used not only for membrane synthesis but also as building blocks for isoprenoid synthesis. In this example, to detect IDI, DMAPP, and DOXP, a product of DXS (which is considered the rate-limiting enzyme of the E. coli MEP pathway), we fabricated sensors by fusing enzymes that use these as substrates (IDI, DXR) with LuxR.
[0077] (Preparation of IDI-LuxR) IDI (isopentenyl-diphosphate isomerase: SEQ ID NO: 76) is known to reversibly isomerize IPP, isopentenyl pyrophosphate, and DMAPP and dimethylallyl pyrophosphate (8). A plasmid was constructed that is constitutively expressed by genetically fusing it with the LuxRv3 mutant (Figure 28, SEQ ID NO: 71). (Digital DXR-LuxR creation) DXR (1-deoxy-D-xylulose 5-phosphate reductoisomerase, ispC) is the second enzyme in the MEP pathway, synthesizing MEP (2-methyl-D-erythritol 4-phosphate) from DOXP (1-deoxy-D-xylulose 5-phosphate) using NADPH as a coenzyme. A plasmid was constructed that is constitutively expressed by genetically fusing DXR with the LuxRv3 mutant (Figure 29, SEQ ID NO: 72). (Preparation of substrate (IPP) supply plasmid) It has been shown that expressing the yeast-derived genes mk, pmk, and pmd in E. coli increases the intracellular IPP accumulation level when MVA and mevalonate are added to the culture medium. Therefore, we constructed a plasmid that constitutively expresses the mk, pmk, and pmd genes, and constitutively expresses the blue fluorescent protein mTagBFP as an internal standard for expression levels (Figure 29, SEQ ID NO: 73). (Preparation of substrate (DOXP) supply plasmid) Since overexpression of DXS (1-deoxy-D-xylulose-5-phosphate synthase), which is involved in the first step of the MEP pathway, increases isoprenoid synthesis in E. coli, we hypothesized that the amount of DOXP, a substrate for DXR, could be significantly increased intracellularly by additional expression of DXS. To increase intracellular DOXP levels, we constructed a plasmid (Figure 30, SEQ ID NO: 74) that constitutively expresses the dxs gene.
[0078] (Substrate-level responses of IDI-LuxR and DXR-LuxR) To detect changes in the concentrations of these metabolites within E. coli, the two vectors prepared above were introduced into E. coli along with the Plux-sfGFP plasmid, and the fluorescence intensity was measured using a flow cytometer when the intracellular concentration of the target metabolites was altered (Figure 32). As shown in Figure 32, while IDI-LuxRv3 included some cells showing slightly higher fluorescence intensity upon the addition of mevalonic acid, the overall fluorescence intensity of the culture medium was weak, and no sensor behavior was observed. Similarly, with DXR-LuxRv3, increasing the amount of DOXP by additional DXS expression did not result in any sensor behavior.
[0079] (Evolutionary Engineering of IDI-LuxR (First Generation)) To improve the performance of the IPP / DMAPP sensor, we performed evolutionary engineering on idi-luxRv3. Specifically, we created a library in which random mutations were introduced throughout the entire gene (see Table 4 below).
[0080] [Table 4] A library created using evolutionary engineering techniques from IDI-Lv3.
[0081] IPP-responsive mutants were isolated from the constructed library. Specifically, E. coli strain BW25113, which already possessed a reporter plasmid and an IPP-supply plasmid, was transformed with the constructed plasmid library and inoculated onto solid medium containing 480 μM mevalonic acid to form colonies. After 12 hours of incubation at 37°C, no colonies showed significant fluorescence, so screening was performed after an additional 12 hours of static incubation at 4°C. At this point, 1,500 out of 3,000 colonies showed fluorescence, of which 45 showed stronger fluorescence than the parent. These 45 colonies, along with 135 randomly selected from 1,500 luminescent colonies (a total of 180 clones), were cultured in two separate culture media: one containing 480 μM mevalonic acid and the other without. The fluorescence intensity of these clones was then evaluated. Among the screened mutants, one mutant (G1P2D4) showed high fluorescence when a high concentration of mevalonic acid was added. The ratio of fluorescence intensity when cultured in medium containing 4800 μM mevalonic acid to medium without it was 2.8 times for IDI-Lv3, while it was 9.5 times for G1P2D4. Analysis of the DNA sequence of this mutant revealed that an L19P mutation was introduced into the IDI region and a V162I mutation into the LuxR region (see Table 5 below). We confirmed that the G1P2D4-LuxRv3(V162I) mutant functions as a mevalonate sensor. Furthermore, a TS sequence is inserted between G1P2D4 and LuxRv3(V162I), and an HHHHHHGS sequence is inserted after the start codon of G1P2D4. Furthermore, to investigate the effect of the mutation introduced into the G1P2D4 mutant, we created IDI-LuxRv3V162I by introducing the V162I mutation into the LuxR domain of IDI-LuxRv3.
[0082] [Table 5] The genotype of the mutant obtained through evolutionary engineering (first generation) of IDI-Lv3. a) The nucleotide and amino acid mutations introduced into LuxR were renumbered from LuxR onward. b) All variants retain, in addition to the new mutations listed above, the nine mutations introduced into the LuxR side of the parent IDI-LuxRv3 (A97G(T33A), T125C(L42S), T169A(S57T), C258A(N86K), T279A(N93K), A295G(N99D), A299G(N100S), T624C(G208G), and C735G(C245W)).
[0083] Figure 33 shows the results of parallel examination of the dose responsiveness of IDI-LuxRLv3, IDI-LuxRLv3V162I, and IDI-LuxRLv3{G1P2D4} to mevalonic acid. The addition of the V162I mutation to IDI-Lv3 increased the overall transcriptional activation activity and improved the maximum output, but decreased the stringency. The G1P2D4 mutant, in which the L19P mutation was introduced into the IDI domain of this IDI-Lv3V162I, had a maximum output comparable to that of IDI-Lv3V162I, while the stringency was improved. This confirmed that IDI-LuxRLv3, IDI-LuxRLv3V162I, and IDI-LuxRLv3{G1P2D4} can serve as mevalonate sensors. It should be noted that a TS sequence is inserted between IDI and each LuxR, and an HHHHHHGS sequence is inserted after the start codon of IDI. Furthermore, based on the above results, it is considered that the V162I mutation introduced into LuxR increased fusion tolerance, and the L19P introduced into IDI moderately reduced the stability of the sensor protein.
[0084] (Directed evolution of IDI-LuxR (second generation)) To produce an IPP / DMAPP sensor with a higher dynamic range than the first generation, a second-generation library was constructed by introducing random mutations only into the IDI region, using IDI-LuxR G1P2D4 as the parent. To facilitate the search for mutants with high-sensitivity responses, cultures were cultured under the condition of adding 480 μM mevalonic acid, and positive screening was performed by adding various concentrations of kanamycin. Clonal strains that were cultured and concentrated for 3 hours under the condition of 30 μg / mL kanamycin concentration were inoculated onto a solid medium containing no mevalonic acid, and the functional distribution of 88 clones was evaluated among 600 dark colonies out of 700 total colonies. As a result of screening, one interesting mutant was obtained (see: Table 6 below). The G2P3D9 mutant had a maximum output comparable to that of its parent G1P2D4, and its dynamic range was improved due to increased stringency (Figure 34). This confirmed that IDI-LuxRLv3{G2P3D9} functions as a mevalonic acid sensor. A TS sequence is inserted between IDI and each LuxR, and an HHHHHHGS sequence is inserted after the start codon of IDI. In addition, a D28H mutation was introduced into the IDI region of this mutant. Since the stringency of the sensor was improved, it is considered that D28H is a mutation that reduces the structural stability of the sensor protein but does not eliminate the binding ability to IPP / DMAPP.
[0085] [Table 6] Genotypes of mutants obtained through directed evolution of IDI-Lv3 (second generation). a) In addition to the new mutations listed above, the mutant carries 9 mutations introduced on the LuxR side of LuxRv3 (A97G(T33A), T125C(L42S), T169A(S57T), C258A(N86K), T279A(N93K), A295G(N99D), A299G(N100S), T624C(G208G), and C735G(C245W)).
[0086] (Directed evolution of IDI-LuxR (third generation)) In order to produce an IPP / DMAPP sensor with a higher dynamic range than that of the second generation, a third-generation library was prepared by introducing random mutations only into the IDI region using IDI-LuxR G2P3D9 as the parent. To facilitate screening for mutants with high-sensitivity responses, culture was performed under the condition of adding 4800 µM mevalonic acid, and positive screening was carried out by adding various concentrations of kanamycin. The cloned strain that was cultured and concentrated for 6 hours under the condition of 60 µg / mL kanamycin concentration was inoculated onto a solid medium containing no mevalonic acid, and the functional distribution of 80 randomly selected clones out of 2000 dark colonies from 2000 total colonies was evaluated. Screening yielded two interesting mutants. The G3P1D3 mutant (see Table 7 below) exhibited a similar maximum output to its parent, G2P3D9, but with improved dynamic range due to increased constriction (Figure 35a). On the other hand, the G3P1F4 mutant (see Table 7 below) had a higher maximum output than its parent, G2P3D9, and also exhibited an expanded dynamic range due to increased constriction (Figure 35b). Furthermore, this mutant showed a higher Hill coefficient (5.9 for the mutant compared to 3.7 for the parent) due to a shift in the mevalonate concentration at which it began to respond. Based on the above, it was confirmed that IDI-LuxRv3{G3P1F4} and IDI-LuxRv3{G3P1D3} function as mevalonate sensors. A TS sequence is inserted between each IDI and LuxR, and an HHHHHHGS sequence is inserted after the start codon of each IDI.
[0087] [Table 7] The genotype of a mutant obtained through evolutionary engineering (third generation) of IDI-Lv3. a) In addition to the new mutations listed above, the mutant retains the nine mutations that were introduced into the LuxR side of LuxRv3 (A97G(T33A), T125C(L42S), T169A(S57T), C258A(N86K), T279A(N93K), A295G(N99D), A299G(N100S), T624C(G208G), and C735G(C245W)).
[0088] (Evolutionary Engineering of DXR-LuxR) As is clear from the results in Figure 32, the sensor performance of DXR-LuxRv3 is extremely low, suggesting low fusion tolerance and inherently poor stability. Therefore, in the process of improving the sensor performance of DXR-LuxRv3, we performed evolutionary engineering on two generations of mutants to enhance enzyme activity.
[0089] (Creation of the first generation library) A [dxr]-luxRv3 library was constructed by introducing random mutations only into the dxr gene (see Table 8 below).
[0090] [Table 8] A library created using evolutionary engineering techniques for DXR-Lv3.
[0091] (1st generation) We prepared strain BW25113, into which we introduced the reporter plasmid (Plux-GFP-hsvTK / aph) and the substrate feeder plasmid (pDXS, Figure 31), and transformed it with the [DXR]lib-LuxRv3 library plasmid prepared above. Mutants with improved substrate binding should exhibit a higher signal than the parent in the presence of the substrate. Therefore, DXS expression was induced, and kanamycin selection (positive selection) was performed under these conditions. The resulting concentrated mutant population was then plated on agar medium, and mutants that formed colonies with high GFP fluorescence were selected (positive screening). Among approximately 1650 colonies, 32 clones showing higher output than the parent were found. These were cultured in liquid in 96-deep wells, and fluorescence intensity was quantified. Furthermore, sequencing analysis was performed to obtain four unique mutants. (Functional evaluation (sensor function)) The transcriptional enhancement activity of cells expressing these mutants was more than four times higher than that of the parent cells (Figure 36). In other words, we were able to obtain a sensor that responds to DOXP, a product of DXS (Table 9). In other words, it was confirmed that DXR{G1P1A2}-LuxRv3, DXR{G1P1B3}-LuxRv3, DXR{G1P1E2}-LuxRv3, and DXR{G1P1F2}-LuxRv3 are sensors that respond to DOXP. Note that a TS sequence is inserted between each DXR and LuxRv3, and an HHHHHHGS sequence is inserted after the start codon of each DXR. It should be noted that all of the isolated DXR-Lv3 mutant populations contained numerous amino acid mutations (Table 9). While it remains unclear how these mutations contributed to the improvement of sensor performance, the results indicate that there are many amino acid substitutions and combinations thereof that increase the output when DXS is overexpressed.
[0092] [Table 9] Mutations introduced into the DXR-Lv3 mutant.
[0093] (Second generation) Using, as a template, a plasmid mixture prepared by mixing equal concentrations of the four mutants isolated in the first generation, a second-generation library with random mutations introduced only into the DXR region was prepared (see Table 8). (Functional selection) BW25113 strain into which a reporter plasmid (Plux-GFP-hsvTK / aph) and a substrate feeder plasmid (pDXS) had been introduced was prepared, and the strain was transformed with the [DXR]lib-LuxRv3 library plasmid prepared above. In order to enrich mutants exhibiting high fluorescence intensity, DXS expression was induced and kanamycin selection (positive selection) was performed, then the enriched mutant population was further spread on an agar medium to select mutants that form colonies with high GFP fluorescence (positive screening). The thus enriched mutant population was further spread on an agar medium, and various colonies with different GFP fluorescence levels were selected (Figure 37). (Functional evaluation (sensor function)) Among the colonies, it was confirmed that the mutant with the highest fluorescence intensity ratio between the presence and absence of dxs is G2P1C11. The ratio was 2.5-fold (Figure 38). From the above, it was confirmed that G2P1C11 is a sensor that responds to DOXP. Furthermore, it was also confirmed that G2P1F4 and G2P1D7 are also sensors that respond to DOXP.
[0094] [Table 10] This mutation was introduced into the second-generation DXR-Lv3 variant. [Examples]
[0095] (Method for screening enzyme activity) In the above embodiment, it was demonstrated using multiple sensor elements E (enzymes) that a sensor can be fabricated simply by conjugating enzyme E to actuator A, LuxR, and adjusting its stability downwards. If the enzyme can be used as a molecular recognition element of the sensor by conjugating it to LuxR, then it is possible to construct sensors for almost all metabolites and metabolic intermediates on the metabolic map. On the other hand, the output characteristics of a sensor using an enzyme as the sensor element E accurately reflect the enzyme's substrate binding characteristics (and more precisely, its characteristics in subsequent activation and product release). In other words, using an enzyme as a sensor component is equivalent to making the enzyme's behavior "visible" through the sensor's output. That is, the enzyme's substrate binding event is detected by the degree of the sensor's output. By measuring this detection, it becomes possible to (1) screen a compound library for compounds that can be substrates for the enzyme, (2) estimate the Km (an indicator of substrate affinity) of the enzyme for its substrate, and (3) screen for the enzyme activity acting on a particular metabolite. In particular, by setting the substrate supply to a constant level (because of the high degree of homeostasis within cells, metabolite concentrations can be approximated as being in a steady state), the substrate binding characteristics of enzymes can be evaluated by assessing the sensor performance of the element. In other words, regardless of the type of reaction, the activity improvement of any enzyme can be achieved by fusing it with LuxR (see Figure 39).
[0096] Typically, enzyme activity screening requires devising methods to visualize only the enzyme reaction expressed in the cell, distinguishing it from thousands of other enzyme reactions occurring within the cell. With the exception of pigments and other factors, many enzyme reactions produce invisible substrates and products. Therefore, it is necessary to develop new chemo-enzyme systems that selectively visualize product accumulation or substrate depletion, or to develop methods that couple with the host cell growth rate. As demonstrated in this embodiment, if the substrate binding event of an enzyme can be converted into the activity of a transcription factor, the substrate recognition performance of the enzyme reaction can be visualized colorimetrically using methods such as GFP fluorescence, luciferase chemiluminescence, and LacZ dye synthesis, even without a method to track the enzyme reaction itself. Furthermore, by placing assimilation genes or antibiotic resistance genes under the regulatory promoter of the fused transcription factor, it is possible to couple substrate recognition ability with the host cell's growth rate. In other words, it becomes possible to screen the activity of any enzyme reaction within a cell without the need for methods to directly detect substrate depletion or product formation.
[0097] (2nd Screening) The products obtained from the 2nd screening were boil-prepped to recover the plasmids, and in addition to the reporter plasmid, a DXS-expressing strain (BW25113 with pDXS introduced) and a DXS-inactive mutant-expressing strain (BW25113 with pDXSdead introduced) were transformed with their respective plasmids. These DXS-LuxRv3 mutant groups were scored using two evaluation axes. [1] Sensor signal increase ratio The BW25113 strain, which carries the reporter plasmid (Plux-GFP-hsvTK / aph), was introduced along with (1) the substrate feeder plasmid (pDXS) or the control plasmid (pDXSdead), and the fluorescence output was measured with or without DXS overexpression. [2] Cell activity in a single frame The LuxR domain was excised from each DXS-LuxRv3 mutant to create constructs expressing only the DXR mutant. These constructs were introduced into E. coli BW25113 along with plasmid 1, which constantly expresses the lycopene synthesis pathway (CrtE, CrtB, and CrtI), and the amount of lycopene accumulated in the resulting transformants was measured. Figure 40 shows a plot with the signal gain obtained by dxs expression in the sensor on the X axis and enzyme activity (lycopene accumulation) on the Y axis.
[0098] As is clear from the results in Figure 40, when comparing the performance of the sensor element in the state fused with LuxRLv3 (fluorescence intensity ratio in dxs + / -) with the enzyme performance (lycopene synthesis amount) shown in the state of a single frame from which LuxRLv3 had been excised, we were able to obtain three mutants (G2P1C11, G2P1D7, G2P1F4) that showed a lycopene synthesis amount more than 10% higher than the wild type among the eight mutants that were judged to have significantly improved sensor ON / OFF performance compared to the parent (ON / OFF ratio > 1.5 times). In particular, G2P1C11 showed a 20% increase in production. As a result, using the method of this embodiment, it was possible to obtain mutants with high enzyme activity by screening based on the detection sensitivity of the sensor element. Furthermore, the DXR portions of these mutants were sequenced, and the introduced mutations are shown in the table below.
[0099] [Table 11] a) Mean ratio of fluorescence per OD of mutants compared to wild-type. b) Mean ratio of lycopene production of mutants to wild-type.
[0100] In the enzyme activity screening method of this embodiment, by (1) fusing the sensor element E and actuator A, and (2) screening the performance as a sensor (detection sensitivity of the sensor), it was possible to obtain an enzyme with excellent enzyme activity without screening the actual enzyme activity (product formation or substrate consumption).
Claims
1. A polypeptide having detection activity for morphinan alkaloids, wherein the morphinan alkaloid is devine, codeine, or reticulin, and the polypeptide has an amino acid sequence of any one of the following (1) to (6): (1) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, (2) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 121 and 346, and has substantially the same devine and / or codeine detection activity as (1) above. (3) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, has 90% or more homology to the amino acid sequence described in Sequence ID No. 51, and has substantially equivalent devine and / or codeine detection activity to that of (1) above. (4) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, (5) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 11 and 276, and has substantially the same reticulin detection activity as (4) above. (6) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, has 90% or more homology to the amino acid sequence described in Sequence ID No. 50, and has substantially the same reticulin detection activity as (4) above.
2. The polypeptide according to claim 1, wherein the morphinan alkaloid is devine or codeine, and is a codeine 3-O-demethylase (CODM) mutant having any one of the following amino acid sequences (1) to (3): (1) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, (2) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 121 and 346, and has substantially the same devine and / or codeine detection activity as (1) above. (3) The amino acid sequence shown in Sequence ID No. 51 has the amino acid substitutions Q121L and R346H, has 90% or more homology to the amino acid sequence described in Sequence ID No. 51, and has substantially the same devine and / or codeine detection activity as (1) above.
3. A gene encoding the CODM mutant polypeptide of claim 2, wherein the gene is either (A) or (B) below: (A) A gene encoding a polypeptide having substantially equivalent devine and / or codeine detection activity to that of (1) above, in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (1) above. (B) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (1) above, and having substantially equivalent devine and / or codeine detection activity to (1) above.
4. The polypeptide according to claim 1, wherein the morphinan alkaloid is reticulin and is a codeinone reductase (COR) mutant having any one of the following amino acid sequences (4) to (6): (4) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, (5) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, and furthermore, 1 to 20 amino acids are substituted, deleted, inserted and / or added at positions other than 11 and 276, and has substantially the same reticulin detection activity as (4) above. (6) The amino acid sequence shown in Sequence ID No. 50 has the amino acid substitutions S11G and F276Y, has 90% or more homology to the amino acid sequence described in Sequence ID No. 50, and has substantially the same reticulin detection activity as (4) above.
5. A gene encoding the COR variant polypeptide of claim 4, wherein the gene is either (C) or (D) below: (C) A gene encoding a polypeptide having substantially equivalent reticulin detection activity to that of (4) above, in which 1 to 20 amino acids are substituted, deleted, inserted and / or added in the amino acid sequence of (4) above. (D) A gene encoding a polypeptide having 90% or more homology to the amino acid sequence of (4) above, and having substantially equivalent reticulin detection activity to (4) above.
Citation Information
Patent Citations
Thebaine-enriched poppies and methods for producing same
JP2019528084A
Methods for making nor-opioid and nar-opioid benzylisoquinoline alkaloids
JP2019536476A
Papaver bracteatum with modified alkaloid content
WO2013163668A1
Multi-input / multi-output gene switch, and method for producing same
WO2019182156A1