Fluorescent dyes, methods for producing the same, and their use

Abstract

Disclosed are fluorescent dyes according to formula (I) comprising an electron donor moiety D, a conjugated system E, and an electron acceptor moiety A, and methods for their preparation and use. The fluorescent dyes are provided with long wavelength emission capability, low background fluorescence, excellent water solubility, sensitive viscosity response, and tunable wavelength. [Formula 1] TIFF2024528240000088.tif44170

Description

TECHNICAL FIELD

[0001] The present invention relates to the technical field of fluorescent dyes, and in particular, relates to a fluorescent dye with low background fluorescence, excellent water solubility, high sensitivity to viscosity, and adjustable molecular structure, as well as a preparation method and use thereof.

BACKGROUND ART

[0002] Cell viscosity is one of the important parameters affecting the diffusion rate of substances, and by influencing the mobility of substances, it has a very significant impact on substance transport, signal transduction, recognition, and biopolymer interactions. At the same time, changes in intracellular viscosity have a certain correlation with the occurrence of atherosclerosis, diabetes, Alzheimer's disease and tumors, and are potential indicators of these diseases. Therefore, the measurement of intracellular viscosity is of very great significance. The fluorescence method has unique advantages such as high sensitivity, real-time performance, in-situ capability, and visualizability, so it is an important means for measuring microscopic viscosity in cells. Unlike the measurement of viscosity of macroscopic, large-volume viscous fluids, where instruments such as rotational viscometers and falling-ball viscometers can be used, the measurement of intracellular viscosity generally employs fluorescent probes based on molecular rotors. A molecular rotor is a special type of fluorescent molecule, and the energy lost in non-radiative transition from the excited state changes with the change in viscosity. An increase in viscosity or ambient rigidity inhibits the twisting of the molecular rotor, reducing the energy lost in the non-radiative transition of the molecular rotor, which is specifically manifested as an increase in the fluorescence intensity of the molecular rotor. Therefore, the fluorescence intensity of the molecular rotor can directly reflect the viscosity of the intracellular microenvironment.

[0003] Viscosity-responsive molecular rotor fluorescent molecules are frequently used not only for measuring intracellular microviscosity but also for designing fluorescence-activated fluorescent probes (fluorogenic probes). This is primarily because, after binding to proteins, nucleic acids, or other biomolecules, the molecular rotor fluorescent molecules restrict their twisting rotation (equivalent to increased viscosity), causing fluorescence emission. Unbound molecules remain in a twisted state and do not emit fluorescence, enabling low background and highly specific fluorescence emission for biomolecules. Fluorescence imaging of biomolecules present in low biomass requires both a high signal-to-noise ratio and low background. For example, widely used thiazole orange dyes exhibit a good signal-to-noise ratio when labeling large proteins and tRNAs, but emit relatively strong background fluorescence, severely limiting their ability to label some small biomolecules present in low abundance. The development of fluorescent dye molecules with low background, high viscosity sensitivity, and a high signal-to-noise ratio is extremely important and is expected to be more widely applied in a wider range of fields.

[0004] The high background of various fluorescent probes is mainly due to the following: First, continuous-emission fluorescent probes produce strong fluorescence background because they cannot quench their own fluorescence. For example, conventional fluorescent dyes such as coumarin, luciferin, and rhodamine emit bright fluorescence in water, and after binding to the target substance, they need to be washed before imaging. However, thorough washing is often not possible, resulting in strong background fluorescence. Second, quenched fluorescent probes produce background fluorescence because the quenching is not thorough. For example, rhodamine is bound to a typical quenching group, and when a fluorescence-activated probe is constructed using a mechanism that quenches fluorescence using the PET or FRET principle, and then RNA is imaged using this probe, strong background fluorescence is produced because the quenching is not thorough. Third, environmentally responsive fluorescent probes produce background fluorescence because they have poor water solubility and lipophilicity. Environmentally responsive fluorescent molecules themselves do not emit fluorescence in water, but only after binding to a target. However, if the fluorescent probe has very poor water solubility, it can still excite some fluorescence by binding to cell membrane structures due to the principle of like-minded substances dissolving together, leading to background fluorescence problems. Therefore, improving the water solubility of viscosity-responsive fluorescent probes is a crucial factor in solving the background fluorescence problem.

[0005] The greatest advantage of fluorescent dyes as fluorescent probes compared to fluorescent proteins is that the structure of small-molecule fluorescent dyes can be adjusted, allowing for wavelength adjustment and the ability to label biomolecules with different colors. While the structure of small-molecule fluorescent probes can be adjusted, many require numerous steps in organic synthesis, and the synthesis yield of many molecules is not high, resulting in a relatively high cost. Furthermore, while long wavelengths have a clear advantage as fluorescent dyes, in current dye structures, long-wavelength molecules generally have relatively large conjugations, which generally means that the compound has relatively poor water solubility, leading to the problem of background fluorescence. If a significant change in wavelength can be brought about by simply changing a single chemical element on the dye molecule, and if the wavelength can be shifted to a longer wavelength, it is possible to ensure the structure of the fluorescent molecule is small, while simultaneously increasing the wavelength. This ensures the water solubility of the dye molecule and enables the use of long-wavelength dye molecules, which has extremely significant implications for bioimaging. [Overview of the project]

[0006] The object of the present invention is to provide a fluorescent dye that exhibits low background fluorescence, excellent water solubility, sensitivity to viscosity response, and adjustable wavelength.

[0007] In one aspect of the present invention, a fluorescent dye comprising an electron donor portion D, a conjugated system E, and an electron acceptor portion A is provided, wherein the fluorescent dye is represented by formula (I).

[0008] [ka] The electron donor moiety -D is (X1)(X2)N-, where X1 and X2 are independently selected from hydrogen, alkyl groups, or modified alkyl groups, and X1 and X2 may bond to each other with the N atom to form an aliphatic heterocycle. The conjugated system E is formed by at least one conjugated bond selected from a subaromatic ring and a subaromatic heterocycle, and each hydrogen atom in the conjugated system E may be independently substituted with an alkyl group. In the electron donor region D-, X1 and X2 may independently form an aliphatic heterocycle with the conjugated system E. The electron acceptor portion may form a cyclic structure as shown in equation (I-1) below. [ka] During the ceremony, R1 is independently -O-, -S-, and -(NR a )- Selected from, of which R a is selected from hydrogen or alkyl groups. R2 is independently selected from =O, =S, and =NH. R3 is independently selected from =O, =S, and =NH. X is independently selected from hydrogen, alkyl groups, or modified alkyl groups. However, the aforementioned "alkyl group" is C1-C 30 A linear or branched alkyl group, preferably C1-C 10The linear or branched alkyl group is preferably a C1-C7 linear or branched alkyl group, preferably a C1-C5 linear or branched alkyl group, preferably a methyl group, ethyl group, n-propyl group, isopropyl group, n-butyl group, isobutyl group, t-butyl group, s-butyl group, n-pentyl group, 1-methylbutyl group, 2-methylbutyl group, 3-methylbutyl group, isopentyl group, 1-ethylpropyl group, neopentyl group, n-hexyl group, 1-methylpentyl group, 2-methylpentyl group Selected from 3-methylpentyl group, isohexyl group, 1,1-dimethylbutyl group, 2,2-dimethylbutyl group, 3,3-dimethylbutyl group, 1,2-dimethylbutyl group, 1,3-dimethylbutyl group, 2,3-dimethylbutyl group, 2-ethylbutyl group, n-heptyl group, 2-methylhexyl group, 3-methylhexyl group, 2,2-dimethylpentyl group, 3,3-dimethylpentyl group, 2,3-dimethylpentyl group, 2,4-dimethylpentyl group, 3-ethylpentyl group, or 2,2,3-trimethylbutyl group, The aforementioned "modified alkyl group" is a group in which any carbon atom of the alkyl group is substituted with at least one group selected from a halogen atom, -O-, -OH, -CO-, -SO2-, -(S=O)-, a primary amino group, a secondary amino group, or a tertiary amino group, and the modified alkyl group has 1 to 30 carbon atoms (the modified alkyl group may have 1 to 12 carbon atoms, the modified alkyl group may have 1 to 10 carbon atoms, the modified alkyl group may have 1 to 8 carbon atoms, the modified alkyl group may have 1 to 5 carbon atoms, or the modified alkyl group may have 1 to 2 carbon atoms). The substitution of the carbon atom means that the carbon atom, or the carbon atom and the hydrogen atom bonded to it, is substituted with the corresponding group. The aforementioned "aliphatic heterocycle" is a saturated or unsaturated 4-10 membered monocyclic or polycyclic aliphatic heterocycle having at least one heteroatom selected from N, O, or S in the ring, and if the aliphatic heterocycle has an S atom in the ring, it is -S-, -SO-, or -SO2-, and the aliphatic heterocycle may be substituted with an alkyl group. The aforementioned "aromatic ring" is a monocyclic, fused dicyclic, or fused polycyclic arylene group with 6 to 13 members. The aforementioned "subaromatic heterocycle" is a 5-12 membered monocyclic, fused dicyclic, or fused polycyclic heteroarylene group having at least one heteroatom selected from N, O, S, or Si in the ring. Each of the aforementioned "halogen atoms" is independently selected from F, Cl, Br, and I. The aforementioned "primary amino group" is an RNH2 group, The aforementioned "secondary amino group" is an RNHR' group, The aforementioned "tertiary amino group" is an RNR'R'' group, Each R, R', and R'' is independently a single bond, an alkyl group, an alkylene group, a modified alkyl group, or a modified alkylene group. The aforementioned "alkylene group" is C1~C 10 A linear or branched alkylene group, which may be a C1-C6 linear or branched alkylene group. The aforementioned "modified alkylene group" is C1-C 10 A group in which any carbon atom of an alkyl group (which may be C1 to C6) is substituted with one of the groups selected from -O-, -OH, -CO-, -CS-, and -(S=O)-, wherein substitution of the carbon atom means that the carbon atom, or the carbon atom and the hydrogen atom bonded to it, is substituted with the corresponding group.

[0009] Optionally, the modified alkyl group or modified alkylene group is a group comprising at least one group selected from -OH, -O-, -NH2, ethylene glycol unit (-(CH2CH2O)n-), C1-C8 alkyl group, C1-C8 haloalkyl group (preferably C2-C6 haloalkyl group), C1-C8 alkylcarboxyl group (preferably C2-C6 alkylcarboxyl group), -SO2-NH-, halogen atom, cyano group, and nitro group, where n is 1-30, more preferably 1-10, and more preferably 1-2. The C1-C8 alkyl group may optionally be a methyl group, an ethyl group, a propyl group, or an isopropyl group, and the C1-C8 haloalkyl group may be a trifluoromethyl group, a chloromethyl group, or a bromomethyl group. Optionally, the aliphatic heterocycle may be selected from morpholine, thiomorpholine, and tetrahydropyridine. Optionally, X1 and X2 are each independently substituted with one or more groups selected from a hydroxyl group, a cyano group, a halogen atom, and a carboxyl group. 1-10 It is a linear or branched alkyl group.

[0010] The conjugated system E may be arbitrarily selected from the structures shown in equations (I-2-1) to (I-2-20) below. [ka] Alternatively, the conjugated system E, together with (X1)(X2)N--, forms an aliphatic heterocycle as shown in (I-3-1)~(I-3-4) below. [ka] The electron acceptor A portion is arbitrarily selected from the following equations (I-4-1) to (I-4-43).

[0011] [ka] [ka] Optionally, the fluorescent dye formula (I) is selected from the compounds shown below.

[0012] [ka] [ka] In a second aspect of the present invention, a method for producing the above-mentioned fluorescent dye is provided, characterized by including a synthesis reaction step of reacting a compound of formula (a) with a compound of formula (b) to produce a fluorescent dye represented by formula (I).

[0013] [ka] A third aspect of the present invention provides the use of the above-mentioned fluorescent dye for viscosity measurement, fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids.

[0014] A fourth aspect of the present invention provides the use of the above-mentioned fluorescent dye for producing reagents for viscosity measurement, fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids.

[0015] In a fifth aspect of the present invention, a fluorescence-activated luminescent probe is provided, characterized by containing the above-mentioned fluorescent dye.

[0016] A sixth aspect of the present invention provides the use of the above-mentioned fluorescence-activated luminescence probe for fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids.

[0017] A seventh aspect of the present invention provides the use of the above-mentioned fluorescence-activated luminescence probe for producing reagents for fluorescent labeling of proteins, fluorescent labeling of nucleic acids, quantification or detection of proteins, or quantification or detection of nucleic acids.

[0018] The fluorescent dye according to the present invention has long-wavelength emission (maximum emission wavelength reaches 800 nm). Its fluorescence intensity increases with increasing ambient viscosity, and the logarithmic relationship between fluorescence intensity and solvent viscosity is a very good linear relationship. The relationship between fluorescence intensity and viscosity satisfies the Hoffman equation and has a relatively high gradient, is sensitive to viscosity, has a high excitation factor, and is not sensitive to polarity changes.

[0019] The fluorescent dye according to the present invention can be used to measure the viscosity of a sample, for example, by measuring microviscosity. According to another embodiment, the resulting fluorescent dye can be specifically bound to a corresponding antibody, aptamer, or amyloid protein, or to a protein tag or enzyme via a ligand or inhibitor, thereby obtaining a series of fluorescently activated luminescent probes that can be used for fluorescent labeling, quantification, or monitoring of proteins, enzymes, or nucleic acids. [Brief explanation of the drawing]

[0020] [Figure 1] This is a diagram showing the fluorescence emission intensity of dye dye7 (1 × 10⁻⁵ M) under different viscosity conditions. [Figure 2] This is a linear relationship diagram between the viscosity conditions and fluorescence intensity of the dye dye7 (1 × 10⁻⁵ M). [Figure 3] This is a diagram showing the fluorescence emission intensity of the dye dye9 (1 × 10⁻⁵ M) under different viscosity conditions. [Figure 4] This is a linear relationship diagram between the viscosity conditions and fluorescence intensity of the dye dye9 (1 × 10⁻⁵ M). [Figure 5] This is a diagram showing the fluorescence emission intensity of dye dye12 (1 × 10⁻⁵ M) under different viscosity conditions. [Figure 6] This is a linear relationship diagram between the viscosity conditions and fluorescence intensity of the dye dye12 (1 × 10⁻⁵ M). [Figure 7] This is a diagram showing the fluorescence emission intensity of the dye dye25 (1 × 10⁻⁵ M) under different viscosity conditions. [Figure 8] This is a linear relationship diagram between the viscosity conditions and fluorescence intensity of the dye dye25 (1 × 10⁻⁵ M). [Figure 9] This is a diagram showing the fluorescence emission intensity of dye dye40 (1 × 10⁻⁵ M) under different viscosity conditions. [Figure 10] This is a linear relationship diagram between the viscosity conditions and fluorescence intensity of the dye dye40 (1 × 10⁻⁵ M). [Figure 11] This is a diagram showing the fluorescence emission intensity of the dye dye7 (1 × 10⁻⁵ M) under different polarity conditions. [Figure 12]This is a diagram showing the fluorescence emission intensity of the dye Dye9 (1 × 10⁻⁵ M) under different polarity conditions. [Figure 13] This is a diagram showing the fluorescence emission intensity of the dye dye12 (1 × 10⁻⁵ M) under different polarity conditions. [Figure 14] This is a diagram showing the fluorescence emission intensity of the dye dye25 (1 × 10⁻⁵ M) under different polarity conditions. [Figure 15] This is a diagram showing the fluorescence emission intensity of the dye dye40 (1 × 10⁻⁵ M) under different polarity conditions. [Figure 16] This is a comparison chart of the emission spectra of dyes dye 5 and dye 6. [Figure 17] This is a comparison chart of the emission spectra of dyes dye11, dye12, and dye14. [Figure 18] This is a comparison chart of the emission spectra of dyes dye12 and dye13. [Figure 19] This is the emission spectrum of the dye dye39. [Figure 20] This is the emission spectrum of the dye dye42. [Figure 21] This is a comparison chart of the background fluorescence of dyes dye1 and dye48 in PBS solution. [Figure 22] This is a comparison of the background fluorescence of dyes dye22 and dye49 in PBS solution. [Figure 23] This is a comparison chart of background fluorescence in PBS solutions of dyes dye40 and dye50. [Figure 24] This is a comparison chart of the background fluorescence of dyes dyes dye9, dye10, and dye47 in PBS solutions. [Figure 25] This figure shows the use of dyes dye1, dye12, dye25, and dye41 to label aptamers in cells. [Figure 26] This is flow cytometry in which the dye dye3 is bound to an RNA aptamer. [Figure 27] This is a flow cytometry image showing the dye dye13 bound to an RNA aptamer. [Figure 28] This is a flow cytometry image of the dye dye21 bound to an RNA aptamer. [Figure 29] This is a flow cytometry image of the dye dye34 bound to an RNA aptamer. [Figure 30] This is a flow cytometry image of the dye dye50 bound to an RNA aptamer. [Modes for carrying out the invention]

[0021] The following describes in detail embodiments for carrying out the present invention. It should be understood that the embodiments for carrying out the invention described herein are merely illustrative and do not limit the present invention.

[0022] [ka] compound 1 5-bromothiophene-2-carbaldehyde (0.5 g, 2.6 mmol) and 2-methylaminoethanol (0.78 g, 10.4 mmol) were dissolved in 10 ml of water, heated to 100°C in an oil bath under Ar protection, and reacted overnight to terminate the reaction. After cooling to room temperature, the mixture was extracted three times with dichloromethane, washed with saturated brine, dried over anhydrous sodium sulfate, the organic phase was removed by rotary evaporation, and the residue was subjected to column chromatography to obtain 10.4 g of the compound, with a yield of 84%. 1 H NMR(400MHz,DMSO-d6)δ 9.40(s,1H),7.65(d,J=4.5Hz,1H),6.12(d,J=4.5Hz,1H),3.62(q,J=5.5Hz,2H),3.47(t,J=5.6Hz,2H),3.09(s,3H).

[0023] Dye 1 [ka] Compound 1 (0.2 g, 1.08 mmol) and 3-methylthiazolidine-2,4-dione (0.13 g, 1.30 mmol) were dissolved in 50 mL of absolute ethanol, a catalytic amount of piperidine was added, the mixture was heated to 90 °C in an oil bath under argon protection and reacted for 3 h. After the reaction was completed, the mixture was cooled to room temperature, a large amount of solid precipitated in the system, followed by filtration. The filter cake was washed twice with cold ethanol and vacuum-dried to obtain 0.2 g of a yellow compound dye1, with a yield of 71.4%. 1 H NMR (400 MHz, DMSO-d6) δ 7.71(s,1H),7.43(d,J=4.4Hz,1H),6.15(d,J=4.4Hz,1H),3.62(q,J=5.5Hz,2H),3.46(t,J=5.6Hz,2H),3.20(s,3H), 3.09(s,3H).

[0024] Compound 2

Chemical Formula

[0025] dye2

Chemical Formula

[0026] Compound 3

Chemical Formula

[0027] Dye 3 [ka] Dye 3 The synthesis process for dye3 followed the method for synthesizing dye1, and the yield was 82%. 1 H NMR(400MHz,DMSO-d6)δ 11.71(s,1H),11.56(s,1H),6.98-6.94(m,1H),6.94-6.88(m,1H),6.65(s,1H), 6.57(td,J=7.5,1.2Hz,1H),3.38-3.32(m,2H),3.05-2.80(m,2H),2.69(s,3H).

[0028] Dye 4 [ka] The synthesis method for dye 4 followed the synthesis procedure for dye 1, and the yield was 70%. 1 H NMR(400MHz,DMSO-d6)δ 13.81(s,1H),6.98-6.94(m,1H),6.94-6.88(m,1H),6.65(s,1H),6.57(t d,J=7.5,1.2Hz,1H),3.38-3.32(m,2H),3.05-2.80(m,2H),2.69(s,3H).

[0029] compound 4 [ka] The synthesis method for compound 4 followed the method for compound 3, and the yield was 56%. 1 H NMR(400MHz,DMSO-d6)δ 10.11(s,1H)6.98-6.94(m,1H),6.94-6.88(m,1H),6.57(td,J=7.5,1.2Hz,1H),3.57-3.42(m,2H),3.13-3.00(m,2H),2.87(s,3H).

[0030] Dye 5 [ka] Dye 5 was synthesized using the same method as Dye 1, with a yield of 65.8%. 1H NMR(400MHz,DMSO-d6)δ 11.75(s,1H),7.42(s,1H),7.38-7.15(m,2H),6.82(d,J=8.7Hz,1H),3.76-3.57(m,2H),3.13-3.05(m,2H),3.03(s,3H).

[0031] Dye 6 [ka] compound 4 Dye 6 was synthesized following the method used for synthesizing dye 1, with a yield of 75.8%. 1 H NMR(400MHz,DMSO-d6)δ 13.15(s,1H),7.42(s,1H),7.38-7.15(m,2H),6.82(d,J=8.7Hz,1H),3.76-3.57(m,2H),3.13-3.05(m,2H),3.03(s,3H). [ka] Compound 5 was synthesized using the same method as Compound 3, with a yield of 65.7%. 1 H NMR(400MHz,DMSO-d6)δ 10.21(s,1H),7.33(dd,J=8.8,2.2Hz,1H),7.15(d,J=2.2Hz,1H),6.63(d,J=8.8 Hz,1H),5.47(d,J=1.5Hz,1H),2.87(s,3H),1.96(d,J=1.4Hz,3H),1.34(s,6H). [ka] The dye was synthesized following the method for synthesizing dye 1, with a yield of 84.2%. 1 H NMR(400MHz,DMSO-d6)δ 13.86(s,1H),7.41(s,1H),7.33(dd,J=8.8,2.2Hz,1H),7.15(d,J=2.2Hz,1H),6.63(d ,J=8.8Hz,1H),5.47(d,J=1.5Hz,1H),2.87(s,3H),1.96(d,J=1.4Hz,3H),1.34(s,6H). Dye 8 [ka] Dye 8 was synthesized following the method used for dye 1, with a yield of 80.3%. 1 H NMR(400MHz,DMSO-d6)δ 7.41(s,1H),7.33(dd,J=8.8,2.2Hz,1H),7.15(d,J=2.2Hz,1H),6.63(d,J=8.8Hz,1H),5.47 (d,J=1.5Hz,1H),4.40(m,2H),2.87(s,3H),2.61(m,2H)1.96(d,J=1.4Hz,3H),1.34(s,6H).

[0032] compound 6 [ka] Compound 6 was synthesized using the same method as compound 3, with a yield of 60.7%. 1 H NMR(400MHz,DMSO-d6)δ 10.25(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0033] dye9 [ka] Dye 9 was synthesized using the same method as Dye 1, with a yield of 88.6%. 1 H NMR(400MHz,DMSO-d6)δ 12.21(s,1H),7.31(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0034] dye 10 [ka] Dye 10 was synthesized using the same method as dye 1, with a yield of 82.4%. 1H NMR(400MHz,DMSO-d6)δ 19.21(s,1H),7.31(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0035] Compounds 7, 8 [ka]

[0036] Compound 7: 2-bromothieno[3,2-b]thiophene (0.438 g, 2 mmol) was dissolved in 15 mL of N-methyl-N-hydroxyethylamine, and copper powder (6.4 mg, 0.01 mmol), cuprous iodide (19 mg, 0.01 mmol), and tripotassium phosphate (0.850 g, 4 mmol) were added. The mixture was heated overnight in an 80°C oil bath under Ar protection to complete the reaction, and after cooling to room temperature, the system was poured into 50 mL of water and extracted three times with 50 mL of dichloromethane. The organic phases were combined, the solvent was removed by rotary evaporation, and the mixture was separated by column chromatography to obtain 0.362 g of a yellow product with a yield of 85%. 1 H-NMR (400MHz, CDCl3): δ=7.92(s,1H),7.63(d,1H,J=5.2Hz),7.31(d,1H,J=5.2Hz),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).

[0037] Compound 8: Compound 8 (0.426 g, 2 mmol) was dissolved in 50 ml of anhydrous dichloromethane, 1 ml of triethylamine was added, and acetic anhydride (0.3 ml, 3 mmol) was slowly added dropwise under ice bath conditions. After the addition was complete, the system was slowly heated to room temperature and stirred for 3 hours to terminate the reaction. 100 ml of water was added to separate the organic phase, the aqueous phase was extracted twice with 50 ml of dichloromethane, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was removed by rotary evaporation. The residue was used directly in the next step without further purification.

[0038] The above residue was dissolved in 50 ml of dichloromethane, 5 ml of dimethylformamide was added, and 2 ml of phosphorus oxychloride was added under ice bath conditions. The mixture was stirred for 0.5 hours under Ar protection, the system was slowly heated to room temperature, and the mixture was stirred for another 5 hours to complete the reaction. Saturated sodium carbonate solution was added to adjust the pH to 10.0, and the mixture was stirred overnight at room temperature. The next day, the organic phase was separated, the aqueous phase was extracted three times with 50 ml of dichloromethane, the organic phase was combined, washed twice with saturated brine, the organic phase was dried over anhydrous sodium sulfate, the solvent was removed by rotary evaporation, and the residue was separated by column chromatography to obtain 0.285 g of yellow solid, with a yield of 59%. 1 H-NMR (400MHz, CDCl3): δ=10.01(s,1H),7.92(s,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).

[0039] Dye 11 [ka] Dye 11 was synthesized using the same method as dye 1, with a yield of 78.4%. 1 H-NMR (400MHz, CDCl3): δ=12.01(s,1H),7.57(s,1H),7.92(s,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).

[0040] [ka] Dye 12 was synthesized using the same method as dye 1, with a yield of 78.3%. 1 H-NMR (400MHz, CDCl3): δ=13.25(s,1H),7.57(s,1H),7.92(s,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).

[0041] Dye 13 [ka] Dye 13 was synthesized using the same method as dye 1, with a yield of 87.1%. 1 H-NMR (400MHz, CDCl3): δ=11.35(s,1H),11.25(s,1H),7.87(s,1H),7.92(s ,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).

[0042] dye14 [ka] Dye 14 was synthesized using the same method as dye 1, with a yield of 87.1%. 1 H-NMR (400MHz, CDCl3): δ=18.35(s,1H),6.87(s,1H),7.92(s,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H).

[0043] dye15 [ka] Dye 15 was synthesized using the same method as Dye 1, with a yield of 84.7%. 1 H-NMR (400MHz, CDCl3): δ=7.42(s,1H),7.92(s,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.34(s,3H),3.10(s,3H).

[0044] Dye 16 [ka] Dye 16 was synthesized using the same method as dye 1, with a yield of 82.1%. 1H-NMR (400MHz, CDCl3): δ=6.72(s,1H),7.92(s,1H),7.63(s,1H)3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.52(s,3H),3.10(s,3H).

[0045] dye17 [ka] Dye 17 was synthesized using the same method as Dye 1, with a yield of 82.7%. 1 H-NMR (400MHz, CDCl3): δ=12.03(s,1H),11.41(s,1H)6.72(s,1H),7.92(s,1H),7.63(s,1H),4. 40(m,2H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.52(s,3H),3.10(s,3H),2.62(m,2H).

[0046] Dye 18 [ka]

[0047] compound 9 Compound 9 was synthesized according to the synthesis method described in the literature (Organic & Biomolecular Chemistry, 7(1), 142-154; 2009). ¹H-NMR (400 MHz, CDCl3): δ = 10.05 (s, 1H), 7.57 (s, 1H), 7.92 (s, 1H), 3.95 (m, 4H), 3.45 (m, 8H), 3.10 (s, 3H).

[0048] The dye was synthesized following the method for dye 1, with a yield of 52.3%. ¹H-NMR (400MHz, CDCl3): δ = 8.02 (s, ¹H), 7.57 (s, ¹H), 7.92 (s, ¹H), 3.95 (m, ⁴H), 3.45 (m, ⁸H), 3.25 (s, ⁃H), 3.10 (s, ⁃H).

[0049] Dye 19 [ka]

[0050] compound 10 Compound 10 was synthesized according to the method described in the literature (Journal of Organic Chemistry, 83(15), 8533-8542; 2018) with a yield of 52.1%. ¹H-NMR (400 MHz, CDCl3): δ = 10.15 (s, ¹H), 7.57 (s, ¹H), 7.92 (s, ¹H), 3.10 (s, ³H), 3.08 (m, ²H), 1.58-1.43 (m, ⁸H).

[0051] Dye 19 was synthesized by referring to the synthesis method for dye 1, with a yield of 88.9%. 1 H-NMR (400MHz, CDCl3): δ=8.23(s,1H),7.57(s,1H),7.92(s,1H),3.25(s,3H),3.10(s,3H)3.08(m,2H),1.58-1.43(m,18H).

[0052] Compounds 11, 12, 13 [ka]

[0053] compound 11 Thieno[3,2-b]thiophene (10 g, 71.31 mmol) was added to a 250 ml three-necked flask, dissolved in 120 ml of anhydrous tetrahydrofuran, cooled to -78°C, 49 ml of 1.6 M n-butyllithium was added dropwise to the system, maintained at -78°C for 2 hours, the freezing was stopped, the system was slowly allowed to return to room temperature, stirred overnight, and after the reaction was complete, 40 ml of water was added in an ice bath to stop the reaction, the system was poured into 200 ml of dichloromethane and extracted, the aqueous phase was extracted three times with dichloromethane, the organic phase was dried over anhydrous sodium sulfate, the solvent was removed by rotary evaporation, and the residue was separated by column chromatography to obtain 10.7 g of the compound. The yield was 90%. 1H NMR(400MHz,Chloroform-d)δ 9.97(s,1H),7.94(s,1H),7.70(d,J=5.3Hz,1H),7.33(d,J=5.3Hz,1H).

[0054] compound 12 Compound 11 (10 g, 59.5 mmol) was dissolved in 120 ml of a mixed solvent of dry DMF and acetic acid (1:1), and NBS (11.66 g, 65.5 mmol) was added. Under Ar protection, the mixture was heated to 120°C in an oil bath and refluxed overnight. After the reaction was complete, the mixture was extracted three times with ethyl acetate and water, the organic phase was combined and dried, the solvent was removed by rotary evaporation, and the residue was subjected to column chromatography to obtain 11.2 g of product, with a yield of 78%. 1 H NMR(400MHz,Chloroform-d)δ 10.01(s,1H),7.70(d,J=5.3Hz,1H),7.33(d,J=5.3Hz,1H).

[0055] compound 13 The synthesis method for compound 1 was followed, and the yield was 85%. 1 H NMR(400MHz,DMSO-d6)δ 10.15(s,1H),7.87(s,1H),6.39(s,1H),3.85(t,4H,J=5.6Hz),3.60(t,4H,J=5.6Hz). dye20 [ka] Dye 20 was synthesized using the same method as Dye 1, with a yield of 81.2%. 1 H NMR(400MHz,DMSO-d6)δ 11.15(s,1H),7.64(s,1H),7.57(s,1H),6.59(s,1H),3.85(t,4H,J=5.6Hz),3.60(t,4H,J=5.6Hz).

[0056] dye21 [ka] Dye 21 was synthesized using the same method as Dye 1, with a yield of 82.5%. 1 H NMR(400MHz,DMSO-d6)δ 11.35(s,1H),7.64(s,1H),7.57(s,1H),6.59(s,1H),3.85(t,4H,J=5.6Hz),3.60(t,4H,J=5.6Hz).

[0057] Compounds 12, 13 [ka]

[0058] Compounds 14, 15 Compounds 14 and 15 were synthesized using the same methods as those for compounds 7 and 8, with a yield of 50.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz ,1H),6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H).

[0059] [ka] Dye 22 was synthesized using the same method as Dye 1, with a yield of 90.1%. 1 H-NMR (400MHz, CDCl3): δ=12.31(s,1H),7.86(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J =2.0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H).

[0060] dye23 [ka]

[0061] compound 16 Compound 16 was synthesized by referring to the synthesis method described in the literature (Journal of the American Chemical Society, 137(43), 13768-13771; 2015). 1 H-NMR (400MHz, CDCl3): δ=10.31(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H), 6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H),2.91(s,3H).

[0062] Dye 23 was synthesized using the same method as Dye 1, with a yield of 79.5%. 1 H-NMR (400MHz, CDCl3): δ=8.02(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H), 6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H),2.91(s,3H).

[0063] dye24 [ka]

[0064] compound 17 Compound 17 was synthesized by referring to the synthesis method described in the literature (Journal of the American Chemical Society, 131(5), 1766-1774; 2009). 1 H-NMR (400MHz, CDCl3): δ=10.31(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H), 6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H),2.21(s,6H).

[0065] Dye 24 was synthesized using the same method as Dye 1, with a yield of 68.5%. 1 H-NMR (400MHz, CDCl3): δ=12.28(s,1H),8.31(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0H z,1H),6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H),2.21(s,6H).

[0066] compound 18 [ka]

[0067] compound 18 Compound 18 was synthesized following the method used for compound 15. 1 H-NMR (400MHz, CDCl3): δ=10.58(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),2.68(s,3H).

[0068] dye25 [ka]

[0069] Dye 25 was synthesized using the same method as Dye 1, with a yield of 70.0%. 1 H-NMR (400MHz, CDCl3): δ=8.58(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H), 6.92(d,J=2.0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),3.21(s,3H),2.68(s,3H).

[0070] dye26 [ka]

[0071] compound 19 Compound 19 was synthesized by referring to the synthesis method described in the literature (Organic Letters, 14(24), 6366-6369; 2012). 1 H-NMR (400MHz, CDCl3): δ=10.05(s,1H),7.98(s,1H),7.81(d,J=2.0Hz,1H),7.68(d,J=9.0Hz,1H),6.92 (d,J=2.0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H).

[0072] Dye 26 was synthesized using the same method as Dye 17, with a yield of 70.0%. 1 H-NMR (400MHz, CDCl3): δ=8.55(s,1H),7.98(s,1H),7.81(d,J=2.0Hz,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2 .0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H),3.10(s,1H).

[0073] [ka]

[0074] compound 20 Compound 20 was synthesized using the same method as compound 8, with a yield of 30.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.75(d,J=9.0Hz,1H),6.52(d,J=2.0Hz,1H), 6.42(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,3H),3.34(t,J=8.0Hz,3H),3.21(s,3H).

[0075] dye27 [ka]

[0076] Dye 27 was synthesized using the same method as Dye 1, with a yield of 65.9%. 1 H-NMR (400MHz, CDCl3): δ=11.28(s,1H),7.84(s,1H),7.75(d,J=9.0Hz,1H),6.52(d,J=2.0H z,1H),6.42(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,3H),3.34(t,J=8.0Hz,3H),3.21(s,3H).

[0077] [ka]

[0078] compound 21 Compound 21 was synthesized using the same method as compound 8, with a yield of 30.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.21(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz ,1H),6.82(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,2H),3.34(t,J=8.0Hz,2H),3.21(s,3H).

[0079] dye28

[0080] [ka] Dye 28 was synthesized using the same method as Dye 1, with a yield of 65.9%. 1 H-NMR (400MHz, CDCl3): δ=7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H),6.82(d,J=9.1,2.3 Hz,1H),3.61(t,J=8.0Hz,3H),3.60(q,J=5.5Hz,2H),3.34(t,J=8.0Hz,3H),3.21(s,3H),1.2(t,J=7.1Hz 3H). [ka]

[0081] compound 22 Compound 22 was synthesized using the same method as for compound 8, with a yield of 30.4%. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.75(d,J=9.0Hz,1H),6.52(d,J=2.0Hz,1H), 6.42(d,J=9.1,2.3Hz,1H),3.61(t,J=8.0Hz,3H),3.34(t,J=8.0Hz,3H),3.21(s,3H).

[0082] dye29 [ka]

[0083] Dye 29 was synthesized using the same method as dye 1, with a yield of 55.1%. 1 H-NMR (400MHz, CDCl3): δ=7.75(d,J=9.0Hz,1H),6.52(d,J=2.0Hz,1H),6.42(d,J=9. 1,2.3Hz,1H),3.61(t,J=8.0Hz,3H),3.34(t,J=8.0Hz,3H),3.21(s,3H),3.10(s,3H).

[0084] compound 23 [ka]

[0085] compound 23 Compound 23 was synthesized using the same method as compound 11, with a yield of 54.2%. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),3.21(s,6H). dye30 [ka]

[0086] Dye 30 was synthesized using the same method as that used for compound dye 1, with a yield of 45.2%. 1 H-NMR (400MHz, CDCl3): δ=8.01(s,1H),7.81(s,1H),7.68(d,J=9.0Hz,1H),6.92(d,J=2.0Hz,1H),6.82(d,J=9.1,2.3Hz,1H),3.21(s,6H).

[0087] compound 24 [ka]

[0088] compound 24 Compound 24 was synthesized using the same method as compound 11, with a yield of 58.2%. 1 H-NMR (400MHz, CDCl3): δ=9.91(s,1H),7.80(s,1H),7.65(d,J=9.1Hz,1H),6.98(d,J=2.1Hz,1H),6.85(d,J=9.0,2.3Hz,1H),3.21(s,6H).

[0089] Dye 31 [ka] Dye 31 was synthesized using the same method as that used for compound dye 1, with a yield of 80.2%. 1 H-NMR (400MHz, CDCl3): δ=8.03(s,1H),7.80(s,1H),7.65(d,J=9.0Hz,1H),6.98( d,J=2.0Hz,1H),6.85(d,J=9.1,2.3Hz,1H),4.44(m,2H),3.21(s,6H)2.62(m,2H).

[0090] dye32 [ka]

[0091] The synthesis method for compound dye1 was followed, and the yield was 50.2%. 1 H-NMR (400MHz, CDCl3): δ=7.83(s,1H),7.80(s,1H),7.65(d,J=9.0Hz,1H),6.98(d,J=2.0Hz,1H),6.85(d,J=9.1,2.3Hz,1H),3.21(s,6H). compound 25 [ka]

[0092] compound 25 Compound 25 was synthesized using the same method as compound 11, with a yield of 45.2%. 1 H-NMR (400MHz, CDCl3): δ=7.88(s,1H),7.65(d,J=9.1Hz,1H),6.98(d,J=2.1Hz,1H),6.85(d,J=9.0,2.3Hz,1H),3.21(s,6H).

[0093] Dye 33 [ka] Dye 33 was synthesized using the same method as that used for compound dye 1, with a yield of 60.2%. 1 H-NMR (400MHz, CDCl3): δ=8.01(s,1H),7.65(d,J=9.1Hz,1H),6.98(d,J=2.1Hz,1H),6.85(d,J=9.0,2.3Hz,1H),3.21(s,6H).

[0094] Dye 34 [ka]

[0095] Compound 26: The synthesis was performed by referring to the method described in the literature (Chemistry-A European Journal, 22(30), 10627-10637; 2016). 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.82(s,1H),7.71(m,1H),7.60(m,2H),6. 78(s,2H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H)

[0096] Dye 34 was synthesized using the same method as that used for compound dye 1, with a yield of 50.8%. 1 H-NMR (400MHz, CDCl3): δ=11.21(s,1H),7.92(s,1H),7.82(s,1H),7.71(m,1H),7.60(m, 2H),6.78(s,2H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H)

[0097] Dye 35 [ka]

[0098] Dye 35 was synthesized using the same method as that used for compound dye 1, with a yield of 47.8%. 1 H-NMR (400MHz, CDCl3): δ=11.28(s,1H),7.84(s,1H),7.82(s,1H),7.71(m,1H),7.60(m, 2H),6.78(s,2H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H)

[0099] Dye 36 [ka]

[0100] compound 27 The method for synthesizing compound 26 was referenced. 1H NMR(400MHz,CDCl3):10.0(s,1H),8.0(s,1H),7.96-7.98(t,1H),7.89-7.90(t,1 H),7.47-7.49(m,1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H), Dye 36 was synthesized using the same method as that used for compound dye 1, with a yield of 49.7%. 1 H NMR(400MHz, CDCl3):11.28(s,1H),8.04(s,1H),8.0(s,1H),7.96-7.98(t,1H),7.89-7. 90(t,1H),7.47-7.49(m,1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),

[0101] Dye 37 [ka]

[0102] compound 28 The method for synthesizing compound 26 was referenced. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.82(s,1H),7.71(s,1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H) Dye 37 was synthesized using the same method as that used for compound dye 1, with a yield of 59.6%. 1 H-NMR (400MHz, CDCl3): δ=10.28(s,1H),8.05(s,1H),7.82(s,1H),7.71(s, 1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H).

[0103] Dye 38 [ka]

[0104] compound 29 The method for synthesizing compound 26 was referenced. 1 H-NMR (400MHz, CDCl3): δ=9.92(s,1H),7.82(s,1H),7.71(s,1H),7.67(s,1H),7. 50(s,1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H) Dye 38 was synthesized using the same method as that used for compound dye 1, with a yield of 49.6%. 1 H-NMR (400MHz, CDCl3): δ=11.01(s,1H),8.04(s,1H),7.82(s,1H),7.71(s,1H),7.67(s, 1H),7.50(s,1H),3.82(t,2H,J=5.6Hz),3.54(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H)

[0105] dye39 [ka]

[0106] compound 30 It was obtained by referring to the synthesis method described in the literature (Chemistry of Materials, 31(21), 8810-8819; 2019). 1 H-NMR(400MHz,DMSO-d6):δ=10.18(s,1H),7.48(s,1H),7.41(s,1H),7.32(m ,2H),3.69(t,J=4.9Hz,2H),3.12(t,J=4.9Hz,2H),3.10(s,3H),1.48(s,6H) Dye 39 was synthesized using the same method as that used for compound dye 1, with a yield of 58.2%. 1 H-NMR(400MHz,DMSO-d6):δ=14.28(s,1H),7.95(s,1H),7.48(s,1H),7.41(s,1H), 7.32(m,2H),3.69(t,J=4.9Hz,2H),3.12(t,J=4.9Hz,2H),3.10(s,3H),1.48(s,6H)

[0107] dye40 [ka]

[0108] Dye 40 was synthesized using the same method as that used for compound dye 1, with a yield of 69.2%. 1 H-NMR(400MHz,DMSO-d6):δ=7.95(s,1H),7.48(s,1H),7.41(s,1H),7.32(m,2H),3 .69(t,J=4.9Hz,2H),3.12(t,J=4.9Hz,2H),3.21(s,3H),3.10(s,3H),1.48(s,6H) dye41 [ka]

[0109] compound 32 The synthesis was performed by referring to the method described in the literature (Journal of Organic Chemistry, 73(17), 6587-6594; 2008). 1 H-NMR (400MHz, DMSO-d6): δ=10.18(s,1H),7.89(s,1H),7.18(s,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H). Dye 41 was synthesized using the same method as that used for compound dye 1, with a yield of 56.6%. 1 H-NMR(400MHz,DMSO-d6):δ=12.58(s,1H),8.01(s,1H),7.89(s,1H),7.18(s ,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H).

[0110] dye42 [ka]

[0111] For dye42, the synthesis method of compound dye1 was referred to, and the yield was 38.2%. 1 H-NMR (400 MHz, DMSO-d6): δ=8.01(s,1H),7.89(s,1H),7.18(s,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.50(s,6H). dye43

Chemical Formula

[0112] Compound 33 Compound 33 was synthesized with reference to the synthesis method of compound 26. 1 H-NMR (400 MHz, DMSO-d6): δ=10.18(s,1H),7.89(s,1H),7.36(s,2H),7.18(s,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz)3.10(s,1H). For dye43, the synthesis method of compound dye1 was referred to, and the yield was 78.2%. 1H-NMR (400 MHz, DMSO-d6): δ=12.09(s,1H),8.28(s,1H),7.89(s,1H),7.36(s,2H),7.18(s,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz)3.10(s,1H).

[0113] dye44

Chemical Formula

[0114] Compound 34: Compound 34 was synthesized with reference to the synthesis method described in Zhu, Linyong et al., PCT Int. Appl., 2019218876, 21 Nov 2019. 1H-NMR (400 MHz, CDCl₃): δ=9.74(s,1H),7.76(d,1H),7.60(s,1H),7.03(d,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H).

[0115] Dye44 was synthesized with reference to the synthesis method for compound dye1. 1 H-NMR (400 MHz, CDCl₃): δ=11.24(s,1H),8.02(s,1H),7.76(d,1H),7.60(s,1H),7.03(d,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H).

[0116] dye45 [Chem.]

[0117] Dye45 was synthesized with reference to the synthesis method for dye1. 1 H-NMR (400 MHz, CDCl₃): δ=13.08(s,1H),8.05(s,1H),7.76(d,1H),7.60(s,1H),7.03(d,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H).

[0118] dye46 [Chem.]

[0119] Dye46 was synthesized with reference to the synthesis method for dye1. 1 H-NMR (400 MHz, CDCl₃): δ=15.56(s,1H),8.08(s,1H),7.76(d,1H),7.60(s,1H),7.03(d,1H),3.85(t,2H,J=5.6Hz),3.60(t,2H,J=5.6Hz),3.10(s,3H),1.42(s,6H).

[0120] Comparative Examples Dye 47 [ka] Dye 47 was synthesized by referring to the method described in the literature (European Journal of Organic Chemistry, 2011(25), 4773-4787). 1 H NMR(400MHz,DMSO-d6)δ 19.21(s,1H),7.31(s,1H),6.95(s,2H),3.25(dd,J=6.6,4.9Hz,4H),2.68(t,J=6.3Hz,4H),2.05-1.57(m,4H).

[0121] Dye 48 [ka] Dye 48 was synthesized by referring to the method described in the literature (J.Am.Chem.Soc.2020,142,17515-17523). 1 H-NMR(400MHz,Chloroform-d)δ 8.07(d,J=8.9Hz,2H),7.11(s,1H),6.70(d,J=8.8Hz,2H),4.29(s,3H),3.05(s,6H),2.31(s,3H).

[0122] dye 49 [ka] Dye 49 was synthesized by referring to the method described in the literature (J.Am.Chem.Soc.2020,142,17515-17523). 1H-NMR (400 MHz, Chloroform-d) δ 8.19 (d, J=8.6 Hz, 2H), 7.97 (d, J=15.6 Hz, 1H), 7.48 (d, J=8.7, 2H), 7.12 (s, 1H), 6.75 (d, J=8.6, 2H), 6.70 (d, J=8.6, 2H), 6.42 (d, J=15.6 Hz, 1H), 4.45 (s, 2H), 3.07 (s, 6H), 3.05 (s, 6H), 1.49 (m, 9H).

[0123] dye50

Chemical Formula

[0124] Test Example 1 Each of the fluorescent dyes (molecular rotors) produced in Examples dye1 to dye42 was dissolved in dimethyl sulfoxide to a concentration of 1×10 -2 M stock solution was prepared respectively, each stock solution was added to glycerin and methanol separately, and mixed uniformly to prepare a solution with a final concentration of 1×10 -5 M. According to the respective fluorescent dye, the fluorescence emission spectrum was measured sequentially under the same conditions using the maximum excitation wavelength of each fluorescent dye. The results are shown in Table 1, and it was found that the fluorescent dye of the present invention has long-wavelength luminescent fluorescence and is sensitive to viscosity changes.

[0125]

Table 1(1)

Table 1(2)

[0126] Test Example 2 Each of the dyes dye7, dye9, Dyedye12, dye25, and dye40 is added to the following mixed solutions of glycerin and ethylene glycol with viscosities of 16.4 cp (volume ratio of glycerin is 0%), 29.8 cp (volume ratio of glycerin is 20%), 64.5 cp (volume ratio of glycerin is 40%), 143.5 cp (volume ratio of glycerin is 60%), 377.0 cp (volume ratio of glycerin is 80%), and 946.0 cp (volume ratio of glycerin is 100%), so that the final concentration is 1×10 -5 M solution is prepared, and the fluorescence emission spectra under different viscosity conditions are shown in Figures 1, 3, 5, 7, and 9. The emission wavelengths of the above molecular rotors are 620 nm, 576 nm, 650 nm, 670 nm, and 720 nm, respectively. The results show that the fluorescence intensity of the fluorescent dye at the same concentration increases as the environmental viscosity rises. The logarithmic relationship between the logarithm of fluorescence intensity and the solvent viscosity satisfies the Hoffman equation, presents a very good linear relationship, and has a relatively high slope. As shown in Figures 2, 4, 6, 8, and 10, it is verified that the above dyes are sensitive to viscosity response and can be used for viscosity measurement of unknown samples.

[0127] When each of the dyes dye7, dye9, dye12, dye25, and dye40 is dissolved in solvents of different polarities (toluene, ethyl acetate, methanol, acetonitrile, dimethyl sulfoxide) for measurement, as shown in Figures 11, 12, 13, 14, and 15, the fluorescence intensity is all very weak and does not change with the polarity change of the solvent.

[0128] According to the above results, the fluorescent dye of the present invention has relatively excellent specificity for viscosity environments, and can reduce non-specific fluorescence caused by polarity response.

[0129] Test Example 3 Dyes dye5, dye6, dye11, dye12, dye13, dye14, dye39, and dye42 are added to glycerin to a final concentration of 1×10 -5A solution of M was prepared, and a fluorescent dye was excited at the corresponding maximum excitation wavelength to obtain emission spectra. A portion of these emission spectra was normalized. Comparing the emission spectra of dyes dyes dye5 and dye6, as shown in Figure 16, the wavelength increased by approximately 50 nm when the oxycarbonyl group in the electron-withdrawing moiety was replaced with a thiocarbonyl group. Comparing the emission spectra of dyes dye11, dye12, and dye14, as shown in Figure 17, it was found that this wavelength increase effect could be superimposed. Comparing the emission spectra of dyes dye12 and dye13, as shown in Figure 18, when the sulfur atom in the electron-withdrawing 5-membered ring is replaced with a nitrogen atom, the wavelength is shortened by 20 nm. This demonstrates that the emission wavelength of the above dye can be achieved very easily by changing just one atom in the structure. This ensures that the dye structure does not change significantly (so that water solubility and membrane permeability do not change significantly), while enabling spectral adjustment. Furthermore, this wavelength adjustment mechanism allows the maximum emission wavelength of the dye to be set to over 800 nm, which is very advantageous for the application of the dye to biological imaging, as shown in Figures 19 and 20.

[0130] Test Example 4 When dyes dye1 and dye48, dye22 and dye49, dye40 and dye50, and dye9, dye10, and dye47 are added to PBS, the final concentration is 1 × 10⁻⁶. -5 Solutions of M were prepared, the dyes were excited at the corresponding maximum excitation wavelengths, and their fluorescence in PBS was measured. The maximum fluorescence intensity of each set of samples was normalized to 100 and is shown in Figures 21, 22, 23, and 24. The results show that, compared to fluorescent dyes reported in the literature, the fluorescent dyes of the present invention have lower background fluorescence due to the presence of a special electron-withdrawing group structure.

[0131] Test Example 5 Using a stable cell line (293T / 17) and control cells (293T / 17) that continuously express the RNA aptamer (UUGCCAUGUGUAUGUGGGUUCGCCCACAUACUCUGAUGAUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCUUCGGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGAUCAUUCAUGGCAA), under general mammalian cell culture conditions (37°C, 5% carbon dioxide, 100% relative humidity), After the cells reached 90% confluence, the initial cell medium was replaced with cell medium containing 2 μM of dyes dyes dye1, dye12, dye25, and dye41, and incubated for 10 minutes (37°C, 5% carbon dioxide, 100% relative humidity). Observation using a confocal microscope at the corresponding wavelength of the dyes revealed that the dyes emitted almost no fluorescence before binding, but fluorescence was significantly excited after binding. Furthermore, the compounds were able to bind to proteins in the cells, and as shown in Figure 25, cells expressing the aptamers emitted bright fluorescence, while cells not expressing the aptamers did not. This indicates that the dyes of the present invention have excellent cell membrane permeability and can be used to label aptamers in living cells.

[0132] Test Example 6 Using a stable cell line (293T / 17) and control cells (293T / 17) that continuously express the RNA aptamer (UUGCCAUGUGUAUGUGGGUUCGCCCACAUACUCUGAUGAUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCGGUGUAGUAGGUCCUUCGGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGACCGGAAGAAUUGAUCUCGGCCGGAUCAUUCAUGGCAA), under general mammalian cell culture conditions (37°C, 5% carbon dioxide, 100% relative humidity), the cells were grown to 90% confluence, then digested, centrifuged at 800 rpm, and extracted to 1 μM. Cells were resuspended in PBS containing dye1, dye12, dye25, and dye41 molecules and incubated for 5 minutes. Fluid measurements were then performed, and the results are shown in flow cytometry Figures 26-29. The background of the dyes was very low before dye3, dye13, dye21, and dye34 bound, and fluorescence was significantly excited after binding. Furthermore, the dyes bound to RNA aptamers in the cells and emitted bright fluorescence, but did not excite nonspecific fluorescence. Therefore, the fluorescent dyes of the present invention have very low background fluorescence and very low nonspecific fluorescence in cells and can be used to label biomacromolecules with low abundance, such as nucleic acids. In contrast, dye50 has clear background fluorescence and, as shown in Figure 30, is not suitable for labeling biomacromolecules with low abundance, such as nucleic acids.

Claims

1. A fluorescent dye comprising an electron donor portion D, a conjugated system E, and an electron acceptor portion A, wherein the fluorescent dye is represented by formula (I), 【Chemistry 1】 The electronic donor portion - D is (X １ ) (X ２ ) N- and X １ , X ２ These are independently selected from hydrogen, alkyl groups, or modified alkyl groups. The conjugated system E is selected from the structures shown in the following equations (I-2-3), (I-2-4), (I-2-6), (I-2-7), (I-2-9), (I-2-11) to (I-2-15), 【Chemistry 2】 Alternatively, the conjugated system E is (X １ ) (X ２ Together with N-, it forms the group shown in (I-3-1) below, 【Transformation 3】 The electron acceptor portion A has a cyclic structure as shown in formula (I-1) below, 【Chemistry 4】 During the ceremony, R １ is independently selected from -O-, -S-, and -(NR ａ )-, wherein R ａ is hydrogen, R ２ These are independently selected from =O and =S. R ３ These are independently selected from =O and =S. X is independently selected from hydrogen and alkyl groups. However, the aforementioned "alkyl group" is C １ ~C １０ It is a linear or branched alkyl group, The aforementioned "modified alkyl group" is defined as an alkyl group in which any carbon atom is a halogen atom, -O-, -OH, or -SO ２ -, -(S=O)-, RNH ２ The group is substituted with at least one group selected from RNHR' or RNR'R'', and the modified alkyl group has 1 to 12 carbon atoms. The substitution of the carbon atom means that the carbon atom, or the carbon atom and the hydrogen atom bonded to it, is substituted with the corresponding group. Each of the aforementioned "halogen atoms" is independently selected from F, Cl, Br, and I. Each R is a single bond, Each R' and R'' is independently a single bond or alkyl group in the fluorescent dye.

2. The fluorescent dye according to claim 1, characterized in that the electron acceptor A portion is one selected from the following formulas (I-4-1) to (I-4-3), (I-4-7) to (I-4-10), (I-4-13) to (I-4-15), (I-4-19) to (I-4-24), (I-4-31) to (I-4-36). 【Transformation 5】

3. A fluorescent dye represented by formula (I), comprising an electron donor portion D, a conjugated system E, and an electron acceptor portion, 【Transformation 6】 A fluorescent dye characterized by being selected from the compounds shown in the following formula. 【Chemistry 7(1)】 【Chemistry 7(2)】

4. A method for producing a fluorescent dye according to any one of claims 1 to 3, comprising a synthesis reaction step of reacting a compound of formula (a) with a compound of formula (b) to produce a fluorescent dye represented by formula (I), 【Transformation 8】 A method for producing a fluorescent dye, characterized in that the definitions of each group in formula (a), formula (b), and formula (I) are as described in any one of claims 1 to 3.

5. A fluorescent dye according to any one of claims 1 to 3, used in the manufacture of a viscosity measuring reagent, a fluorescent labeling reagent for proteins, a fluorescent labeling reagent for nucleic acids, a reagent for the quantitative determination or detection of proteins, or a reagent for the quantitative determination or detection of nucleic acids.

6. A fluorescence-activated luminescent probe characterized by containing the fluorescent dye described in any one of claims 1 to 3.

7. A fluorescence-activated luminescent probe according to claim 6, used in the manufacture of a fluorescent labeling reagent for proteins, a fluorescent labeling reagent for nucleic acids, a reagent for the quantification or detection of proteins, or a reagent for the quantification or detection of nucleic acids.

Images