Nitro compound detection element

Abstract

The present invention addresses the problem of providing a nitro compound detection technique, and solves this problem by providing a nitro compound detection element that is formed from a specific type of insect olfactory receptor, or an insect olfactory receptor to which a specific mutation has been introduced.

Description

[Technical Field]

[0001] This disclosure relates to a nitro compound detection element, etc. [Background technology]

[0002] Many nitro compounds are explosive, and the development of detection technologies for them is needed. It is known that organisms such as dogs can recognize nitro compounds, and olfactory receptor genes in mammals (mice, rats) have been identified as biological factors involved in this recognition (Non-Patent Literature 1).

[0003] On the other hand, in recent years, the olfactory function of insects has been recognized as having high specificity in recognizing odor molecules, and its use in olfactory sensors and other applications is being explored. Insect olfactory organs contain olfactory receptor complexes formed by olfactory receptors that recognize odor molecules and olfactory receptor coreceptors. When activated by odor molecules, these complexes exhibit ion channel activity, thereby detecting the odor molecules. However, it is not known that insect olfactory receptors can detect nitro compounds. [Prior art documents] [Patent Documents]

[0004] [Patent Document 1] Japanese Patent Publication No. 2013-27376 [Patent Document 2] Japanese Patent Publication No. 2018-59786 [Patent Document 3] Japanese Patent Publication No. 2012-78351 [Non-patent literature]

[0005] [Non-Patent Document 1] Li J, Haddad R, Chen S, Santos V, Luetje CW. A broadly tuned mouse odorant receptor that detects nitrotoluenes.J Neurochem. 2012 Jun;121(6):881-890. [Overview of the Initiative] [Problems that the invention aims to solve]

[0006] The objective of this disclosure is to provide a technology for detecting nitro compounds. [Means for solving the problem]

[0007] In view of the above problems, the inventors diligently conducted research and found that insect olfactory receptors of a specific type, or those with specific mutations introduced, are responsive to nitro compounds. Based on this finding, the inventors furthered their research and completed the invention of this disclosure. That is, this disclosure encompasses the following aspects.

[0008] Item 1. (1) Amino acid sequence 1C is formed by a mutation in amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 80% or more identity with amino acid sequence 1A, wherein mutation 1a: includes a deletion of part or all of the region of the first extracellular loop; (2) Amino acid sequence 2C is formed by a mutation in amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 80% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B; (3) Amino acid sequence 3C, which is formed by mutations in amino acid sequence 3A shown in Sequence ID No. 3 or amino acid sequence 3B having 80% or more identity with amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in amino acid sequence 3A or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop; (4) Amino acid sequence 4C obtained by mutating amino acid sequence 4A shown in Sequence ID No. 4 or amino acid sequence 4B having 80% or more identity with amino acid sequence 4A, wherein mutation 4a: contains substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in amino acid sequence 4A, or substitution 4ay corresponding to substitution 4ax in amino acid sequence 4B; or (5) Amino acid sequence 5C obtained by mutation of amino acid sequence 5A shown in Sequence ID No. 5 or amino acid sequence 5B having 80% or more identity with amino acid sequence 5A, wherein mutation 5a: includes the substitution 5ax of amino acid L178 in amino acid sequence 5A or the substitution 5ay corresponding to the substitution 5ax in amino acid sequence 5B. A nitro compound detection element consisting of olfactory receptor proteins containing [specific components].

[0009] Item 1A. (1) Amino acid sequence 1C is formed by a mutation in amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 80% or more identity with amino acid sequence 1A, wherein mutation 1a: includes a deletion of part or all of the first extracellular loop region; (2) Amino acid sequence 2C is formed by a mutation in amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 80% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B; (3) Amino acid sequence 3C, which is formed by mutations in amino acid sequence 3A shown in Sequence ID No. 3 or amino acid sequence 3B having 80% or more identity with amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in amino acid sequence 3A or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop; (4) Amino acid sequence 4C obtained by mutating amino acid sequence 4A shown in Sequence ID No. 4 or amino acid sequence 4B having 80% or more identity with amino acid sequence 4A, wherein mutation 4a: contains substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in amino acid sequence 4A, or substitution 4ay corresponding to substitution 4ax in amino acid sequence 4B; or (5) Amino acid sequence 5C obtained by mutation of amino acid sequence 5A shown in Sequence ID No. 5 or amino acid sequence 5B having 80% or more identity with amino acid sequence 5A, wherein mutation 5a: includes the substitution 5ax of amino acid L178 in amino acid sequence 5A or the substitution 5ay corresponding to the substitution 5ax in amino acid sequence 5B. Use of olfactory receptor proteins, including those mentioned above, as nitro compound detection elements.

[0010] Item 1B. (1) Amino acid sequence 1C is formed by a mutation in amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 80% or more identity with amino acid sequence 1A, wherein mutation 1a: includes a deletion of part or all of the first extracellular loop region; (2) Amino acid sequence 2C is formed by a mutation in amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 80% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B; (3) Amino acid sequence 3C, which is formed by mutations in amino acid sequence 3A shown in Sequence ID No. 3 or amino acid sequence 3B having 80% or more identity with amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in amino acid sequence 3A or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop; (4) Amino acid sequence 4C obtained by mutating amino acid sequence 4A shown in Sequence ID No. 4 or amino acid sequence 4B having 80% or more identity with amino acid sequence 4A, wherein mutation 4a: contains substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in amino acid sequence 4A, or substitution 4ay corresponding to substitution 4ax in amino acid sequence 4B; or (5) Amino acid sequence 5C obtained by mutation of amino acid sequence 5A shown in Sequence ID No. 5 or amino acid sequence 5B having 80% or more identity with amino acid sequence 5A, wherein mutation 5a: includes the substitution 5ax of amino acid L178 in amino acid sequence 5A or the substitution 5ay corresponding to the substitution 5ax in amino acid sequence 5B. Use of olfactory receptor proteins, including those mentioned above, for the manufacture of nitro compound detection elements.

[0011] Item 2. The deletion region in mutation 1a is a region from the N-terminal amino acid to 5-30 amino acids; In mutation 2a, the mutated amino acid of L60 is proline, the mutated amino acid of M138 is a branched-chain amino acid, and / or the mutated amino acid of A152 is a hydrophilic neutral amino acid; In mutation 3a, the amino acid after mutation S114 is an aliphatic amino acid, the amino acid after mutation A120 is an acidic amino acid, the amino acid after mutation H162 is an aromatic amino acid, the amino acid after mutation V186 is an aliphatic amino acid, the amino acid after mutation V352 is a sulfur-containing amino acid, and the amino acid after mutation S368 is proline; the number of said substitutions to uncharged amino acids in said mutation 3b is 6 to 18; the mutated amino acid at M61 in said mutation 4a is a hydrophilic neutral amino acid, the mutated amino acid at C104 is a basic amino acid, the mutated amino acid at R112 is a hydrophilic neutral amino acid, the mutated amino acid at G181 is an aliphatic amino acid, the mutated amino acid at V189 is a branched-chain amino acid, and the mutated amino acid at I327 is a branched-chain amino acid; the mutated amino acid at L178 in said mutation 5a is proline, The nitro compound detection element according to Item 1.

[0012] Item 3. The deletion region in said mutation 1a is a region of 15 to 25 amino acids from the N-terminal amino acid; the mutated amino acid at L60 in said mutation 2a is proline, the mutated amino acid at M138 is isoleucine, and / or the mutated amino acid at A152 is threonine; the mutated amino acid at S114 in said mutation 3a is alanine, the mutated amino acid at A120 is glutamic acid, the mutated amino acid at H162 is tyrosine, the mutated amino acid at V186 is alanine, the mutated amino acid at V352 is methionine, and the mutated amino acid at S368 is proline; the number of said substitutions to uncharged amino acids in said mutation 3b is 8 to 14; the mutated amino acid at M61 in said mutation 4a is threonine, the mutated amino acid at C104 is arginine, the mutated amino acid at R112 is glutamine, the mutated amino acid at G181 is alanine, the mutated amino acid at V189 is isoleucine, and the mutated amino acid at I327 is valine; the mutated amino acid at L178 in said mutation 5a is proline, The nitro compound detection element according to Item 1 or 2.

[0013] Item 4. The nitro compound detection element according to any one of items 1 to 3, wherein the nitro compound is a compound having a structure in which a nitro group is directly linked to a benzene ring, and / or a compound containing two or more nitro groups.

[0014] Item 5. The olfactory receptor protein, The general formula in the corresponding wild-type olfactory receptor protein (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 [In the formula, X1-X6 and Z1-Z3 represent amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ1 represents a hydrophobic amino acid, φ2-φ7 each independently represent an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid.] It includes an amino acid sequence B which is formed by a mutation of the amino acid sequence A shown, Conditions 1-3 below: (Condition 1) In the amino acid sequence B, X3 and / or X4 are substituted, and X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. (Condition 2) If both X5 and X6 are positively charged polar amino acids in amino acid sequence A, then in amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid, and (Condition 3) If one or both of X1 and X2 are positively charged polar amino acids in amino acid sequence A, then in amino acid sequence B, X1 and / or X2 are substituted, and X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. Selected from the group consisting of, satisfying at least one condition, A nitro compound detection element as described in any of items 1 to 4.

[0015] Item 6. (1) Amino acid sequence 1C is formed by a mutation in amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 80% or more identity with amino acid sequence 1A, wherein mutation 1a: includes a deletion of part or all of the region of the first extracellular loop; (2) Amino acid sequence 2C is formed by a mutation in amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 80% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B; (3) Amino acid sequence 3C, which is formed by a mutation in amino acid sequence 3A shown in Sequence ID No. 3 or amino acid sequence 3B having 80% or more identity with amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in amino acid sequence 3A or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop; or (4) Amino acid sequence 4C is formed by a mutation in amino acid sequence 4A shown in Sequence ID No. 4 or amino acid sequence 4B having 80% or more identity with amino acid sequence 4A, wherein mutation 4a: contains substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in amino acid sequence 4A, or substitution 4ay corresponding to substitution 4ax in amino acid sequence 4B. Olfactory receptor proteins, including those mentioned above.

[0016] Item 7. A polynucleotide containing the coding sequence for the olfactory receptor protein described in Item 6.

[0017] Item 8. Cells containing the polynucleotides described in Item 7.

[0018] Item 9. Non-human animals, including the cells described in Item 8.

[0019] Item 10. A nitro compound detection sensor comprising a lipid bilayer, a cell, or a non-human animal containing the nitro compound detection element described in any of Items 1 to 5.

[0020] Item 10A. Use of a lipid bilayer, cell, or non-human animal containing the nitro compound detection element described in any of Items 1 to 5 as a nitro compound detection sensor.

[0021] Item 10B. Use of a lipid bilayer, cell, or non-human animal containing the nitro compound detection element described in any of Items 1 to 5 for the manufacture of a nitro compound detection sensor.

[0022] Item 11. A method for detecting nitro compounds, comprising contacting a nitro compound detection element described in any of Items 1 to 5, or a nitro compound detection sensor described in Item 10, with a nitro compound. [Effects of the Invention]

[0023] This disclosure provides a technology for detecting nitro compounds. [Brief explanation of the drawing]

[0024] [Figure 1] The results of measuring the response activity of Anopheles mosquito olfactory receptor 28 and its mutants to nitro compounds (2,3-dinitrotoluene, 2,6-dinitrotoluene) are shown (Test Example 1). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium. The olfactory receptor used is shown at the top of the graph (WT indicates wild type, others indicate mutant sites). [Figure 2] The results of measuring the response activity of Anopheles mosquito olfactory receptor 47 and its mutants to nitro compounds (4-amino-2,6-dinitrotoluene) are shown (Test Example 2). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium (see legend). The olfactory receptors used are shown at the top of the graph (WT indicates wild type, others indicate mutant sites). [Figure 3] The results of measuring the response activity of Anopheles mosquito olfactory receptor 47 and its mutants to nitro compounds (4-amino-2,6-dinitrotoluene) are shown (Test Example 2). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium (see legend). The mutation site of the olfactory receptor used is shown at the top of the graph. [Figure 4] The results of measuring the response activity of Anopheles mosquito olfactory receptor 47 and its mutants to nitro compounds (3-trifluoromethyl-4-nitrophenol, 2,3-dinitrotoluene, 2,4-dinitrotoluene, or 2,6-dinitrotoluene) are shown (Test Example 2). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium. The olfactory receptor used (wild type or 7-mutant (Example 12)) is shown at the top of the graph. [Figure 5] The results of measuring the response activity of Anopheles mosquito olfactory receptor 47 and its mutants to nitro compounds (3-nitrotoluene, 4-nitrotoluene, or toluene) are shown (Test Example 2). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium. The olfactory receptor used (wild type or 7-fold mutant (Example 12)) is shown at the top of the graph. [Figure 6] The results of measuring the response activity of Anopheles mosquito olfactory receptor 47 and its mutants to the nitro compound (2,3-dimethyl-2,3-dinitrobutane) are shown (Test Example 2). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium (DMSO is shown as 0 μM). The olfactory receptors used are shown at the top of the graph (WT indicates wild type, others indicate mutant sites). [Figure 7] The results of measuring the response activity of Anopheles mosquito olfactory receptor 6 and its mutants to nitro compounds (2-nitroaniline) are shown (Test Example 3). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium (DMSO shows 0 μM). The olfactory receptors used (wild type, mutant) are shown at the top of the graph. [Figure 8] The results of measuring the response activity of Anopheles mosquito olfactory receptor 15 and its mutants to nitro compounds (2-nitroaniline) are shown (Test Example 4). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium (DMSO shows 0 μM). The olfactory receptors used (wild type, mutant) are shown at the top of the graph. [Figure 9]The results of measuring the response activity of the mosquito olfactory receptor 4 to nitro compounds (2,4-dinitrotoluene, 4-nitrotoluene) are shown (Test Example 5). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium. The olfactory receptor used is shown at the top of the graph. [Figure 10] The results of measuring the response activity of the Anopheles mosquito olfactory receptor 28 and the mouse olfactory receptor Olfr256_17 to nitro compounds (3-nitrotoluene) are shown (Test Example 6). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium. [Figure 11] The results of measuring the response activity to nitro compounds (2,3-dinitrotoluene) when an additional amino acid substitution was introduced in the seventh transmembrane region of the Anopheles mosquito olfactory receptor 28 are shown (Test Example 7). The vertical axis shows the fluorescence intensity (=activity intensity), and the horizontal axis shows the concentration of the test substance in the culture medium (DMSO shows 0 μM). [Modes for carrying out the invention]

[0025] 1. Definition etc. In this specification, the terms “contains” and “includes” include the concepts of “contains,” “includes,” “substantially consist of,” and “consist solely of.” In this specification, "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87:2264-2268 (1990), Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc Natl Acad Sci USA. 90:5873-7 (1993)). A program called BLASTX has been developed based on this BLAST algorithm. The specific methods for these analyses are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of the base sequence is also defined accordingly. In this specification, "conservative substitution" means that an amino acid residue is substituted for another amino acid residue with a similar side chain. For example, substitutions between amino acid residues with basic side chains, such as lysine, arginine, and histidine, constitute conservative substitutions.Other substitutions that are conserved include those between amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains, such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues with non-polar side chains, such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues with β-branched side chains, such as threonine, valine, and isoleucine; and amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, tryptophan, and histidine.

[0026] In this specification, nucleotides such as DNA and RNA may be subjected to known chemical modifications, as exemplified below. To prevent degradation by hydrolytic enzymes such as nucleases, the phosphate residue of each nucleotide can be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate. The hydroxyl group at position 2 of the sugar (ribose) of each ribonucleotide may also be replaced with -OR (where R represents, for example, CH3(2'-O-Me), CH2CH2OCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base portion (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or cationic functional group at position 5 of the pyrimidine base, or by substituting the carbonyl group at position 2 with a thiocarbonyl group. Furthermore, examples include, but are not limited to, those in which the phosphate or hydroxyl portion is modified with, for example, biotin, an amino group, a lower alkylamine group, or an acetyl group. In addition, BNA (LNA), in which the conformation of the sugar portion of the nucleotide is fixed to the N-type by cross-linking the 2' oxygen and 4' carbon atoms of the sugar portion, can also be preferably used.

[0027] Olfactory receptor proteins are membrane proteins with a seven-transmembrane structure, and are composed of the following domains linked together from the amino terminus (sometimes referred to as the "N terminus") to the carboxyl terminus (sometimes referred to as the "C terminus"): the N-terminal region (NT), the first transmembrane domain (TM1), the first extracellular loop (EC1), the second transmembrane domain (TM2), the first intracellular loop (IC1), the third transmembrane domain (TM3), the second extracellular loop (EC2), the fourth transmembrane domain (TM4), the second intracellular loop (IC2), the fifth transmembrane domain (TM5), the third extracellular loop (EC3), the sixth transmembrane domain (TM6), the third intracellular loop (IC3), the seventh transmembrane domain (TM7), and the C-terminal region (CT). In this disclosure, each region is determined by structural prediction using TMpred (K. Hofmann, W. Stoffel, TMbase - a database of membrane spanning protein segments, Biol. Chem. Hoppe-Seyler, 374 (1993), p. 166, https: / / embnet.vital-it.ch / software / TMPRED_form.html) (default conditions).

[0028] In this specification, amino acid mutations specifically refer to the deletion, substitution, insertion, or addition of amino acids. Olfactory receptor proteins may have deletions of amino acids that have little effect on chemical response activity, and may, for example, be olfactory receptor peptides in which some amino acids other than those in the transmembrane region are deleted.

[0029] In this specification, the position of an amino acid in an amino acid sequence may be indicated by an amino acid position letter followed by the amino acid number, counted from the N-terminal amino acid. For example, "A153" indicates alanine, which is the 153rd amino acid from the N-terminus.

[0030] In this specification, nitro compound responsiveness refers to the property in which an olfactory receptor recognizes a nitro compound, and the olfactory receptor complex formed by the olfactory receptor and its coreceptor is activated, exhibiting ion channel activity. The nitro compound responsiveness of an olfactory receptor can be measured using the ion channel activity of the olfactory receptor complex formed by the olfactory receptor and its coreceptor in contact with the nitro compound as an indicator. For example, a nitro compound is brought into contact with (a) an olfactory receptor, (b) an olfactory receptor coreceptor, and (c) a cell expressing a protein that develops color or emits light in response to ions (such as calcium ions) flowing into the cell when the olfactory receptor responds, and the amount of light emitted by the cell is measured. The greater the measured amount of light emitted, the higher the nitro compound responsiveness of the olfactory receptor is judged to be. Specific examples of measuring nitro compound responsiveness are described in Test Examples 1-2 and 1-3 below.

[0031] 2. Olfactory receptor proteins In one aspect, this disclosure relates to (1) an amino acid sequence 1C obtained by a mutation in amino acid sequence 1A shown in SEQ ID NO: 1 or an amino acid sequence 1B having 80% or more identity with amino acid sequence 1A, wherein mutation 1a: includes a deletion of part or all of the region of the first extracellular loop; (2) Amino acid sequence 2C is formed by a mutation in amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 80% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B; (3) Amino acid sequence 3C, which is formed by mutations in amino acid sequence 3A shown in Sequence ID No. 3 or amino acid sequence 3B having 80% or more identity with amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in amino acid sequence 3A or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop; (4) Amino acid sequence 4C obtained by mutating amino acid sequence 4A shown in Sequence ID No. 4 or amino acid sequence 4B having 80% or more identity with amino acid sequence 4A, wherein mutation 4a: contains substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in amino acid sequence 4A, or substitution 4ay corresponding to substitution 4ax in amino acid sequence 4B; or (5) Amino acid sequence 5C obtained by mutation of amino acid sequence 5A shown in Sequence ID No. 5 or amino acid sequence 5B having 80% or more identity with amino acid sequence 5A, wherein mutation 5a: includes the substitution 5ax of amino acid L178 in amino acid sequence 5A or the substitution 5ay corresponding to the substitution 5ax in amino acid sequence 5B. This relates to olfactory receptor proteins (which may also be referred to as "olfactory receptor proteins of this disclosure" in this specification). This is described below.

[0032] 2-1. Amino acid sequence 1C Amino acid sequence 1C is a sequence obtained by mutation of amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 80% or more identity with amino acid sequence 1A, and is not particularly limited as long as it includes mutation 1a: deletion of part or all of the region of the first extracellular loop.

[0033] Amino acid sequence 1A is the amino acid sequence of olfactory receptor 28, which is endogenously expressed (inherently present) in the mosquito Anopheles gambiae.

[0034] The amino acid sequence 1B is not particularly limited, as long as the nitro compound responsiveness of the protein (protein 1B) consisting of the sequence in which mutation 1a is introduced is not significantly reduced compared to the nitro compound responsiveness of the protein (protein 1A) consisting of the sequence in which mutation 1a is introduced into amino acid sequence 1A. The nitro compound responsiveness of protein 1B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more, relative to the 100% nitro compound responsiveness of protein 1A. From this viewpoint, the identity of amino acid sequence 1B with respect to amino acid sequence 1A is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and also less than 100%.

[0035] Amino acid sequence 1B is preferably the amino acid sequence described in (1B') below: (1B') This is an amino acid sequence 1B' in which one or more amino acids are mutated from amino acid sequence 1A.

[0036] In amino acid sequence 1B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.

[0037] Amino acid mutations in amino acid sequence 1B relative to amino acid sequence 1A include, for example, substitutions, deletions, additions, and insertions, with substitutions being preferred, and conservative substitutions being more preferred.

[0038] Amino acid sequence 1B is preferably an amino acid sequence of an olfactory receptor derived from an insect. "Derived from" means that it is endogenously expressed (inherently possessed) by that organism. Examples of insects include endoptera, more preferably dipteran insects such as Culicidae and Drosophilidae; lepidoptera insects such as Bombycidae; and hymenoptera insects such as Apidae. Even more preferably are dipteran insects such as Culicidae and Drosophilidae, and even more preferably Culicidae insects. Examples of Culicidae insects include Anopheles gambiae, Aedes aegypti, and Culex quinquefasciatus. Examples of insects in the Drosophilidae family include Drosophila melanogaster, Drosophila pseudoobscura, and Drosophila virillis. Examples of insects in the Bombycidae family include Bombyx mori, Bombyx mandarina, and Trilocha varians. Examples of insects in the Apidae family include Apis mellifera, Apis florea, Apis dorsata, and Bombus terrestris.

[0039] Mutation 1a is a deletion of part or all of the first extracellular loop. In amino acid sequence 1A, the first extracellular loop is a 30-amino acid region from the 55th amino acid to the 84th amino acid from the N-terminus. More preferably, mutation 1a is a region from the N-terminus of the first extracellular loop to 5-30 amino acids, even more preferably a region from the N-terminus to 10-25 amino acids, and even more preferably a region from the N-terminus to 15-25 amino acids.

[0040] In mutation 1a, it is preferable that a portion of the C-terminal side of the first transmembrane domain, which is adjacent to the N-terminal side of the first extracellular loop, is also deleted. For example, it is preferable that a region of 1 to 5 amino acids, including the C-terminal amino acid of the first transmembrane domain, is deleted.

[0041] The amino acid sequence 1C preferably further includes mutation 1b: substitution 1bx of at least one amino acid selected from the group consisting of T25 and P31 in amino acid sequence 1A, or substitution 1by corresponding to substitution 1bx in amino acid sequence 1B.

[0042] Note that "corresponding substitutions" indicate that when comparing two sequences using BLAST (default settings), the substitutions occur at the same position on the alignment sequence. For example, a substitution corresponding to T25 in amino acid sequence 1A refers to the substitution of an amino acid at the same position as T25 in amino acid sequence 1A in the alignment sequence obtained by comparing amino acid sequence 1A and amino acid sequence 1B. Furthermore, the substituted amino acid in amino acid sequence 1A and the substituted amino acid in amino acid sequence 1B are the same.

[0043] In mutation 1b, the amino acid after the mutation of T25 or the corresponding amino acid is preferably a basic amino acid. Examples of basic amino acids include lysine, arginine, and histidine, with lysine being particularly preferred among these.

[0044] In mutation 1b, the amino acid after the mutation of P31 or the corresponding amino acid is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with threonine being particularly preferred among these.

[0045] The amino acid sequence 1C may contain other amino acid mutations (e.g., substitutions, conservative substitutions) as long as nitro compound responsiveness is not significantly impaired. For example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the seventh transmembrane region. The number of other amino acid mutations may be, for example, 1-50, 1-20, 1-10, or 1-5.

[0046] Specifically, examples of amino acid sequence 1C include the amino acid sequence shown in sequence numbers 21, 25, 27, or 29, or an amino acid sequence having 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%) identity with said amino acid sequence.

[0047] 2-2. Amino Acid Sequence 2C The amino acid sequence 2C is formed by a mutation of the amino acid sequence 2A shown in Sequence ID No. 2 or the amino acid sequence 2B having 80% or more identity with the amino acid sequence 2A, and is not particularly limited as long as mutation 2a includes a substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in the amino acid sequence 2A, or a substitution 2ay corresponding to the substitution 2ax in the amino acid sequence 2B.

[0048] Amino acid sequence 2A is the amino acid sequence of olfactory receptor 47, which is endogenously expressed (inherently present) in the mosquito Anopheles gambiae.

[0049] The amino acid sequence 2B is not particularly limited, as long as the nitro compound responsiveness of the protein (protein 2B) consisting of the sequence in which mutation 2a is introduced is not significantly reduced compared to the nitro compound responsiveness of the protein (protein 2A) consisting of the sequence in which mutation 2a is introduced into amino acid sequence 2A. The nitro compound responsiveness of protein 2B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more, relative to the nitro compound responsiveness of protein 2A, which is 100%. From this viewpoint, the identity of amino acid sequence 2B with respect to amino acid sequence 2A is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and also less than 100%.

[0050] Amino acid sequence 2B is preferably the amino acid sequence described in (2B') below: (2B') This is an amino acid sequence 2B' in which one or more amino acids are mutated from amino acid sequence 2A.

[0051] In amino acid sequence 2B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.

[0052] Amino acid mutations in amino acid sequence 2B relative to amino acid sequence 2A include, for example, substitutions, deletions, additions, and insertions, with substitutions being preferred, and conservative substitutions being more preferred.

[0053] Amino acid sequence 2B is preferably the amino acid sequence of an insect-derived olfactory receptor. The definition of an insect-derived olfactory receptor is the same as in "2-1. Amino acid sequence 1C" above.

[0054] Mutation 2a is either substitution 2ax of at least one amino acid selected from the group consisting of L60, M138, and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B. The definition of "corresponding substitution" is the same as in "2-1. Amino Acid Sequence 1C" above.

[0055] In mutation 2a, the amino acid after the mutation of L60 or the corresponding amino acid is preferably proline.

[0056] The amino acid after mutation M138 or its corresponding amino acid in mutation 2a is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with isoleucine being particularly preferred among these.

[0057] In mutation 2a, the amino acid after mutation of A152 or the corresponding amino acid is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with threonine being particularly preferred among these.

[0058] Mutation 2a preferably includes at least one substitution of M138 and A152 or a corresponding amino acid substitution, and more preferably includes both of these substitutions or a corresponding amino acid substitution.

[0059] The amino acid sequence 2C preferably further includes mutation 2b: substitution 2bx of at least one amino acid selected from the group consisting of D5, L71, I134, S140, F147, K235, and N241 in amino acid sequence 2A, or substitution 2by corresponding to substitution 2bx in amino acid sequence 2B.

[0060] The amino acid after mutation D5 or the corresponding amino acid in mutation 2b is preferably an acidic amino acid. Examples of acidic amino acids include aspartic acid and glutamic acid, with glutamic acid being particularly preferred among these.

[0061] The amino acid after mutation L71 or the corresponding amino acid in mutation 2b is preferably an aromatic amino acid. Examples of aromatic amino acids include phenylalanine, tyrosine, and tryptophan, with phenylalanine being particularly preferred among these.

[0062] In mutation 2b, the amino acid after mutation of I134 or the corresponding amino acid is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with valine being particularly preferred among these.

[0063] The amino acid after mutation S140 or the corresponding amino acid in mutation 2b is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with glycine being particularly preferred among these.

[0064] In mutation 2b, the amino acid after mutation of F147 or the corresponding amino acid is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with leucine being particularly preferred among these.

[0065] In mutation 2b, the amino acid after the mutation of K235 or the corresponding amino acid is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with glutamine being particularly preferred among these.

[0066] In mutation 2b, the amino acid after mutation of N241 or the corresponding amino acid is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with serine being particularly preferred among these.

[0067] Mutation 2b preferably comprises a substitution of L71F or a corresponding amino acid substitution, more preferably a substitution of L71F and I134 or a corresponding amino acid substitution, even more preferably a substitution of L71F, I134 and S140 or a corresponding amino acid substitution, and even more preferably a substitution of L71F, I134, S140 and F147 or a corresponding amino acid substitution.

[0068] The amino acid sequence 2C may contain other amino acid mutations (e.g., substitutions, conservative substitutions) as long as nitro compound responsiveness is not significantly impaired. For example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the seventh transmembrane region. The number of other amino acid mutations may be, for example, 1-50, 1-20, 1-10, or 1-5.

[0069] Specifically, examples of amino acid sequence 2C include the amino acid sequence shown in sequence numbers 63, 67, 71, 73, 75, 77, or 79, or an amino acid sequence having 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%) identity with said amino acid sequence.

[0070] 2-3. Amino acid sequence 3C The amino acid sequence 3C is formed by a mutation of the amino acid sequence 3A shown in Sequence ID No. 3 or the amino acid sequence 3B having 80% or more identity with the amino acid sequence 3A, and is not particularly limited as long as it includes mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in the amino acid sequence 3A or substitution 3ay in the amino acid sequence 3B corresponding to the substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop.

[0071] Amino acid sequence 3A is the amino acid sequence of olfactory receptor 6, which is endogenously expressed (proprietarily present) in the mosquito Anopheles gambiae.

[0072] The amino acid sequence 3B is not particularly limited, as long as the nitro compound responsiveness of the protein (protein 3B) consisting of a sequence in which mutations 3a and 3b are introduced into the sequence is not significantly reduced compared to the nitro compound responsiveness of the protein (protein 3A) consisting of a sequence in which mutations 3a and 3b are introduced into the amino acid sequence 3A. The nitro compound responsiveness of protein 3B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more, relative to the 100% nitro compound responsiveness of protein 3A. From this viewpoint, the identity of amino acid sequence 3B with respect to amino acid sequence 3A is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and also less than 100%.

[0073] Amino acid sequence 3B is preferably the amino acid sequence described in (3B') below: (3B') This is an amino acid sequence 3B' in which one or more amino acids are mutated from amino acid sequence 3A.

[0074] In amino acid sequence 3B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.

[0075] Amino acid mutations in amino acid sequence 3B relative to amino acid sequence 3A include substitutions, deletions, additions, and insertions, with substitutions being preferred, and conservative substitutions being more preferred.

[0076] Amino acid sequence 3B is preferably the amino acid sequence of an insect-derived olfactory receptor. The definition of an insect-derived olfactory receptor is the same as that described in "2-1. Amino acid sequence 1C" above.

[0077] Mutation 3a is substitution 3ax in amino acid sequence 3A, consisting of S114, A120, H162, V186, V352, and S368, or substitution 3ay in amino acid sequence 3B, corresponding to substitution 3ax. The definition of "corresponding substitution" is the same as in "2-1. Amino Acid Sequence 1C" above.

[0078] The amino acid after mutation of S114 or the corresponding amino acid in mutation 3a is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with alanine being particularly preferred among these.

[0079] The amino acid after mutation A120 or its corresponding amino acid in mutation 3a is preferably an acidic amino acid. Examples of acidic amino acids include aspartic acid and glutamic acid, with glutamic acid being particularly preferred among these.

[0080] The amino acid resulting from the mutation of H162 or its corresponding amino acid in mutation 3a is preferably an aromatic amino acid. Examples of aromatic amino acids include phenylalanine, tyrosine, and tryptophan, with tyrosine being particularly preferred among these.

[0081] The amino acid after mutation V186 or its corresponding amino acid in mutation 3a is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with alanine being particularly preferred among these.

[0082] The amino acid after mutation V352 or its corresponding amino acid in mutation 3a is preferably a sulfur-containing amino acid. Examples of sulfur-containing amino acids include methionine and cysteine, with methionine being particularly preferred among these.

[0083] In mutation 3a, the amino acid after the mutation of S368 or the corresponding amino acid is preferably proline.

[0084] Mutation 3b is a substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop (i.e., the region consisting of the third extracellular loop, the sixth transmembrane domain, and the third intracellular loop). The third extracellular loop is a 69-amino acid region in amino acid sequence 3A, from amino acid 211 to amino acid 279 from the N-terminus. The sixth transmembrane domain is a 23-amino acid region in amino acid sequence 3A, from amino acid 280 to amino acid 302 from the N-terminus. The third intracellular loop is a 76-amino acid region in amino acid sequence 3A, from amino acid 303 to amino acid 378 from the N-terminus.

[0085] Charged amino acids are acidic amino acids and basic amino acids, specifically lysine, arginine, histidine, aspartic acid, and glutamic acid. In mutation 3b, some or all of the charged amino acids are replaced with uncharged amino acids. The uncharged amino acids are not particularly limited as long as they are amino acids other than charged amino acids. The number of substitutions with uncharged amino acids is usually multiple, for example, 5 to 25 or more, preferably 6 to 18, and more preferably 8 to 14.

[0086] The amino acid sequence 3C may contain other amino acid mutations (e.g., substitutions, conservative substitutions) as long as nitro compound responsiveness is not significantly impaired. For example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the seventh transmembrane region. The number of other amino acid mutations may be, for example, 1-60, 1-20, 1-10, or 1-5.

[0087] Specifically, examples of amino acid sequence 3C include the amino acid sequence shown in sequence number 81, or an amino acid sequence having 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%) identity with said amino acid sequence.

[0088] 2-4. Amino Acid Sequence 4C The amino acid sequence 4C is formed by a mutation of the amino acid sequence 4A shown in Sequence ID No. 4 or the amino acid sequence 4B having 80% or more identity with the amino acid sequence 4A, and is not particularly limited as long as mutation 4a includes substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in the amino acid sequence 4A, or substitution 4ay corresponding to the substitution 4ax in the amino acid sequence 4B.

[0089] Amino acid sequence 4A is the amino acid sequence of olfactory receptor 15, which is endogenously expressed (proprietarily present) in the mosquito Anopheles gambiae.

[0090] The amino acid sequence 4B is not particularly limited, as long as the nitro compound responsiveness of the protein (protein 4B) consisting of the sequence in which mutation 4a is introduced is not significantly reduced compared to the nitro compound responsiveness of the protein (protein 4A) consisting of the sequence in which mutation 4a is introduced into amino acid sequence 4A. The nitro compound responsiveness of protein 4B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more, relative to the nitro compound responsiveness of protein 4A, which is 100%. From this viewpoint, the identity of amino acid sequence 4B with respect to amino acid sequence 4A is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and also less than 100%.

[0091] Amino acid sequence 4B is preferably the amino acid sequence described in (4B') below: (4B') This is an amino acid sequence 4B' in which one or more amino acids are mutated from amino acid sequence 4A.

[0092] In amino acid sequence 4B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.

[0093] Amino acid mutations in amino acid sequence 4B relative to amino acid sequence 4A include substitutions, deletions, additions, and insertions, with substitutions being preferred, and conservative substitutions being more preferred.

[0094] Amino acid sequence 4B is preferably the amino acid sequence of an insect-derived olfactory receptor. The definition of an insect-derived olfactory receptor is the same as that described in "2-1. Amino acid sequence 1C" above.

[0095] Mutation 4a is substitution 4ax in amino acid sequence 4A, consisting of M61, C104, R112, G181, V189, and I327, or substitution 4ay in amino acid sequence 4B, corresponding to substitution 4ax. The definition of "corresponding substitution" is the same as in "2-1. Amino Acid Sequence 1C" above.

[0096] The amino acid after mutation M61 or its corresponding amino acid in mutation 4a is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with threonine being particularly preferred among these.

[0097] The amino acid after mutation of C104 or the corresponding amino acid in mutation 4a is preferably a basic amino acid. Examples of basic amino acids include lysine, arginine, and histidine, with arginine being particularly preferred among these.

[0098] The amino acid after mutation R112 or the corresponding amino acid in mutation 4a is preferably a hydrophilic neutral amino acid. Examples of hydrophilic neutral amino acids include serine, threonine, asparagine, and glutamine, with glutamine being particularly preferred among these.

[0099] The amino acid that replaces G181 or the corresponding amino acid in mutation 4a is preferably an aliphatic amino acid. Examples of aliphatic amino acids include alanine, glycine, valine, isoleucine, and leucine, with alanine being particularly preferred among these.

[0100] The amino acid after mutation V189 or its corresponding amino acid in mutation 4a is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with isoleucine being particularly preferred among these.

[0101] The amino acid after mutation I327 or the corresponding amino acid in mutation 4a is preferably a branched-chain amino acid. Examples of branched-chain amino acids include valine, isoleucine, and leucine, with valine being particularly preferred among these.

[0102] The amino acid sequence 4C can contain other amino acid mutations (e.g., substitutions, conservative substitutions) as long as nitro compound responsiveness is not significantly impaired. For example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the seventh transmembrane region. The number of other amino acid mutations can be, for example, 1-50, 1-20, 1-10, or 1-5.

[0103] Specifically, examples of amino acid sequence 4C include the amino acid sequence shown in sequence number 83, or an amino acid sequence having 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%) identity with said amino acid sequence.

[0104] 2-5. Amino Acid Sequence 5C The amino acid sequence 5C is formed by a mutation of the amino acid sequence 5A shown in Sequence ID No. 5 or the amino acid sequence 5B which has 80% or more identity with the amino acid sequence 5A, and is not particularly limited as long as mutation 5a includes the substitution 5ax of amino acid L178 in the amino acid sequence 5A or the substitution 5ay corresponding to the substitution 5ax in the amino acid sequence 5B.

[0105] Amino acid sequence 5A is the amino acid sequence of olfactory receptor 4, which is endogenously expressed (inherently present) in the mosquito Aedes aegypti.

[0106] The amino acid sequence 5B is not particularly limited, as long as the nitro compound responsiveness of the protein (protein 5B) consisting of the sequence in which mutation 5a is introduced is not significantly reduced compared to the nitro compound responsiveness of the protein (protein 5A) consisting of the sequence in which mutation 5a is introduced into amino acid sequence 5A. The nitro compound responsiveness of protein 5B is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more, relative to the nitro compound responsiveness of protein 5A, which is 100%. From this viewpoint, the identity of amino acid sequence 5B with respect to amino acid sequence 5A is preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and also less than 100%.

[0107] Amino acid sequence 5B is preferably the amino acid sequence described in (5B') below: (5B') This is an amino acid sequence 5B' in which one or more amino acids are mutated from amino acid sequence 5A.

[0108] In amino acid sequence 5B', "multiple" means, for example, 2 to 20, preferably 2 to 10, more preferably 2 to 5, even more preferably 2 to 3, and even more preferably 2.

[0109] Amino acid mutations in amino acid sequence 5B relative to amino acid sequence 5A include substitutions, deletions, additions, and insertions, with substitutions being preferred, and conservative substitutions being more preferred.

[0110] Amino acid sequence 5B is preferably the amino acid sequence of an insect-derived olfactory receptor. The definition of an insect-derived olfactory receptor is the same as that described in "2-1. Amino acid sequence 1C" above.

[0111] Mutation 5a is either the substitution 5ax of amino acid L178 in amino acid sequence 5A, or the substitution 5ay corresponding to substitution 5ax in amino acid sequence 5B. The definition of "corresponding substitution" is the same as in "2-1. Amino Acid Sequence 1C" above.

[0112] In mutation 5a, the amino acid after the mutation of L178 or the corresponding amino acid is preferably proline.

[0113] The amino acid sequence 5C may contain other amino acid mutations (e.g., substitutions, conservative substitutions) as long as nitro compound responsiveness is not significantly impaired. For example, nitro compound responsiveness can be further enhanced by introducing specific mutations in the seventh transmembrane region. The number of other amino acid mutations may be, for example, 1-50, 1-20, 1-10, or 1-5.

[0114] Specifically, examples of amino acid sequence 5C include the amino acid sequence shown in sequence number 85, or an amino acid sequence having 80% or more (preferably 85% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 97% or more, particularly preferably 99% or more, and less than 100%) identity with said amino acid sequence.

[0115] 2-6. Proteins In one embodiment, the olfactory receptor protein of this disclosure has the general formula (1) in the corresponding wild-type olfactory receptor protein: φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 [In the formula, X1-X6 and Z1-Z3 represent amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ1 represents a hydrophobic amino acid, φ2-φ7 each independently represent an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid.] It includes an amino acid sequence B which is formed by a mutation of the amino acid sequence A shown, Conditions 1-3 below: (Condition 1) In the amino acid sequence B, X3 and / or X4 are substituted, and X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. (Condition 2) If both X5 and X6 are positively charged polar amino acids in amino acid sequence A, then in amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid, and (Condition 3) If one or both of X1 and X2 are positively charged polar amino acids in amino acid sequence A, then in amino acid sequence B, X1 and / or X2 are substituted, and X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. It can satisfy at least one condition selected from the group consisting of the following:

[0116] This can improve responsiveness to nitro compounds. The "corresponding wild-type olfactory receptor" refers to an olfactory receptor consisting of any of the amino acid sequences 1A to 5A. The amino acid sequence A represented by the general formula (1) may also be included in the seventh transmembrane region.

[0117] The olfactory receptor proteins of this disclosure may have other amino acid sequences other than amino acid sequence 1C-5C, such as protein tags, fluorescent proteins, luminescent proteins, signal sequences, or other proteins or peptides attached, as long as their nitro compound responsiveness is not significantly impaired. Examples of protein tags include biotin, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, PA tags, and the like.

[0118] The olfactory receptor proteins of this disclosure may be chemically modified, provided that their nitro compound responsiveness is not significantly impaired.

[0119] The olfactory receptor proteins disclosed herein have a carboxyl group (-COOH) at the C-terminus, and a carboxylate (-COOH) at the C-terminus. - It may be any of the following: ), amide (-CONH2), or ester (-COOR).

[0120] Here, examples of R in the ester include C such as methyl, ethyl, n-propyl, isopropyl, n-butyl and the like 1-6 alkyl group; for example, C such as cyclopentyl, cyclohexyl and the like 3-8 cycloalkyl group; for example, C such as phenyl, α-naphthyl and the like 6-12 aryl group; for example, phenyl-C such as benzyl, phenethyl and the like 1-2 alkyl group; α-naphthyl-C such as α-naphthylmethyl and the like 1-2 C such as alkyl group and the like 7-14 aralkyl group; pivaloyloxymethyl group and the like are used.

[0121] In the olfactory receptor protein of the present disclosure, a carboxyl group (or carboxylate) other than the C-terminus may be amidated or esterified. As the ester in this case, for example, the above-mentioned C-terminal ester and the like are used.

[0122] Furthermore, the olfactory receptor protein of the present disclosure includes those in which the amino group of the N-terminal amino acid residue is protected with a protecting group (for example, C such as formyl group, acetyl group and the like 1-6 C such as alkanoyl and the like 1-6 acyl group and the like), those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutaminated, those in which the substituent on the side chain of an intramolecular amino acid (for example, -OH, -SH, amino group, imidazole group, indole group, guanidino group and the like) is protected with an appropriate protecting group (for example, C such as formyl group, acetyl group and the like 1-6 C such as alkanoyl group and the like 1-6 acyl group and the like), or complex proteins such as so-called glycoproteins to which a sugar chain is bound, and the like are also included.

[0123] The olfactory receptor proteins of this disclosure may be in the form of salts with an acid or a base. The salts are not particularly limited, and either acidic or basic salts can be used. For example, examples of acidic salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, and p-toluenesulfonate; and amino acid salts such as aspartate and glutamate. Examples of basic salts include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

[0124] The olfactory receptor proteins of this disclosure may be in the form of solvates. The solvent is not particularly limited and includes, for example, water, ethanol, glycerol, acetic acid, and the like.

[0125] The olfactory receptor proteins of this disclosure can be readily produced according to known genetic engineering techniques. For example, they can be produced using PCR, restriction enzyme digestion, DNA ligation, in vitro transcription and translation techniques, recombinant protein production techniques, etc.

[0126] 3. Polynucleotides, cells, non-human animals In one aspect, this disclosure relates to polynucleotides (which may be referred to herein as "the polynucleotides of the disclosure") containing the coding sequence of the olfactory receptor protein of the disclosure, cells (which may be referred to herein as "the cells of the disclosure") containing the polynucleotides of the disclosure, and non-human animals (which may be referred to herein as "the non-human animals of the disclosure") containing the cells of the disclosure. These are described below.

[0127] The coding sequence of the olfactory receptor protein of this disclosure is not particularly limited, as long as it is a polynucleotide consisting of a base sequence encoding the olfactory receptor protein of this disclosure.

[0128] In one embodiment, the polynucleotides of the Disclosure include an expression cassette of the olfactory receptor protein of the Disclosure.

[0129] The expression cassette for the olfactory receptor protein of this disclosure is not particularly limited, as long as it is a polynucleotide capable of expressing the olfactory receptor protein of this disclosure in a cell. Typical examples of the expression cassette for the olfactory receptor protein of this disclosure include a polynucleotide comprising a promoter and a coding sequence for the olfactory receptor protein of this disclosure, positioned under the control of the promoter.

[0130] The promoters included in the olfactory receptor protein expression cassette of this disclosure are not particularly limited and can be appropriately selected depending on the target cells. Various pol II system promoters can be used as promoters. Pol II system promoters are not particularly limited, but examples include the CMV promoter, EF1 promoter, SV40 promoter, MSCV promoter, etc. Other examples of promoters include tryptophan promoters such as trc and tac, lac promoter, T7 promoter, T5 promoter, T3 promoter, SP6 promoter, arabinose-inducible promoter, cold shock promoter, tetracycline-inducible promoter, etc.

[0131] The olfactory receptor protein expression cassette of this disclosure may optionally include other elements (e.g., a multicloning site (MCS), a drug resistance gene, an origin of replication, an enhancer sequence, a repressor sequence, an insulator sequence, a reporter protein (e.g., a fluorescent protein) coding sequence, a drug resistance gene coding sequence, etc.).

[0132] The polynucleotides of this disclosure may be in the form of vectors. An appropriate vector is selected depending on the intended use (cloning, protein expression) and the type of host cell. Examples of vectors that use Escherichia coli as a host include M13 phage or its variants, λ phage or its variants, pBR322 or its variants (pB325, pAT153, pUC8, etc.), examples of vectors that use yeast as a host include pYepSec1, pMFa, pYES2, pPIC3.5K, examples of vectors that use insect cells as a host include pAc, pVL, etc., and examples of vectors that use mammalian cells as a host include pcDNA, pCDM8, pMT2PC, etc.

[0133] The cells of this disclosure are not particularly limited in that they contain the polynucleotides of this disclosure. Examples of cells include Escherichia coli K12 and other Escherichia coli, Bacillus bacteria such as Bacillus subtilis MI114, yeast such as Saccharomyces cerevisiae AH22, Sf cell lines derived from Spodoptera frugiperda or HighFive cell lines derived from Trichoplusia ni, insect cells such as olfactory nerve cells, and animal cells such as COS7 cells. Preferably, animal cells are cultured cells derived from mammals, specifically COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, Hela cells, PC12 cells, N1E-115 cells, SH-SY5Y cells, etc.

[0134] The cells of this disclosure preferably contain the coding sequence of an insect olfactory receptor coreceptor, from the viewpoint that they can be used directly for the nitro compound detection application described later. Although the insect olfactory receptor coreceptor is a membrane protein having a seven-transmembrane structure, similar to the olfactory receptor, it does not recognize odor molecules itself, but functions by forming a heterocomplex with the olfactory receptor. The olfactory receptor complex, which is a heterocomplex composed of the olfactory receptor and the olfactory receptor coreceptor, has ion channel activity that is activated by odor molecules, and when activated, it attracts sodium ions (Na + ), calcium ions (Ca 2+It causes positive ions such as ) to flow into the cell.

[0135] From a similar viewpoint, the cells of this disclosure preferably contain a coding sequence for a protein that emits color or light in response to ions (such as calcium ions) that flow into the cell when an olfactory receptor responds. Examples of such proteins include aequorin, Yellow Cameleon (YC), and GCaMP. Alternatively, the cells of this disclosure preferably contain a calcium ion-dependent fluorescent dye (e.g., Fura-2, Fluo-3, Fluo-4).

[0136] From a similar perspective, the cells of the Disclosure contain the olfactory receptor protein of the Disclosure, that is, the olfactory receptor protein of the Disclosure is expressed in the cells of the Disclosure. In this case, since the olfactory receptor protein of the Disclosure has a seven-transmembrane structure, it is positioned on the cell membrane as a membrane protein.

[0137] The non-human animals of this disclosure are not particularly limited in that they include the cells of this disclosure. While there are no particular limitations on the non-human animals, insects are preferred from the viewpoint of suitability for nitro compound detection applications described later. The description of insects is the same as in "2-1. Amino Acid Sequence 1C" above. Also, from a similar viewpoint, the cells of this disclosure in the non-human animals of this disclosure preferably include olfactory nerve cells.

[0138] 4.Applications The olfactory receptor protein described herein responds to nitro compounds by releasing cations (sodium ions (Na) into the cell) + ), calcium ions (Ca 2+ It has the activity to allow cations (etc.) to flow in. Nitro compounds can be detected by detecting these cations, or by detecting behavioral changes based on olfactory nerve cell activation induced by the influx of these cations. For this reason, the olfactory receptor protein of this disclosure can be used as a nitro compound detection element.

[0139] In one embodiment, this disclosure relates to a nitro compound detection element (detection element of the disclosure) comprising an olfactory receptor protein of the disclosure, and further to a nitro compound detection sensor (detection sensor of the disclosure) comprising a cell containing the detection element of the disclosure, a lipid bilayer (artificial cell membrane) containing the detection element of the disclosure, or a non-human animal containing said cell.

[0140] Nitro compounds are not particularly limited as long as they are compounds containing a nitro group. Preferred nitro compounds include compounds having a structure in which a nitro group is directly linked to a benzene ring, and compounds containing two or more nitro groups. Specific examples of nitro compounds include 2-nitrotoluene, 3-nitrotoluene, 4-nitrotoluene, 2,3-dinitrotoluene, 2,4-dinitrotoluene, 2,6-dinitrotoluene, 4-amino-2,6-dinitrotoluene, 3-trifluoromethyl-4-nitrophenol, nitroaniline, trinitrotoluene, trimethylenetrinitroamine, pentaerythritol tetranitrate, picric acid, nitroglycerin, and 2,3-dimethyl-2,3-dinitrobutane.

[0141] Chemical detection sensors utilizing cells, lipid bilayers, or non-human animals are already known, and their specific configurations can be those described in, for example, Patent Documents 1, 2, and 3. The nitro compound detection sensor comprising cells or lipid bilayers of this disclosure comprises, for example, a container for holding the cells or lipid bilayers of this disclosure, a sensor that outputs a signal when it detects a nitro compound response (e.g., light) in the cells of this disclosure, and a determination device that detects nitro compounds based on the signal. The nitro compound detection sensor comprising non-human animals of this disclosure comprises, for example, a detection unit (e.g., motion sensor, vibration sensor, sound sensor, etc.) for detecting the movement of the non-human animals of this disclosure. [Examples]

[0142] An embodiment of the present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0143] In the following examples, OR represents an olfactory receptor, Orco represents an olfactory receptor co-receptor, Ag represents Anopheles gambiae, and Aa represents Aedes aegypti.

[0144] The wild-type olfactory receptor genes used in the following examples are as follows:

[0145] [Table 1]

[0146] Test Example 1. Measurement of the nitro compound responsiveness of AgOR28 The response activity of olfactory receptors (wild-type AgOR28 and mutant AgOR28) to nitro compounds was measured.

[0147] Test Example 1-1. Production of Expression Plasmid < Comparative Example 1 .Construction of wild-type AgOR28 expression plasmid> A double-stranded DNA containing the coding sequence (nucleotide sequence: SEQ ID NO: 6) of wild-type AgOR28 (amino acid sequence: SEQ ID NO: 1) was synthesized on one of the DNA strands and introduced into pcDNA3.1 to obtain a wild-type AgOR28 expression plasmid (pcDNA3.1-AgOR28).

[0148] < Comparative Example 2 Construction of mutant AgOR28 (T25K mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 12) of a mutant AgOR28 (T25K mutation) (amino acid sequence: SEQ ID NO: 11), in which the 25th amino acid residue, threonine, in the amino acid sequence of wild-type AgOR28 is mutated to lysine, was constructed as follows.

[0149] PCR primers (CAGAGGCATGGCCAAGAAGATCCAGAACAGC (SEQ ID NO: 13), GCTGTTCTGGATCTTCTTGGCCATGCCTCTG (SEQ ID NO: 14)) were synthesized to convert threonine, the 25th amino acid residue in the amino acid sequence of wild-type AgOR28, to lysine. Using these primers, PCR amplification was performed with pcDNA3.1-AgOR28 as the template. The PCR reaction was performed using KOD-Plus-Neo (TOYOBO), and the reaction mixture was prepared according to the attached protocol with 1 x PCR buffer for KOD-Plus-Neo, 0.2 mM dNTPs, 1.5 mM MgSO4, 0.2 μM primer, and 1 U KOD-Plus-Neo DNA polymerase, with a final volume of 50 μL. The reaction cycle consisted of pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 30 seconds, annealing at 55°C for 1 minute, and extension at 68°C for 10 minutes. This cycle was repeated 16 times. 20 μL of the obtained PCR product was mixed with 0.4 μL of DpnI and treated at 37°C for 2 hours before being transformed into E. coli (DH5α). The transformed E. coli were seeded onto LB plates pre-treated with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. Subsequently, the plasmid sequences they contained were determined to obtain a mutant AgOR28 (T25K mutation) expression plasmid.

[0150] < Comparative Example 3 Construction of mutant AgOR28 (P31T mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 16) of a mutant AgOR28 (P31T mutation) (amino acid sequence: SEQ ID NO: 15), in which the 31st amino acid residue, proline, in the wild-type AgOR28 amino acid sequence is mutated to threonine, was constructed. Specifically, it was constructed in the same manner as in Comparative Example 2, except that primer F: CAGATCCAGAACAGCACCATCGACCTGTACGTG (SEQ ID NO: 17) and primer R: CACGTACAGGTCGATGGTGCTGTTCTGGATCTG (SEQ ID NO: 18) were used as PCR primers.

[0151] < Comparative Example 4 .Construction of mutant AgOR28 (T25K-P31T double mutation) expression plasmid> A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 20) of mutant AgOR28 (T25K, P31T double mutation) (amino acid sequence: SEQ ID NO: 19), in which the 25th amino acid residue, threonine, is mutated to lysine and the 31st amino acid residue, proline, is mutated to threonine, was constructed. Specifically, it was constructed in the same manner as Comparative Example 3, except that the mutant AgOR28 (T25K mutation) expression plasmid (Comparative Example 2) was used as the PCR template.

[0152] < Example 1 Construction of a mutant AgOR28 (22a.a deletion) expression plasmid. A plasmid (pcDNA3.1) was constructed containing the coding sequence (nucleotide sequence: SEQ ID NO: 22) of a mutant AgOR28 (22a.a deletion) (amino acid sequence: SEQ ID NO: 21) in which 22 amino acids from positions 52 to 73 of the wild-type AgOR28 amino acid sequence were consecutively deleted. Specifically, the following PCR primers were synthesized: Primer F1: TACCGAGCTCGGATCATGGCCAGACTGGTGCTG (SEQ ID NO: 23), Primer R1: GATATCTTGCAGAATT TTACTGCTGGTTGATGGTC (SEQ ID NO: 24), Primer F2: GCCAGCCTGTGCGTGCCCCAGTTCACCTACCTGGTGGTGGACACCAAG (SEQ ID NO: 90), and Primer R2: CACCAGGTAGGTGAACTGGGGCACGCACAGGCTGGCGATAGGGATG (SEQ ID NO: 91). Using wild-type AgOR28 as a template, PCR was performed using primers F1 and R2, and PCR using primers F2 and R1. The amplification products were purified by electrophoresis on an agarose gel. The purified products were mixed in a 1:1 molar ratio and allowed to stand at 95°C for 5 minutes, followed by 5 minutes at room temperature. A final volume of 50 μL reaction solution (1U KOD-Plus-Neo DNA polymerase (TOYOBO), 1.5 mM MgSO4 (TOYOBO), 0.2 mM dNTPs Mix (TOYOBO), 1 x PCR Buffer for KOD plus neo PCR (TOYOBO)) was prepared, containing 10 μL of this mixture. The reaction was carried out in two cycles, with each cycle consisting of 94°C for 2 minutes, 95°C for 30 seconds, 63°C for 30 seconds, and 68°C for 1 minute 50 seconds. 5 μL of this reaction solution was taken, and PCR was performed using primers F1 and R1. The PCR reaction mixture was prepared with 1 x PCR buffer for KOD-Plus-Neo, 0.2 mM dNTPs, 1.5 mM MgSO4, 0.2 μM primer, and 1 U KOD-Plus-Neo DNA polymerase. The final volume was 50 μL, and the reaction was carried out for 30 cycles, consisting of pre-denaturation at 94°C for 2 minutes, denaturation at 98°C for 10 seconds, annealing at 63°C for 30 seconds, and extension at 68°C for 1 minute 50 seconds.The obtained PCR amplification fragments and pcDNA3.1 expression plasmid fragments, cleaved with BamHI and EcoRI, were ligated using the In-Fusion HD Cloning Kit (Takara Bio Inc.) according to the provided protocol. After the reaction, the in-fusion reaction solution was used to transform Escherichia coli (DH5α). The transformed Escherichia coli were seeded on LB plates supplemented with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. Subsequently, the nucleotide sequences of the plasmids they contained were determined to obtain expression plasmids.

[0153] Furthermore, when the amino acid sequence of wild-type AgOR28 was predicted using TMpred (K. Hofmann, W. Stoffel, TMbase - a database of membrane spanning proteins segments, Biol. Chem. Hoppe-Seyler, 374 (1993), p. 166, https: / / embnet.vital-it.ch / software / TMPRED_form.html) with default settings, the amino acid region from position 55 to 84 was predicted to be the first extracellular loop. From this, it was determined that the deleted region is the first extracellular loop.

[0154] < Example 2 Preparation of mutant AgOR28 (T25K mutation, 22a.a deletion) expression plasmid: A plasmid (pcDNA3.1) was prepared containing the coding sequence (nucleotide sequence: SEQ ID NO: 26) of mutant AgOR28 (T25K mutation, 22a.a deletion) (amino acid sequence: SEQ ID NO: 25), in which the 25th amino acid residue, threonine, in the amino acid sequence of wild-type AgOR28 is mutated to lysine, and 22 amino acids from the 52nd to the 73rd position are consecutively deleted. Specifically, it was prepared in the same manner as Comparative Example 2, except that the mutant AgOR28 (22a.a deletion) expression plasmid (Example 1) was used as the PCR template.

[0155] < Example 3 Preparation of mutant AgOR28 (P31T mutation, 22a.a deletion) expression plasmid: A plasmid (pcDNA3.1) was prepared containing the coding sequence (nucleotide sequence: SEQ ID NO: 28) of mutant AgOR28 (P31T mutation, 22a.a deletion) (amino acid sequence: SEQ ID NO: 27), in which the 31st amino acid residue, proline, of the wild-type AgOR28 amino acid sequence is mutated to threonine, and 22 amino acids from the 52nd to the 73rd position are consecutively deleted. Specifically, it was prepared in the same manner as Comparative Example 3, except that the mutant AgOR28 (22a.a deletion) expression plasmid (Example 1) was used as the PCR template.

[0156] < Example 4 Preparation of mutant AgOR28 (T25K-P31T double mutation, 22a.a deletion) expression plasmid: A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 30) of mutant AgOR28 (T25K-P31T double mutation, 22a.a deletion) (amino acid sequence: SEQ ID NO: 29), in which the amino acid sequence of wild-type AgOR28 is mutated from threonine at the 25th amino acid residue to lysine, from proline at the 31st amino acid residue to threonine, and 22 consecutive amino acids from the 52nd to the 73rd amino acid residue are deleted, was prepared. Specifically, it was prepared in the same manner as Comparative Example 3, except that the mutant AgOR28 (T25K mutation, 22a.a deletion) expression plasmid (Example 2) was used as the PCR template.

[0157] < Reference example 1 .Construction of Chimeric Orco Expression Plasmids> In accordance with a previously reported study (Japanese Patent Publication No. 2018-50556), a plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 93) of the fusion protein Dm(NT-TM4)AmORCO (amino acid sequence: SEQ ID NO: 92), which is a combination of a portion of the Drosophila coreceptor and a portion of the honeybee coreceptor, was constructed. In Dm(NT-TM4)AmORCO, the amino acid sequence from the N-terminal region (NT) to the fourth transmembrane domain (TM4) (the amino acid sequence from the N-terminal amino acid residue to the 234th amino acid residue) is derived from the Drosophila coreceptor (Dm(NT-TM4)), and the amino acid sequence from the second intracellular loop to the C-terminal region is derived from the honeybee coreceptor (Am(IC2-CT)).

[0158] Test Example 1-2. Introduction of Expression Plasmid into Cells HEK293FT cells (purchased from Invitrogen) were seeded in 10cm petri dishes at a rate of 3 × 10^6 cells / dish and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C under 5% CO2 conditions for approximately 24 hours. 1.5 μg of one of the prepared olfactory receptor expression plasmids, 3.0 μg of an olfactory receptor co-receptor expression plasmid, and 8 μg of a GFP-aequorin (GAP) expression plasmid were mixed with 12.5 μL of Plus reagent and 31.25 μL of lipofectamine LTX (Invitrogen) and held for 10 minutes. This mixture was then transfected into the cells. Four hours after the start of transfection, cells were seeded at 9 × 10^4 cells / well in a 96-well plate and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. This yielded transformed cells in which olfactory receptor expression plasmids, olfactory receptor coreceptor expression plasmids, and GAP expression plasmids were transiently introduced.

[0159] Test Examples 1-3. Activity Measurement GFP-aequorin (GAP) is activated when it binds to calcium ions and emits green fluorescence in the presence of substrates such as coelenterazine. Therefore, an increase in intracellular calcium ion concentration in cells expressing GAP directly manifests as an increase in fluorescence intensity. Thus, by adding a test substance, it is possible to measure whether the olfactory receptor complex is functioning as an ion channel by observing the change in fluorescence intensity.

[0160] The culture medium of the transformed cells described above was removed and replaced with Assay buffer (Hanks-HEPES (20 mM pH 7.4) containing 0.5 μM coelenterazine h (Promega) and 0.3% BSA), and the cells were left to stand at room temperature for a further 4 hours. Then, using a Flexstation 3 (Molecular Devices), the test substance corresponding to the olfactory receptor was added to the cell culture medium, and the luminescence of the cells was measured.

[0161] In this test example, 2,3-dinitrotoluene, 2,6-dinitrotoluene, or toluene were used as the test substance.

[0162] The results are shown in Figure 1. It was found that Anopheles mosquito olfactory receptor 28 containing the 22a.a deletion showed responsiveness to nitro compounds but not to non-nitro compounds. On the other hand, Anopheles mosquito olfactory receptor 28 without this deletion did not show responsiveness to nitro compounds.

[0163] Test Example 2. Measurement of the nitro compound responsiveness of AgOR47 The response activity of olfactory receptors (wild-type AgOR47 and mutant AgOR47) to nitro compounds was measured.

[0164] Test Example 2-1. Production of Expression Plasmids < Comparative Example 5 .Construction of wild-type AgOR47 expression plasmid> A double-stranded DNA containing the coding sequence (nucleotide sequence: SEQ ID NO: 7) for wild-type AgOR47 (amino acid sequence: SEQ ID NO: 2) was synthesized on one of the DNA strands and introduced into pcDNA3.1 to obtain a wild-type AgOR47 expression plasmid (pcDNA3.1-AgOR47).

[0165] < Comparative Example 6 Construction of mutant AgOR47 (L71F mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 36) of a mutant AgOR47 (L71F mutation) (amino acid sequence: SEQ ID NO: 35), in which the 71st amino acid residue, leucine, in the wild-type AgOR47 amino acid sequence is mutated to phenylalanine, was constructed as follows.

[0166] PCR primers were synthesized (Primer F: CTATCGCCGAGGGCATGTTCAGCTTCAATACCACC (SEQ ID NO: 37) and Primer R: GGTGGTATTGAAGCTGAACATGCCCTCGGCGATAG (SEQ ID NO: 38)) designed to convert leucine, the 71st amino acid residue in the amino acid sequence of wild-type AgOR47, to phenylalanine. Using these primers, PCR amplification was performed with pcDNA3.1-AgOR47 as the template (reaction procedure and conditions were standard). After amplification, the PCR reaction mixture was digested with DpnI and then transformed into Escherichia coli (DH5α). The transformed Escherichia coli was seeded on LB plates supplemented with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. Subsequently, the nucleotide sequences of the plasmids they contained were determined to obtain mutant AgOR47 (L71F mutation) expression plasmids.

[0167] < Comparative Example 7 Construction of mutant AgOR47 (I134V mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 40) of a mutant AgOR47 (I134V mutation) (amino acid sequence: SEQ ID NO: 39) in which the isoleucine residue at position 134 of the amino acid sequence of wild-type AgOR47 is mutated to valine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F:CATCTTCACCAACGGCGTCGTGTTCGCCATGAC (SEQ ID NO: 41) and primer R:GGTCATGGCGAACACGACGCCGTTGGTGAAGATG (SEQ ID NO: 42) were used as PCR primers.

[0168] < Comparative Example 8 Construction of a mutant AgOR47 (S140G mutation) expression plasmid. A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 44) of a mutant AgOR47 (S140G mutation) (amino acid sequence: SEQ ID NO: 43) in which the 140th amino acid residue, serine, in the wild-type AgOR47 amino acid sequence is mutated to glycine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F:GTGTTCGCCATGACCGGCTCTACAATCGCCGG (SEQ ID NO: 45) and primer R:CCGGCGATTGTAGAGCCGGTCATGGCGAACAC (SEQ ID NO: 46) were used as PCR primers.

[0169] < Comparative Example 9 Construction of mutant AgOR47 (F147L mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 48) of a mutant AgOR47 (F147L mutation) (amino acid sequence: SEQ ID NO: 47) in which phenylalanine at the 147th amino acid residue in the amino acid sequence of wild-type AgOR47 is mutated to leucine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F: CAATCGCCGGCATGTTCTACACCTACTACACC (SEQ ID NO: 49) and primer R: GGTGTAGTAGGTGTAGAACATGCCGGCGATTG (SEQ ID NO: 50) were used as PCR primers.

[0170] < Comparative Example 10 Construction of mutant AgOR47 (D5E mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 52) of a mutant AgOR47 (D5E mutation) (amino acid sequence: SEQ ID NO: 51), in which the fifth amino acid residue, aspartic acid, in the amino acid sequence of wild-type AgOR47 is mutated to glutamic acid, was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F:ATGGTTGTGTTCGAACCACTGGACGACCC (SEQ ID NO: 53) and primer R:GGGTCGTCCAGTGGTTCGAACACAACCAT (SEQ ID NO: 54) were used as PCR primers.

[0171] < Comparative Example 11 Construction of a mutant AgOR47 (K235Q mutation) expression plasmid. A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 56) of a mutant AgOR47 (K235Q mutation) (amino acid sequence: SEQ ID NO: 55) in which the 235th amino acid residue, lysine, in the amino acid sequence of wild-type AgOR47 is mutated to glutamine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F: GATCGGACCCGTTGACCAGTATACTGCAGAGCTG (SEQ ID NO: 57) and primer R: CAGCTCTGCAGTATACTGGTCAACGGGTCCGATC (SEQ ID NO: 58) were used as PCR primers.

[0172] < Comparative Example 12 Construction of a mutant AgOR47 (N241S mutation) expression plasmid. A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 60) of a mutant AgOR47 (N241S mutation) (amino acid sequence: SEQ ID NO: 59) in which the 241st amino acid residue, asparagine, in the wild-type AgOR47 amino acid sequence is mutated to serine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F:GTATACTGCAGAGCTGAGTGAAATTATCGAACTTCAC (SEQ ID NO: 61) and primer R:GTGAAGTTCGATAATTTCACTCAGCTCTGCAGTATAC (SEQ ID NO: 62) were used as PCR primers.

[0173] < Example 5 Construction of mutant AgOR47 (L60P mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 32) of a mutant AgOR47 (L60P mutation) (amino acid sequence: SEQ ID NO: 31), in which the 60th amino acid residue, leucine, in the wild-type AgOR47 amino acid sequence is mutated to proline, was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F:CTACGAGACAATCCCGCAGTGCTTCCGGTC (SEQ ID NO: 33) and primer R:GACCGGAAGCACTGCGGGATTGTCTCGTAG (SEQ ID NO: 34) were used as PCR primers.

[0174] < Example 6 Construction of mutant AgOR47 (M138I mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 64) of a mutant AgOR47 (M138I mutation) (amino acid sequence: SEQ ID NO: 63) in which the 138th amino acid residue, methionine, in the wild-type AgOR47 amino acid sequence is mutated to isoleucine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F: GGCGTCGTGTTCGCCATCACCGGCTCTACAATC (sequence number 65) and primer R: GATTGTAGCCGGTGATGGCGAACACGACGCC (sequence number 66) were used as PCR primers.

[0175] < Example 7 Construction of mutant AgOR47 (A152T mutation) expression plasmid > A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 68) of a mutant AgOR47 (A152T mutation) (amino acid sequence: SEQ ID NO: 67) in which the amino acid residue at position 152 of the wild-type AgOR47 amino acid sequence is mutated from alanine to threonine was constructed. Specifically, it was constructed in the same manner as in Comparative Example 6, except that primer F: GGATGTTTTACACCTACTACACGAAAGATTCGGAATATTCC (SEQ ID NO: 69) and primer R: GGAATATTCCGAATCTTTCGTGTAGTAGGTGTAAAACATTCC (SEQ ID NO: 70) were used as PCR primers.

[0176] < Example 8 .Construction of mutant AgOR47 (L60P-A152T double mutation) expression plasmid> A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 72) of mutant AgOR47 (L60P-A152T double mutation) (amino acid sequence: SEQ ID NO: 71), which has an L60P--A152T double mutation in the amino acid sequence of wild-type AgOR47, was constructed. Specifically, the expression plasmid was constructed in the same manner as in Example 7, except that the mutant AgOR47 (L60P mutation) expression plasmid (Example 5) was used as the PCR template.

[0177] < Example 9 Preparation of mutant AgOR47 (M138I-A152T double mutation) expression plasmid: A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 74) of mutant AgOR47 (M138I-A152T double mutation) (amino acid sequence: SEQ ID NO: 73), which has an M138I-A152T double mutation in the amino acid sequence of wild-type AgOR47, was prepared. Specifically, it was prepared in the same manner as in Example 7, except that the mutant AgOR47 (M138I mutation) expression plasmid (Example 6) was used as the PCR template.

[0178] < Example 10 Preparation of mutant AgOR47 (L60P-M138I-A152T triple mutation) expression plasmid: A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 76) of mutant AgOR47 (L60P-M138I-A152T triple mutation) (amino acid sequence: SEQ ID NO: 75), which has the L60P-M138I-A152T triple mutation in the amino acid sequence of wild-type AgOR47, was prepared. Specifically, it was prepared in the same manner as in Example 6, except that the mutant AgOR47 (L60P-A152T double mutation) expression plasmid (Example 8) was used as the PCR template.

[0179] < Example 11 Construction of a mutant AgOR47 (L60P-L71F-I134V-S140G-F147L quintuple mutation) expression plasmid. A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 109) of a mutant AgOR47 (L60P-L71F-I134V-S140G-F147L quintuple mutation) (amino acid sequence: SEQ ID NO: 108) with the L60P-L71F-I134V-S140G-F147L quintuple mutation in the amino acid sequence of wild-type AgOR47 was constructed. Specifically, the mutant AgOR47 (L60P double mutation) expression plasmid (Example 5) was used as a PCR template, and the mutation was sequentially introduced using the primers used in the comparative example above.

[0180] < Example 12 Construction of a mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L-A152T 7-fold mutation) expression plasmid. A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 78) of a mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L-A152T sevenfold mutation) (amino acid sequence: SEQ ID NO: 77) with the sevenfold mutation L60P-L71F-I134V-M138I-S140G-F147L-A152T sevenfold mutation) in the amino acid sequence of wild-type AgOR47 was constructed. Specifically, first, the mutant AgOR47 (L60P-L71F-I134V-S140G-F147L fivefold mutation) expression plasmid (Example 11) was used as a PCR template, and the mutation was sequentially introduced using the primers used in the above examples and comparative examples.

[0181] < Example 13 Construction of a mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L hexa-mutation) expression plasmid. A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 80) of a mutant AgOR47 (L60P-L71F-I134V-M138I-S140G-F147L hexavalent mutation) (amino acid sequence: SEQ ID NO: 79) with the L60P-L71F-I134V-M138I-S140G-F147L hexavalent mutation) in the amino acid sequence of wild-type AgOR47 was constructed. Specifically, the mutant AgOR47 (L60P-L71F-I134V-S140G-F147L pentavalent mutation) expression plasmid (Example 11) was used as a PCR template, and the mutation was introduced using the primers used in the above example.

[0182] Test Example 2-2. Introduction of expression plasmid into cells and measurement of activity. Expression plasmids were introduced into cells in the same manner as in Test Example 1-2, and activity was measured in the same manner as in Test Example 1-3. In this test, 4-amino-2,6-dinitrotoluene, 3-trifluoromethyl-4-nitrophenol, 2,3-dinitrotoluene, 2,6-dinitrotoluene, or 2,3-dimethyl-2,3-dinitrobutane were used as the test substances.

[0183] The results are shown in Figures 2 to 6. It was found that Anopheles mosquito olfactory receptor 47 containing at least one amino acid substitution selected from the group consisting of A61, M138, and A152 exhibited nitro compound responsiveness. On the other hand, Anopheles mosquito olfactory receptor 47 without the deletion did not exhibit nitro compound responsiveness.

[0184] Test Example 3. Measurement of the responsiveness of AgOR6 to nitro compounds The response activity of olfactory receptors (wild-type AgOR6 and mutant AgOR6) to nitro compounds was measured.

[0185] Test Example 3-1. Production of Expression Plasmids < Comparative Example 13 .Construction of wild-type AgOR6 expression plasmid> A double-stranded DNA containing the coding sequence (nucleotide sequence: SEQ ID NO: 8) for wild-type AgOR6 (amino acid sequence: SEQ ID NO: 3) was synthesized on one of the DNA strands and introduced into pcDNA3.1 to obtain a wild-type AgOR6 expression plasmid (pcDNA3.1-AgOR6).

[0186] < Example 14 Construction of mutant AgOR6 expression plasmids > A plasmid (pcDNA3.1) was constructed containing the coding sequence (nucleotide sequence: SEQ ID NO: 82) of a mutant AgOR6 (amino acid sequence: SEQ ID NO: 81), in which the amino acid sequence of wild-type AgOR6 is modified in the following ways: the 114th amino acid residue, serine, is replaced by alanine; the 120th amino acid residue, alanine, is replaced by glutamic acid; the 162nd amino acid residue, histidine, is replaced by tyrosine; the 186th amino acid residue, valine, is replaced by alanine; the 352nd amino acid residue, valine, is replaced by methionine; and the 368th amino acid residue, serine, is replaced by proline, resulting in 79 amino acid substitutions (including the substitution of 11 charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop). Specifically, a double-stranded DNA containing the coding sequence (nucleotide sequence: SEQ ID NO: 82) of mutant AgOR6 (amino acid sequence: SEQ ID NO: 81) was synthesized on one of the DNA strands, and this was introduced into pcDNA3.1 to obtain a mutant AgOR6 expression plasmid (pcDNA3.1-AgOR6). .

[0187] Test Example 3-2. Introduction of expression plasmid into cells and measurement of activity. The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, 2-nitroaniline was used as the test substance.

[0188] The results are shown in Figure 7. The mutant Anopheles mosquito olfactory receptor 6 was found to be responsive to nitro compounds. In contrast, the wild-type Anopheles mosquito olfactory receptor 6 did not show responsiveness to nitro compounds.

[0189] Test Example 4. Measurement of the nitro compound responsiveness of AgOR15 The response activity of olfactory receptors (wild-type AgOR15 and mutant AgOR15) to nitro compounds was measured.

[0190] Test Example 4-1. Production of Expression Plasmids < Comparative Example 14 Construction of wild-type AgOR15 expression plasmid > A double-stranded DNA containing the coding sequence (nucleotide sequence: SEQ ID NO: 9) for wild-type AgOR15 (amino acid sequence: SEQ ID NO: 4) was synthesized on one of the DNA strands and introduced into pcDNA3.1 to obtain a wild-type AgOR15 expression plasmid (pcDNA3.1-AgOR15).

[0191] < Example 15 Construction of mutant AgOR15 expression plasmids > A plasmid (pcDNA3.1) was constructed containing the coding sequence (nucleotide sequence: SEQ ID NO: 84) of a mutant AgOR15 (amino acid sequence: SEQ ID NO: 83), in which the amino acid sequence of wild-type AgOR15 is modified in the following ways: methionine at position 61 (methionine) is mutated to threonine, cysteine ​​at position 104 (cysteine) is mutated to arginine, arginine at position 112 (arginine) is mutated to glutamine, glycine at position 181 (glycine) is mutated to alanine, valine at position 189 (valine) is mutated to isoleucine, and isoleucine at position 327 (valine). Specifically, Using a wild-type AgOR15 expression plasmid as a template, the following primers were used to create the M61T-C104R-R112Q-G181A-V189I-I327V6 double mutant.

[0192] M61T mutation introduction primer set CCCGACCTTGAGATAACGATCATTGGCACCGCTG (nucleotide sequence: SEQ ID NO: 94) and CAGCGGTGCCAATGATCGTTATCTCAAGGTCGGG (nucleotide sequence: SEQ ID NO: 95) C104R Mutation Introducer Primer Set CCCAAACGGTTATCCGTGCGTCACCTCCCGCG (nucleotide sequence: SEQ ID NO: 96) and CGCGGGAGGTGACGCACGGATAACCGTTTGGG (nucleotide sequence: SEQ ID NO: 97) R112Q Mutation Introducer Primer Set CCTCCCGCGGTGGTCCAGCATTTGACGACCCAG (nucleotide sequence: SEQ ID NO: 98) and CTGGGTCGTCAAATGCTGGACCACCGCGGGAGG (nucleotide sequence: SEQ ID NO: 99) G181A Mutation Introducer Primer Set CAGACTCGCACCTCGGCTACGCACTACCTGATC (nucleotide sequence: SEQ ID NO: 100) and GATCAGGTAGTGCGTAGCCGAGGTGCGAGTCTG (nucleotide sequence: SEQ ID NO: 101) V189I Mutation Introducer Primer Set CTACCTGATCTTCGGTATCGTCATGACGCCTACC (nucleotide sequence: SEQ ID NO: 102) and GGTAGGCGTCATGACGATACCGAAGATCAGGTAG (nucleotide sequence: SEQ ID NO: 103) I327V mutation introduction primer set CGTGTAGCACATACCGTTTACGAAAGTGGCTGG (nucleotide sequence: SEQ ID NO: 104) and CCAGCCACTTTCGTAAACGGTATGTGCTACACG (nucleotide sequence: SEQ ID NO: 105).

[0193] Test Example 4-2. Introduction of expression plasmid into cells and measurement of activity. The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, 2-nitroaniline was used as the test substance.

[0194] The results are shown in Figure 8. The mutant Anopheles mosquito olfactory receptor 15 was found to be responsive to nitro compounds. In contrast, the wild-type Anopheles mosquito olfactory receptor 15 did not show responsiveness to nitro compounds.

[0195] Test Example 5. Measurement of Nitro Compound Responsiveness of AaOR4 The response activity of olfactory receptors (two types of wild-type AaOR4) to nitro compounds was measured.

[0196] Test Example 5-1. Production of Expression Plasmids < Comparative Example 15 .Construction of wild-type AaOR4 type 1 expression plasmid> A double-stranded DNA containing the coding sequence (nucleotide sequence: SEQ ID NO: 10) for wild-type AaOR4 type 1 (amino acid sequence: SEQ ID NO: 5) was synthesized on one of the DNA strands and introduced into pcDNA3.1 to obtain a wild-type AaOR4 type 1 expression plasmid (pcDNA3.1-AaOR4 type 1).

[0197] < Example 16 .Construction of wild-type AaOR4 type 2 expression plasmid> A plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 86) of wild-type AaOR4 type 2 (amino acid sequence: SEQ ID NO: 85), which is formed by a mutation in the amino acid sequence of wild-type AaOR4 type 1, where leucine at amino acid residue 178 is replaced with proline, was constructed. Specifically, it was constructed as follows.

[0198] PCR primers (GGGTCAAGCTATTTCCGTACGTGATTTGGTTC (SEQ ID NO: 106), GAACCAAATCACGTACGGAAATAGCTTGACCC (SEQ ID NO: 107)) were synthesized to convert leucine, the 178th amino acid residue in the wild-type AaOR4 amino acid sequence, to proline. Using these primers, PCR amplification was performed with pcDNA3.1-AaOR4 type 1 as the template (reaction procedure and conditions were standard). After amplification, the PCR reaction mixture was digested with DpnI and then transformed into Escherichia coli (DH5α). The transformed Escherichia coli was seeded on a plate supplemented with ampicillin and cultured at 37°C to form colonies. Two colonies were selected and cultured again in LB liquid medium. Subsequently, the nucleotide sequences of the plasmids they contained were determined to obtain a wild-type AaOR4 type 2 (L178P mutation) expression plasmid.

[0199] Test Example 5-2. Introduction of expression plasmid into cells and measurement of activity. The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, 2,4-dinitrotoluene, 4-nitrotoluene, or toluene was used as the test substance.

[0200] The results are shown in Figure 9. Wild-type AaOR4 type 2 was found to be responsive to nitro compounds. On the other hand, wild-type AaOR4 type 1 did not show responsiveness to nitro compounds.

[0201] Test Example 6. Comparison with Conventional Technology It is known that cells into which the mouse olfactory receptor Olfr256_17 has been introduced respond to nitro compounds. Such cells are known to be produced by introducing plasmids encoding the mouse olfactory receptor Olfr256_17, the G protein (Gα15_olf), the receptor transport protein (RTP1S), and GAP. Therefore, in this study, such cells (mouse olfactory receptor-expressing cells) were produced and their responsiveness to nitro compounds was compared with cells obtained in one embodiment of the present invention (cells into which mutant AgOR28 (T25K mutation, 22a.a deletion) (Example 2) was introduced (Test Examples 1-2)).

[0202] First, expression plasmids for the mouse olfactory receptor Olfr256_17 (amino acid sequence: SEQ ID NO: 87), which has rho and myc tags added to its N-terminus (rho-myc-mOlfr256_17 / pcDNA3.1), expression plasmids for Gα15_olf (amino acid sequence: SEQ ID NO: 88) (Ga15_olf / pBK-CMV), and expression plasmids for RTPS (amino acid sequence: SEQ ID NO: 89) (mRTP1S / pcDNA3.1) were prepared according to standard methods.

[0203] HEK293FT cells (purchased from Invitrogen) were seeded in 10cm petri dishes at a rate of 3 × 10^6 cells / dish and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C under 5% CO2 conditions for approximately 24 hours. The prepared Ga15_olf / pBK-CMV (1 μg), rho-myc-mOlfr256_17 / pcDNA3.1 (2.5 μg), mRTP1S / pcDNA3.1 (1 μg), and GFP-Aequorin / pcDNA3.1 (8 μg) were mixed with 12.5 μL of Plus reagent and 31.25 μL of lipofectamine LTX (Invitrogen) and held for 10 minutes. Subsequently, this mixture was transfected into the cells. Four hours after the start of transfection, cells were seeded at 9 × 10^4 cells / well in a 96-well plate and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. This yielded transformed cells in which mouse olfactory receptor Olfr256_17, G protein, receptor transport protein expression plasmids, and GAP expression plasmids were transiently introduced (mouse olfactory receptor expressing cells).

[0204] Cells into which the mutant AgOR28 (T25K mutation, 22a.a deletion) (Example 2) was introduced (Test Examples 1-2), and the mouse olfactory receptor-expressing cells obtained above were used to measure activity in the same manner as in Test Examples 1-3. In these tests, 3-nitrotoluene was used as the test substance.

[0205] The results are shown in Figure 10. It was found that the mutant AgOR28 (T25K mutation, 22a.a deletion) could detect nitro compounds with higher sensitivity and activity than the mouse olfactory receptor.

[0206] Test Example 7. Introduction of amino acid mutations into the seventh transmembrane region. An expression plasmid for mutant AgOR28 (T25K-P31T-S368A-Q376A-R380A-S382L-S385A 7-mutation, 22a.a deletion), which was created by introducing an additional amino acid substitution (S368A, Q376A, R380A, S382L, S385A) in the 7th transmembrane region of mutant AgOR28 (T25K-P31T double mutation, 22a.a deletion) (Example 4), was prepared using PCR mutation induction technology, similar to Example 4. The expression plasmid was introduced into cells in the same manner as in Test Examples 1-2, and activity was measured in the same manner as in Test Examples 1-3. In this test example, 2,3-dinitrotoluene was used as the test substance.

[0207] The results are shown in Figure 11. It was found that introducing a mutation in the seventh transmembrane region increased the responsiveness to nitro compounds.

Claims

1. (1) Amino acid sequence 1C is formed by a mutation in amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 90% or more identity with amino acid sequence 1A, wherein mutation 1a: includes a deletion of part or all of the region of the first extracellular loop; (2) Amino acid sequence 2C is formed by a mutation in amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 90% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B; (3) Amino acid sequence 3C, which is formed by mutations in amino acid sequence 3A shown in Sequence ID No. 3 or amino acid sequence 3B having 90% or more identity with amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in amino acid sequence 3A or substitution 3ay in amino acid sequence 3B corresponding to substitution 3ax, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop; (4) Amino acid sequence 4C is formed by a mutation in amino acid sequence 4A shown in Sequence ID No. 4 or amino acid sequence 4B having 90% or more identity with amino acid sequence 4A, wherein mutation 4a: contains substitution 4ax of the amino acid group consisting of M61, C104, R112, G181, V189, and I327 in amino acid sequence 4A, or substitution 4ay corresponding to substitution 4ax in amino acid sequence 4B; or (5) Amino acid sequence 5C is formed by a mutation in amino acid sequence 5A shown in Sequence ID No. 5 or amino acid sequence 5B which has 90% or more identity with amino acid sequence 5A, wherein mutation 5a: contains the substitution 5ax of amino acid at L178 in amino acid sequence 5A or the substitution 5ay corresponding to the substitution 5ax in amino acid sequence 5B. It consists of olfactory receptor proteins that include The deletion region in mutation 1a is the region from the N-terminal amino acid to 15-25 amino acids; the mutated amino acid at L60 in mutation 2a is proline, the mutated amino acid at M138 is isoleucine, valine, or leucine, and / or the mutated amino acid at A152 is threonine; In mutation 3a, the mutated amino acid of S114 is alanine, glycine, valine, isoleucine, or leucine; the mutated amino acid of A120 is glutamic acid or aspartic acid; the mutated amino acid of H162 is tyrosine; the mutated amino acid of V186 is alanine; the mutated amino acid of V352 is methionine; and the mutated amino acid of S368 is proline; The number of substitutions to uncharged amino acids in mutation 3b is 8 to 14; In mutation 4a, the mutated amino acid of M61 is threonine, asparagine, glutamine, or serine; the mutated amino acid of C104 is arginine; the mutated amino acid of R112 is glutamine; the mutated amino acid of G181 is alanine; the mutated amino acid of V189 is isoleucine; and the mutated amino acid of I327 is valine; In mutation 5a, the mutated amino acid at L178 is proline. Nitro compound detection element.

2. The deletion region in mutation 1a is the region from the N-terminal amino acid to 15-25 amino acids; the mutated amino acid at L60 in mutation 2a is proline, the mutated amino acid at M138 is isoleucine, valine, or leucine, and / or the mutated amino acid at A152 is threonine; In mutation 3a, the mutated amino acid of S114 is alanine, glycine, valine, isoleucine, or leucine; the mutated amino acid of A120 is glutamic acid or aspartic acid; the mutated amino acid of H162 is tyrosine; the mutated amino acid of V186 is alanine; the mutated amino acid of V352 is methionine; and the mutated amino acid of S368 is proline; The number of substitutions to uncharged amino acids in mutation 3b is 8 to 14; In mutation 4a, the mutated amino acid of M61 is threonine, asparagine, or glutamine; the mutated amino acid of C104 is arginine; the mutated amino acid of R112 is glutamine; the mutated amino acid of G181 is alanine; the mutated amino acid of V189 is isoleucine; and the mutated amino acid of I327 is valine; In mutation 5a, the mutated amino acid at L178 is proline. The nitro compound detection element according to claim 1.

3. In mutation 1a, the deletion region is the region from the N-terminal amino acid to 15-25 amino acids; in mutation 2a, the amino acid after mutation L60 is proline, the amino acid after mutation M138 is isoleucine, and / or the amino acid after mutation A152 is threonine; in mutation 3a, the amino acid after mutation S114 is alanine, the amino acid after mutation A120 is glutamic acid, the amino acid after mutation H162 is tyrosine, the amino acid after mutation V186 is alanine, the amino acid after mutation V352 is methionine, and the amino acid after mutation S368 is proline; The number of substitutions to uncharged amino acids in mutation 3b is 8 to 14; In mutation 4a, the mutated amino acid of M61 is threonine, the mutated amino acid of C104 is arginine, the mutated amino acid of R112 is glutamine, the mutated amino acid of G181 is alanine, the mutated amino acid of V189 is isoleucine, and the mutated amino acid of I327 is valine; In mutation 5a, the mutated amino acid at L178 is proline. The nitro compound detection element according to claim 1 or 2.

4. The nitro compound detection element according to any one of claims 1 to 3, wherein the nitro compound is a compound having a structure in which a nitro group is directly linked to a benzene ring, and / or a compound containing two or more nitro groups.

5. The olfactory receptor protein, The general formula in the corresponding wild-type olfactory receptor protein (1): φ 7 X 1 X 2 Z 1 X 3 X 4 Z 2 Z 3 φ 6 Uφ 5 φ 4 φ 3 φ 2 φ 1 X 5 X 6 [In the formula, X 1 ~X 6 and Z 1 ~Z 3 This shows amino acids derived from the amino acid sequence of wild-type insect olfactory receptors, φ 1 It exhibits hydrophobic amino acids, φ 2 ~φ 7 Each of these independently represents either an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid. It includes an amino acid sequence B which is formed by a mutation of the amino acid sequence A shown, Conditions 1-3 below: (Condition 1) In the above amino acid sequence B, X 3 and / or X 4 D is replaced by X 3 is a branched-chain amino acid and / or X 4 It is an uncharged polar amino acid. (Condition 2) In the above amino acid sequence A, X 5 and X 6 When both are positively charged polar amino acids, in the amino acid sequence B, X 6 (Condition 3) In the amino acid sequence A, X 1 and X 2 If one or both of the amino acids are positively charged polar amino acids, then in the amino acid sequence B, 1 and / or X 2 D is replaced by X 1 is an uncharged polar amino acid and / or X 2 The fact that it is a hydrophobic amino acid Selected from the group consisting of, satisfying at least one condition, A nitro compound detection element according to any one of claims 1 to 4.

6. (1) Amino acid sequence 1C is formed by a mutation in amino acid sequence 1A shown in Sequence ID No. 1 or amino acid sequence 1B having 90% or more identity with amino acid sequence 1A, wherein mutation 1a: deletion of part or all of the first extracellular loop region, and mutation 1b: substitution 1bx of at least one amino acid selected from the group consisting of T25 and P31 in amino acid sequence 1A or substitution 1by corresponding to substitution 1bx in amino acid sequence 1B, wherein the amino acid after the mutation of T25 or the amino acid corresponding thereto in mutation 1b is a basic amino acid, and the amino acid after the mutation of P31 or the amino acid corresponding thereto is a hydrophilic neutral amino acid; (2) Amino acid sequence 2C obtained by mutating amino acid sequence 2A shown in Sequence ID No. 2 or amino acid sequence 2B having 90% or more identity with amino acid sequence 2A, wherein mutation 2a: includes substitution 2ax of at least one amino acid selected from the group consisting of L60, M138 and A152 in amino acid sequence 2A, or substitution 2ay corresponding to substitution 2ax in amino acid sequence 2B, wherein the amino acid after mutation of L60 or the amino acid corresponding thereto in mutation 2a is proline, the amino acid after mutation of M138 or the amino acid corresponding thereto is a branched-chain amino acid, and the amino acid after mutation of A152 or the amino acid corresponding thereto is a hydrophilic neutral amino acid; or (3) The amino acid sequence 3C is formed by mutations in the amino acid sequence 3A shown in Sequence ID No. 3 or the amino acid sequence 3B having 90% or more identity with the amino acid sequence 3A, wherein mutation 3a: substitution 3ax of the amino acid group consisting of S114, A120, H162, V186, V352, and S368 in the amino acid sequence 3A or substitution 3ay corresponding to the substitution 3ax in the amino acid sequence 3B, and mutation 3b: substitution of charged amino acids with uncharged amino acids in the region from the third extracellular loop to the third intracellular loop, The deletion region in mutation 1a is the region from the N-terminal amino acid to 15-25 amino acids; the mutated amino acid of M138 in mutation 2a is isoleucine, valine, or leucine, and / or the mutated amino acid of A152 is threonine; In mutation 3a, the mutated amino acid of S114 is alanine, glycine, valine, isoleucine, or leucine; the mutated amino acid of A120 is glutamic acid or aspartic acid; the mutated amino acid of H162 is tyrosine; the mutated amino acid of V186 is alanine; the mutated amino acid of V352 is methionine; and the mutated amino acid of S368 is proline; The number of substitutions to uncharged amino acids in mutation 3b is 8 to 14. , an olfactory receptor protein that is responsive to nitro compounds.

7. A polynucleotide comprising the coding sequence for the olfactory receptor protein described in claim 6.

8. A cell comprising the polynucleotide described in claim 7.

9. A non-human animal comprising the cells described in claim 8.

10. A nitro compound detection sensor, A lipid bilayer containing a nitro compound detection element according to any one of claims 1 to 5, A cell containing the nitro compound detection element, or Non-human animals containing the aforementioned cells, A nitro compound detection sensor equipped with the following features.

Images