Nucleic acid complex for regulating ZIC5 expression

Abstract

To provide nucleic acid complexes for modulating expression of transcripts and protein of ZIC5 gene.SOLUTION: A nucleic acid complex for modulating the transcript and protein expression of ZIC5 gene is useful for elucidating functions of ZIC5 as it works as a suppressor or inhibitor of ZIC5 specific expression. The inventors of the invention have found that when the expression of ZIC5 in melanoma is inhibited, the in vivo proliferation potency, a characteristic of cancer, is remarkably reduced, so that it is useful for the treatment, amelioration or progression delay of melanoma. The nucleic acid complex of the invention specifically inhibits the expression of ZIC5 so that it is useful for carrying out the treatment, amelioration or progression delay of melanoma in a patient in need thereof.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a nucleic acid complex for regulating the expression of Zinc finger protein 5 gene (hereinafter referred to as ZIC5). The present invention also relates to the regulation of the expression of ZIC5 gene or its transcript. The present invention further relates to a therapeutic agent for malignant melanoma, which has an effect of regulating the expression of the transcript of ZIC5 gene.

Background Art

[0002] Malignant melanoma is a malignant tumor that arises from the canceration of melanocytes, which are melanin-producing cells. While it can be cured by early detection, the 5-year survival rate in cases with distant metastasis is as low as about 10%, and no effective treatment method has been established (see, for example, Non-Patent Document 1). In addition, BRAF V600E gene mutations have been confirmed in about 60% to 70% or more of cases. BRAF (MAPKKK in the MAPK pathway) phosphorylates and activates downstream MEK (MAPKK in the MAPK pathway), and the activated MEK further phosphorylates and activates downstream ERK (MAPK in the MAPK pathway), whereby many proteins involved in proliferation, survival, invasion and metastasis are activated (see, for example, Non-Patent Document 2). The constitutive and strong activation of BRAF due to the BRAFV600E mutation is one of the causes of melanoma. Currently, clinical trials using selective inhibitors (PLX4032, vemurafenib) against mutant BRAF have been conducted, and a high response rate has been confirmed. However, it has been reported that drug resistance to BRAF inhibitors occurs through various mechanisms such as the expression of splicing variants of the BRAF gene and the expression of hepatocyte growth factor (HGF) secreted from stromal cells, and the effect thereof is limited (see, for example, Non-Patent Documents 3 to 5).

[0003] One known cause of metastatic potential in epithelial cancers is epithelial-mesenchymal transition (EMT). EMT is a phenomenon in which epithelial cells acquire the characteristics of mesenchymal cells, and it is known that when EMT occurs, the expression level of E-cadherin, an epithelial cell-cell adhesion molecule, decreases. Furthermore, it has been revealed that EMT is regulated by transcription factors such as Snail, Slug, and Twist, and it is known that these factors regulate the expression of E-cadherin and other factors, thereby causing EMT (see, for example, Non-Patent Document 6).

[0004] In melanoma, the expression of many EMT-related genes is altered in cases with metastasis, suggesting that enhanced EMT programs are one of the causes of metastasis (see, for example, Non-Patent Document 7). Furthermore, in melanoma with BRAF mutations, constitutive activation of BRAF induces the expression of transcription factors such as Zeb1 and Twist1, leading to suppression of E-cadherin expression by these factors and causing melanoma exacerbation, an EMT-like phenomenon has been observed (see, for example, Non-Patent Document 8). E-cadherin expression levels are decreased in many melanomas, and it has been reported that the recurrence rate is significantly higher in cases with decreased E-cadherin expression (see, for example, Non-Patent Document 9). These findings suggest a link between decreased E-cadherin expression and melanoma exacerbation.

[0005] On the other hand, EMT is an essential phenomenon not only in cancer but also during early embryonic development, and is involved in gastrulation and the differentiation of neural coronal cells. Neural coronal cells undergo EMT in a part of the dorsal neural tube, gaining migratory ability by separating from epithelial tissue, and then differentiate into peripheral nervous system cells, glial cells, satellite cells, melanocytes, odontoblasts, craniofacial cartilage, etc. In neural coronal cell EMT, transcription factors such as Snail, Slug, and Twist cause a decrease in E-cadherin expression (see, for example, Non-Patent Documents 6 and 10).

[0006] In cancer treatment, the emergence of drug-resistant cancers poses a problem that hinders a cure. To prevent the acquisition of drug resistance, it is necessary to induce a high rate of cancer cell death during the initial administration of the drug. Furthermore, the development of new drugs is desirable for cases in which resistance to existing drugs has already developed.

[0007] The inventors, Fukami, Sato, et al., identified ZIC5 as a transcription factor that promotes drug resistance in melanoma through their own screening (see Non-Patent Literature 11). ZIC5 is hardly expressed in normal human tissue, but is highly expressed in various types of cancer tissue. Furthermore, suppressing ZIC5 expression in melanoma significantly reduces its proliferative capacity. In addition, the rate of melanoma cell death induced by molecular targeted drugs and anticancer drugs increases dramatically, with almost all cells dying. Inhibition of the transcription factor ZIC5 is also effective against melanoma cells that have already acquired drug resistance, inducing cell death. It has also been shown that ZIC5 promotes progression in other types of cancer (see Non-Patent Literature 12). Therefore, ZIC5 is a "cancer-specific target molecule," and it is assumed that drugs targeting ZIC5 will reduce drug resistance in cancer cells and cause cancer cell death at a high rate. The inventors, Fukami and Sato, have filed an international patent application for ZIC5 with the Japan Science and Technology Agency (JST) (see Patent Document 1).

[0008] However, nucleic acid complexes containing antisense strands that regulate the expression of the ZIC5 gene transcript and exhibit strong ZIC5 expression inhibitory activity have not yet been sufficiently obtained. [Prior art documents] [Patent Documents]

[0009] [Patent Document 1] WO2016 / 178374 [Non-patent literature]

[0010] [Non-Patent Document 1] Aamdal et al., European Journal of Cancer, 2011, vol.47, Suppl 3, p.S336-S337. [Non-licensed Document 2] Cangol et al., FEBS Journal, 2009, vol.277(1), p.2-27. [Non-licensed Document 3] Poulikakos et al.,Nature,2011,vol.480,p.387-390. [Non-licensed Document 4] Price et al.,Journal of Clinical Oncology 2011,vol.29(19),p.2675-2682. [Non-licensed Document 5] Villanueva et al., Cancer Research, 2011, vol.71, p.7137. [Non-licensed Document 6] Thiery et al.,Cell,2009,vol.139,p.871-890. [Non-licensed Document 7] Alonso et al., Cancer Research, 2007, vol.67(7), p.3450-3460. [Non-licensed Document 8] Caramel et al., Cancer Cell, 2013, vol.24, p.466-480. [Non-licensed Document 9] Andersen et al., Modern Pathology, 2004, vol.17, p.990-997. [Non-licensed Document 10] Acloque et al.,Journal of Clinical Investigation,2009,vol.119,p.1438-1449. [Non-licensed Document 11] Satow et al.,Canser Research, 2017,vol.77(2),p.366-377 [Non-licensed Document 12] Satow et al., Cancer Science, 2017, vol.108, pp.2405-2412 SUMMARY OF THE INVENTION PROBLEMS TO BE SOLVED BY THE INVENTION

[0011] An object of the present invention is to provide an inhibitor or suppressor of the ZIC5 gene or its transcript. An object of the present invention is to provide a novel nucleic acid complex that regulates the expression of the ZIC5 gene or its transcript. An object of the present invention is to provide a therapeutic agent for melanoma consisting of a nucleic acid complex bound to a ligand that can be delivered to an affected cancer site or cancer tissue in a subject. MEANS FOR SOLVING THE PROBLEMS

[0012] As a result of conducting research on genes associated with cancer malignancy, the inventors found that ZIC5 is a transcription factor that promotes drug resistance in melanoma. In the present invention, a nucleic acid complex and a method for reducing the expression of mRNA, which is the transcript of the ZIC5 gene, are disclosed as means for solving the problems.

[0013] Such a ZIC5 inhibitor is useful for performing treatment, prevention, amelioration, or delay of progression of melanoma in a patient in need thereof.

[0014] In a specific embodiment, the nucleic acid complex comprises 12 to 30 oligonucleotides, and the oligonucleotides have a nucleobase sequence that is complementary to the ZIC5 transcript. In a specific embodiment, the oligonucleotide of the nucleic acid complex is a single-stranded oligonucleotide consisting of DNA (deoxyribonucleic acid). That is, it is a single-stranded antisense oligonucleotide (ASO) consisting of DNA.

[0015] Furthermore, in a specific embodiment, the nucleic acid complex is a heteroduplex oligonucleotide (HDO) consisting of an antisense strand composed of an oligonucleotide and a nucleic acid strand complementary to the antisense strand.

[0016] In a specific embodiment, the antisense oligonucleotide comprises a modified oligonucleotide. In some embodiments, the modified nucleotides may have a structure including nucleotides and optionally modified nucleotides, or all of them may be modified nucleotides. For the purpose of making the bonds between nucleic acids stronger than those of natural nucleic acids in order to prevent cleavage of the nucleic acid strand by enzymatic digestion in vivo, the antisense oligonucleotide may contain any number of modified nucleotides at any positions.

[0017] The disease for which the pharmaceutical composition comprising the nucleic acid complex that regulates the expression of the ZIC5 transcription factor of the present invention as an active ingredient has a use as a therapeutic agent is cancer such as melanoma.

[0018] ["Inhibitor" is a general term for substances that reduce the reaction rate of oxidation reactions, polymerization reactions, or in vivo reactions. For example, an inhibitor of ZIC5 refers to an agent that reduces, inhibits, or suppresses the expression of the transcription factor ZIC5 in a living body, or in a tissue or cell in a living body.

[0019] That is, the present invention is as follows. [1] A nucleic acid complex comprising an antisense strand composed of 12 to 30 linked nucleic acids, wherein the antisense strand is the nucleobase sequence represented by SEQ ID NO: 2 15-28, 180-193, 249-262, 516-529, 615-628, 654-667, 924-937, 1063-1076, 1241-1254, 1499-1512, 1535-1548, 1719-1732, 1920-1933, 1967-1980, 2016-2029, 2191-2204, 109-122, 1425-1438, 1 664-1677, 1859-1872, 1906-1919, 1990-2003, 2010-2023, 2028-2041, 2043-2056, 2062-2075, 2141-2154, 2322-2335, 2355-2368, 2391-2404, 2406-2419, 2498-2511, 2551-2564, 2568-2581, 2604 -2617, 2618-2631, 2640-2653, 3218-3231, 3975-3988, 1719-1737, 1719-1736, 1719-1735, 1719-1733, 1718-1732, 1717-1732, 1716-1732, 1715-1732, 1714-1732, 1718-1733, 1717-1734, 1716-17 A nucleic acid complex that can hybridize with nucleotides at positions 35, 1719–1732, 2191–2209, 2191–2208, 2191–2207, 2191–2206, 2187–2204, 2190–2205, 2189–2206, 2188–2207, or 2191–2204, and has an antisense effect on ZIC5 transcripts. [2] The nucleic acid complex described in [1], wherein the antisense strand is a single-stranded oligonucleotide. [3] The nucleic acid complex according to [1], which is a heterodouble-stranded nucleic acid comprising an antisense strand and a nucleic acid strand complementary to the antisense strand. [4] The nucleic acid complex according to any one of [1] to [3], wherein the antisense strand comprises at least one modified nucleotide. [5] The nucleic acid complex according to any one of [1] to [4], wherein the antisense strand comprises at least one phosphorothioate nucleotide. [6] The nucleic acid complex according to any one of [1] to [5], wherein the antisense chain comprises at least one phosphodiester nucleoreotide. [7] The nucleic acid complex according to [5], wherein the antisense strand is a phosphorothioate nucleotide. [8] The nucleic acid complex according to any one of [1] to [7], wherein the antisense strand comprises a modified nucleic acid base. [9] The nucleic acid complex according to [8], wherein the modified nucleotide is 5-methylcytosine, 2'-MOE, 2'-OMe, 2'-F, BNA, LNA, ENA, scpBNA, cEt, or AmNA.

[10] The nucleic acid complex according to [3], characterized in that the nucleic acid strand complementary to the antisense strand is RNA.

[11] The antisense chain is: A 5' wing region consisting of multiple nucleic acids; A gap region consisting of multiple nucleic acids; A 3' wing region consisting of multiple nucleic acids; The nucleic acid complex according to [1], characterized by containing [1].

[12] The antisense chain is: A 5' wing region consisting of multiple nucleic acids; A gap region consisting of multiple nucleic acids; A 3' wing region consisting of multiple nucleic acids; The nucleic acid complex according to [3], characterized by containing [3].

[13] The nucleic acid complex according to [1], wherein the nucleic acid complex comprises a functional portion having a labeling function, a purification function and / or a delivery function to a target.

[14] The nucleic acid complex according to

[13] , characterized in that the functional portion is a compound selected from fluorescent proteins, luciferases and other compounds, biotin, avidin, His-tagged peptides, GST-tagged peptides, cRDG peptides, FLAG-tagged peptides and other compounds, receptor-binding compounds, S1P receptor-binding compounds, cholesterol, lipids such as fatty acids, vitamin E, tocopherols, tocotrienols, fat-soluble vitamins such as vitamin A, vitamin D, and vitamin K, intermediate metabolites such as acylcarnitine and acyl-CoA, glycolipids and glycerides or derivatives thereof.

[15] The nucleic acid complex according to [2], wherein a ligand having the function of delivering the nucleic acid complex to a target site is bound to the antisense strand, either via or without a linker.

[16] The nucleic acid complex according to [3], wherein a ligand having the function of delivering the nucleic acid complex to a target site is bound to a nucleic acid chain complementary to the antisense chain, with or without the linker. A ZIC5-specific inhibitor containing the nucleic acid complex described in [1] [1].

[18] [1] A tumor cell malignancy inhibitor comprising the nucleic acid complex described above.

[19] An antitumor agent used to treat melanoma, comprising the nucleic acid complex described in [1].

[20] A double-stranded nucleic acid complex for regulating the expression level of ZIC5 in melanoma tissue when administered to a subject, A double-stranded nucleic acid complex consists of a first nucleic acid strand and a second nucleic acid strand. The first nucleic acid chain includes an antisense chain consisting of 12 to 30 linked nucleotides, each containing at least one modified nucleotide. The second nucleic acid chain consists of 12 to 30 linked nucleotides, each containing at least one modified nucleotide, and a functional moiety. The functional portion has labeling, purification, and / or delivery to the target. moreover, The first nucleic acid strand is a double-stranded nucleic acid complex that has a base sequence complementary to both the second nucleic acid strand and ZIC5 mRNA.

[21] The double-stranded nucleic acid complex according to

[20] , characterized in that the functional portion is a compound selected from or a derivative thereof from a fluorescent protein, a luciferase, biotin, avidin, His-tagged peptide, GST-tagged peptide, cRDG peptide, FLAG-tagged peptide, a receptor-binding compound, a S1P receptor-binding compound, cholesterol, lipids such as fatty acids, vitamin E, tocopherols, tocotrienols, fat-soluble vitamins such as vitamin A, vitamin D, and vitamin K, intermediate metabolites such as acylcarnitine and acyl-CoA, glycolipids and glycerides.

[22] The double-stranded nucleic acid complex according to

[20] , wherein a ligand having the function of delivering the nucleic acid complex to a target site is bound to the antisense strand, either via or without a linker. [Effects of the Invention]

[0020] The nucleic acid complex of the present invention, which includes an antisense strand for a partial sequence of a ZIC5 transcript consisting of 12 to 30 linked nucleic acids, contains a complementary base sequence, is capable of hybridizing with the sense portion of the ZIC5 transcript, and has an antisense effect on the ZIC5 transcript. Furthermore, the nucleic acid complex of the present invention can be used in the treatment of melanoma. [Brief explanation of the drawing]

[0021] [Figure 1] Figure 1 shows the changes in tumor volume induced by Ren-4-36-1ASO in an in vivo study. [Figure 2A] Figure 2A shows the relative expression rate of ZIC5 mRNA mediated by Ren-4-36-1ASO in in vivo studies. Figure 2A shows the values ​​for n=9. [Figure 2B] Figure 2B shows the relative expression rate of ZIC5 mRNA mediated by Ren-4-36-1ASO in in vivo studies. Figure 2B shows the results of statistical analysis of n=9 values. [Figure 3] Figure 3 shows the relative expression levels of target transcripts of HDO bound to various ligands. [Figure 4] Figure 4 shows the changes in tumor size when Chol-Ren-4-36-1HDO was administered intravenously to tumor-bearing mice. [Modes for carrying out the invention]

[0022] The present invention will be described in detail below. The present invention relates to a nucleic acid complex comprising an oligonucleotide consisting of 12 to 30 nucleotides, wherein the oligonucleotide has a nucleic acid base sequence complementary to a specific nucleic acid base site of the ZIC5 gene transcript. The nucleic acid having a nucleic acid base sequence complementary to the ZIC5 gene transcript acts as an antisense nucleic acid against the ZIC5 gene transcript. That is, it acts as a specific inhibitor of the ZIC5 transcript or gene, and has the activity to suppress the expression of the target gene, the ZIC5 gene, or the normal transcript level through an antisense effect.

[0023] The transcript of the ZIC5 gene is mRNA transcribed from the genomic DNA encoding the ZIC5 gene, and includes unmodified mRNA and unspliced ​​mRNA precursors. Generally, the "transcript" can be any RNA synthesized by DNA-dependent RNA polymerase.

[0024] In the present invention, "nucleic acid complex" refers to a nucleic acid molecule that regulates the expression or editing of a target gene, its transcript, or its translation product. Examples of such nucleic acid molecules include nucleic acid molecules having a nucleic acid sequence complementary to the target gene or its transcript and possessing antisense activity. More specifically, such nucleic acid molecules include single-stranded antisense oligonucleotides (ASO), RNA interference (RNAi), short interference RNA (siRNA), short hairpin RNA (shRNA), antisense double-stranded DNA oligonucleotides (ADO), and hetero-duplex oligonucleotides (HDO).

[0025] In certain embodiments, the oligonucleotide of the nucleic acid complex is a single-stranded oligonucleotide; that is, a single-stranded antisense oligonucleotide (ASO).

[0026] In certain embodiments, the nucleic acid complex is a heteroduplex oligonucleotide (HDO) consisting of an antisense strand made of an oligonucleotide and a sense strand which is a nucleic acid strand complementary to the antisense strand, with the antisense strand annealing to the sense strand. The antisense strand is sometimes called the first nucleic acid strand, and the sense strand is sometimes called the second nucleic acid strand. Such a nucleic acid complex is called a double-stranded nucleic acid complex.

[0027] Furthermore, in certain embodiments, the nucleic acid complex may be a single-stranded oligonucleotide at the time of manufacture, and may have a structure comprising an antisense strand consisting of a DNA nucleotide or DNA nucleotide analog, a linker portion consisting of 3 to 10 nucleotides, and a sense strand consisting of an RNA nucleotide or RNA nucleotide analog complementary to the antisense strand. A nucleic acid complex of this structure is called a single-stranded heteroduplex oligonucleotide (ss-HDO), and is, for example, an oligonucleotide with the structure XLY described in WO2017 / 131124A1. X is the antisense strand, Y is the complementary strand to the antisense strand, and L is a nucleotide that acts as a linker. When this single-stranded oligonucleotide is used as a pharmaceutical composition, the antisense strand and the complementary strand to the antisense strand undergo single-molecule annealing with the linker as a fulcrum in a solvent used in physiological saline, aqueous injections, non-aqueous injections, suspension injections, solid injections, etc., or in blood or plasma to form a double-stranded structure. Such nucleic acid complexes, when acting as pharmaceutical compositions, undergo single-molecule annealing to form a double-stranded structure, and are therefore classified as double-stranded nucleic acid complexes.

[0028] The basic form of heteroduplex nucleic acid (HDO) for carrying out the pharmaceutical composition containing the ZIC5 transcript or gene-specific inhibitor of the present invention is described below. Specifically, HDO is composed of a double helix consisting of an antisense strand (Active strand) composed of DNA, which is the active component, and a sense strand (Carrier strand) mainly composed of RNA having a complementary sequence. Furthermore, HDO is characterized by containing a ligand structure in its sense strand. Due to this form, the pharmaceutical composition containing the ZIC5 transcript or gene-specific inhibitor has high stability in the blood in humans and is efficiently delivered to target tissue according to the performance of the ligand. After HDO is delivered into the cell, the RNA strand is rapidly degraded and removed by RNase H. A new double-stranded structure is then formed between the freed DNA strand and mRNA, and the mRNA is degraded by the action of intracellular RNase H, thereby exerting a knockdown effect.

[0029] In certain embodiments, the nucleic acid complex comprises 12 to 30 oligonucleotides, the oligonucleotides having nucleic acid base sequences complementary to the transcript of the ZIC5 gene.

[0030] The oligonucleotide, which is the antisense strand of the nucleic acid complex of the present invention, targets mRNA, which is the transcript of the ZIC5 gene. The nucleotide sequence of the antisense strand is complementary to a partial sequence in the nucleotide sequence of the human ZIC5 gene. The nucleotide sequence of the human ZIC5 transcript is represented by SEQ ID NO: 1 (NM_033132.4) and SEQ ID NO: 2 (NM_033132.5). That is, the nucleic acid nucleotide sequence of the present invention, which includes an oligonucleotide consisting of 12 to 30 nucleotides and is complementary to the ZIC5 transcript, is a sequence complementary to a partial sequence in the nucleotide sequence of the human ZIC5 gene.

[0031] "Antisense effect" refers to the effect in which the antisense strand of a nucleic acid molecule hybridizes with a target gene or its transcript (RNA sense strand), thereby regulating the expression or editing of that target gene or its transcript.

[0032] "Regulation" is used in descriptions such as "regulating the expression of a target gene" or "regulating the expression of a target transcript," and means suppression or reduction, enhancement, inhibition of translation, inhibition of translation product function, regulation of RNA splicing (e.g., splicing switch, exon inclusion, exon skipping, etc.), degradation of transcript, or inhibition of the binding of the target gene to a protein.

[0033] In one embodiment, the antisense effect refers to the suppression resulting from translation inhibition or splicing function conversion effects such as exon skipping, which may occur by coating the transcript by hybridization, and / or from the degradation of the transcript, which may occur when the hybridized portion is recognized. In another embodiment, the antisense effect refers to the enhancement of normal mRNA expression, which occurs in the exon inclusion of a target gene or transcript, by incorporating into the mRNA, conversely to exon skipping, an exon that would otherwise be excluded from the mRNA due to a genetic abnormality, through the action of antisense.

[0034] For example, in post-transcriptional inhibition of a target gene, when an RNA oligonucleotide is introduced into a cell as an ASO, the ASO forms a partial double helix through annealing with the mRNA, the transcript of the target gene. This partial double helix acts as a cover to prevent translation by ribosomes, thereby inhibiting the expression of the target protein encoded by the target gene at the translational level (steric blocking). On the other hand, when an oligonucleotide containing DNA is introduced into a cell as an ASO, a partial DNA-RNA heteroduplex is formed. As a result of this heteroduplex structure being recognized by RNase, the mRNA of the target gene is degraded, and the expression of the protein encoded by the target gene is inhibited at the expression level. Furthermore, the antisense effect can also be induced by targeting introns in the mRNA precursor. In one embodiment, the regulation of target transcript expression may be achieved by reducing the amount of the target transcript.

[0035] For example, when ADO is used as a nucleic acid molecule with an antisense strand, the DNA double strand is cleaved by DNA nuclease (DNase) within the cell, the DNA antisense strand hybridizes with the target RNA to form a double strand, and then the target RNA is degraded by RNase. By repeating this cycle, the expression of the target RNA or the action of the target RNA is suppressed. In another embodiment, after the DNA double strand of ADO is cleaved by DNA nuclease (DNase), the DNA antisense strand hybridizes with the target RNA, and then the expression of the target gene is suppressed or enhanced by inhibiting the transcription or translation of the target RNA or by regulating RNA splicing such as exon skipping.

[0036] For example, when HDO is used as a nucleic acid molecule with an antisense strand, after the complementary strand of HDO RNA is cleaved by RNase in the cell, the DNA antisense strand hybridizes with the target RNA to form a double helix, and then the target RNA is degraded by RNase. By repeating this cycle, the expression of the target RNA or the action of the target RNA is suppressed. Alternatively, after the complementary strand of HDO RNA is cleaved by RNase in the cell, the DNA antisense strand hybridizes with the target RNA, suppressing or upregulating the expression of the target gene by inhibiting the transcription or translation of the target RNA or by regulating RNA splicing such as exon skipping.

[0037] For example, when RNA interference (RNAi) is used as a nucleic acid molecule with an antisense strand, RNAi refers to antisense-mediated gene silencing via a mechanism utilizing the RNA-induced silencing complex (RISC). Examples of RNAi include siRNA and shRNA.

[0038] Nucleic acid molecules with specific antisense strands alter pre-mRNA splicing. Regardless of the specific mechanism, sequence specificity allows nucleic acid molecules with antisense strands to be used as tools for target validation and gene functioning, and as therapeutic agents to selectively regulate the expression of genes involved in disease pathogenesis.

[0039] There are no particular restrictions on the length of the antisense strand, but it is at least 8 bases, for example 8 to 40 bases, preferably 12 to 30 bases, more preferably 12 to 25 bases, or 13 to 20 bases. In some cases, the strand length is usually selected depending on the strength of the antisense effect of the nucleic acid strand on the target, as well as other factors such as cost and synthesis yield. In the case of double-stranded nucleic acids, the strand length may be selected from a length such that the double-stranded Tm value is 50°C or higher, more preferably 60°C or higher.

[0040] In the case of double-stranded nucleic acids, the chain length of the complementary strand may be the same as that of the antisense strand. In that case, it is at least 8 bases, for example 8 to 40 bases, preferably 12 to 30 bases, more preferably 12 to 25 bases, or 13 to 20 bases. It may also be a few bases longer or shorter than the chain length of the antisense nucleic acid strand, for example 1, 2, 3, 4, 5, 6, 7, 8, or 9 bases to a dozen or so bases, for example 11, 12, 13, 14, 15, 16, 17, 18, or 19 bases.

[0041] Hybridization refers to the cross-pollination or hybridization of substances, specifically the complementary formation of complexes between nucleic acid molecules such as DNA or RNA.

[0042] "Hybridizing" means forming a hybridization. For example, when one nucleic acid strand has a complementary sequence, it is said that they hybridize.

[0043] The antisense strand of the nucleic acid complex of the present invention is complementary to all or part of the base sequence of the target transcript and can therefore hybridize (or anneal) to the target transcript. Base sequence complementarity can be determined using a program such as BLAST.

[0044] Those skilled in the art can easily determine the conditions (temperature, salt concentration, etc.) under which two strands can hybridize, taking into account the degree of complementarity between the strands. Furthermore, those skilled in the art can easily design an antisense nucleic acid complementary to a target transcript, for example, based on the base sequence information of the target gene. Hybridization conditions may be various stringent conditions, such as low-stringent conditions and high-stringent conditions. Low-stringent conditions may be relatively low temperature and high salt concentration conditions, for example, 30°C, 2×SSC, 0.1%SDS. High-stringent conditions may be relatively high temperature and low salt concentration conditions, for example, 65°C, 0.1×SSC, 0.1%SDS. The stringency of hybridization can be adjusted by changing conditions such as temperature and salt concentration. Here, 1×SSC contains 150 mM sodium chloride and 15 mM sodium citrate.

[0045] "Complementary" or "complementarity" refers to a relationship that allows for the formation of so-called Watson-Crick base pairs (native base pairs) or non-Watson-Crick base pairs (Hoogsteen base pairs, etc.) via hydrogen bonding. If a sufficient number of nucleic acid bases in the antisense strand can hydrogen bond with the corresponding nucleic acid bases of the target gene or target transcript, the antisense strand and the target gene or target transcript are complementary, and the desired antisense effect occurs. Non-complementary nucleic acid bases between the antisense strand and the target gene or target transcript may be acceptable, provided that the antisense strand can specifically hybridize to the target nucleic acid. Furthermore, if the antisense strand can hybridize to one or more segments of the target gene or target transcript, and the intervening or adjacent segments do not participate in hybridization events (e.g., loop structures, mismatches, or hairpin structures), then the antisense strand can be said to be complementary to the sequence of the target gene or target transcript. Complementarity means that the antisense strand is complementary to the target gene or target transcript to a certain extent, for example, 80% or more, 90% or more, or 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more complementary. 100% complementarity is also acceptable. A mismatch of 0 to 4 strands is acceptable.

[0046] In certain embodiments, the antisense strands provided herein are 80-100%, preferably 90-100%, more preferably 95-100%, or 100% complementary to the target nucleic acid sequence. The percentage of complementarity of the antisense strand to the target nucleic acid sequence can be determined using conventional methods.

[0047] For example, an antisense strand in which 16 of the 20 nucleic acid bases are complementary to the target region and therefore specifically hybridizes exhibits 80% complementarity. In this example, the remaining non-complementary nucleic acid bases may be clustered or scattered with complementary nucleic acid bases, and these non-complementary nucleic acid bases do not need to be adjacent to each other or to complementary nucleic acid bases. For example, an antisense strand with an 18 nucleic acid base length having four non-complementary nucleic acid bases adjacent to two regions that are perfectly complementary to the target nucleic acid has an overall complementarity of 77.8% because 14 of the bases are complementary to the target region of the target nucleic acid, and is therefore within the scope of the present invention. The percentage of complementarity of the antisense strand to the region of the target nucleic acid can be determined by a BLAST program or the like, which is known in the art.

[0048] In one embodiment, the first nucleic acid chain is an antisense nucleic acid complementary to a target transcript, such as a transcript of a target gene, and is a nucleic acid having a region containing at least four consecutive nucleotides when the first nucleic acid chain hybridizes with the transcript.

[0049] Here, "nucleic acid" may refer to monomeric nucleotides, or to oligonucleotides composed of multiple monomers. The term "nucleic acid chain" is also used here to refer to oligonucleotides. Nucleic acid chains may be prepared in whole or in part by chemical synthesis methods, such as the use of an automated synthesizer, or by enzymatic treatment, although this is not limited to polymerase, ligase, or restriction enzyme reactions.

[0050] There are no particular restrictions on the length of the first nucleic acid chain, but it is typically 12-30 bases, 12-25 bases, or 13-20 bases. In some cases, the chain length is usually selected depending on the strength of the antisense effect of the nucleic acid chain on the target, as well as other factors such as cost and synthesis yield.

[0051] The length of the second nucleic acid chain may be the same as that of the first nucleic acid chain. In that case, it may be 12-30 bases, 12-25 bases, or 13-20 bases. It may also be several bases longer or shorter than the length of the first nucleic acid chain by more than ten bases.

[0052] The "at least four consecutive nucleotides recognized by RNaseH" is typically a region containing 4 to 20 consecutive nucleotides, a region containing 5 to 16 consecutive nucleotides, or a region containing 6 to 12 consecutive nucleotides. Furthermore, this region can utilize nucleotides recognized by RNaseH, which cleaves RNA strands when hybridized to RNA nucleotides, such as native DNA. Suitable nucleotides, such as modified DNA nucleotides and other bases, are known in this art. It is also known that nucleotides with a hydroxyl group at the 2' position, such as RNA nucleotides, are unsuitable. Regarding the use of this region containing "at least four consecutive nucleotides," those skilled in the art can easily determine the suitability of nucleotides.

[0053] In one embodiment, the antisense oligonucleotide or antisense chain includes a modified nucleotide.

[0054] In one embodiment, the antisense oligonucleotide may consist of nucleotides and optionally modified nucleotides, or it may consist entirely of modified nucleotides. To prevent cleavage of the nucleic acid chain by enzymatic digestion in vivo, and to strengthen the bonds between nucleic acids compared to natural nucleic acids, the antisense oligonucleotide may contain any number of modified nucleotides at any location.

[0055] In one embodiment, the first nucleic acid chain comprises "nucleotides and optionally nucleotide analogs." This means that the first nucleic acid chain has DNA nucleotides, RNA nucleotides, and optionally further comprises nucleotide analogs.

[0056] Here, "DNA nucleotide" refers to naturally occurring DNA nucleotides, or DNA nucleotides in which the base, sugar, or phosphate-bonded subunits have been modified. Similarly, "RNA nucleotide" refers to naturally occurring RNA nucleotides, or RNA nucleotides in which the base, sugar, or phosphate-bonded subunits have been modified. Modification of the base, sugar, or phosphate-bonded subunits refers to the addition of one substituent or the substitution of one substituent within the subunit, and does not mean the substitution of the entire subunit with a different chemical group. From the viewpoint of providing high resistance to DNA-degrading enzymes, etc., some or all of the region containing the nucleotide may be modified nucleotides.

[0057] Furthermore, "modified nucleotide" refers to a nucleotide that has been modified. Examples of such modified nucleotides include 5-methylation, 5-fluoration, 5-bromination, 5-iodation, and N4-methylation of cytosine; 5-demethylation, 5-fluoration, 5-bromination, and 5-iodation of thymidine; N6-methylation and 8-bromination of adenine; N2-methylation and 8-bromination of guanine; phosphorothioate, methylphosphonate, methylthiophosphonate, chiral-methylphosphonate, phosphorodithioate, phosphoramidate, 2'-O-methylation, 2'-methoxyethyl (MOE), 2'-aminopropyl (AP), and 2'-fluoration. From the viewpoint of superior pharmacokinetics, phosphorothioate is preferred. Moreover, multiple types of such modifications may be applied to the same DNA. Furthermore, as described later, RNA nucleotides may also be modified to achieve similar effects. Nucleotides that have been phosphorothioated are called phosphorothioate nucleotides, and they form phosphorothioate bonds. Nucleotides that form phosphodiester bonds are called phosphodiester nucleotides.

[0058] In some cases, depending on the number and location of the modified DNA, it may affect the antisense effect of the double-stranded nucleic acids disclosed herein. These aspects vary depending on the sequence of the target gene, and therefore cannot be generalized, but those skilled in the art can determine them by referring to the literature on antisense methods described below. Furthermore, the modification can be evaluated if the antisense effect of the modified double-stranded nucleic acid complex is measured and the obtained measurement is not significantly lower than that of the unmodified double-stranded nucleic acid complex (for example, if the measurement of the modified double-stranded nucleic acid complex is 30% or more of the measurement of the unmodified double-stranded nucleic acid complex). The antisense effect can be measured, for example, by introducing the test nucleic acid compound into cells, as shown in the examples below, and then appropriately using known methods such as Northern blotting, quantitative PCR, or Western blotting to measure the expression level (mRNA, cDNA, protein, etc.) of the target gene in the cells, which is suppressed by the antisense effect of the test nucleic acid compound. The modified nucleotides include the nucleotide analogs described below.

[0059] Here, "nucleotide analog" refers to a nucleotide that does not exist in nature, and means that two or more substituents are added to the base, sugar, or phosphate bonded subunit of the nucleotide, or two or more substitutions are made within the subunit, or the entire subunit is replaced with a different chemical group. An example of an analog with two or more substitutions is a crosslinked nucleic acid. A crosslinked nucleic acid is a nucleotide analog in which a crosslinking unit is added based on two substitutions in the sugar ring, and typically, a nucleotide analog in which the 2' carbon and the 4' carbon are bonded is included. In a first nucleic acid chain in a certain embodiment, the first nucleic acid chain further contains a nucleotide analog in terms of increasing affinity to a partial sequence of the transcript of a target gene and / or resistance to nucleases. As a "nucleotide analog," any nucleotide whose affinity for a partial sequence of the target gene transcript and / or resistance to nucleases has been increased by modification (crosslinking, substitution, etc.) is acceptable. Examples include nucleic acids disclosed as suitably used in antisense methods in Japanese Patent Publication No. 10-304889, International Publication No. 2005 / 021570, Japanese Patent Publication No. 10-195098, Japanese Patent Publication No. 2002-521310, International Publication No. 2007 / 143315, International Publication No. 2008 / 043753, International Publication No. 2008 / 029619, and International Publication No. 2008 / 049085 (hereinafter, these documents are also referred to as "documents relating to antisense methods"). In other words, nucleic acids disclosed in the aforementioned literature include: hexitol nucleic acid (HNA), cyclohexene nucleic acid (CeNA), peptide nucleic acid (PNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), morpholino nucleic acid, tricyclo-DNA (tcDNA), 2'-O-methylated nucleic acid, 2'-MOE (2'-O-methoxyethyl)-modified nucleic acid, 2'-AP (2'-O-aminopropyl)-modified nucleic acid, 2'-fluorinated nucleic acid, 2'F-arabino nucleic acid (2'-F-ANA), and BNA (bridged nucleic acid).

[0060] In one embodiment, BNA may be any ribonucleotide or deoxyribonucleotide in which the 2' carbon and the 4' carbon are cross-linked by two or more atoms. Examples of cross-linked nucleic acids are known to those skilled in the art. One subgroup of such BNAs is BNA in which the 2' carbon and the 4' carbon are cross-linked by 4'-(CH2)pO-2', 4'-(CH2)pS-2', 4'-(CH2)p-OCO-2', or 4'-(CH2)nN(R3)-O-(CH2)m-2' (where p, m, and n are integers from 1 to 4, 0 to 2, and 1 to 3, respectively. R3 represents a hydrogen atom, an alkyl group, an alkenyl group, a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group, and a unit substituent (such as a fluorescent or chemiluminescent labeled molecule, a nucleic acid cleavage-active functional group, or an intracellular or nuclear localization signal peptide)). Furthermore, in BNA in a certain embodiment, R1 and R2 of the substituents OR2 at the 3' carbon and OR1 at the 5' carbon are typically hydrogen atoms, but may be the same or different, and may represent a hydroxyl group protecting group for nucleic acid synthesis, an alkyl group, an alkenyl group, a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group, a silyl group, a phosphate group, a phosphate group protected by a nucleic acid protecting group, or -P(R4)R5 (wherein R4 and R5 may be the same or different, and represent a hydroxyl group, a hydroxyl group protected by a nucleic acid protecting group, a mercapto group, a mercapto group protected by a nucleic acid protecting group, an amino group, a C1-C5 alkoxy group, a C1-C5 alkylthio group, a C1-C6 cyanoalkoxy group, or an amino group substituted with a C1-C5 alkyl group).Examples of such BNAs include α-L-methyleneoxy(4'-CH2-O-2')BNA or β-D-methyleneoxy(4'-CH2-O-2')BNA, also known as LNA (Locked Nucleic Acid®, 2',4'-BNA), ethyleneoxy(4'-(CH2)2-O-2')BNA, β-D-thio(4'-CH2-S-2')BNA, aminooxy(4'-CH2-ON(R3)-2')BNA, oxyamino(4'-CH2-N(R3)-O-2')BNA, and 2',4'-BNANC. Examples include NACOC, 3'amino-2',4'-BNA, 5'-methylBNA, (4'-CH(CH3)-O-2')BNA (also called cEt or cEt-BNA), (4'-CH(CH2OCH3)-O-2')BNA (also called cMOE-BNA), amide BNA (4'-C(O)-N(R)-2')BNA (R=H,Me) (also called AmNA), 2'-O,4'-C-spirocyclopropylene bridged nucleic acid (scpBNA), which is a 2',4'-BNA with a spirocyclopropane structure introduced into the crosslinking portion, and other BNAs known to those skilled in the art.

[0061] Furthermore, in modified nucleic acids in certain embodiments, the base sites may be modified. Examples of base site modifications include 5-methylation, 5-fluoration, 5-bromination, 5-iodation, and N4-methylation of cytosine; 5-demethylation, 5-fluoration, 5-bromination, and 5-iodation of thymidine; N6-methylation and 8-bromination of adenine; and N2-methylation and 8-bromination of guanine. Moreover, in modified nucleic acids in certain embodiments, the phosphate diester bond sites may also be modified. Examples of phosphate diester bond site modifications include phosphorothioate, methylphosphonate, methylthiophosphonate, chiral-methylphosphonate, phosphorodithioate, and phosphoramidate, but phosphorothioate is used from the viewpoint of superior pharmacokinetics. In addition, multiple types of such base site modifications and phosphate diester bond site modifications may be applied to the same nucleic acid.

[0062] Overall, modified nucleotides and modified nucleotide analogs are not limited to those exemplified herein. Numerous modified nucleotides and modified nucleotide analogs are known in the art, and for example, the description in Tachas et al.'s U.S. Patent No. 8,299039, particularly columns 17-22, could be used as embodiments of this application.

[0063] Those skilled in the art can select and use a nucleotide analog from among such modified nucleic acids, taking into consideration aspects such as antisense effect, affinity to partial sequences of the target gene transcript, and resistance to nucleases. In one embodiment, the nucleotide analog is an LNA represented by the following formula (1).

[0064] [ka]

[0065] In formula (1), Base represents an aromatic heterocyclic group or aromatic hydrocarbon ring group which may have substituents, for example, the base site of a natural nucleoside (purine base, pyrimidine base) or the base site of a non-natural (modified) nucleoside. Examples of modifications of the base site are as described above.

[0066] R1 and R2 may be the same or different, and represent a hydrogen atom, a hydroxyl group protecting group for nucleic acid synthesis, an alkyl group, an alkenyl group, a cycloalkyl group, an aryl group, an aralkyl group, an acyl group, a sulfonyl group, a silyl group, a phosphate group, a phosphate group protected by a nucleic acid protecting group, or -P(R4)R5 [wherein R4 and R5 may be the same or different, and represent a hydroxyl group, a hydroxyl group protected by a nucleic acid protecting group, a mercapto group, a mercapto group protected by a nucleic acid protecting group, an amino group, an alkoxy group having 1 to 5 carbon atoms, an alkylthio group having 1 to 5 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or an amino group substituted with an alkyl group having 1 to 5 carbon atoms].

[0067] Although the compounds shown in the above chemical formula are nucleosides, in certain embodiments, "LNA" and ordinary BNA also include forms in which a phosphate group is attached to the nucleoside (nucleotides). That is, BNA such as LNA is incorporated as a nucleotide into nucleic acid chains containing double-stranded nucleic acid complexes.

[0068] In one embodiment, the "wing region containing at least one modified nucleotide" is located at the 5' end and / or 3' end of a region consisting of multiple nucleic acids containing DNA nucleotides (hereinafter also referred to as the "DNA gap region"). In one embodiment, the DNA gap region consists of multiple nucleic acids containing at least four or more consecutive DNA nucleotides.

[0069] The region containing the nucleotide analog located at the 5' end of the DNA gap region (hereinafter also referred to as the "5' wing region" or "5' wing segment") and the region containing the nucleotide analog located at the 3' end of the DNA gap region (hereinafter also referred to as the "3' wing region" or "3' wing segment") are independent of each other and only need to contain at least one modified nucleotide listed in the literature on antisense methods, and may also contain native nucleic acids (DNA or RNA) in addition to such nucleotide analogs. Furthermore, the chain lengths of the 5' wing region and the 3' wing region are independently typically 1 to 10 bases, 1 to 7 bases, 1 to 5 bases, or 2 to 5 bases.

[0070] Furthermore, in the 5' wing region and the 3' wing region, the type, number, and position of the nucleotide analog and native nucleotides used as modified nucleotides may affect the antisense effect exerted by the double-stranded nucleic acid complex in a given embodiment; therefore, the preferred embodiment may vary depending on the sequence and other factors. While it is not possible to generalize, those skilled in the art can determine the preferred embodiment by referring to the literature on the aforementioned antisense method. Also, similar to the region containing "at least four consecutive DNA nucleotides," if the antisense effect of the modified double-stranded nucleic acid is measured and the obtained measurement is not significantly lower than that of the unmodified double-stranded nucleic acid, the modification can be evaluated as a preferred embodiment.

[0071] The antisense strand of a ZIC5 transcript containing modified nucleotides against mRNA may consist of a 5' wing region (5' wing site) of 1 to 10 bases, a gap region (8 to 25 bases), and a 3' wing region (3' wing site) of 1 to 10 bases. The antisense strand may have motifs such as 5-8-5, 5-10-5, 4-10-4, 3-10-3, 2-10-2, 1-10-1, 5-8-5, 4-8-4, or 3-8-3. Here, the first number of the motif represents the number of bases in the 5' wing region, the second number represents the number of bases in the gap region, and the third number represents the number of bases in the 3' wing region.

[0072] Previous antisense methods consisting solely of RNA or LNA suppressed translation by binding to target mRNA, but their effectiveness was generally insufficient. On the other hand, antisense methods consisting solely of DNA were expected to strongly suppress target gene expression because, upon binding to the target gene, they form a double-stranded structure of DNA and RNA, leading to mRNA cleavage when targeted by RNaseH. However, the binding to the target gene itself was weak, resulting in insufficient actual effectiveness.

[0073] Therefore, in the first nucleic acid strand, a DNA strand with a chain length of at least 4 bases is positioned in the center, and LNA (or other BNA) with a strong binding ability to RNA (i.e., the target transcript) is positioned at both ends, thereby promoting the cleavage of the target RNA by RNaseH. The "DNA with a chain length of 4 bases" is not limited to DNA nucleotides alone, but is also intended to include at least four consecutive nucleotides that are recognized by RNaseH when the first nucleic acid strand hybridizes with the transcript. In one embodiment, from the viewpoint of achieving an extremely high antisense effect due to heteroduplex formation with the target transcript, it is desirable that the wing regions containing modified nucleic acids positioned at the 5' and 3' ends of the region containing at least four consecutive nucleotides recognized by RNaseH when the first nucleic acid strand hybridizes with the transcript optionally contain a nucleotide analog. The nucleotide analog may be BNA, for example, LNA, or ENA.

[0074] In the embodiment of the double-stranded nucleic acid complex, the second nucleic acid chain is a nucleic acid complementary to the first nucleic acid chain described above. The base sequence of the second nucleic acid chain and the base sequence of the first nucleic acid chain do not need to be perfectly complementary; they only need to have at least 70%, preferably 80%, and more preferably 90% or more complementarity (for example, 95%, 96%, 97%, 98%, 99% or more).

[0075] The second nucleic acid chain is an oligonucleotide consisting of at least one nucleic acid selected from the group consisting of RNA, DNA, PNA (peptide nucleic acid), and BNA (e.g., LNA). More specifically, the second nucleic acid chain (i) comprises RNA nucleotides, optionally a nucleotide analog, and optionally DNA nucleotides; (ii) comprises DNA nucleotides and / or a nucleotide analog; or (iii) comprises PNA nucleotides. The phrase "complies with RNA nucleotides, optionally a nucleotide analog, and optionally DNA nucleotides" means that the second nucleic acid chain contains RNA nucleotides, may further optionally contain a nucleotide analog, and may further optionally contain DNA nucleotides. The phrase "complies with DNA nucleotides and / or a nucleotide analog" means that the second nucleic acid chain may contain either DNA nucleotides and nucleotide analogs, or may contain both DNA nucleotides and nucleotide analogs. "Complies with PNA nucleotides" means that the second nucleic acid chain may consist of PNA nucleotides.

[0076] However, in one embodiment, the second nucleic acid strand contains RNA, as this allows the double-stranded nucleic acid complex to be recognized by intracellular RNaseH, leading to the degradation of the second nucleic acid strand and thus facilitating the antisense effect of the first nucleic acid strand. Furthermore, in one embodiment, the second nucleic acid strand may be PNA, as this facilitates the binding of functional molecules such as peptides to the double-stranded nucleic acid complex.

[0077] Here, "RNA nucleotide" refers to naturally occurring RNA nucleotides, or RNA nucleotides in which the base, sugar, or phosphate-bonded subunits have been modified. Modification of the base, sugar, or phosphate-bonded subunit means the addition of one substituent or the substitution of one substituent within the subunit, and not the substitution of the entire subunit with a different chemical group.

[0078] In the second nucleic acid chain, some or all of the nucleic acid may be modified nucleotides, from the viewpoint of high resistance to nucleolytic enzymes such as RNA-degrading enzymes. Examples of such modifications include 5-methylation, 5-fluoration, 5-bromination, 5-iodation, and N4-methylation of cytosine; 5-demethylation, 5-fluoration, 5-bromination, and 5-iodation of thymidine; N6-methylation and 8-bromination of adenine; N2-methylation and 8-bromination of guanine; phosphorothioate, methylphosphonate, methylthiophosphonate, chiral-methylphosphonate, phosphorodithioate, phosphoramidate, 2'-O-methylation, 2'-methoxyethyl (MOE) conversion, 2'-aminopropyl (AP) conversion, and 2'-fluoration. The use of RNA nucleotides in which uracil bases are substituted with thymidine bases is also conceivable, but phosphorothioate conversion is used from the viewpoint of superior pharmacokinetics. Furthermore, multiple types of modifications may be applied to the same nucleic acid. For example, as used in the examples described later, phosphorothioate and 2'-O-methylation may be applied to the same RNA to confer resistance to enzymatic cleavage. However, if it is expected or desired that the RNA nucleotide will be cleaved by RNaseH, only either phosphorothioate or 2'-O-methylation may be applied.

[0079] The number and position of modifications can affect the antisense effect exerted by the double-stranded nucleic acid complex in certain embodiments; therefore, there are preferred configurations for the number and position of nucleotide analogs in the second nucleic acid chain. While these preferred configurations vary depending on the type and sequence of the nucleic acid to be modified, they can be identified by measuring the antisense effect of the modified double-stranded nucleic acid, similar to the first nucleic acid chain described above. One such preferred configuration involves the second nucleic acid chain being RNA, where degradation by RNA-degrading enzymes such as RNase A is suppressed until the second nucleic acid chain is delivered into the nucleus of a specific cell, while degradation by RNase H within that cell facilitates the exertion of an antisense effect. In this configuration, the second nucleic acid chain is RNA, and the region complementary to the nucleotide analog-containing region of the first nucleic acid chain (i.e., the 5' wing region and / or 3' wing region) is a modified nucleic acid or nucleotide analog, with the modification or analog having the effect of suppressing degradation by enzymes such as RNA-degrading enzymes. In one embodiment, the modification is 2'-O-methylation and / or phosphorothioate of RNA. Furthermore, in such cases, the entire region complementary to the region containing the nucleotide analog of the first nucleic acid chain may be modified, or only a portion of the region complementary to the region containing the modified nucleic acid of the first nucleic acid chain may be modified. Moreover, the modified region may be longer or shorter than the region containing the modified nucleic acid of the first nucleic acid chain, as long as it includes the portion thereof.

[0080] In a double-stranded nucleic acid complex in one embodiment, the functional moiety may be bound to the second nucleic acid chain. The binding between the second nucleic acid chain and the functional moiety may be direct or indirect, mediated by other substances. However, in one embodiment, it is preferable that the second nucleic acid chain and the functional moiety are directly bound by a covalent bond, ionic bond, hydrogen bond, etc., and a covalent bond is more preferable from the viewpoint of obtaining a more stable bond.

[0081] In one embodiment, there are no particular structural limitations to the "functional portion," and it confers a desired function to the double-stranded nucleic acid complex and / or nucleic acid strand to which it is bound. Desired functions include labeling, purification, and target delivery. Examples of portions that confer labeling function include compounds such as fluorescent proteins and luciferases. Examples of portions that confer purification function include compounds such as biotin, avidin, His-tagged peptides, GST-tagged peptides, and FLAG-tagged peptides.

[0082] Furthermore, from the viewpoint of delivering the antisense strand to the target site with high specificity and efficiency, and suppressing the expression of the target gene very effectively by the nucleic acid, it is preferable that a molecule having the activity to deliver the nucleic acid complex to the target site in a certain embodiment is bound to the nucleic acid complex as a functional part.

[0083] In one embodiment of the double-stranded nucleic acid complex, it is preferable that a molecule having the activity to deliver the double-stranded nucleic acid complex in that embodiment to a target site is bound to the second nucleic acid chain as a functional moiety.

[0084] As a portion having the "delivery function to a target," for example, lipids can be cited as a "functional portion" that can deliver the double-stranded nucleic acid complex in a certain embodiment with high specificity and efficiency to the liver, etc. Examples of such lipids include cholesterol, fatty acids (e.g., vitamin E (tocopherols, tocotrienols), vitamin A, vitamin D), fat-soluble vitamins such as vitamin K (e.g., acylcarnitine), intermediate metabolites such as acyl-CoA, glycolipids, glycerides, and their derivatives. Among these, from the viewpoint of higher safety, it is preferable to use cholesterol and vitamin E (tocopherols, tocotrienols) in a certain embodiment. Furthermore, from the viewpoint of delivering the double-stranded nucleic acid of the present invention to the brain with high specificity and efficiency, sugars (e.g., glucose, sucrose) can be cited as a "functional portion" in a certain embodiment. Furthermore, from the viewpoint that the double-stranded nucleic acid complex in a certain embodiment can be delivered to the organ with high specificity and efficiency by binding to various proteins on the cell surface of each organ, peptides or proteins such as receptor ligands, for example, ligands for the S1P receptor, peptides that bind to cell adhesion molecules, for example, cRGD peptides that bind to integrins, antibodies, and / or fragments thereof, can be cited as "functional parts" in a certain embodiment.

[0085] While several embodiments have described suitable typical examples of double-stranded nucleic acid complexes, in some embodiments, it is possible to use ASOs consisting of single-stranded antisense or double-stranded nucleic acids such as HDO, siRNA, and shRNA.

[0086] The antisense and complementary strands of these nucleic acid complexes can be prepared by appropriately selecting methods known to those skilled in the art. For example, the nucleic acid can be prepared by designing the nucleic acid sequence based on the base sequence of the target transcript (or, in some cases, the base sequence of the target gene), synthesizing it using a commercially available automated nucleic acid synthesizer (e.g., Applied Biosystems, Beckmann), and then purifying the resulting oligonucleotide using a reversed-phase column. The nucleic acid thus prepared can then be mixed in a suitable buffer, denatured at approximately 90-98°C for several minutes (e.g., 5 minutes), and then annealed at approximately 30-70°C for approximately 1-8 hours to prepare double-stranded nucleic acid complexes in some embodiments. Furthermore, double-stranded nucleic acid complexes to which the functional moiety is bound can be prepared by using a nucleic acid species to which the functional moiety has been previously bound, and synthesizing, purifying, and annealing it as described above. Many methods for binding the functional moiety to the nucleic acid are well known in the art.

[0087] Generally, the active site of an RNaseH-dependent antisense oligonucleotide is expected to be the active site of an siRNA (Vickers et al., 2003, J. Biol Chem. 278, 7108-7118). In one embodiment of the present invention, the nucleic acid base sequence of the double-stranded antisense strand includes at least a portion of the oligonucleotide sequence shown in Tables 1, 2, and 6. The ends of the dsRNA strand can be modified by adding one or more native or modified nucleic acid bases to form an overhang. The sense strand of the dsRNA may then be designed and synthesized as a complement to the antisense strand and may contain modifications or additions at either end. For example, in one embodiment, both strands of the dsRNA double-stranded molecule are complementary across the central nucleic acid bases, and each has an overhang at one or both ends. The double-stranded molecule may be a single-molecule double-stranded molecule or a bi-molecule double-stranded molecule. That is, the two strands may be linked directly or by a linker, or they may be separate molecules.

[0088] In one embodiment, the antisense nucleic acid has an RNaseH-independent antisense effect. "RNaseH-independent antisense effect" refers to the activity that suppresses the expression of the target gene, which is caused by the hybridization of the transcript (RNA sense strand) of the target gene with a nucleic acid strand complementary to its partial sequence, or by splicing function conversion effects such as exon skipping.

[0089] Compositions containing nucleic acid complexes in some embodiments can be formulated by known pharmaceutical methods. For example, they can be used enterally (oral, etc.) or non-enterally as capsules, tablets, pills, liquids, powders, granules, fine granules, film coatings, pellets, lozenges, sublinguals, chewables, buccal preparations, pastes, syrups, suspensions, elixirs, emulsions, topical preparations, ointments, plasters, poultices, transdermal preparations, lotions, inhalants, aerosols, injections, suppositories, etc.

[0090] These formulations can be appropriately combined with carriers that are pharmacologically or food-grade, specifically sterile water or physiological saline, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, pH adjusters, stabilizers, flavoring agents, fragrances, excipients, vehicles, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffers, coating agents, lubricants, colorants, sweeteners, viscosity modifiers, flavoring and odor modifiers, solubilizers, or other additives.

[0091] In some embodiments of nucleic acid complexes, where lipids are bound as the functional portion during formulation, a complex with lipoproteins such as chylomicrons or chylomicron remnants may be formed. Furthermore, from the viewpoint of improving the efficiency of enteral administration, in addition to the lipoprotein, a complex (mixed micelle, emulsion) may be formed with a substance that enhances the permeability of the colonic mucosal epithelium (for example, medium-chain fatty acids, long-chain unsaturated fatty acids or their derivatives (salts, esters, or ethers)) and a surfactant (nonionic surfactant, anionic surfactant).

[0092] There are no particular limitations on the preferred mode of administration of the composition in some embodiments, and these include enteral (e.g., oral) or non-enteral administration, more specifically, intravenous administration, intra-arterial administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intra-airway administration, rectal administration, intramuscular administration, and administration by fluid infusion.

[0093] The compositions in some embodiments can be used as test subjects, with animals including humans being used as test subjects.

[0094] When administering or ingesting the compositions in some embodiments, the dosage or intake is appropriately selected depending on the age, weight, symptoms, health condition, and type of composition (pharmaceuticals, food and beverages, etc.) of the subject. However, the effective intake of the composition according to a particular embodiment is preferably 0.001 mg / kg / day to 50 mg / kg / day in terms of nucleotides.

[0095] The present invention encompasses therapeutic agents for melanoma, including ZIC5 gene-specific inhibitors or inhibitors of ZIC5 transcripts. [Examples]

[0096] The present invention will be specifically described by the following embodiments, but the present invention is not limited to these embodiments.

[0097] Example 1 Design of HDO that inhibits ZIC5 We obtained human and mouse ZIC5 sequence information from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) and designed a total of 110 antisense oligonucleotides (ASOs) based on the human ZIC5 transcript sequence: NCBI Reference Sequence: NM_033132.4 (SEQ ID NO: 1), the human ZIC5 transcript sequence: NCBI Reference Sequence: NM_033132.5 (SEQ ID NO: 2), and the mouse ZIC5 transcript sequence: NCBI Reference Sequence: NM_022987.3 (SEQ ID NO: 3). Of these 110 ASO sequences, 68 were human-selective sequences and 42 were human-mouse common sequences.

[0098] Table 1 shows the antisense strand name, antisense strand sequence, complementary strand name, complementary strand sequence, strand length, motif, type, GC content, Tm value (°C), and ZIC5 mRNA site location (start site, stop site).

[0099] Table 1 shows antisense strands containing nucleic acid base sequences that can hybridize to human selective ZIC5 sequences (68 strands).

[0100] [Table 1]

[0101] TIFF0007933315000003.tif250161

[0102] TIFF0007933315000004.tif249161

[0103] TIFF0007933315000005.tif250161

[0104] TIFF0007933315000006.tif250103

[0105] In the sequence formulas of the antisense and sense strands in Table 1, lowercase letters represent DNA, uppercase letters represent RNA, (L) represents LNA, C(L) represents 5-methylcytosine LNA, (M) represents 2'-O-methyl sugar modification, and ^ represents a phosphorothioate bond.

[0106] Table 2 shows antisense strands containing nucleic acid base sequences that can hybridize to the common human-mouse ZIC5 sequence (42 strands).

[0107] [Table 2]

[0108] TIFF0007933315000008.tif245153

[0109] TIFF0007933315000009.tif245155

[0110] TIFF0007933315000010.tif245153

[0111] TIFF0007933315000011.tif24461

[0112] The notation for the antisense and sense strand sequences in Table 2 is the same as in Table 1. All sequences listed in the "Antisense" column in Tables 1 and 2 contain phosphorothioate (PS) bonds between nucleotides. The bases in bold contain LNA modifications. For example, 3-8-3 in the "Motif" column indicates an antisense nucleic acid composed of 14-mer nucleic acid bases: 3 LNA-modified nucleic acids, 8 unmodified nucleic acids, and 3 LNA-modified nucleic acids (all containing PS modifications between nucleotides). In the "Species specificity" column, "human / mouse" indicates an antisense nucleic acid that perfectly matches human and mouse sequences. "mouse" indicates an antisense nucleic acid that perfectly matches mouse sequences but not human sequences. GC content was calculated based on the website (http: / / www.ngrl.co.jp / tools / 0217oligocalc.htm). The Tm value of LNA-modified antisense nucleic acids was calculated based on the website (https: / / www.exiqon.com / ls / pages / exiqontmpredictiontool.aspx). Sequence information within the coding regions of humans and mice was obtained from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ).

[0113] Example 2 In vitro testing (screening) To identify HDO sequences that inhibit ZIC5 expression, and to identify antisense strand sequences with high ZIC5 suppression rates, 110 sequences corresponding to ZIC5 were screened using the following method. The nucleic acid strands of the sequences listed in Tables 1 and 2 were obtained from Gene Design Co., Ltd.

[0114] A375 cells, a melanoma cell line that highly expresses ZIC5, were placed in a commercially available 96-well plate in a 3 x 10⁶ arrangement. 3Cells were seeded one cell per well and cultured in a CO2 incubator for 24 hours. The following day, transfection with ASO was performed using Lipofectamine LTX with Plus Reagent (Thermo Fisher), and the cells were cultured in a CO2 incubator for 48 hours. Total RNA was extracted and reverse transcription was performed from each well of the cultured 96-well plate using SuperPrep® Cell Lysis&RT Kit for qPCR (Toyobo). In assays using 12-well plates, total RNA was extracted using ReliaPrep® RNA Miniprep Systems (Promega), and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). Quantitative PCR was performed using THUNDERBIRD® SYBR® qPCR Mix (Toyobo), and the quantitative PCR instrument used was the CFX96 Real-Time PCR Analysis System (Bio-Rad). In this study, the following primers were used: ZIC5-F:AACCTCAAGATCCACAAGCGT (SEQ ID NO: 282) and R:CACTGGTGTGGACATGGGAA (SEQ ID NO: 283); ACTB-F:GCCCTGGCACCCAGCACAAT (SEQ ID NO: 284) and R:GGAGGGGCCGGACTCGTCAT (SEQ ID NO: 285); GAPDH-F:AGCCTCCCGCTTCGCTCTCT (SEQ ID NO: 286) and R:CCAGGCGCCCAATACGACCA (SEQ ID NO: 287). mRNA expression levels were calculated by measuring the Ct values ​​of ZIC5 and ACTB or GAPDH, and then using a relative quantification method based on a calibration curve. The value calculated by this method is called the relative expression rate of ZIC5 mRNA.

[0115] 1) Screening (96-well plate assay: 100 nM) (i) A screening (i) was performed using human melanoma A375 cells. The test was conducted in three separate trials to confirm reproducibility. ZIC5 expression levels were corrected using ACTB. First, knockdown activity was examined for all 110 cells in a 96-well plate at an ASO concentration of 100 nM. The knockdown activity was measured according to the method for calculating the relative expression rate of ZIC5 mRNA described above. The results are shown in Table 3.

[0116] [Table 3]

[0117] TIFF0007933315000013.tif24381

[0118] TIFF0007933315000014.tif11486

[0119] As a result, Ren-4-5ASO, Ren-4-7ASO, Ren-4-10ASO, Ren-4-13ASO, Ren-4-14ASO, Ren-4-16ASO, Ren-4-22ASO, Ren-4-23ASO, Ren-4-24ASO, Ren-4-32ASO, R en-4-33ASO, Ren-4-36ASO, Ren-4-39ASO, Ren-4-40ASO, Ren-4-41ASO, Ren-4-42ASO, Ren-4-48ASO, Ren-4-53ASO, Ren-4-54ASO, Ren-4-56ASO, Ren-4 Thirty-nine of the following strains showed knockdown activity of 50% or more: -57ASO, Ren-4-58ASO, Ren-4-59ASO, Ren-4-60ASO, Ren-4-61ASO, Ren-4-62ASO, Ren-4-63ASO, Ren-4-64ASO, Ren-4-66ASO, Ren-4-67ASO, Ren-4-68ASO, Ren-4-69ASO, Ren-4-72ASO, Ren-4-73ASO, Ren-4-75ASO, Ren-4-76ASO, Ren-4-77ASO, Ren-4-89ASO, and Ren-4-105ASO.

[0120] These 39 antisense strands correspond to the nucleic acid bases of SEQ ID NO: 15-28, 180-193, 249-262, 516-529, 615-628, 654-667, 924-937, 1063-1076, 1241-1254, 1499-1512, 1535-1548, 1719-1732, 1920-1933, 1967-1980, 2016-2029, 2191-2204, 109-122, 1425-1438, 1664-1677, and 1859-1872. Hybridize with the sense portion of 1906-1919, 1990-2003, 2010-2023, 2028-2041, 2043-2056, 2062-2075, 2141-2154, 2322-2335, 2355-2368, 2391-2404, 2406-2419, 2498-2511, 2551-2564, 2568-2581, 2604-2617, 2618-2631, 2640-2653, 3218-3231, or 3975-3988.

[0121] The sequence numbers for these 39 antisense chains are: Sequence ID 8, Sequence ID 10, Sequence ID 13, Sequence ID 16, Sequence ID 17, Sequence ID 19, Sequence ID 25, Sequence ID 26, Sequence ID 27, Sequence ID 35, Sequence ID 36, Sequence ID 39, Sequence ID 42, Sequence ID 43, Sequence ID 44, Sequence ID 45, Sequence ID 51, Sequence ID 56, Sequence ID 57, Sequence ID 59, Sequence ID 60, Sequence ID 61, Sequence ID 62, Sequence ID 63, Sequence ID 64, Sequence ID 65, Sequence ID 66, Sequence ID 67, Sequence ID 69, Sequence ID 70, Sequence ID 71, Sequence ID 72, Sequence ID 75, Sequence ID 76, Sequence ID 78, Sequence ID 79, Sequence ID 80, Sequence ID 92, and Sequence ID 108.

[0122] Among them, 16 of the following showed knockdown activity of 60% or more: Ren-4-5ASO, Ren-4-7ASO, Ren-4-22ASO, Ren-4-23ASO, Ren-4-24ASO, Ren-4-32ASO, Ren-4-33ASO, Ren-4-36ASO, Ren-4-40ASO, Ren-4-42ASO, Ren-4-53ASO, Ren-4-63ASO, Ren-4-64ASO, Ren-4-72ASO, Ren-4-73ASO, and Ren-4-76ASO.

[0123] These 16 antisense strands hybridize with the sense portions of nucleic acid bases 15-28, 180-193, 924-937, 1063-1076, 1241-1254, 1499-1512, 1532062-20755-1548, 1719-1732, 1967-1980, 2191-2204, 1425-1438, 2141-2154, 2322-2335, 2551-2564, 2568-2581, and 2618-2631 of Sequence ID No. 2.

[0124] The sequence numbers for these 16 antisense chains are sequence number 8, sequence number 10, sequence number 25, sequence number 26, sequence number 27, sequence number 35, sequence number 36, sequence number 39, sequence number 43, sequence number 45, sequence number 56, sequence number 66, sequence number 67, sequence number 75, sequence number 76, and sequence number 79.

[0125] 2) Screening (12-well plate assay: 30, 50, 100 nM) (ii) Next, screening (ii) was performed using human melanoma A375 cells. Knockdown activity was measured according to the method for calculating the relative expression rate of ZIC5 mRNA described above. ZIC5 expression levels were corrected using both ACTB and GAPDH. The tests were conducted using 12-well plates with ASO concentrations of 30, 50, and 100 nM. The relative expression rate of ZIC5 mRNA was examined using the method described above for 16 ASO cells that showed knockdown activity of 50% or more in screening (i). The results are shown in Table 4.

[0126] [Table 4]

[0127] As a result, three of the oligonucleotides, Ren-4-32ASO, Ren-4-36ASO, and Ren-4-42ASO, showed knockdown activity of more than 60% in terms of the relative expression rate of ZIC5 mRNA.

[0128] 3) Screening (12-well plate assay: 30, 50 nM) (iii) Next, screening (iii) was performed using human melanoma A375 cells. Knockdown activity was measured according to the method for calculating the relative expression rate of ZIC5 mRNA described above. ZIC5 expression levels were corrected using both ACTB and GAPDH. The tests were conducted using 12-well plates with ASO concentrations of 30 and 50 nM, and knockdown activity was examined for a total of 12 samples containing sequences that hit in screening (ii). The results are shown in Table 5.

[0129] Both Ren-4-36ASO and Ren-4-42ASO showed knockdown activity of over 59%.

[0130] Based on these results, it was clear that Ren-4-36ASO and Ren-4-42ASO exhibited strong knockdown effects with good reproducibility. Therefore, these two sequences were selected for secondary screening.

[0131] [Table 5]

[0132] Example 3 In vitro testing (screening) The inventors designed 28 antisense strands in total, 14 strands each with a base length of 14-20 mers, near the sequences of Ren-4-36ASO and Ren-4-42ASO, which showed high screening suppression efficiency in Example 2. These strands further modified the sequences of each component.

[0133] Since the inventors' target disease area is human cancer, when designing the antisense strand length to 14-20mers, considering that in vivo evaluation would be performed using a human cancer model, human sequences were selected in all cases where a mismatch occurred between the mouse mRNA sequence and the human mRNA sequence. The 14mer Ren-4-36ASO was common to both humans and mice, but 10 of the 14 sequences derived from Ren-4-36ASO (Ren-4-36-1, 2, 3, 4, 5, 9, 10, 11, 12, 13) showed a mismatch between the mouse mRNA sequence and the human mRNA sequence, so these sequences were made complementary to the sense site of the human mRNA sequence. On the other hand, there were no mismatches in the 14 sequences derived from Ren-4-42ASO, so all sequences were designed as common to both humans and mice. These 28 oligonucleotides were obtained from GeneDesign.

[0134] Table 6 shows the antisense strands, complementary strands, motifs, GC contents, Tm value, and start and stop positions on the ZIC5 mRNA for these 28 strands.

[0135] Table 6 shows 28 antisense strands whose sequences were designed near the sequences of Ren-4-36ASO and Ren-4-42ASO.

[0136] [Table 6]

[0137] TIFF0007933315000018.tif245154

[0138] TIFF0007933315000019.tif245135

[0139] Using these 28 antisense strands, the inventors measured the knockdown activity of ZIC5 mRNA from each antisense strand in A375 cells. Knockdown activity was measured according to the method for calculating the relative expression rate of ZIC5 mRNA described above. ZIC5 expression levels were corrected using both ACTB and GAPDH. The tests were conducted using 12-well plates with ASO concentrations of 30 and 50 nM to examine the knockdown activity of ZIC5 mRNA. The results are shown in Tables 7 and 8.

[0140] Table 7 shows the relative expression rates of ZIC5 mRNA (ZIC5 / GAPDH) at ASO concentrations of 30 nM and 50 nM.

[0141] [Table 7]

[0142] As shown in Table 7, Ren-4-36-1ASO, Ren-4-36-2ASO, Ren-4-36-3ASO, Ren-4-36-5ASO, Ren-4-36-6ASO, Ren-4-36- 7ASO, Ren-4-36-8ASO, Ren-4-36-9ASO, Ren-4-36-10ASO, Ren-4-36-11ASO, Ren-4-36-12ASO, Ren-4-36- 13ASO, Ren-4-36-14ASO, Ren-4-42-1ASO, Ren-4-42-2ASO, Ren-4-42-3ASO, Ren-4-42-4ASO, Ren-4-42-9ASO, Ren-4-42-11ASO, Ren-4-42-12ASO, Ren-4-42-13ASO, and Ren-4-42-14ASO inhibited ZIC5 mRNA expression by more than 50%.

[0143] These 22 antisense strands hybridize with the sense portions of the nucleic acid bases 1719-1737, 1719-1736, 1719-1735, 1719-1733, 1718-1732, 1717-1732, 1716-1732, 1715-1732, 1714-1732, 1718-1733, 1717-1734, 1716-1735, 1719-1732, 2191-2209, 2191-2208, 2191-2207, 2191-2206, 2187-2204, 2190-2205, 2189-2206, 2188-2207, and 2191-2204 of Sequence ID No. 2.

[0144] The sequence numbers for these 22 antisense strands are sequence numbers 114, 115, 116, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 136, 138, 139, 140, and 141.

[0145] Ren-4-36-1ASO, Ren-4-36-6ASO, Ren-4-36-11ASO, Ren-4-42-3ASO, Ren-4-42-4ASO, Ren-4-42-11ASO, and Ren-4-42-12ASO inhibited ZIC5 mRNA expression by more than 80% at 30 nM.

[0146] Ren-4-36-1ASO, Ren-4-36-6ASO, and Ren-4-42-12ASO inhibited ZIC5 mRNA expression by more than 80% at both 30nM and 50nM concentrations. Ren-4-36-1ASO inhibited ZIC5 mRNA expression by more than 87% at both 30nM and 50nM concentrations.

[0147] Table 8 shows the relative expression rates of ZIC5 mRNA (ZIC5 / ACTB) at ASO concentrations of 30 nM and 50 nM.

[0148] [Table 8]

[0149] As shown in Table 8, Ren-4-36-1ASO, Ren-4-36-2ASO, Ren-4-36-3ASO, Ren-4-36-5ASO, Ren-4-36-6ASO, Ren-4-36-7ASO, Ren -4-36-8ASO, Ren-4-36-9ASO, Ren-4-36-10ASO, Ren-4-36-11ASO, Ren-4-36-12ASO, Ren-4-36-13ASO, Ren-4-36-1 The 24 strains of ZIC5 mRNA—4ASO, Ren-4-42-1ASO, Ren-4-42-2ASO, Ren-4-42-3ASO, Ren-4-42-4ASO, Ren-4-42-5ASO, Ren-4-42-7ASO, Ren-4-42-10ASO, Ren-4-42-11ASO, Ren-4-42-12ASO, Ren-4-42-13ASO, and Ren-4-42-14ASO—inhibited ZIC5 mRNA expression by more than 50%.

[0150] These 24 antisense strands are the nucleic acid bases of SEQ ID NO: 1719–1737, 1719–1736, 1719–1735, 1719–1733, 1718–1732, 1717–1732, 1716–1732, 1715–1732, 1714–1732, 1718–1733, 1717–1734, 1716– Hybridize with the sense portion of 1735, 1719-1732, 2191-2209, 2191-2208, 2191-2207, 2191-2206, 2191-2205, 2189-2204, 2186-2204, 2190-2205, 2189-2206, 2188-2207, and 2191-2204.

[0151] The sequence numbers for these 24 antisense strands are sequence numbers 114, 115, 116, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 134, 137, 138, 139, 140, and 141.

[0152] Ren-4-36-1ASO, Ren-4-42-3ASO, and Ren-4-42-4ASO inhibited ZIC5 mRNA expression by more than 80% at 30 nM.

[0153] Ren-4-36-1ASO inhibited ZIC5 mRNA expression by more than 84% at both 30 nM and 50 nM concentrations.

[0154] Example 4 Human melanoma cells A375, 5 x 10 5 Immunodeficient mice were used as test subjects, in which cells were mixed with 50 μL of Matrigel (Corning) and subcutaneously transplanted. The antitumor effect of Ren-4-36-1ASO administration in these test subjects was investigated.

[0155] The inventors created tumor-bearing mice by subcutaneously transplanting human melanoma cells A375 into immunodeficient mice and conducted tumor suppression tests. Each group of 9 mice received repeated weekly administrations of PBS or Ren-4-36-1ASO at a dose of 1.5 μmol / kg via the tail vein for 3 weeks. The tumor volume (mm³) of the subjects was measured at the time of the first administration (day 8), the second administration (day 15), the third administration (day 22), and one week after the third administration (day 29). 3 The following was measured: In addition, tumor tissue from the subject was excised one week after the third administration (day 29) and the knockdown activity of ZIC5 mRNA was measured. The method for calculating the knockdown activity was the same as the method for calculating the relative expression rate of ZIC5 mRNA described in Example 2.

[0156] Administration of Ren-4-36-1ASO reduced tumor volume and significantly decreased ZIC5 mRNA levels in the tumors (Figures 1 and 2).

[0157] Figure 1 shows the changes in tumor size after Ren-4-36-1ASO in an in vivo study. Tumor volume decreased with administration of Ren-4-36-1ASO. The rate of decrease in tumor volume increased from day 22 onward.

[0158] Figures 2A and 2B show the relative expression rates of ZIC5 mRNA induced by Ren-4-36-1ASO in in vivo studies. The mean Av for n=1-9 was 1.99 in the Ren-4-36-1ASO group compared to 3.37 in the PBS group, indicating that Ren-4-36-1ASO suppressed ZIC5 mRNA expression (Figure 2A). Statistical analysis of the n=9 data showed that Ren-4-36-1ASO administration reduced tumor volume and significantly decreased ZIC5 mRNA levels in the tumors (Figure 2B Compared to PBS group **: p<0.01).

[0159] Example 5 A ligand selection test was conducted. By attaching a ligand molecule to the RNA chain of HDO, it is possible to selectively deliver HDO to cancer cells. We identified a suitable ligand for melanoma-specific HDO delivery.

[0160] In this example, we evaluated appropriate ligands for melanoma-specific delivery of HDO, which consists of the antisense strand of SEQ ID NO: 142 and the complementary strand of SEQ ID NO: 143 (complementary to the antisense strand of SEQ ID NO: 142 and configured to hybridize), and targets human Malat1 ncRNA. HDO is an antisense strand consisting of 16 consecutive nucleic acids (16mers) that target human Malat1 ncRNA and is composed of the following sequence that can hybridize to the target site of human Malat1 ncRNA. The sequences of the antisense strand and complementary strand are as follows.

[0161] Antisense strand: 5'-G(L)^C(L)^A(L)^t^t^c^t^a^a^t^a^g^c^A(L)^G(L)^C(L)-3' (Malat1ASO, SEQ ID NO: 142) Sense chain: 5'-G(M)^C(M)^U(M)GCUAUUAGAAU(M)^G(M)^C(M)―3'(Malat1SO, Sequence ID 143)

[0162] In the sequence formulas of the antisense and sense strands above, lowercase letters represent DNA, uppercase letters represent RNA, (L) represents LNA, C(L) represents 5-methylcytosine LNA, (M) represents 2'-O-methyl sugar modification, and ^ represents a phosphorothioate bond.

[0163] The HDO that Malat1ASO and Malat1SO are annealing is called Malat1HDO.

[0164] Oligonucleotides and cRGD groups can be covalently bonded via triazole rings, disulfide bonds, maleimide-thiol bonds, and other mechanisms.

[0165] [ka]

[0166] For example, one way to attach cRGD to the complementary strand Malat1SO is to attach X (bicyclooctin-carbonyl-hexylamino group) to the 5' end of Malat1SO in sequence number 143, resulting in 5' dibenzocyclooctin-succinyl-hexylamino oligonucleotide (5'-XG(M)^C(M)^U(M)GCUAUUAGAAU(M)^G(M)^C(M)―3'

[0167] In the sequence, X represents a bicyclooctin-carbonyl-hexylamino group, lowercase letters represent DNA, uppercase letters represent RNA, (L) represents LNA, C(L) represents 5-methylcytosine LNA, (M) represents 2'-O-methyl sugar modification, and ^ represents a phosphorothioate bond. To this, cRGD-Amide-Peg4-Azide, which can be synthesized by DMSO solvent condensation of cRGDfK and Azido-PEG4-NHSester, is added, and after stirring, it can be allowed to stand for 5 minutes to ~36 hours to synthesize. In this case, by using Azido-PEGn-NHS (n=1~32) with PEG groups of any length or Azido-(CH2)n-NHS (n=1~32) with alkyl groups of any length instead of Azido-PEG4-NHS, the corresponding azide can be synthesized and bound to oligonucleotides in the same way.

[0168] The reaction solution was diluted with an 8 mM triethylamine 100 mM hexafluoroisopropanol 5% (w / v) methanol aqueous solution and purified by HPLC (column: YMC-TriartC18, 150 x 10.0 mm ID S-5 μm; eluents: A 8 mM triethylamine 100 mM hexafluoroisopropanol 5% (w / v) methanol aqueous solution, B 80% (w / v) methanol aqueous solution; elution conditions: 4.7 mL / min, 0-60% B). After removing the solvent under reduced pressure, the solution was dissolved again in water (1 mL), sodium chloride aqueous solution (5.0 M, 30 μL) was added and stirred, then EtOH (4 mL) was added and the mixture was centrifuged. The resulting precipitate was washed with 80% (w / v) EtOH and dried under reduced pressure to obtain cRGD-Malat1SO.

[0169] In the above process, any oligonucleotide can be obtained by changing Malat1SO to any oligonucleotide sequence. For example, by changing it to Malat1ASO, cRGD-Malat1ASO can be synthesized.

[0170] Malat1ASO (10 nmol) and cRGD-Malat1SO (10.5 nmol) were mixed, and the solvent was removed to obtain cRGD-Malat1HDO, which is a ligand-bound HDO. Physiological saline (Otsuka Saline Injection (Otsuka Pharmaceutical)) was added to cRGD-Malat1HDO, and this solution was heated at 95°C for 5 minutes. The solution was then slowly cooled to room temperature to perform annealing.

[0171] In the above synthesis process, the sequence of the oligonucleotide can be changed to any sequence, including Malat1. For example, by using Ren-4-36, cRGD-Ren-4-36-HDO can be synthesized. Alternatively, the cRGD group can be introduced by substituting the 5′ dibenzocyclooctin-succinyl-hexylamino group with the 5′ bicyclooctin-carbonyl-hexylamino group.

[0172] SEQ ID NO: 143: Malat1SO modified with a 3-(2-pyridyldithiopropionyl-hexylamino group at its 5' end (5′3-(2-pyridyldithiopropionyl-hexylamino oligonucleotide (1.0 mM 1.0 mL, :5'-XG*C*A*UUCAGUGAAC*U*A*G-3', where X is the 3-(2-pyridyldithiopropionyl-hexylamino group, * is a phosphorothioate bond, uppercase italics indicate 2'-O-methyl sugar modification, and uppercase letters indicate RNA) was mixed with cRGDfC and allowed to stand for 5 minutes to 36 hours. Diluted with 8 mM triethylamine and 100 mM hexafluoroisopropanol 5% (w / v) methanol aqueous solution, and purified by HPLC (column: YMC-TriartC18, 150X10.0 mm ID S-5 μm; eluent: A 8 mM Triethylamine 100 mM hexafluoroisopropanol 5% (w / v) methanol aqueous solution and B 80% (w / v) methanol aqueous solution; elution conditions: 4.7 mL / min, 0-60% (B). After removing the solvent by distillation, the solution was redissolved in water (1 mL), sodium chloride aqueous solution (5.0 M, 30 μL) was added and stirred, then ethanol (4 mL) was added and the solution was centrifuged. The resulting precipitate was washed with 80% (w / v) EtOH and dried under reduced pressure to obtain cRGDfC-Malat1SO.

[0173] Malat1ASO (10 nmol) and cRGDfC-Malat1SO (10.5 nmol) were mixed, and the solvent was removed to obtain cRGD-Malat1HDO, which is a ligand-bound HDO. Physiological saline (Otsuka Saline Injection (Otsuka Pharmaceutical)) was added to cRGD-Malat1HDO, and this solution was heated at 95°C for 5 minutes. The solution was then slowly cooled to room temperature to perform annealing.

[0174] Ligands other than cRGD, such as cholesterol (Chol), tocopherol (Toc), and VPC-P, were also attached to Malat1HDO using a similar method.

[0175] [Table 9]

[0176] The knockdown effect of Malat1HDO prepared in Example 2 and ligand-bound Malat1HDO on target genes in cultured cells was tested. Human melanoma cell line A375 (obtained from ATCC) was used in this experiment. A375 cells were maintained at 37°C in 5% CO2 in Dulbecco's modified Eagle medium (Thermo Fisher Scientific) supplemented with 10% (w / v) fetal bovine serum (Thermo Fisher Scientific), 100 U / mL penicillin, and 100 μg / mL streptomycin. Cells at 80% confluence were harvested from a 10 cm dish using 0.25% (w / v) trypsin-0.53 mM EDTA, and then transferred to a 48-well plate in 2 × 10⁶ cells. 4Seeds were seeded in one well and cultured at 37°C. The following day, HDO at final concentrations of 10, 100, and 1000 μM was added to the culture medium and the entire amount was added to the wells of a 48-well plate. A PBS-added group was used as a negative control. Seven days after each HDO addition, the supernatant was discarded and RNA was extracted from the cells using Lysis buffer. Total RNA was purified using the SV96 Total RNA Isolation System (Promega), and cDNA was synthesized from the total RNA using PrimeScriptRT master mix (Takara, RR036A). After further dilution by half, qPCR was performed using Luna Universal qPCR Master Mix (NEB, M3003) and primers and probes for human Malat1 and human Gapdh (Thermo Fisher Scientific, Hs00273907_s1, Hs02786624_g1). The expression levels of hMalat1 and hGapdh mRNA were calculated by measuring the Ct values ​​of human Malat1 and human Gapdh mRNA, and then using a relative quantification method based on the ΔΔCt method.

[0177] Using the method described above, knockdown effects of the endogenous gene Malat1 were tested for each HDO. The results are shown in Figure 3. The vertical axis in Figure 3 represents the relative hMalat1 ncRNA expression level. The hMalat1 ncRNA expression level when 0 nM HDO was administered was set to 1. In Figure 3, the horizontal axis represents the PBS group or 10 nmol / L, 100 nmol / L, 1000 nmol / L Malat1 HDO, Chol-Malat1 HDO, Toc-Malat1 HDO, cRGD-Malat1 HDO, or VPC-P-Malat1 HDO. The vertical axis represents the relative expression level (hMalat1 ncRNA expression level / hGapdh mRNA expression level). As shown in Figure 3, the addition of 10 nmol / L, 100 nmol / L, or 1000 nmol / L Malat1 HDO resulted in knockdown effects of 31%, 30%, and 70% of hMalat1 ncRNA expression levels, respectively. Addition of 10 nmol / L, 100 nmol / L, or 1000 nmol / L of Chol-Malat1HDO resulted in a knockdown of 25%, 72%, and 65% of hMalat1 ncRNA expression levels. Addition of 10 nmol / L, 100 nmol / L, or 1000 nmol / L of Toc-Malat1HDO resulted in a knockdown of 26%, 20%, and 68% of hMalat1 ncRNA expression levels. Addition of 10 nmol / L, 100 nmol / L, or 1000 nmol / L of cRGD-Malat1HDO resulted in a knockdown of 4%, 18%, and 52% of hMalat1 ncRNA expression levels. Addition of 100 nmol / L or 1000 nmol / L of VPC-P-Malat1HDO resulted in an 8%, and 68% knockdown of hMalat1 ncRNA expression levels. As shown in Figure 3, it was revealed that cholesterol (Chol), tocopherol (Toc), cRGD, and VPC-P have the effect of delivering Malat1HDO to human melanoma cells A375.

[0178] IC of Malat1HDO and Malat1HDO bound to each ligand. 50 The values ​​were examined. The results are shown in Table 10.

[0179] [Table 10]

[0180] Example 6 Human melanoma cells A375, 5 x 10 5 Immunodeficient mice were used as test subjects, in which cells were mixed with 50 μL of Matrigel (Corning) and subcutaneously transplanted. The antitumor effect of Chol-Ren-4-36-1HDO administration in these subjects was investigated.

[0181] In Example 5, studies using HDO with multiple ligands attached revealed that the ligand with cholesterol (chol) was taken up by melanoma cells at a lower concentration. Therefore, to investigate the effect of ligands using ZIC5-targeted HDO, the inventors verified the in vivo tumor-suppressing effect of intravenous administration of Chol-Ren-4-36-1HDO to tumor-bearing mice. Chol-Ren-4-36-1HDO was administered via tail vein once a week for two weeks at a dose of 1.5 μmol / kg. Although hepatotoxicity was observed, the tumor significantly regressed with the administration of Chol-Ren-4-36-1HDO (Figure 4 Compared to Control group on Day 19**: p<0.01).

[0182] Figure 4 shows the changes in tumor size when Chol-Ren-4-36-1HDO was administered intravenously to tumor-bearing mice.

Claims

1. A nucleic acid complex comprising an antisense chain consisting of 12 to 30 linked nucleotides, wherein the antisense chain has a nucleic acid base sequence represented by Sequence ID No.

2. The 1716-1732, 1716-1735, 1717-1732, 1717-1734, 1718-1732, 1718-1733, 1719-1732, 1719-1733, 1719-1735, 1719-1736 or 1719-1737th nucleotide A nucleic acid complex that can hybridize with and has an antisense effect on ZIC5 transcripts.

2. The nucleic acid complex according to claim 1, wherein the antisense strand is a single-stranded oligonucleotide.

3. The nucleic acid complex according to claim 1, comprising the antisense strand and a nucleic acid strand complementary to the antisense strand, in a heteroduplex nucleic acid.

4. The nucleic acid complex according to claim 1, wherein the antisense strand comprises at least one modified nucleotide.

5. The nucleic acid complex according to claim 1, wherein the antisense chain comprises at least one phosphorothioate nucleotide.

6. The nucleic acid complex according to claim 1, wherein the antisense chain comprises at least one phosphodiester nucleoreotide.

7. The nucleic acid complex according to claim 5, wherein the antisense chain is a phosphorothioate nucleotide.

8. The nucleic acid complex according to any one of claims 1 to 7, wherein the antisense strand includes a modified nucleic acid base.

9. The nucleic acid complex according to claim 8, wherein the modified nucleotide is 5-methylcytosine, 2'-MOE, 2'-OMe, 2'-F, BNA, LNA, ENA, scpBNA, cEt, or AmNA.

10. The nucleic acid complex according to claim 3, characterized in that the nucleic acid strand complementary to the antisense strand is RNA.

11. The aforementioned antisense chain is: A 5' wing region consisting of multiple nucleic acids; A gap region consisting of multiple nucleic acids; A 3' wing region consisting of multiple nucleic acids; The nucleic acid complex according to claim 2, characterized by containing the following:

12. The nucleic acid chain complementary to the aforementioned antisense strand is: A 5' wing region consisting of multiple nucleic acids; A gap region consisting of multiple nucleic acids; A 3' wing region consisting of multiple nucleic acids; The nucleic acid complex according to claim 3, characterized by containing the following:

13. The nucleic acid complex according to claim 1, wherein the nucleic acid complex includes a functional portion having a labeling function, a purification function and / or a delivery function to a target.

14. The nucleic acid complex according to claim 13, characterized in that the functional portion is a compound selected from fluorescent proteins, compounds such as luciferase, biotin, avidin, His-tagged peptides, GST-tagged peptides, cRDG peptides, FLAG-tagged peptides, compounds that bind to receptors, compounds that bind to S1P receptors, lipids such as cholesterol and fatty acids, fat-soluble vitamins such as vitamin E, tocopherols, tocotrienols, vitamin A, vitamin D, and vitamin K, intermediate metabolites such as acylcarnitine and acyl-CoA, glycolipids, and glycerides.

15. The nucleic acid complex according to claim 2, wherein a ligand having the function of delivering the nucleic acid complex to a target site is bound to the antisense strand, with or without the linker.

16. The nucleic acid complex according to claim 3, wherein a ligand having the function of delivering the nucleic acid complex to a target site is bound to a nucleic acid chain complementary to the antisense chain, with or without the linker.

17. A ZIC5-specific inhibitor comprising the nucleic acid complex described in claim 1.

18. An inhibitor of malignant transformation of tumor cells, comprising the nucleic acid complex described in claim 1.

19. An antitumor agent used for the treatment of melanoma, comprising the nucleic acid complex described in claim 1.

20. A double-stranded nucleic acid complex for regulating the expression level of ZIC5 in melanoma tissue when administered to a subject, A double-stranded nucleic acid complex consists of a first nucleic acid strand and a second nucleic acid strand. The first nucleic acid chain includes an antisense chain consisting of 12 to 30 linked nucleotides, each containing at least one modified nucleotide, and the antisense chain is capable of hybridizing with the nucleotides at positions 1716-1732, 1716-1735, 1717-1732, 1717-1734, 1718-1732, 1718-1733, 1719-1732, 1719-1733, 1719-1735, 1719-1736, or 1719-1737 of the nucleic acid base sequence represented by Sequence ID No. 2, and has an antisense effect on the ZIC5 transcript. The second nucleic acid chain consists of 12 to 30 linked nucleotides, each containing at least one modified nucleotide, and a functional moiety. The functional portion has labeling, purification, and / or target delivery functions. moreover, The first nucleic acid strand is a double-stranded nucleic acid complex having a base sequence complementary to both the second nucleic acid strand and ZIC5 mRNA.

21. The double-stranded nucleic acid complex according to claim 20, characterized in that the functional portion is a compound selected from fluorescent proteins, compounds such as luciferase, biotin, avidin, His-tagged peptides, GST-tagged peptides, cRDG peptides, FLAG-tagged peptides, compounds that bind to receptors, compounds that bind to S1P receptors, lipids such as cholesterol and fatty acids, fat-soluble vitamins such as vitamin E, tocopherols, tocotrienols, vitamin A, vitamin D, and vitamin K, intermediate metabolites such as acylcarnitine and acyl-CoA, glycolipids, and glycerides.

22. The double-stranded nucleic acid complex according to claim 20, wherein a ligand having the function of delivering the nucleic acid complex to a target site is bound to the antisense strand, either via or without a linker.

Images