Bisulfite-free whole-genome methylation analysis

Abstract

To provide methods for cost-effective bisulfite-free identification in DNA, including whole genomic DNA, of the locations of one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine and 5-formylcytosine.SOLUTION: The methods described herein are based on the conversion of modified cytosine (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU), for example by Tet-assisted pyridine borane treatment, followed by endonuclease cleavage of the DHU, and identification of the cleavage site, which corresponds to the location of the modified cytosine.SELECTED DRAWING: Figure 29A

Description

Detailed description of the invention

[0001] [Technical Field] This disclosure provides a method for locating the positions of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine, and / or 5-formylcytosine in the entire genome. [Background technology] 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) are two major epigenetic marks found in the mammalian genome. 5hmC is produced from 5mC by dioxygenases of the 10-11 translocation (TET) family. TET can further oxidize 5hmC to 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC), which are considerably less abundant than 5mC and 5hmC in the mammalian genome (1 / 10 to 1 / 100th the amount of 5hmC). 5mC and 5hmC work together to play crucial roles in a wide range of biological processes, from gene regulation to normal development. Abnormal DNA methylation and hydroxymethylation are associated with various diseases and are widely recognized as features of cancer. Therefore, the identification of 5mC and 5hmC in DNA sequences is important not only for basic research but also for clinical applications, including diagnosis and treatment.

[0002] 5fC and 5caC are two final oxidative derivatives of 5mC that can be converted to unmodified cytosine by thymine DNA glycosylase (TDG) in the base excision repair pathway. In other words, 5fC and 5caC are two key intermediates in the active demethylation process, which plays a crucial role in embryonic development. 5fC and 5caC have been identified in these situations and can serve as indicators that 5mC demethylation is nearly complete. 5fC and 5caC may also perform additional functions, such as binding to specific proteins and affecting the rate and specificity of RNA polymerase II.

[0003] Among the methods for analyzing DNA methylation and hydroxymethylation, the current gold standard and most widely used method is bisulfite sequencing (BS), as well as its derivatives such as Tet-assisted bisulfite sequencing (TAB-Seq) and oxidized bisulfite sequencing (oxBS). Similarly, bisulfite sequencing is the most established method for assaying whole-genomic DNA methylation. In all of these methods, bisulfite treatment is used to convert unmethylated cytosines to uracil, while leaving 5mC and / or 5hmC intact. Through PCR amplification of bisulfite-treated DNA (reading uracil as thymine), modification information for each cytosine can be obtained with single-base resolution (the position of unmethylated cytosines can be obtained by converting C to T). However, bisulfite sequencing has at least two main drawbacks. Firstly, bisulfite treatment is a harsh chemical reaction in which over 90% of DNA is degraded due to depurination under the required acidic and thermal conditions. This degradation severely limits its applications to samples with low input, such as circulating cell-free DNA and clinical samples involving single-cell sequencing. Secondly, bisulfite sequencing relies on the complete conversion of unmodified cytosine to thymine. Unmodified cytosine accounts for approximately 95% of all cytosine in the human genome. When all of these positions are converted to thymine, sequence complexity decreases significantly, sequencing quality declines, mapping rates decrease, genome coverage becomes heterogeneous, and sequencing costs increase. Bisulfite sequencing is also prone to false detection of 5mC and 5hmC due to incomplete conversion of unmodified cytosine to thymine.

[0004] While whole-genome-resolution methylome sequencing allows for the most comprehensive analysis of DNA methylation, its high sequencing costs often limit its applications. Reduced Representation Bisulfite Sequencing (RRBS) can be used to reduce sequencing costs. However, RRBS only targets a small fraction of CpG sites within a given sequence context, thus failing to provide a comprehensive picture of methylation. Therefore, there is a need for a low-cost approach that improves mCpG coverage. [Summary of the Invention] This disclosure provides a methylome analysis method with whole-genome base resolution. In embodiments, the method identifies the location of one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine, and / or 5-formylcytosine in a DNA sample. In embodiments, the DNA sample includes the entire genome. The method described herein is an analysis of DNA methylation and hydroxymethylation, achieving an analysis with a mild reaction that detects modified cytosine with base-level resolution without affecting unmodified cytosine. Provided herein is an improved method for identifying 5mC and / or 5hmC by combining oxidation with TET and reduction with a borane derivative (e.g., pyridineborane and 2-picolineborane (pic-BH3)), which is referred herein as TAPS (TET-assisted pyridineborane sequencing) (Table 1). TAPS directly detects modifications with high sensitivity and specificity without affecting unmodified cytosine, and can also be modified to detect other cytosine modifications as described herein. TAPS is non-destructive and preserves DNA up to 10kb. Compared to bisulfite sequencing, TAPS offers higher mapping rates, more uniform coverage, lower sequencing costs, improved quality, and more comprehensive, less expensive methylome analysis. To identify 5fC and / or 5caC as described herein, a modified form of this method that does not involve an oxidation step is used.

[0005] Whole-genome TAPS (wgTAPS) reduces sequencing costs by half compared to whole-genome bisulfite sequencing (WGBS). However, considering that 5mC and 5hmC account for only about 4% of all cytosine residues in the mammalian genome, and that approximately 65% ​​to 80% of reads generated by short-read whole-genome sequencing do not contain any methylated CpG sites (mCpGs), the cost of whole-genome sequencing remains exorbitant for many projects. To reduce sequencing costs, Reduced Representation Bisulfite Sequencing (RRBS), which involves enriching CpG-rich regions with restriction enzymes before bisulfite treatment, is a widely used method. However, RRBS only covers a small fraction of CpG sites in a given sequence context, and therefore does not provide comprehensive coverage of methylation. Consequently, there is a need for a low-cost approach that improves mCpG coverage. In one embodiment, the Disclosure provides a modified version of the TAPS method (hereinafter referred to as endonuclease-enriched TAPS (eeTAPS)) that provides a novel approach for performing cost-effective genome-wide methylation analysis at a resolution of 1 CpG. In another embodiment, the Disclosure provides modified versions of the TAPS method (e.g., TAPSβ and CAPS) that can be used to detect 5mC, 5hmC, 5fC and / or 5caC.

[0006] In other words, this disclosure provides a low-cost method for identifying one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine, and / or 5-formylcytosine in the whole genome. The method described herein is based on converting modified cytosines (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU) by, for example, TET-assisted pyridineborane treatment, then cleaving the DHU sites with an endonuclease to create DNA fragments, and finally creating a sequencing library from these fragments. Genomic DNA that has not been fragmented cannot be directly sequenced; only in the presence of modified cytosines that can be converted to DHU, the genomic DNA is cleaved into DNA fragments, and then sequenced by each end of the fragment (indicating the location of the modified cytosine). By sequencing these cleaved fragments, methylated cytosines in the original DNA sample can be identified with base-level resolution. Furthermore, since highly methylated cytosine is more likely to be cleaved than less methylated sites, this method can be used to perform semi-quantification of DNA methylation.

[0007] In one embodiment, the present disclosure is a method for identifying 5mC or 5hmC in a DNA sample, a. A step of preparing a DNA sample containing target DNA having 5mC and / or 5hmC, b. The process of modifying the DNA (including the following steps), i. A step of converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5fC. ii. A step of converting the 5caC and / or 5fC to DHU to obtain a modified DNA sample containing the modified target DNA. c. The process of cutting the modified target DNA, d. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, e. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for obtaining either a 5mC or 5hmC position in target DNA based on the presence of a cleavage site.

[0008] In another aspect, the present disclosure relates to a method for identifying 5-methylcytosine (5mC) in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. The process of modifying the DNA sample (including the following steps), i. The process of adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the DNA sample. ii. A step of converting 5mC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC). iii. A step of converting the 5caC and / or 5fC to dihydrouracil (DHU) to obtain a modified DNA sample containing the modified target DNA. c. The process of cutting the modified target DNA, d. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, e. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for determining the 5mC position in target DNA based on the presence of a cleavage site.

[0009] In another aspect, the present disclosure relates to a method for identifying 5mC or 5hmC in a DNA sample, a. A step of preparing a DNA sample containing target DNA having 5mC and / or 5hmC, b. The process of modifying the DNA (including the following steps), i. A step of converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5fC. ii. A step of converting the 5caC and / or 5fC to DHU to obtain a modified DNA sample containing the modified target DNA. c. The process of cutting the modified target DNA, d. a step of adding an adapter DNA molecule to the cleaved modified target DNA, e. a step of detecting the sequence of the modified target DNA, and comprising, a method wherein the presence of the cleavage site provides the position of either 5mC or 5hmC in the target DNA is provided.

[0010] In another aspect, the present disclosure relates to a method for identifying 5mC and identifying 5hmC in a DNA sample, the method comprising: a. identifying 5mC in the DNA sample (comprising the following steps), i. a step of preparing a first DNA sample comprising a target DNA having 5mC and / or 5hmC ii. a step of modifying the DNA in the first sample (comprising the following steps) 1. a step of adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the first DNA sample 2. a step of converting 5mC in the first DNA sample to 5caC and / or 5fC 3. a step of converting the 5caC and / or 5fC to DHU to provide a first modified DNA sample comprising the modified target DNA iii. a step of cleaving the modified target DNA iv. a step of adding an adapter DNA molecule to the cleaved modified target DNA v. a step of detecting the sequence of the modified target DNA, wherein the presence of the cleavage site provides the position of 5mC in the target DNA b. identifying 5mC or 5hmC in the DNA sample (comprising the following steps), i. a step of preparing a second DNA sample comprising a target DNA having 5mC and / or 5hmC ii. a step of modifying the DNA in the second sample (comprising the following steps) 1. a step of converting 5mC and 5hmC in the second DNA sample to 5caC and / or 5fC 2. a step of converting the 5caC and / or 5fC into DHU to provide a second modified DNA sample containing the modified target DNA iii. a step of cleaving the modified target DNA iv. a step of adding an adapter DNA molecule to the cleaved modified target DNA v. a step of detecting the sequence of the modified target DNA derived from the second sample, wherein the presence of the cleavage site provides the position of either 5mC or 5hmC in the target DNA c. comparing the results of steps (a) and (b), wherein a cleavage site that is present in step (b) but not present in step (a) provides the position of 5hmC in the target DNA, and A method comprising the same is provided.

[0011] In an embodiment, the blocking group added to 5hmC in the DNA sample is a sugar. In an embodiment, the sugar is a natural sugar or a modified sugar, for example, glucose or modified glucose. In an embodiment, the blocking group is added to 5hmC by contacting the DNA sample with a UDP linked to a sugar, for example, UDP-glucose, or a UDP linked to a modified glucose, in the presence of a glucosyltransferase enzyme, for example, T4 bacteriophage β-glucosyltransferase (βGT) and T4 bacteriophage α-glucosyltransferase (αGT), as well as derivatives and analogs thereof.

[0012] In each embodiment, the steps of converting 5mC in a DNA sample to 5caC and / or 5fC, and converting 5mC and 5hmC in a DNA sample to 5caC and / or 5fC, each include contacting the DNA sample with a 10-11 translocation (TET) enzyme. In a further embodiment, the TET enzyme is one or more of human TET1, human TET2, human TET3, mouse Tet1, mouse Tet2, mouse Tet3, Naegleria TET (NgTET), Coprinopsis cinerea (CcTET), and derivatives or analogs thereof. In each embodiment, the TET enzyme is NgTET or a derivative thereof. In each embodiment, the TET enzyme is mouse mTet1 (mTet1CD) or a derivative thereof. In another embodiment, the TET enzyme is human TET2 (hTET2) or a derivative thereof.

[0013] In another aspect, the present disclosure is a method for identifying 5caC or 5fC in a DNA sample, a. A step of preparing a DNA sample containing target DNA having 5caC and / or 5fC, b. A step of converting the 5caC and 5fC into DHU to obtain a modified DNA sample containing the modified target DNA, c. The process of cutting the modified target DNA, d. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, e. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for obtaining either the 5caC or 5fC position in target DNA based on the presence of a cleavage site.

[0014] In another aspect, the present disclosure relates to a method for identifying 5caC in a DNA sample, a. A step of preparing a DNA sample containing target DNA having 5caC, b. A step of adding a blocking group to 5fC in the DNA sample, c. A step of converting the 5caC into DHU to obtain a modified DNA sample containing the modified target DNA, d. The process of cutting the modified target DNA, e. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, f. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for determining the position of 5caC in target DNA based on the presence of a cleavage site.

[0015] In the embodiment, the step of adding a blocking group to 5fC in the DNA sample includes contacting the DNA with an aldehyde-reactive compound (for example, including hydroxylamine derivatives (such as O-ethylhydroxylamine), hydrazine derivatives, and hydrazide derivatives).

[0016] In another aspect, the present disclosure relates to a method for identifying 5fC in a DNA sample, a. A step of preparing a DNA sample containing target DNA having 5fC, b. A step of adding a blocking group to 5caC in the DNA sample, c. A step of converting the 5fC into DHU to obtain a modified DNA sample containing the modified target DNA, d. The process of cutting the modified target DNA, e. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, f. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for determining the location of the 5fC in target DNA based on the presence of a cleavage site.

[0017] In the embodiment, the step of adding a blocking group to 5caC in the DNA sample includes contacting the DNA sample with a carboxylic acid derivatization reagent (for example, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC)) and (ii) an amine (such as ethylamine), hydrazine, or hydroxylamine compound.

[0018] In another aspect, the present disclosure relates to a method for identifying 5hmC in a DNA sample, a. Prepare a DNA sample containing target DNA with 5hmC, b. Modifying the DNA in the sample (including the following steps), i. A step of converting 5hmC in the DNA sample to 5caC and / or 5fC. ii. A step of converting the 5caC and / or 5fC to dihydrouracil (DHU) to obtain a modified DNA sample containing the modified target DNA. c. Cutting the modified target DNA, d. Adding an adapter DNA molecule to the cleaved, modified target DNA, e. Detecting the sequence of the modified target DNA, Includes, This invention provides a method for determining the position of 5hmC in target DNA based on the presence of a cleavage site.

[0019] In some embodiments, the step of converting 5hmC to 5caC and / or 5fC includes contacting the DNA sample with an oxidizing agent. In further embodiments, the oxidizing agent is potassium perruthenate, Cu(II) / TEMPO, potassium ruthenate, or manganese oxide.

[0020] In one embodiment, the DNA sample contains genomic DNA. In another embodiment, the DNA sample contains picograms of DNA. In yet another embodiment, the DNA sample contains approximately 1 pg to 900 pg of DNA, approximately 1 pg to 500 pg of DNA, approximately 1 pg to 100 pg of DNA, approximately 1 pg to 50 pg of DNA, approximately 1 to 10 pg of DNA, less than approximately 200 pg of DNA, less than approximately 100 pg of DNA, less than approximately 50 pg of DNA, less than approximately 20 pg of DNA, and less than approximately 5 pg of DNA. In the embodiments, the DNA sample contains approximately 1 to 500 ng of DNA, approximately 1 to 200 ng of DNA, approximately 1 to 100 ng of DNA, approximately 1 to 50 ng of DNA, approximately 1 ng to 10 ng of DNA, approximately 1 ng to 5 ng of DNA, less than approximately 100 ng of DNA, less than approximately 50 ng of DNA, approximately 5 ng of DNA, or less than approximately 2 ng of DNA. In the embodiments, the DNA sample contains circulating cell-free DNA (cfDNA). In the embodiments, the DNA sample contains micrograms of DNA.

[0021] In embodiments, the step of converting 5caC and / or 5fC to DHU includes contacting the DNA sample with a reducing agent (e.g., pyridineborane, 2-picolineborane (pic-BH3), tert-butylamineborane, borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride). In preferred embodiments, the reducing agent is pic-BH3 and / or pyridineborane.

[0022] In the embodiment, the step of cleaving the modified target DNA includes contacting the modified DNA sample containing the modified target DNA with one or more endonucleases that specifically cleave the modified target DNA in the presence of DHU, thereby specifically cleaving the modified target DNA containing DHU. In the embodiment, the endonuclease is a bifunctional DNA endonuclease having DNA N-glycosylase activity and AP lyase activity, such as Tma endonuclease III, endonuclease VIII, formamidepyrimidine DNA glycosylase (Fpg), and / or hNEIL1. In the embodiment, the modified target DNA is cleaved using a uracil-specific removal reagent (USER). The USER enzyme includes a combination of uracil DNA glycosylase (UDG) and endonuclease VIII. Other enzymes that can be used alone or in combination to cleave modified target DNA include aprinic acid / apyrimidate endonuclease 1 (APE1), UDG, endonuclease III, Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, Fpg, and / or hNEIL1.

[0023] In embodiments, the above method further includes a step of sorting the size of the cleaved modified target DNA. In embodiments, the above method further includes a step of amplifying the copy number of the modified target DNA. In embodiments, this amplification step is performed before the step of detecting the sequence of the modified target DNA. The step of amplifying the copy number of the modified target DNA may be performed by polymerase chain reaction (PCR), primer extension and / or cloning.

[0024] In the embodiment, the step of determining the sequence of the modified target DNA includes chain termination sequencing, microarray sequencing, high-throughput sequencing, and restriction enzyme analysis. In the embodiment, the step of detecting the sequence of the modified target DNA includes next-generation sequencing.

[0025] In one embodiment, the present disclosure provides a method for cleaving a modified target DNA, comprising contacting a modified target DNA containing one or more DHUs (i.e., DHU residues) with one or more endonucleases that cleave the modified target DNA at the location of the one or more DHUs or at a location adjacent to the one or more DHUs. The one or more endonucleases may be, for example, any of the types of endonucleases described herein or a combination thereof. In an embodiment, the one or more DHUs in the modified target DNA are derived, for example, from 5mC and / or 5hmC by the method described herein. In an embodiment, the one or more DHUs in the modified target DNA are derived, for example, from 5caC and / or 5fC by the method described herein.

[0026] In embodiments, the method further comprises modifying a target DNA containing 5mC and / or 5hmC to obtain the modified target DNA prior to the contact step, the modification comprising (i) converting the 5mC and 5hmC in the target DNA to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC) by, for example, the method described herein, and (ii) converting the 5caC and / or 5fC to dihydrouracil (DHU) by, for example, the method described herein.

[0027] In embodiments, the method further comprises modifying a target DNA containing 5mC and 5hmC to obtain a modified target DNA prior to the contact step, the modification comprising (i) adding a block group to 5hmC in the target DNA, for example by the method described herein; (ii) converting 5mC in the target DNA to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC), for example by the method described herein; and (iii) converting 5caC and / or 5fC to dihydrouracil (DHU), for example by the method described herein.

[0028] In embodiments, the method further comprises modifying a target DNA containing 5caC and / or 5fC to yield a modified target DNA prior to the contact step, the modification including, for example, the conversion of the 5caC and / or 5fC to dihydrouracil (DHU) by the method described herein.

[0029] In embodiments, the method further comprises modifying a target DNA containing 5caC and / or 5fC to obtain a modified target DNA prior to the contact step, the modification comprising (i) adding a blocking group to the 5fC in the target DNA, for example by a method described herein, and (ii) converting the 5caC to dihydrouracil (DHU), for example by a method described herein.

[0030] In embodiments, the method further comprises modifying a target DNA containing 5caC and / or 5fC to obtain a modified target DNA prior to the contact step, the modification comprising (i) adding a block group to the 5caC in the target DNA, for example by the method described herein, and (ii) converting the 5fC to dihydrouracil (DHU), for example by the method described herein.

[0031] In embodiments, the method further comprises modifying a target DNA containing 5mC and / or 5hmC to obtain a modified target DNA prior to the contact step, the modification comprising (i) converting 5mC in the target DNA to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC) by, for example, the method described herein, and (ii) converting 5caC and / or 5fC to dihydrouracil (DHU) by, for example, the method described herein. [Brief explanation of the drawing] [Figure 1] Screening of borane-containing compounds. Borane-containing compounds were screened for the conversion of 5caC to DHU in 11mer oligonucleotides ("oligo"), and the conversion rate was estimated by MALDI. 2-picoline borane (pic-borane), borampyridine, and tert-butylamine borane were able to completely convert 5caC to DHU, but ethylenediamine borane and dimethylamine borane had a conversion rate of around 30%. No detectable products were measured (not detected) for dichlorohexylamine borane, morpholine borane, 4-methylmorpholine borane, and trimethylamine borane. Other reducing agents such as sodium borohydride and sodium tri(acetoxy)borohydride decomposed rapidly in acidic media, resulting in incomplete conversion. Sodium cyanoborohydride was not used because it may form hydrogen cyanide under acidic conditions. Pic-borane and pyridineborane were selected due to their complete conversion, low toxicity, and high stability. [Figure 2] Pic-borane reaction in DNA oligonucleotides. (A) Model DNA containing 5caC, treated with pic-borane, and characterized by MALDI. Calculated mass (m / z) values ​​are shown above each graph, and observed mass values ​​are shown to the left of the peaks. (B) Conversion rates of dC and various cytosine derivatives were quantified by HPLC-MS / MS. Data are given as the mean ± standard deviation of three replicates. [Figure 3A] This is the pic-borane reaction of a single nucleoside. 1 The 1H NMR results follow previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). The pic-borane reaction product of a single nucleoside. 1This is a 1H NMR (MeOH-d4, 400MHz) chart. δ ppm: 6.28 (t, 1H, J = 7 Hz), 4.30 (m, 1H), 3.81 (m, 1H), 3.63 (m, 2H), 3.46 (m, 2H), 2.65 (t, 2H, J = 6 Hz), 2.20 (m, 1H), 2.03 (m, 1H). [Figure 3B] This is the pic-borane reaction of a single nucleoside. 13 The 13C NMR results follow previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). The pic-borane reaction product of a single nucleoside. 13 This is a 1C NMR (MeOH-d4, 400 MHz) chart. δ ppm: 171.56 (CO), 153.54 (CO), 85.97 (CH), 83.86 (CH), 70.99 (CH), 61.92 (CH2), 36.04 (CH2), 35.46 (CH2), 30.49 (CH2). [Figure 4A] This figure shows the conversion of 5caC to DHU by borane and a proposed mechanism for the borane reaction of 5caC to DHU. [Figure 4B] This figure shows the conversion of 5fC to DHU by borane and a proposed mechanism for the borane reaction of 5fC to DHU. [Figure 5] (A) This figure shows that the TAPS method converts both 5mC and 5hmC into DHU, and that DHU functions as thymine during replication. (B) This is an overview of the TAPS, TAPSβ, and CAPS methods. [Figure 6-1] This figure shows the results of MALDI characterization of model DNA oligos containing 5fC and 5caC, treated with pic-borane in a state where 5fC and 5caC were blocked or unblocked. 5fC and 5caC are converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked by a hydroxylamine derivative such as O-ethylhydroxylamine (EtONH2), but this derivative became an oxime, which inhibited conversion by pic-borane. 5caC was blocked by ethylamine via EDC bonding, converting it to an amide that blocked conversion by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 6-2] This figure shows the results of MALDI characterization of model DNA oligos containing 5fC and 5caC, treated with pic-borane in a state where 5fC and 5caC were blocked or unblocked. 5fC and 5caC are converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked by a hydroxylamine derivative such as O-ethylhydroxylamine (EtONH2), but this derivative became an oxime, which inhibited conversion by pic-borane. 5caC was blocked by ethylamine via EDC bonding, converting it to an amide that blocked conversion by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 7-1] This figure shows the results of MALDI characterization of model DNA oligos containing 5mC and 5hmC, treated with KRuO4 and pic-borane, either with or without blocking 5hmC. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC, and 5gmC could not be converted by pic-borane. 5hmC could be oxidized with KRuO4 to 5fC and then converted to DHU by pic-borane. The calculated MS (m / z) values ​​are shown above each graph, and the observed MS values ​​are shown to the left of the peaks. [Figure 7-2] This figure shows the results of MALDI characterization of model DNA oligos containing 5mC and 5hmC, treated with KRuO4 and pic-borane, either with or without blocking 5hmC. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC, and 5gmC could not be converted by pic-borane. 5hmC could be oxidized with KRuO4 to 5fC and then converted to DHU by pic-borane. The calculated MS (m / z) values ​​are shown above each graph, and the observed MS values ​​are shown to the left of the peaks. [Figure 8] Restriction enzyme digestion demonstrated that TAPS can effectively convert 5mC to T. (A) Diagram of the restriction enzyme digestion assay to confirm sequence changes by TAPS. (B) TaqαI digestion test to confirm the conversion from C to T by TAPS. TAPS was performed on a 222 bp model DNA containing five fully methylated CpG sites (5mC) with TaqαI restriction sites, and its unmethylated control (C). As shown in the 5mC, C, and C TAPS, the PCR-amplified 222 bp model DNA can be cleaved by TaqαI into fragments of approximately 160 bp and 60 bp. As shown in the 5mC-TAPS lane, after TAPS on methylated DNA, the T(mC)GA sequence is converted to TTGA and is no longer cleaved by TaqαI digestion. [Figure 9] TAPS in 222 bp model DNA and mESC gDNA. (A) Sanger sequencing results of a 222 bp model DNA containing five fully methylated CpG sites before TAPS (5 mC, C) and after TAPS (5 mC TAPS, C TAPS), and its unmethylated control. Only 5 mC is converted to T by the TAPS method. (B) HPLC-MS / MS quantitative results of the relative modification levels in the mESC gDNA control after oxidation with NgTET1 and reduction with pic-borane. Data are given as the mean ± standard deviation of three replicates. [Figure 10A] TAPS does not cause significant DNA degradation compared to bisulfite. These are agarose gel images of 222bp unmethylated DNA, 222bp methylated DNA, and mESC gDNA before cooling in an ice bath. After TAPS, no detectable DNA degradation was observed, the DNA remained double-stranded, and could be seen without cooling. With bisulfite conversion, degradation occurred, the DNA became single-stranded, and could only be seen after cooling on ice. [Figure 10B] TAPS does not cause significant DNA degradation compared to bisulfite. These are agarose gel images of 222bp unmethylated DNA, 222bp methylated DNA, and mESC gDNA after cooling in an ice bath (B). After TAPS, no detectable DNA degradation was observed, the DNA remained double-stranded, and could be observed without cooling. With bisulfite conversion, degradation occurred, the DNA became single-stranded, and could only be observed after cooling on ice. [Figure 10C] TAPS does not cause significant DNA degradation compared to bisulfite. These are agarose gel images of mESC gDNA of various fragment lengths treated with TAPS and bisulfite, before (left panel) and after (right panel) cooling on ice. The DNA after TAPS retained its double helix and could be directly observed on the gel. Bisulfite treatment resulted in greater sample damage and fragmentation, and the DNA became single-stranded, only visible after cooling on ice. As shown in Figure 15, the conversion by TAPS was complete for all gDNA, regardless of fragment length. [Figure 10D] TAPS does not cause significant DNA degradation compared to bisulfite. These are agarose gel images of 222 bp model DNA before and after TAPS (three independent repeats), and no detectable degradation was observed after the reaction. [Figure 11] Comparison of amplification and melting curves between model DNA before and after TAPS. qPCR assays showed small differences in the amplification curves between the model DNA before and after TAPS. The melting curve of methylated DNA (5mC) shifted to lower temperatures after TAPS, suggesting a decrease in Tm and the possibility of C to T conversion, but no shift was observed in unmethylated DNA (C). [Figure 12] As shown by Sanger sequencing, complete conversion from C to T was induced after TAPS, TAPSβ, and CAPS. Model DNA containing one methylated CpG site and one hydroxymethylated CpG site was prepared as described herein. Conversion with TAPS was performed according to the protocol of oxidation with NgTET1 and reduction with pyridineborane as described herein. Conversion with TAPSβ was performed according to the protocol of blocking 5hmC, oxidation with NgTET1, and reduction with pyridineborane. Conversion with CAPS was performed according to the protocol of oxidation of 5hmC and reduction with pyridineborane. After conversion, 1 ng of the converted DNA sample was amplified by PCR with Taq DNA polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC, while CAPS selectively converted 5hmC. None of these three methods converted unmodified cytosine or other bases. [Figure 13A] TAPS is compatible with various DNA and RNA polymerases and induces complete C-to-T conversion, as shown by Sanger sequencing. Model DNA and primer sequences containing methylated CpG sites for polymerase testing are described herein. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase, Taq polymerase, and Vent exopolymerase read DHU as T, thus inducing complete C-to-T conversion after PCR. Alternatively, primer extension was performed with biotin-labeled primers and isothermal polymerases, including Klenow fragments, Bst DNA polymerase, and phi29 DNA polymerase. The newly synthesized DNA strands were separated by Dynabeads MyOne Streptavidin C1, amplified by PCR using Taq polymerase, and processed for Sanger sequencing. T7 RNA polymerase was able to efficiently bypass the DHU and insert adenine on the opposite side of the DHU site, as demonstrated by RT-PCR and Sanger sequencing. [Figure 13B] Certain other commercially available polymerases did not efficiently amplify DNA containing DHU. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase and Taq polymerase read DHU as T, thus inducing a complete C-to-T conversion. Certain other commercially available polymerases, including KAPA HiFi polymerase, Pfu polymerase, Phusion polymerase, and NEB Q5 polymerase, were observed to exhibit low or no C-to-T conversion (not shown). [Figure 14] No PCR bias was observed with DHU compared to T and C. Model DNA containing one DHU / U / T / C modification was synthesized using the corresponding DNA oligo as described herein. Based on the qPCR reaction, standard curves for each model DNA with DHU / U / T / C modification were plotted, and the model DNA input was serially diluted 1:10 (0.1 pg to 1 ng. All qPCR experiments were performed in triplicates). The slope of the regression between the logarithmic concentration (ng) value and the mean Ct value was calculated using the SLOPE function in Excel. PCR efficiency was calculated using the formula Efficiency (%) = (10^(-1 / slope) - 1) × 100%. The amplification coefficient was calculated using the formula Amplification coefficient = 10^(-1 / slope). The PCR efficiency for model DNA with DHU, T, or C modifications was almost the same, indicating that DHU can be read as a normal base and does not appear to be a cause of PCR bias. [Figure 15] TAPS completely converted 5mC to T regardless of the length of the DNA fragment. (A) Agarose gel images from the TaqαI digestion assay confirmed complete conversion from 5mC to T in all samples, regardless of the length of the DNA fragment. After TAPS, a 194bp model sequence derived from the λ genome was PCR amplified and digested with the TaqαI enzyme. The PCR product amplified from the unconverted sample could be cleaved, but the product amplified from the TAPS-treated sample remained intact, suggesting loss of the restriction site, i.e., complete conversion from 5mC to T. (B) The percentage of conversion from C to T was estimated by quantification of the gel bands and was 100% for all DNA fragment lengths tested. [Figure 16] Conversion and false positives under different TAPS conditions. When mTet1 and pyridineborane were combined, the conversion rate of methylated C was the highest (96.5%, calculated with fully CpG-methylated λDNA) and the conversion rate of unmodified C was the lowest (0.23%, calculated with 2kb unmodified spike-in) compared to other conditions using NgTET1 or pic-borane. The bars above show the conversion rate ± standard error for all cytosine sites tested. [Figure 17] Conversion rate in short spike-ins. (A) 120mer-1 and (B) 120mer-2, containing 5mC and 5hmC. Nearly complete conversion occurred at the 5mC and 5hmC sites in both strands. The actual sequences, along with the modification status, are shown above and below. [Figure 18A] Sequencing quality of TAPS is improved compared to whole-genome bisulfite sequencing (WGBS). This shows the conversion rates of 5mC and 5hmC in DNA treated with TAPS. Left: Synthetic spike in (CpN) methylated or hydroxymethylated at known locations. [Figure 18B] Improved sequencing quality of TAPS compared to whole-genome bisulfite sequencing (WGBS). This is the false positive rate of TAPS obtained from unmodified 2kb spike insulators. [Figure 18C] Sequencing quality of TAPS is improved compared to whole-genome bisulfite sequencing (WGBS). Total execution time for TAPS and WGBS when processing 1 million simulation reads on one core of one Intel Xeon CPU. [Figure 18D] Sequencing quality of TAPS is improved compared to whole-genome bisulfite sequencing (WGBS). This represents the percentage of all sequenced read pairs (after trimming) that were mapped to the genome. [Figure 18E] Sequencing quality of TAPS is improved compared to whole-genome bisulfite sequencing (WGBS). The sequencing quality score per base pair for the first and second reads in all sequenced read pairs was recorded by Illumina BaseSpace. The top image is TAPS. The bottom image is WGBS. [Figure 19] TAPS provided more uniform coverage than WGBS, with fewer uncovered locations. The coverage depth for (A) all bases and (B) CpG sites was compared between WGBS and TAPS, and calculated for both strands. In "TAPS (downsampled)," random reads were selected from all mapped TAPS reads so that the median coverage matched the median coverage of WGBS. The last bin shows locations with coverage greater than 50×. [Figure 20] Distribution of modification levels across all chromosomes. The average modification level across all mouse chromosomes in a 100kb window was weighted by CpG coverage and smoothed using a Gaussian weighted moving average filter with a window size of 10. [Figure 21A] Comparison of genome-wide methylome measurements using TAPS and WGBS. The average sequencing coverage depth is shown for all mouse CpG islands (binned into 20 windows) and 4kbp flanking regions (binned into 50 windows of equal size). To account for differences in sequencing depth, all mapped TAPS reads were downsampled and fitted to the median number of mapped WGBS reads across the entire genome. [Figure 21B] Comparison of genome-wide methylome measurements using TAPS and WGBS. These are CpG sites covered by at least three reads, using TAPS alone, both TAPS and WGBS, or WGBS alone. [Figure 21C] Comparison of genome-wide methylome measurements using TAPS and WGBS. This is the number of CpG sites covered by at least three reads and detected with a modification level greater than 0.1 by TAPS alone, TAPS and WGBS, or WGBS alone. [Figure 21D] Comparison of genome-wide methylome measurements using TAPS and WGBS. Examples of chromosome distribution of modification levels (%) in TAPS and WGBS. The average percentage of modified CpG per 100kb window in mouse chromosome 4 was smoothed using a Gaussian weighted moving average filter with a window size of 10. [Figure 21E] Comparison of genome-wide methylome measurements using TAPS and WGBS. The heatmap shows the number of CpG sites covered by at least three reads in both TAPS and WGBS, categorized by the level of modification measured by each method. To improve contrast, the first bin containing unmodified CpGs in both methods has been excluded from the color scale and is indicated by an asterisk. [Figure 22] Modification levels around CpG islands. This is the average modification level in CpG islands (binned into 20 windows) and 4kbp flanking regions (binned into 50 windows of equal size). Bins with coverage of less than 3 reads were ignored. [Figure 23] TAPS shows less coverage-modification bias than WGBS. All CpG sites are binned according to their coverage, and the mean (●) and median (black triangle) of the modification values ​​for each bin are shown for WGBS (A) and TAPS (B). The last bin shows CpG sites covered by more than 100 reads. The lines represent linear approximations across data points. [Figure 24] Using dsDNA and ssDNA library preparation kits, gDNA and cell-free DNA TAPS with low input levels were prepared. (A) Using the dsDNA library kit NEBNext Ultra II or KAPA HyperPrep kit, a sequencing library was successfully constructed using only 1 ng of mouse embryonic stem cell (mESC) genomic DNA (gDNA). Using the ssDNA library kit Accel-NGS Methyl-Seq kit, the amount of input DNA was further reduced to (B) 0.01 ng of mESC gDNA or (C) 1 ng of cell-free DNA. [Figure 25] TAPS libraries of gDNA and cell-free DNA with small inputs were prepared using the dsDNA KAPA HyperPrep library preparation kit. Using the KAPA HyperPrep kit, sequencing libraries were successfully constructed with small amounts of (A) mESC gDNA and (B) cell-free DNA (approximately 1 ng). Cell-free DNA exhibits a sharp length distribution of approximately 160 bp (nucleosome size) after digestion by plasma nucleases. After library construction, the DNA length becomes approximately 300 bp, which is represented by the sharp band in B. [Figure 26] High-quality cell-free DNA TAPS. (A) Conversion rate of 5mC in cfDNA treated with TAPS. (B) False positive rate in cfDNA treated with TAPS. (C) Percentage of all sequenced read pairs that are uniquely mapped to the genome. (D) Percentage of all sequenced read pairs that are uniquely mapped to the genome after PCR duplicate reads have been removed. CHG and CHH are in a non-CpG context. [Figure 27] TAPS can detect genetic variants. For methylation (MOD, top row) and C→T SNP (bottom row), separate base distributions were observed in the original upper strand (OT) / original lower strand (OB) (left column), as well as in the strand complementary to OT (CTOT) and the strand complementary to OB (CTOB) (right column). [Figure 28] Endonucleases cleaved by TAPS conversion products. (A) Results of digestion of mESC gDNA before and after TAPS conversion by different endonucleases. In TAPS conversion, DHU is introduced in place of methylated cytosine. Endo VIII is cleaved by endonuclease VIII, Endo IV is cleaved by endonuclease IV, Tma Endo III is endonuclease III, Tth Endo IV is endonuclease IV, Nth Endo III is Nth endonuclease III, Endo V is endonuclease V. (B) Representative images of mESC gDNA treated with TAPS before USER digestion, after USER digestion, and after size sorting. (C) Scatter plot showing methylation levels in all CpGs measured by both BS-seq and eeTAPS. [Figure 29A] Endonuclease-enriched TAPS (eeTAPS). The diagram above shows a schematic of eeTAPS, and the diagram below shows computer-measured CG methylation levels. First, 5-methylcytosine (mC) was converted to dihydrouracil (DHU) using TAPS, and then enriched through USER digestion. Subsequently, size-sorted DNA fragments were prepared, converted into a sequencing library, and amplified by PCR. After read alignment, the CG methylation level was calculated by dividing the number of reads cleaved at each CpG site by the total number of reads cleaved at each CpG site, or the total number of reads covering each CpG site. [Figure 29B] This shows the validation of eeTAPS on a 4kb model DNA. The tracks, from top to bottom, show the methylation levels measured by bisulfite sequencing (BS-seq), eeTAPS, and the eeTAPS control. In the eeTAPS control, the DNA was digested using USER enzyme without conversion with TAPS. [Figure 30A] This figure compares wgTAPS, eeTAPS, and rrTAPS in mESC DNA. It shows the genome fragmentation methods of wgTAPS, eeTAPS, and rrTAPS. In wgTAPS, genomic DNA is fragmented randomly, whereas in eeTAPS, fragmentation occurs specifically at methylated CpG (mCG) sites, and in rrTAPS, it occurs specifically at CCGG sites. [Figure 30B] This is a comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. The bar plot shows the percentage of CpG sites covered by wgTAPS, eeTAPS, and rrTAPS superimposed on different chromatin features. These chromatin features were defined in a previous study (20). [Figure 30C] Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. This heatmap shows the correlation of methylation levels determined at a resolution of 1 CpG using wgTAPS and eeTAPS. Methylation levels were divided into 16 groups for both wgTAPS and eeTAPS. The color indicates the number of CpGs at a given interval. Only sites with coverage greater than 5 in wgTAPS were considered. Pearson's correlation coefficient is shown at the top of the plot. [Figure 30D] Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. This is a Benn plot showing the overlap of detected mCpG sites in wgTAPS, rrTAPS, and eeTAPS. In both wgTAPS and eeTAPS, CpG sites with a methylation level greater than the first quartile were defined as methylated CpGs. For rrTAPS, the same methylation cutoff value as wgTAPS was used. (In wgTAPS and rrTAPS, CpG sites with a methylation level greater than 0.5 were defined as mCpGs, while in eeTAPS, CpG sites with a methylation level greater than 0.28 were defined as mCpGs.) [Figure 31] (A) Nucleotide frequencies at the ends of the sequenced fragments. (B) Bar plot showing the distribution of distances between cleavage sites and the CpG closest to those sites. (C) Heatmap showing the correlation of methylation levels obtained with a resolution of 1 CpG using wgTAPS and rrTAPS. Methylation levels were divided into 16 groups in both wgTAPS and rrTAPS. The color indicates the number of CpGs at a predetermined interval. Only sites with coverage greater than 5 in both wgTAPS and rrTAPS were considered. The Pearson correlation coefficient is 0.92. (D) Overlap of mCpG sites detected by replicating eeTAPS. The replicas were subsampled to the same depth to detect mCpGs. [Figure 32] Profiles of methylation in different genomic mechanisms using eeTAPS. (A) Methylation levels measured by both eeTAPS (upper line) and wgTAPS (lower line) in chromosome 1 of mESC. A 100kb window was used, and the moving mean was calculated in R with bw=10 using the movAvg2 function. (B) Density plot showing the correlation of methylation levels in chromosome bins between eeTAPS and wgTAPS. The mean of methylation levels was calculated in each bin using a 100kb window. Pearson's correlation coefficient is shown at the top of the plot. (C) Average methylation levels across CpG islands (CGI) and 4kb flanking regions for eeTAPS and wgTAPS. (D) Density plot showing the correlation of methylation levels in CpG islands between eeTAPS and wgTAPS. Pearson's correlation coefficient is shown at the top of the plot. (E) Density plots showing the correlation of methylation levels in different chromatin features in eeTAPS and wgTAPS. These chromatin features were previously defined by histone markers (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal). This is also shown in Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819), (F). Pearson's correlation coefficient is shown at the top of the plot. (F) This is a box plot showing the distribution of methylation levels across all chromatin features as measured by eeTAPS (lower bars) and wgTAPS (upper bars). [Figure 33] This shows the average methylation distribution around the transcription start site (TSS) in wgTAPS and eeTAPS. The genes were classified according to their expression levels, following the GSE72855 dataset. [Figure 34] Analysis using eeTAPS with samples with low input levels. (A) The number of mCpGs detected using eeTAPS with 1 ng, 10 ng, 50 ng, and 200 ng of mESC gDNA input (the number of mCpGs identified by wgTAPS). For 200 ng of mESC, the reads were downsampled by half to adjust the sequencing depth to match the sample with low input levels. A criterion of methylation levels greater than 0.28 was used to assign mCpGs; in eeTAPS, a number of cleavage greater than 1 was assigned as an mCpG, while in wgTAPS, a methylation level greater than 0.5 was assigned as an mCpG. The percentages shown above the bars represent the percentage of detected mCpGs (mCpGs detected by wgTAPS are defined as true). (B) A heatmap showing the methylation distribution measured by eeTAPS across the mouse genome using different input levels. Each chromosome is divided into 100kb windows, which are represented by rows in the heatmap. Methylation levels were defined as the number of methylated CpG sites divided by the total number of covered CpG sites within each 100kb window. (C) This is a density plot showing the correlation of methylation between samples with less input relative to a 200ng input sample. Methylation levels were calculated across the entire mouse genome within 100kb windows, as shown in (B). Pearson correlation coefficients are shown for each plot. [Figure 35] Results of eeTAPS sequencing depth analysis. (A) Number of methylated CpGs detected when reads are sampled at sequencing depths of 1 to 10 ×. The percentages shown above represent the percentage of mCpGs detected by eeTAPS (mCpGs detected by wgTAPS are defined as true). (B) Correlation of methylation in the whole mouse genome (upper line) and CpG islands (CGIs) (lower line) within a 100kb window when reads are sampled at sequencing depths of 1 to 10 ×. [Modes for carrying out the invention] This disclosure provides a method for identifying cytosine modifications in target DNA in a DNA sample, including whole-genomic DNA, at base-level resolution without the use of bisulfites. The method described herein includes improvements over the method described in PCT / US2019 / 012627 (which is incorporated herein by reference in its entirety), the PCT patent which includes a method for detecting 5mC and 5hmC in a sequence at base-level resolution without the use of bisulfites (hereinafter referred to as TAPS). TAPS consists of mild enzymatic and chemical reactions for the direct and quantitative detection of 5mC and 5hmC at base-level resolution without affecting unmodified cytosine. This disclosure also provides an improved method for detecting 5fC and 5caC at base-level resolution without affecting unmodified cytosine. That is, the method provided herein maps 5mC, 5hmC, 5fC, and 5caC, overcoming the problems of prior methods such as bisulfite sequencing.

[0032] [Table 1]

[0033] The methods described herein are based on converting modified cytosines (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU) by, for example, Tet-assisted pyridineborane treatment, then cleaving the DHU sites (e.g., with USER (uracil-specific removal reagent)) to create DNA fragments, and finally incorporating these fragments into a sequencing library. Genomic DNA that has not been fragmented cannot be directly sequenced. Only in the presence of modified cytosines that can be converted to DHU can the DNA be cleaved into DNA fragments, and then sequenced by each end of these fragments (indicating the location of the modified cytosines). That is, for example, eeTAPS reduces the cost of whole-genome TAPS (WGTAPS) by sequencing only the fragments cleaved by the conversion of 5mC / 5hmC to DHU. By sequencing the cleaved fragments, methylated cytosines in the original DNA sample can be identified with base-level resolution.

[0034] How to identify 5mC or 5hmC (together) In another aspect, the present disclosure relates to a method for identifying 5mC or 5hmC in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. The process of modifying the DNA (including the following steps), i. A step of converting 5mC and 5hmC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5fC. ii. A step of converting the 5caC and / or 5fC to DHU to obtain a modified DNA sample containing the modified target DNA. c. The process of cutting the modified target DNA, d. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, e. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for obtaining either a 5mC or 5hmC position in target DNA based on the presence of a cleavage site.

[0035] In embodiments of the method for identifying 5mC or 5hmC in target DNA, the method provides a semi-quantitative measure of the frequency of 5mC or 5hmC modifications at each location where such modifications are observed in the target DNA. This method for identifying 5mC or 5hmC yields both 5mC and 5hmC locations but does not distinguish between these two cytosine modifications. Rather, it converts both 5mC and 5hmC to DHU.

[0036] How to identify 5mC In one embodiment, the present disclosure is a method for identifying 5-methylcytosine (5mC) in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. The process of modifying the DNA (including the following steps), i. The process of adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the DNA sample. ii. A step of converting 5mC in the DNA sample to 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC). iii. A step of converting the 5caC and / or 5fC to DHU to obtain a modified DNA sample containing the modified target DNA. c. The process of cutting the modified target DNA, d. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, e. A step of detecting the sequence of the modified target DNA, wherein the presence of a cleavage site determines the position of 5mC in the target DNA, This provides a method that includes [something].

[0037] In an embodiment of the method for identifying 5mC in target DNA, the method provides a semi-quantitative measure of the frequency of 5mC modifications at each location in the target DNA where 5mC modifications are observed.

[0038] To identify 5mC in target DNA without including 5hmC, 5hmC in the sample is blocked to prevent its conversion to 5caC and / or 5fC. In the method of this disclosure, 5hmC in the sample DNA is prevented from reacting in the next step by adding a blocking group to 5hmC. In one embodiment, the blocking group is a sugar containing a modified sugar, such as glucose or 6-azido-glucose (6-azido-6-deoxy-D-glucose). The sugar blocking group is added to the hydroxymethyl group of 5hmC by contacting the DNA sample with uridine diphosphate (UDP) sugar in the presence of one or more glucosyltransferase enzymes.

[0039] In the embodiments, the glucosyltransferase is T4 bacteriophage β-glucosyltransferase (βGT), T4 bacteriophage α-glucosyltransferase (αGT), and derivatives and analogs thereof. βGT is an enzyme that catalyzes a chemical reaction in which a β-D-glucosyl (glucose) residue is transferred from UDP-glucose to a 5-hydroxymethylcytosine residue in DNA.

[0040] The blocking group being glucose, for example, means that a glucose moiety (e.g., a β-D-glucosyl residue) is added to 5hmC to obtain glucosyl 5-hydroxymethylcytosine. This sugar blocking group can be any sugar or modified sugar that is both a substrate for the glucosyltransferase enzyme and blocks the subsequent conversion of 5hmC to 5caC and / or 5fC. Subsequently, a step is performed to convert 5mC in the DNA sample to 5caC and / or 5fC by a method provided in the present invention, such as oxidation using a TET enzyme. Then, the 5caC and / or 5fC are converted to DHU by a method provided in the present invention, such as oxidation with borane.

[0041] Methods for identifying 5mC and 5hmC This disclosure provides a method for identifying 5mC and 5hmC in target DNA by (i) performing a method for identifying 5mC in a first DNA sample described herein, and (ii) performing a method for identifying 5mC or 5hmC in a second DNA sample described herein. The location of 5mC is obtained by (i). By comparing the results of (i) and (ii), the location of 5hmC in the target DNA is obtained by a cleavage site that is present in (i) but not in (ii). In embodiments, the first and second DNA samples are derived from the same DNA sample. For example, the first and second samples may be separate aliquots taken from a sample containing the DNA to be analyzed.

[0042] Since 5mC and 5hmC (unblocked) are converted to 5fC and 5caC before being converted to DHU, all 5fC and 5caC present in the DNA sample will be detected as 5mC and / or 5hmC. However, given that the levels of 5fC and 5caC in genomic DNA are extremely low under normal conditions, this phenomenon is often acceptable when analyzing methylation and hydroxymethylation in DNA samples. The signals of 5fC and 5caC can be removed by protecting them from conversion to DHU, for example, by hydroxylamine binding in the case of 5fC, and by EDC coupling in the case of 5caC.

[0043] The above method identifies the location of 5hmC in target DNA by comparing the location of 5mC with the location of 5mC or 5hmC (combined). Alternatively, the modification location of 5hmC in target DNA can be directly measured. That is, in one embodiment, this disclosure is a method for identifying 5hmC in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. The process of modifying the DNA (including the following steps), i. A step of converting 5hmC in the DNA sample to 5caC and / or 5fC. ii. A step of converting the 5caC and / or 5fC to DHU to obtain a modified DNA sample containing the modified target DNA. c. The process of cutting the modified target DNA, d. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, e. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for determining the position of 5hmC in target DNA based on the presence of a cleavage site.

[0044] In embodiments, the step of converting 5hmC to 5fC involves oxidizing 5hmC to 5fC by contacting the DNA with, for example, potassium perruthenate (KRuO4) (as described in Science. 2012, 33, 934-937 and WO2013017853 (incorporated herein by reference)) or Cu(II) / TEMPO (copper(II) perchlorate and 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)) (as described in Chem. Commun., 2017, 53, 5756-5759 and WO2017039002 (incorporated herein by reference)). Other oxidizing agents that can be used are potassium ruthenate and / or manganese oxide. Subsequently, the 5fC in the DNA sample is converted to DHU by a method disclosed herein, for example, by a borane reaction.

[0045] Method for identifying 5caC or 5fC In one embodiment, the present disclosure is a method for identifying 5caC or 5fC in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. A step of converting 5caC and / or 5fC to DHU to obtain a modified DNA sample containing the modified target DNA, f. The process of cutting the modified target DNA, g. A step of attaching an adapter DNA molecule to the cleaved modified target DNA, h. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for obtaining either the 5caC or 5fC position in target DNA based on the presence of a cleavage site.

[0046] This method for identifying 5fC or 5caC yields the location of either 5fC or 5caC, but does not distinguish between these two cytosine modifications. Rather, both 5fC and 5caC are converted to DHU, and that DHU is detected by the method described herein.

[0047] Method for identifying 5caC In another aspect, the present disclosure relates to a method for identifying 5caC in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. A step of adding a blocking group to 5fC in the DNA sample, c. A step of converting the 5caC into DHU to obtain a modified DNA sample containing the modified target DNA, g. The process of cutting the modified target DNA, h. The process of adding an adapter DNA molecule to the cleaved modified target DNA, i. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for determining the position of 5caC in target DNA based on the presence of a cleavage site.

[0048] In an embodiment of the method for identifying 5caC in target DNA, the method provides a semi-quantitative measure of the frequency of 5caC modification at each location in the target DNA where 5caC modification is observed.

[0049] This method blocks 5fC (5mC and 5hmC are not converted to DHU) and makes 5caC in the target DNA identifiable. In embodiments, the step of adding a blocking group to 5fC in a DNA sample includes contacting the DNA with an aldehyde-reactive compound (e.g., including hydroxylamine derivatives, hydrazine derivatives, and hydrazide derivatives). Examples of hydroxylamine derivatives include hydroxylamine, hydroxylamine hydrochloride, hydroxylammonium sulfate, hydroxylamine phosphate, O-methylhydroxylamine, O-hexylhydroxylamine, O-pentylhydroxylamine, O-benzylhydroxylamine, and in particular O-ethylhydroxylamine (EtONH2), O-alkylated hydroxylamine or O-arylated hydroxylamine, their acids or salts. Examples of hydrazine derivatives include N-alkylhydrazine, N-arylhydrazine, N-benzylhydrazine, N,N-dialkylhydrazine, N,N-diarylhydrazine, N,N-dibenzylhydrazine, N,N-alkylbenzylhydrazine, N,N-arylbenzylhydrazine, and N,N-alkylarylhydrazine. Examples of hydrazide derivatives include toluenesulfonyl hydrazide, N-acylhydrazide, N,N-alkylacylhydrazide, N,N-benzylacylhydrazide, N,N-arylacylhydrazide, N-sulfonyl hydrazide, N,N-alkylsulfonyl hydrazide, N,N-benzylsulfonyl hydrazide, and N,N-arylsulfonyl hydrazide.

[0050] Method for identifying 5fC In another aspect, the present disclosure relates to a method for identifying 5fC in a DNA sample, a. A step of preparing a DNA sample containing the target DNA, b. A step of adding a blocking group to 5caC in the DNA sample, c. A step of converting the 5fC into DHU to obtain a modified DNA sample containing the modified target DNA, d. The process of cutting the modified target DNA, e. The step of attaching an adapter DNA molecule to the cleaved modified target DNA, f. A step to detect the sequence of the modified target DNA, Includes, This invention provides a method for determining the location of the 5fC in target DNA based on the presence of a cleavage site.

[0051] In an embodiment of the method for identifying 5fCs in target DNA, the method provides a semi-quantitative measure of the frequency of 5fC modification at each location in the target DNA where 5fC modification is observed.

[0052] The step of adding a blocking group to 5caC in the DNA sample can be carried out by (i) contacting the DNA sample with a coupling agent, such as a carboxylic acid derivatization reagent, such as a carbodiimide derivative such as 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) or N,N'-dicyclohexylcarbodiimide (DCC), and (ii) contacting the DNA sample with an amine, hydrazine, or hydroxylamine compound. That is, for example, 5caC can be blocked by treating the DNA sample with EDC and then treating it with benzylamine, ethylamine, or other amine to form an amide that blocks 5caC and prevents it from being converted to DHU by pic-BH3. A method for coupling 5caC using an EDC catalyst is described in WO2014165770, which is incorporated herein by reference.

[0053] DNA sample / target DNA The method of this disclosure utilizes mild enzymatic and chemical reactions that avoid the significant degradation associated with methods such as bisulfite sequencing. In other words, the method of the present invention is useful for the analysis of samples with low input, such as circulating cell-free DNA, and for single-cell analysis.

[0054] In one embodiment, the DNA sample contains picograms of DNA. In another embodiment, the DNA sample contains about 1 pg to about 900 pg of DNA, about 1 pg to about 500 pg of DNA, about 1 pg to about 100 pg of DNA, about 1 pg to about 50 pg of DNA, about 1 to about 10 pg of DNA, less than about 200 pg of DNA, less than about 100 pg of DNA, less than about 50 pg of DNA, less than about 20 pg of DNA, and less than about 5 pg of DNA. In yet another embodiment, the DNA sample contains nanograms of DNA. The DNA in the sample used in the methods disclosed herein may be in any amount, including DNA derived from a single cell or a bulk DNA sample. In embodiments, the method of the present invention can be performed with DNA samples containing approximately 1 to approximately 500 ng of DNA, approximately 1 to approximately 200 ng of DNA, approximately 1 to approximately 100 ng of DNA, approximately 1 to approximately 50 ng of DNA, approximately 1 to approximately 10 ng of DNA, approximately 2 to approximately 5 ng of DNA, less than approximately 100 ng of DNA, less than approximately 50 ng of DNA, less than 5 ng of DNA, and less than 2 ng of DNA. In embodiments, the DNA sample contains micrograms of DNA.

[0055] To prepare a DNA sample, as used herein, means to obtain a DNA sample from any source, either directly or indirectly. DNA samples used in the methods described herein may originate from any source, including, for example, body fluids, tissue samples, organs, organelles, or single cells. In embodiments, the DNA sample is circulating cell-free DNA (cell-free DNA or cfDNA), which is DNA found in blood and not present in cells. cfDNA can be isolated from blood or plasma using methods known in the art. Commercially available kits, such as the Circulating DNA Kit (Qiagen), are available for isolating cfDNA. The DNA sample may also be enriched by a concentration process, which may include, but is not limited to, antibody immunoprecipitation, chromatin immunoprecipitation, restriction enzyme digestion-based enrichment, hybridization-based enrichment, or chemical labeling-based enrichment.

[0056] The target DNA may be any DNA having cytosine modifications (i.e., 5mC, 5hmC, 5fC, and / or 5caC), and may include, but are not limited to, DNA fragments or genomic DNA purified from tissues, organs, cells, and organelles. The target DNA may be a single DNA molecule in a sample, or an entire population of DNA molecules in a sample (or a subset thereof) having cytosine modifications. The target DNA may be native DNA derived from a source, or it may be pre-converted to a state suitable for high-throughput sequencing, for example, by ligation with an adapter for fragmentation, repair, and sequencing. That is, the target DNA may include multiple DNA sequences so that a library of target DNA sequences can be prepared using the methods described herein, which can be analyzed individually (e.g., by determining the sequences of individual targets) or in population (e.g., by high-throughput sequencing or next-generation sequencing).

[0057] DNA samples containing target DNA can be obtained from organisms of the Monera (bacteria), Protist (protists), Fungi (fungi), Plant (plants), and Animalia (animals). DNA samples may be obtained from patients or subjects, environmental samples, or the relevant organisms. In embodiments, DNA samples are extracted, purified, or removed from cells, cell populations, bodily fluids, tissue samples, organs, and / or organelles. In preferred embodiments, the sample DNA is whole-genome DNA.

[0058] Conversion of 5mC and 5hmC to 5caC and / or 5fC Embodiments of the methods provided in the present invention, such as the eeTAPS method described herein, include a step of converting 5mC and 5hmC (or 5mC only if 5hmC is blocked) to 5caC and / or 5fC. In embodiments, this step includes contacting a DNA sample with a 10-11 translocation (TET) enzyme. TET enzymes are a family of enzymes that catalyze the transfer of an oxygen molecule to the N5 methyl group of 5mC, which forms 5-hydroxymethylcytosine (5hmC). TET further catalyzes the oxidation of 5hmC to 5fC and the oxidation of 5fC to form 5caC (see Figure 5A). Examples of TET enzymes useful in the methods described herein include human TET1, human TET2, human TET3, mouse Tet1, mouse Tet2, mouse Tet3, Naegleria TET (NgTET), Coprinopsis cinerea (CcTET), and one or more derivatives or analogs thereof. In one embodiment, the TET enzyme is NgTET or a derivative thereof. In another embodiment, the TET enzyme is human TET1 (hTET1) or a derivative thereof. In another embodiment, the TET enzyme is mouse Tet1 or a derivative thereof (mTet1CD). In yet another embodiment, the TET enzyme is human TET2 (hTET2) or a derivative thereof.

[0059] Conversion of 5caC and / or 5fC to DHU The method described herein includes the step of converting 5caC and / or 5fC in a DNA sample to DHU. In embodiments, this step includes contacting the DNA sample with a reducing agent, such as a borane reducing agent (e.g., pyridineborane, 2-picolineborane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride). In preferred embodiments, the reducing agent is pyridineborane and / or pic-BH3.

[0060] The process of cutting the modified target DNA. The methods described herein include a step of cleaving a modified target DNA containing DHU at the location where modified cytosines (5mC, 5hmC, 5fC, and / or 5caC) were present in a DNA sample prior to a conversion step(s) (i.e., prior to one or more steps of converting modified cytosines to DHU). The cleavage steps described herein specifically cleave the modified target DNA containing DHU, while leaving DNA without DHU uncleaved or substantially uncleaved.

[0061] The step of cleaving the modified target DNA containing DHU can be carried out by contacting the modified target DNA containing DHU with one or more DNA endonucleases that specifically cleave the modified target DNA. In embodiments, one or more of the DNA endonucleases are bifunctional DNA endonucleases having DNA N-glycosylase activity and AP lyase activity, and examples of such DNA endonucleases include Tma endonuclease III, endonuclease VIII, formamidepyrimidine DNA glycosylase (Fpg), and / or hNEIL1. In embodiments, the modified target DNA containing DHU is cleaved with a uracil-specific removal reagent (USER). The USER enzyme includes a combination of uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII. Other enzymes that can be used to cleave the modified target DNA include one or more of the following: aprinic acid / apyrimidate endonuclease 1 (APE1), endonuclease III (Endo III), Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, Fpg, and hNEIL1.

[0062] In embodiments, the step of cleaving the modified target DNA containing DHU includes exposing the modified target DNA to an acidic pH and / or heating conditions, as described in House CH, Miller SL Hydrolysis of dihydrouridine and related compounds. Biochemistry. 1996;35(1):315-320. In embodiments, the cleavage step includes exposing the modified target DNA to a temperature of at least 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 105°C or 110°C and / or a pH of 7 or higher, 7.5 or higher, 8 or higher, 8.5 or higher, 9 or higher, 9.5 or higher, 10 or higher, 10.5 or higher, 11 or higher, 11.5 or higher, 12 or higher, 12.5 or higher or 13 or higher.

[0063] Addition of an adapter DNA molecule to a cleaved, modified target DNA. In embodiments, the methods described herein include the step of attaching an adapter DNA molecule to a modified target DNA that has been cleaved, for example, by a USER enzyme. The adapter DNA or DNA linker is a chemically synthesized short single-stranded or double-stranded oligonucleotide that can be ligated to one or both ends of another DNA molecule. Double-stranded adapters can be synthesized such that each end of the adapter has a blunt end or a 5' or 3' overhang (i.e., a sticky end). The DNA adapter is ligated to the cleaved modified target DNA to yield a sequence for PCR amplification with complementary primers and / or for cloning and / or library preparation (e.g., next-generation sequencing library).

[0064] Before ligating the adapter to the cleaved target DNA, the ends of the cleaved DNA may be prepared for ligation, for example, by end repair that creates a blunt end with a 5' phosphate group. The blunt end can be used for ligation to the adapter, or an overhang can be created before ligation, for example, by a tailing reaction. Tailing is an enzymatic method of adding a non-template nucleotide to the 3' end of a blunt double-stranded DNA molecule. Using 3'-terminus A tailing (i.e., addition of dA to the 3' end), ligation of the adapter with a complementary dT overhang can be facilitated.

[0065] In the embodiment, size selection of the cleaved target DNA is performed either before or after the step of attaching the DNA adapter molecule to the cleaved modified target DNA. In the embodiment, the size selection is performed after attaching the DNA adapter to the cleaved target DNA. Size selection can be performed by methods known in the art, including, but not limited to, solid-phase reverse immobilization (SPRI) paramagnetic beads (e.g., using AMPure XP beads).

[0066] Amplification of the copy number of modified target DNA The methods described herein may optionally include a step of amplifying (increasing) the copy number of the modified target DNA by methods known in the art. When the modified target DNA is DNA, its copy number can be increased, for example, by PCR, cloning, and primer extension. The copy number of individual target DNAs can be amplified by PCR using primers specific to a particular target DNA sequence. Alternatively, multiple different modified target DNA sequences can be amplified by cloning them into a DNA vector using standard techniques. In one embodiment, the copy numbers of multiple different modified target DNA sequences are increased by PCR to prepare a library for next-generation sequencing, in which case, for example, a double-stranded adapter DNA is ligated to the sample DNA (or modified sample DNA) beforehand, and PCR is performed using primers complementary to the adapter DNA.

[0067] Creation of next-generation sequencing libraries By attaching an adapter DNA molecule to a cleaved modified target DNA, the copy number of the modified target DNA can be amplified (for example, by PCR) to create a library DNA sequence for next-generation sequencing. The primers for PCR have sequences that correspond to (and are complementary to) the adapter DNA that has been pre-ligated to the cleaved target DNA. The method provided in this invention (including reagents, steps, and their sequence) makes it possible to create a library of DNA sequences that can be sequenced using a high-throughput next-generation sequencing method.

[0068] Detection of cleavage sites in modified target DNA In embodiments of the methods disclosed herein, the method includes the step of detecting the sequence of a cleaved modified target DNA. The modified target DNA contains DHUs at the positions where one or more 5mC, 5hmC, 5fC, and 5caC were present in the unmodified target DNA. The modified target DNA containing DHUs is cleaved by the method described herein, which includes digestion with a DHU-sensitive endonuclease. Subsequently, the cleaved fragments can be converted into a sequencing library, where the start and end points of each fragment correspond to the sites of modified cytosines (5mC, 5hmC, 5fC, or 5caC). This allows for genome-wide enrichment of methylated CpG sites while removing the majority of the unmethylated genome. Thus, cytosine modifications can be detected by any method known in the art for identifying cleavage sites. Such methods include sequencing methods such as Sanger sequencing, microarray sequencing, and next-generation sequencing.

[0069] kit In addition, this disclosure provides a kit for identifying 5mC and 5hmC in target DNA. Such a kit includes reagents for identifying 5mC and 5hmC by the methods described herein. The kit may also include reagents for identifying 5caC and 5fC by the methods described herein. In embodiments, the kit includes a TET enzyme, a borane reducing agent, and instructions for performing the methods of the present invention. In further embodiments, the TET enzyme is TET1 or TET2 (or derivatives thereof), and the borane reducing agent is selected from one or more of the group consisting of pyridineborane, 2-picolineborane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In further embodiments, the TET1 enzyme is NgTet1, human TET1, or mouse Tet1, and the borane reducing agent is pyridineborane and / or pic-BH3. In another embodiment, the TET enzyme is mTET2 or a derivative thereof.

[0070] In some embodiments, the kit further comprises a 5hmC blocking group and a glucosyltransferase enzyme. In further embodiments, the 5hmC blocking group is a uridine diphosphate (UDP) sugar, the sugar is glucose or a glucose derivative, and the glucosyltransferase enzyme is T4 bacteriophage β-glucosyltransferase (βGT), T4 bacteriophage α-glucosyltransferase (αGT), and derivatives and analogs thereof.

[0071] In embodiments, the kit further comprises an oxidizing agent selected from one or more of the following: potassium perruthenate (KRuO4), Cu(II) / TEMPO (copper(II) perchlorate and 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)), potassium ruthenate, and manganese oxide.

[0072] In embodiments, the kit includes a reagent for blocking 5fC in a DNA sample. In embodiments, the kit includes aldehyde-reactive compounds, such as hydroxylamine derivatives, hydrazine derivatives, and hydrazide derivatives, as described herein. In embodiments, the kit includes a reagent for blocking 5caC, as described herein.

[0073] In some embodiments, the kit includes reagents for isolating DNA. In some embodiments, the kit includes reagents for isolating low-input DNA from a sample, for example, cfDNA from blood, plasma, or serum. In some embodiments, the kit includes reagents for isolating genomic DNA.

[0074] In embodiments, the kit comprises one or more enzymes for cleaving a modified target DNA containing DHU, as described herein. In embodiments, the kit comprises an adapter DNA molecule, as described herein. In addition, the kit may comprise an enzyme for ligating the adapter DNA molecule to the cleaved modified target DNA. [Examples] Example 1: TAPS and WGTAPS method Preparation of model DNA DNA oligonucleotides ("oligonucleotides") containing 5fC, 5mC, and 5hmC for MALDI and HPLC-MS / MS testing were purchased from Integrated DNA Technologies (IDT). All sequences and modifications were shown in Figures 6-1 and 6-2, and Figures 7-1 and 7-2. DNA oligonucleotides containing 5fC were synthesized by the C-tailing method. Specifically, DNA oligonucleotides 5'-GTCGACCGGATC-3' and 5'-TTGGATCCGGTCGACTT-3' were annealed and then incubated with 5-formyl-2'-dCTP (Trilink Biotech) and Klenow fragments (3'→5' exonuclease activity-deficient mutant) (New England Biolabs) in NEBuffer2 for 2 hours at 37°C. The product was purified using Bio-Spin P-6 Gel Columns (Bio-Rad).

[0075] Using the Expedite 8900 DNA Synthesis System, DNA oligos containing 5caC were synthesized using standard phosphoramidites (Sigma) and 5-carboxy-dC-CE phosphoramidite (Glen Research). Subsequent deprotection and purification were performed using Glen-Pak Cartridges (Glen Research) according to the manufacturer's instructions. Voyager-DE The purified oligonucleotides were characterized using the MALDI-TOF (Matrix-Assisted Laser Desorption / Ionization Time-of-Flight) Biospectrometry Workstation.

[0076] 222 bp model DNA for conversion testing: To prepare a 222 bp model DNA containing five CpG sites, bacteriophage λDNA (Thermo Fisher) was PCR amplified using Taq DNA polymerase (New England Biolabs) and purified with AMPure XP beads (Beckman Coulter). The primer sequences were 5'-CCTGATGAAACAAGCATGTC-3' for the forward primer and 5'-CAUTACTCACUTCCCCACUT-3' for the reverse primer. The uracil bases in the reverse strand of the PCR product were extracted using USER enzyme (New England Biolabs). The DNA was removed using (England Biolabs). Subsequently, 100 ng of the purified PCR product was methylated for 2 hours at 37°C in 20 μl of a solution containing 1 × NEBuffer 2, 0.64 mM S-adenosylmethionine, and 20 U M.SssI CpG methyltransferase (New England Biolabs), followed by thermal inactivation for 20 minutes at 65°C. The methylated 222 bp model DNA was purified using AMPure XP beads.

[0077] Model DNA for validation of TAPS, TAPSβ, and CAPS by Sanger sequencing: A 34 bp DNA oligo containing one 5mC site and one 5hmC site was annealed with other DNA oligos in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. The mixture was then ligated at 25°C for 1 hour in a reaction solution containing 400 U T4 ligase (NEB), and purified using 1.8 × AMPure XP beads.

[0078] [Table 2]

[0079] After the ligation reaction, the uracil linker was removed with USER enzyme, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCCGA m CGCATGATCTGTACTTGATCGAC hm A final product having the sequence (5'→3') of CGTGCAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG was obtained. The PCR primers for amplifying this model DNA were the P5 primer of 5'-AATGATACGGCGACCACCGAG-3' and the P7 primer of 5'-CAAGCAGAAGACGGCATACGAG-3'.

[0080] Model DNA for polymerase assay and Sanger sequencing: The model DNA for polymerase assay and Sanger sequencing was prepared by the same ligation method as described above, except that different DNA oligos were used.

[0081] [Table 3]

[0082] The sequence (5'→3') of the final product was AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGCGCTAAGTTCTAGATCGCCAACTGGTTGTGGCCTTAGCAGTCT m CGATCAGCTG m CTACTGTA m CGTAGCATCTATAGCCGGCTTGCTCTCTCTGCCTCTAGCAGCTGCTCCCTATAGTGAGTCGTATTAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG The PCR primers for amplifying the model DNA were the P5 and P7 primers shown above. The biotin-labeled primer sequence for primer extension was biotin ligated to the 5' end of the P7 primer. The PCR primers for RT-PCR after transcription by T7 RNA polymerase were the P5 primer and the RT primer 5'-TGCTAGAGGCAGAGAGAGCAAG-3'.

[0083] Model DNA for PCR bias testing: Model DNA for PCR bias testing was prepared using the same ligation method as described above, except that a different DNA oligonucleotide was used.

[0084] [Table 4]

[0085] The sequence of the final product (5'→3') is: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGCGCTAAGTTCTAGATCGCCAACTGGTTGTGGCCTTAGCAGTCTXGATCAGCTGCTACTGTACGT AGCATCTATAGCCGGCTTGCTCTCTCTGCCTCTAGCAGCTGCTCCCTATAGTGAGTCGTATTAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG In this sequence, X is DHU, U, T, or C. The PCR primers for amplifying this model DNA are the P5 and P7 primers described above.

[0086] Preparation of methylated bacteriophage λ genomic DNA Mg 2+In a 50 μL reaction mixture containing 0.64 mM SAM and 0.8 U / μl M.SssI enzyme in a buffer solution (10 mM Tris-Cl (pH 8.0), 50 mM NaCl, and 10 mM EDTA), 1 μg of unmethylated bacteriophage λDNA (Promega) was methylated at 37°C for 2 hours. Subsequently, 0.5 μL of M.SssI enzyme and 1 μL of SAM were added, and the reaction mixture was incubated at 37°C for a further 2 hours. The methylated DNA was then purified using 1×AMPure XP beads. To confirm complete methylation, all procedures were repeated in NEB Buffer 2. Subsequently, DNA methylation was verified by an HpaII digestion assay. In a 10 μL reaction mixture containing 2 U of HpaII enzyme (NEB) in CutSmart buffer (NEB), 50 ng of methylated and unmethylated DNA were digested at 37°C for 1 hour. The digestion products were run on a 1% agarose gel along with an undigested λDNA control. After the assay, unmethylated λDNA was digested, but methylated λDNA remained intact, confirming that CpG methylation was complete and successful. The λDNA sequence can be found at GenBank-EMBL accession number J02459.

[0087] Preparation of a 2kb unmodified spike-in control A 2kb spike-in control (2kb-1, 2, 3) was PCR amplified from the pNIC28-Bsa4 plasmid (Addgene, catalog number 26103) in a reaction mixture containing 1 ng of DNA template, 0.5 μM primer, and 1 U of Phusion High-Fidelity DNA Polymerase (Thermo Fisher). The PCR primer sequences are listed in Table 2.

[0088] [Table 5]

[0089] The PCR product was purified using a Zymo-Spin column. The 2kb unmodified control sequence (5'→3') was as follows: Preparation of 120mer spike-in control A 120-mer spike-in control was generated by primer extension. The oligo sequences and primers are listed in Table 3.

[0090] [Table 6]

[0091] In short, for the 120mer-1 spike-in, 3 μM of oligonucleotides were annealed with 10 μM of primer in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. For the 120mer-2 spike-in, 5 μM of oligonucleotides were annealed with 7.5 μM of primer. Primer extension was performed for 1 hour at 37°C in NEB buffer 2 containing 0.4 μM dNTPs (120mer-1: dATP / dGTP / dTTP / dhmCTP, 120mer-2: dATP / dGTP / dTTP / dCTP) and 5 U of Klenow polymerase (New England Biolabs). After the reaction, the spike-in control was purified using a Zymo-Spin column (Zymo Research). Next, a 120-mer spike-in control was methylated for 2 hours at 37°C in 50 μL of a reaction mixture containing 0.64 mM SAM and 0.8 U / μl M.SssI enzyme in NEB buffer 2, and purified by a Zymo-Spin column. All spike-in sequences used can be downloaded from https: / / figshare.com / s / 80c3ab713c261262494b.

[0092] Generation of synthetic spike ins with N5mCNN and N5hmCNN Synthetic oligonucleotides containing the sequences of N5mCNN and N5hmCNN were generated by annealing and decompression methods. The oligonucleotide sequences are listed in Table 4 below.

[0093] [Table 7]

[0094] In short, 10 μM of N5mCNN and N5hmCNN oligos (IDT) were annealed together in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. Extension was carried out for 1 hour at 37°C in NEB buffer 2 containing 0.4 mM dNTPs (dATP / dGTP / dTTP / dCTP) and 5 U of Klenow polymerase (NEB). After the reaction, the spike-in control was purified using a Zymo-Spin column (Zymo Research).

[0095] Synthetic spike in (5'→3') with N5mCNN and N5hmCNN: GAAGATGCAGAAGACAGGAAGGATGAAACACTCAGGCGCACGCTGGCATNmCNNGACAAACCACAAGAACAGGCTAGTGAGAATGAAGGGATATGTTTGTAAGATGGTCNNGNATCTTGGGTTGTGTGGTGGATGTTGGCGTTGGTGGGTTTCAGAGTTGG Complementary strand (5'→3'): CCAACTCTGAAACCCACCAACGCCAACATCCACCACACAACCCAAGATNhmCNNGACCATCTTACAAACATATCCCTTCATTCTCACTAGCCTGTTCTTGTGGTTTGTCNNGNATGCCAGCGTGCGCCTGAGTGTTTCATCCTTCCTGTCTTCTGCATCTTC DNA digestion and HPLC-MS / MS analysis DNA samples were digested with 2 U of Nuclease P1 (Sigma-Aldrich) and 10 nM of the deaminase inhibitor erythro-9-amino-β-hexyl-α-methyl-9H-purine-9-ethanol hydrochloride (Sigma-Aldrich). After incubation overnight at 37°C, the samples were further treated with 6 U of alkaline phosphatase (Sigma-Aldrich) and 0.5 U of phosphodiesterase I (Sigma-Aldrich) for 3 hours at 37°C. The digested DNA solution was filtered through an Amicon Ultra-0.5 mL 10K centrifuge filter (Merck Millipore) to remove proteins, and then analyzed by HPLC-MS / MS.

[0096] HPLC-MS / MS analysis was performed using a 1290 Infinity LC Systems (Agilent) connected to a 6495B Triple Quadrupole Mass Spectrometer (Agilent). A ZORBAX Eclipse Plus C18 column (2.1 × 150 mm, 1.8 micrometers, Agilent) was used. The column temperature was maintained at 40°C, and the solvent system consisted of water with 10 mM ammonium acetate (pH 6.0, solvent A) and water-acetonitrile (60 / 40 (v / v), solvent B), with a flow rate of 0.4 mL / min. The gradient was 0–5 minutes at solvent B 0%, 5–8 minutes at solvent B 0→5.63%, 8–9 minutes at solvent B 5.63%, 9–16 minutes at solvent B 5.63→13.66%, 16–17 minutes at solvent B 13.66→100%, 17–21 minutes at solvent B 100%, 21–24.3 minutes at solvent B 100→0%, and 24.3–25 minutes at solvent B 0%. Dynamic multiple reaction monitoring mode (dMRM) of MS was used for quantification. Source-dependent parameters were gas temperature 230°C, gas flux 14 L / min, nebulizer 40 psi, sheath gas temperature 400°C, sheath gas flux 11 L / min, capillary voltage 1500 V in positive ion mode, nozzle voltage 0 V, high-pressure RF 110 V and low-pressure RF 80 V (both in positive ion mode). The fragmentation voltage was 380V for all compounds, and other compound-dependent parameters are summarized in Table 5.

[0097] [Table 8]

[0098] NgTET1 expression and purification A pRSET-A plasmid encoding the His-tagged NgTET1 protein (GG739552.1) was designed and purchased from Invitrogen. The protein was expressed in E. coli BL21(DE3) strain and purified, with some modifications to a previously described plasmid (JEPais et al., Biochemical characterization of a Naegleria TET-like oxygenase and its application in single molecule sequencing of 5-methylcytosine. Proc. Natl. Acad. Sci. USA 112, 4316-4321 (2015), as incorporated herein by reference). Briefly, bacteria obtained from small-scale overnight cultures were grown in LB medium at 37°C and 200 rpm until the OD600 reached 0.7–0.8 for protein expression. Next, the culture medium was cooled to room temperature, and the expression of the target protein was induced with 0.2 mM isopropyl-β-d-1-thiogalactopyranoside (IPTG). The cells were then maintained for a further 18 hours at 18°C ​​and 180 rpm. The cells were then harvested and resuspended in a buffer containing 20 mM HEPES (pH 7.5), 500 mM NaCl, 1 mM DTT, 20 mM imidazole, 1 μg / mL leupeptin, 1 μg / mL pepstatin A, and 1 mM PMSF. The cells were disrupted using an EmulsiFlex-C5 high-pressure homogenizer, and the lysate was clarified by centrifugation at 30,000 × g and 4°C for 1 hour. The recovered supernatant was packed into Ni-NTA resin, and the NgTET1 protein was eluted with a buffer containing 20 mM HEPES (pH 7.5), 500 mM imidazole, 2 M NaCl, and 1 mM DTT. Subsequently, the recovered fraction was purified using a HiLoad 16 / 60 Sdx 75 (20 mM HEPES (pH 7.5), 2 M NaCl, 1 mM DTT). Next, the fraction containing NgTET1 was recovered, the buffer was replaced with a buffer containing 20 mM HEPES (pH 7.0), 10 mM NaCl, and 1 mM DTT, and the fraction was placed in a HiTrap HP SP column.The pure protein was eluted using a salt concentration gradient, recovered, and the buffer was replaced with a final buffer containing 20 mM Tris-Cl (pH 8.0), 150 mM NaCl, and 1 mM DTT. Subsequently, the protein was concentrated to 130 μM, mixed with glycerol (30% (v / v)), and the aliquots were stored at -80°C.

[0099] Expression and Purification of mTET1CD The mTET1CD catalytic domain (NM_001253857.2, 4371~6392) with an N-terminal Flag tag was cloned into the pcDNA3-Flag between the KpnI restriction site and the BamH1 restriction site. For protein expression, 1 mg of plasmid was added to 1 L of Expi293F (Gibco) cell culture medium, resulting in a 1 × 10⁶ expression. 6Cells were transfected at a density of cells / mL and grown for 48 hours at 37°C, 170 rpm, and 5% CO2. The cells were then harvested by centrifugation and resuspended in a lysis buffer containing 50 mM Tris-Cl (pH=7.5), 500 mM NaCl, 1× cOmplete Protease Inhibitor Cocktail (Sigma), 1 mM PMSF, and 1% Triton X-100. The cells were incubated on ice for 20 minutes. The cell lysates were then clarified by centrifugation at 30000×g and 4°C for 30 minutes. The recovered supernatant was purified with ANTI-FLAG M2 Affinity Gel (Sigma), and the pure protein was eluted in a buffer containing 20 mM HEPES (pH=8.0), 150 mM NaCl, 0.1 mg / mL 3× Flag peptide (Sigma), 1× cOmplete Protease Inhibitor Cocktail (Sigma), and 1 mM PMSF. The recovered fraction was concentrated, and the buffer was replaced with a final buffer containing 20 mM HEPES (pH=8.0), 150 mM NaCl, and 1 mM DTT. The concentrated protein was mixed with glycerol (30% (v / v)), frozen in liquid nitrogen, and aliquots were stored at -80°C. The activity and quality of recombinant mTET1CD were examined by MALDI mass spectrometry. Based on this assay, recombinant mTET1CD is sufficiently active and can catalyze the oxidation of 5 mC to 5 caC. Significant digestion of the tested model oligo was detected by MALDI, confirming that the protein does not contain a nuclease.

[0100] Oxidation by TET Oxidation with NgTET1: To oxidize a 222 bp model DNA oligo with Tet, 100 ng of 222 bp DNA was incubated for 1 hour at 37°C in 20 μl of a solution containing 50 mM MOPS buffer (pH 6.9), 100 mM iron(II) ammonium sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol (DTT), 50 mM NaCl, and 5 μM NgTET. Then, 0.4 U of proteinase K (New England Biolabs) was added to the reaction mixture, and the mixture was incubated for 30 minutes at 37°C. The product was purified using a Zymo-Spin column (Zymo Research) according to the manufacturer's instructions.

[0101] To oxidize genomic DNA with NgTET1, 500 ng of genomic DNA was incubated for 1 hour at 37°C in 50 μl of a solution containing 50 mM MOPS buffer (pH 6.9), 100 mM ammonium iron(II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 50 mM NaCl, and 5 μM NgTET1. Then, 4 U of proteinase K (New England Biolabs) was added to the reaction mixture, and the mixture was incubated for 30 minutes at 37°C. The product was purified using 1.8 × Ampure beads according to the manufacturer's instructions.

[0102] Oxidation with mTET1: 100 ng of genomic DNA was incubated for 80 minutes at 37°C in 50 μl of a reaction mixture containing 50 mM HEPES buffer (pH 8.0), 100 μM iron(II) ammonium sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 100 mM NaCl, 1.2 mM ATP, and 4 μM mTET1CD. Subsequently, 0.8 U of proteinase K (New England Biolabs) was added to the reaction mixture, and the mixture was incubated for 1 hour at 50°C. The product was purified using a Bio-Spin P-30 Gel Column (Bio-Rad) and 1.8 × AMPure XP beads according to the manufacturer's instructions.

[0103] Voluntary contributions Reduction with Pic-BH3: 25 μL of 5M α-picoline borane (pic-BH3, Sigma-Aldrich) in MeOH and 5 μL of 3M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 20 μL of DNA sample and incubated at 60°C for 1 hour. The product was purified using a Zymo-Spin column (Zymo Research) according to the manufacturer's instructions for 222 bp DNA, or using Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions for oligonucleotides.

[0104] Alternatively, 100 mg of 2-picoline-borane (pic-borane, Sigma-Aldrich) was dissolved in 187 μL of DMSO to obtain a solution of approximately 3.26 M. In each reaction, 25 μL of pic-borane solution and 3 M sodium acetate solution (pH 5.2, Thermo) were used. 5 μL of Fisher's solution was added to 20 μL of DNA sample and incubated at 70°C for 3 hours. The resulting product was purified according to the manufacturer's instructions, using a Zymo-Spin column for genomic DNA and Micro Bio-Spin 6 Columns (Bio-Rad) for DNA oligos.

[0105] Reduction with pyridineborane: 50-100 ng of oxidized DNA in 35 μL of water was reduced in 50 μL of a reaction mixture containing 600 mM sodium acetate solution (pH=4.3) and 1 M pyridineborane using an Eppendorf ThermoMixer for 16 hours at 37°C and 850 rpm. The product was purified by Zymo-Spin column chromatography.

[0106] Pic-borane reaction of a single nucleoside: 500 μL of 3.26 M 2-picoline-borane (pic-borane, Sigma-Aldrich) in MeOH and 500 μL of 3 M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 10 mg of 2'-deoxycytidine-5-carboxylate sodium salt (Berry & Associates). The mixture was stirred at 60°C for 1 hour. The product was purified by HPLC to obtain the pure compound as a white foam. High-resolution MS (Q-TOF) m / z [M + Na]+ C9H 14 Calculated value for N2O5Na: 253.0800; Measured value: 253.0789. 5hmC block 5hmC was blocked for 1 hour at 37°C in 20 μl of a solution containing 50 mM HEPES buffer (pH 8), 25 mM MgCl2, 200 μM uridine diphosphate glucose (UDP-Glc, New England Biolabs), 10 U βGT (Thermo Fisher), and 10 μM 5hmC DNA oligonucleotides. The resulting product was purified using Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions.

[0107] Block 5fC Blocking of 5fC DNA oligonucleotides was performed for 2 hours at 37°C in 100 mM MES buffer (pH 5.0), 10 mM O-ethylhydroxylamine (Sigma-Aldrich), and 10 μM 5fC DNA oligonucleotides. The resulting product was analyzed using Micro Bio-Spin 6. The product was purified using Columns (Bio-Rad) according to the manufacturer's instructions.

[0108] 5caC block Blocking of 5caC DNA oligo was performed at 37°C for 0.5 hours using 75 mM MES buffer (pH 5.0), 20 mM N-hydroxysuccinimide (NHS, Sigma-Aldrich), 20 mM 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC, Fluorochem), and 10 μM 5caC DNA oligo. Subsequently, the buffer was replaced with 100 mM sodium phosphate (pH 7.5) and 150 mM NaCl using Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions. 10 mM ethylamine (Sigma-Aldrich) was added to the oligo, and the mixture was incubated at 37°C for 1 hour. The product was purified using Micro Bio-Spin 6 Columns (Bio-Rad) according to the manufacturer's instructions.

[0109] Oxidation of 5hmC 46 μL of 5hmC DNA oligonucleotides were denatured in 2.5 μL of 1 M NaOH for 30 minutes in a shaking incubator at 37°C, and then oxidized on ice for 1 hour in 1.5 μL of a solution containing 50 mM NaOH and 15 mM potassium perruthenate (KRuO4, Sigma-Aldrich). The resulting product was purified using Micro Bio-Spin 6 Columns according to the manufacturer's instructions.

[0110] Verification of TAPS conversion using the TaqαI assay. We tested the conversion of 5mC after TAPS by PCR amplification of a target region containing a TaqαI restriction site (TCGA) and subsequent TaqαI digestion. For example, the conversion of 5mC in our TAPS library can be tested based on a 194bp amplicon containing a single TaqαI restriction site amplified from a CpG-methylated λDNA spike-in control. The PCR product amplified from the 194bp amplicon is digested with TaqαI restriction enzyme, and the digest product is examined on a 2% agarose gel. The PCR product amplified with unconverted control DNA is digested with TaqαI, and two bands are shown on the gel. In TAPS-converted samples, the restriction site is lost due to the C-to-T conversion, so the 194bp amplicon remains intact. The overall conversion level can be evaluated based on the quantification of digested and undigested gel bands, and in successful TAPS samples, this level should be over 95%.

[0111] In short, using the corresponding primers, Taq DNA polymerase (New DNA samples converted by New England Biolabs were amplified by PCR. The PCR products were incubated with 4 units of TaqαI restriction enzyme (New England Biolabs) in 1×CutSmart buffer (New England Biolabs) for 30 minutes at 65°C and examined by 2% agarose gel electrophoresis.

[0112] Quantitative polymerase chain reaction (qPCR) To compare amplification and melting curves between pre- and post-TAPS model DNA (Figure 11), 1 ng of DNA sample was added to 19 μL of PCR master mix containing 1×LightCycler 480 High Resolution Melting Master Mix (Roche Diagnostics Corporation), 250 nM primers (forward primer: CCTGATGAAACAAGCATGTC and reverse primer: CATTACTCACTTCCCCACTT), and 3 mM MgSO4. For PCR amplification, an initial denaturation step was performed for 10 minutes at 95°C, followed by denaturation at 95°C for 5 minutes, annealing at a customized annealing temperature for 5 minutes, and extension at 72°C for 5 minutes. This cycle was repeated for 40 cycles. The final step included 1 minute at 95°C and 1 minute at 70°C, and the melting curve (in 0.02°C increments, with 5 minutes allowed before each acquisition) ranged from 65°C to 95°C.

[0113] In other assays, qPCR is performed using 1×Fast SYBR Green Master The procedure was performed by adding the required amount of DNA sample to 19 μL of PCR master mix containing Thermo Fisher mix, 200 nM forward primers, and reverse primers. For PCR amplification, an initial denaturation step was performed for 20 seconds at 95°C, followed by 3 seconds of denaturation at 95°C, 20 seconds of annealing, and extension at 60°C. This cycle was repeated for 40 cycles.

[0114] C in mESC gDNA by HpaII-qPCR assay m Verification of CGG methylation levels 1 μg of mESC gDNA was incubated with 50 units of HpaII (NEB, 50 units / μL) and 1×CutSmart buffer in 50 μL of reaction solution at 37°C for 16 hours. HpaII was not added to the control reaction. 1 μL of proteinase K was added to the reaction mixture and incubated at 40°C for 30 minutes, after which the proteinase K was inactivated at 95°C for 10 minutes. The Ct values ​​of the HpaII-digested sample or the control sample were measured using the qPCR assay described above, with the corresponding primer set (listed in Table 9) to determine the specific CCGG location.

[0115] Sanger sequencing Exonuclease I and shrimp-derived alkaline phosphatase (New England PCR products were purified using Biolabs or Zymo-Spin columns and processed for Sanger sequencing.

[0116] DNA damage testing for fragments of different lengths mESC genomic DNA was spiked with 0.5% CpG-methylated λDNA and either left unfragmented or sonicated using a Covaris M220 instrument, followed by size sorting to 500-1kb or 1kb-3kb using AMPure XP beads. 200ng of DNA was oxidized once with mTET1CD and reduced with the pyridineborane complex described above, or converted using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer's protocol. 10ng of DNA before and after conversion with TAPS and bisulfite was flowed onto a 1% agarose gel. For visualization, the bisulfite-converted gel was cooled in an ice bath for 10 minutes. The conversion of 5mC in the TAPS sample was tested by the TaqαI digestion assay as described above.

[0117] mESC culture and genomic DNA isolation Mouse ESCs (mESCs) E14 were cultured on gelatin-coated plates in Dulbecco's modified Eagle medium (DMEM) (Invitrogen) supplemented with 15% FBS (Gibco), 2 mM L-glutamine (Gibco), 1% non-essential amino acids (Gibco), 1% penicillin / streptavidin (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 1000 units / mL LIF (Millipore), 1 μM PD0325901 (Stemgent), and 3 μM CHIR99021 (Stemgent). The culture medium was maintained at 37°C and 5% CO2, and subcultured every two days.

[0118] To isolate genomic DNA, cells were recovered by centrifugation for 5 minutes at 1000×g and at room temperature. DNA was extracted using the Quick-DNA Plus Kit (Zymo Research) according to the manufacturer's protocol.

[0119] Preparation of mESC gDNA for TAPS and WGBS For whole-genome bisulfite sequencing (WGBS), 0.5% unmethylated λDNA was spiked into mESC gDNA. For whole-genome TAPS, mESC gDNA was spiked with 0.5% methylated λDNA and 0.025% 2kb of unmodified spike-in control. The DNA samples were fragmented using a Covaris M220 instrument and size-sorted to 200-400 bp using AMPure XP beads. In addition, after size sorting with AMPure XP beads, 0.25% of N5mCNN and N5hmCNN control oligos were spiked into the DNA for TAPS.

[0120] Whole-genome bisulfite sequencing For whole-genome bisulfite sequencing (WGBS), 200 ng of fragmented mESC gDNA spiked with 0.5% unmethylated bacteriophage λDNA was used. End repair, A-tailing, and methylation adapter (NextFlex) ligation were performed using the KAPA HyperPrep kit (Kapa Biosystems) according to the manufacturer's protocol. Subsequently, bisulfite conversion of the DNA was performed using the EpiTect Bisulfite Kit (Qiagen) according to the Illumina protocol. The final library was amplified for 6 cycles using Uracil Plus Polymerase (Kapa Biosystems) and purified with 1×Ampure beads. Pair-ended sequencing of 80 bp was performed on the WGBS sequencing library using a NextSeq500 sequencer (Illumina) with the NextSeq High Output Kit and a 15% PhiX control library spike-in.

[0121] Whole Genome TAPS For whole-genome TAPS sequencing, 100 ng of fragmented mESC gDNA spiked with 0.5% methylated λDNA and 0.025% 2kb of unmodified spike-in control was used. End repair and A-tailing reactions, as well as ligation of the Illumina Multiplexing adapter, were performed using the KAPA HyperPrep kit according to the manufacturer's protocol. The ligated DNA was oxidized twice with mTET1CD and then reduced with pyridineborane according to the protocol described above. The final sequencing library was amplified for 5 cycles using KAPA Hifi Uracil Plus Polymerase and purified with 1×Ampure beads. 80 bp paired-end sequencing was performed on the whole-genome TAPS sequencing library with a 1% PhiX control library spike-in using a NextSeq500 sequencer (Illumina) and one NextSeq High Output kit.

[0122] Low-input whole-genome TAPS using a dsDNA library preparation kit As described above, mESC gDNA prepared for whole-genome TAPS was used in raw-input whole-genome TAPS. Briefly, samples containing 100 ng, 10 ng, and 1 ng of mESC gDNA were oxidized once using NgTET1 according to the protocol described above. End repair, A-tailing, and ligation were performed using NEBNext Ultra II (New England Biolabs) or KAPA HyperPrep kit according to the manufacturer's protocol. Subsequently, the DNA was subjected to pic-borane reaction as described above. KAPA Hifi The converted library was amplified using Uracil Plus Polymerase and purified with 1×Ampure beads.

[0123] Low-input whole-genome TAPS using ssDNA library preparation kit As described above, mESC gDNA prepared for whole-genome TAPS was used in raw-input whole-genome TAPS. Briefly, samples containing 100 ng, 10 ng, 1 ng, 100 pg, and 10 pg of mESC gDNA were oxidized once with NgTET1 and then reduced with pic-borane as described above. Accel-NGS Methyl-Seq A sequencing library was prepared using the DNA Library Kit (Swift Biosciences) according to the manufacturer's protocol. The final library was amplified for 6 cycles (100 ng), 9 cycles (10 ng), 13 cycles (1 ng), 16 cycles (100 pg), and 21 cycles (10 pg) using KAPA Hifi Uracil Plus Polymerase, and purified with 0.85 × Ampure beads.

[0124] In another experiment, mESC gDNA prepared for whole-genome TAPS as described above was used in a raw-input whole-genome TAPS. Briefly, using the KAPA HyperPrep kit according to the manufacturer's protocol, samples containing 100 ng, 10 ng, and 1 ng of mESC gDNA were ligated to an Illumina Multiplexing adapter using end repair and A-tailing reactions. Subsequently, the ligated samples were oxidized once with mTET1CD and then reduced with pyridineborane according to the protocol described above. The converted libraries were amplified for 5 cycles (100 ng), 8 cycles (10 ng), and 13 cycles (1 ng) using KAPA Hifi Uracil Plus Polymerase and purified with 1×AMPure XP beads.

[0125] Cell-free DNA TAPS Cell-free DNA TAPS samples were prepared from 10 ng and 1 ng of cell-free DNA samples. Briefly, the samples were oxidized once with NgTET1 and reduced with pic-borane as described above. A sequencing library was prepared using the Accel-NGS Methyl-Seq DNA Library Kit (Swift Biosciences) according to the manufacturer's protocol. The final library was amplified 9 cycles (10 ng) and 13 cycles (1 ng) using KAPA Hifi Uracil Plus Polymerase and purified with 0.85 × Ampure beads.

[0126] In a separate experiment, cell-free DNA TAPS samples were prepared from 10 ng and 1 ng of cell-free DNA samples, as described above for whole-genome TAPS. Briefly, the cell-free DNA samples were ligated to an Illumina Multiplexing adapter using the KAPA HyperPrep kit according to the manufacturer's protocol, followed by end repair and A-tailing reactions. Subsequently, the ligated samples were oxidized once with mTET1CD and then reduced with pyridineborane, according to the protocol described above. The converted libraries were amplified for 7 cycles (10 ng) and 13 cycles (1 ng) using KAPA Hifi Uracil Plus Polymerase and purified with 1×AMPure XP beads.

[0127] WGBS data processing Paired-end reads were downloaded as FASTQ from Illumina BaseSpace and then quality trimmed using Trim Galore! v0.4.4 (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ). After trimming, read pairs in which at least one read was shorter than 35 bp were removed. The trimmed reads were mapped to a combined genome of the mm9 version of the mouse genome, λ phage, and PhiX (sequences derived from Illumina iGENOMES) using Bismark v0.19 (F. Krueger, S. Andrews, Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics 27, 1571-1572 (2011), incorporated herein by reference) with the --no_overlap option. Reads with extremely high non-conversion rates were removed using the "three-C" filter. PCR duplicates were called using MarkDuplicates in Picard v1.119 (http: / / broadinstitute.github.io / picard / ). Regions known to be prone to mapping artifacts were downloaded (https: / / sites.google.com / site / anshulkundaje / projects / blacklists) and excluded from further analysis (EPConsortium, An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012). This reference is incorporated herein by reference).

[0128] Preprocessing of TAPS data Paired-end reads were downloaded from Illumina BaseSpace and then quality trimmed using Trim Galore! v0.4.4. After trimming, read pairs with at least one read shorter than 35 bp were removed. BWA Using mem v.0.7.15 (H.Li, R.Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760 (2009). Incorporated herein by reference) with default parameters, trimmed reads were mapped to a combined genome of spike-in sequences, λ phages, and mm9 versions of the mouse genome. Regions known to be prone to mapping artifacts were downloaded (https: / / sites.google.com / site / anshulkundaje / projects / blacklists) and excluded from further analysis (EPConsortium, Nature 489, 57-74 (2012)).

[0129] Detection of converted bases in TAPS Using a custom Python 3 script (MF-filter.py), aligned reads were separated into the original upper strand (OT) and original lower strand (OB). Next, PCR duplicates were removed separately from the OT and OB using Picard MarkDuplicates. On the mapped OT and OB reads from which duplicates had been removed, duplicate segments in the read pairs were removed separately using BamUtil clipOverlap (https: / / github.com / statgen / bamUtil). Subsequently, modified bases were detected using samtools mpileup and a custom Python 3 script (MF-caller_MOD.py).

[0130] Sequencing quality analysis of TAPS and WGBS A Python 3 script (MF-phredder.py) was used to extract quality score statistics for each nucleotide type from the original FASTQ file, such as one downloaded from Illumina BaseSpace.

[0131] Coverage analysis of TAPS and WGBS Base-level genome coverage files were created using Bedtools v2.25 genomecov (ARQuinlan, IMHall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010). This reference is incorporated herein by reference). To compare the relative coverage distribution between TAPS and WGBS, TAPS reads were subsampled against the corresponding median coverage in WGBS using the -s option of samtools view. For analyses comparing coverage in WGBS and subsampled TAPS, clipOverlap was used on both TAPS and WGBS bam files.

[0132] Analysis of cytosine modifications measured by TAPS and WGBS The percentage of modified reads per base was calculated from the Bismark output and the MF-caller_MOD.py output, respectively. The intersection was calculated using Bedtools intersect, and the statistical analysis results and figures were created in R and Matlab. Genomic regions were visualized using IGV v2.4.6 (JTRobinson et al., Integrative genomics viewer. Nat. Biotechnol. 29, 24-26 (2011). Incorporated herein by reference). To plot the coverage and modification levels around CGIs, all CGI coordinates in mm9 were downloaded from the UCSC genome browser, binned into 20 windows, and expanded on both sides by up to 50 windows of size 80 bp (provided that this did not reach half the distance to the next CGI). Using Bedtools map, the average modification level (in CpGs) and coverage (for all bases, on both strands) were calculated for each bin. The values ​​for each bin were averaged again and then plotted in Matlab.

[0133] Data processing time simulation Based on the λ phage genome, synthetic paired-end sequencing reads were simulated using ART42 with the parameters (-p -ss NS50 --errfree --minQ 15 -k 0 -nf 0 -l 75 -c 1000000 -m 240 -s 0 -ir 0 -ir2 0 -dr 0 -dr2 0 -sam -rs 10). Subsequently, 50% of all CpG locations were marked as modified, and two libraries were created using a custom Python 3 script, either as TAPS (transforms modified bases) or WGBS (transforms unmodified bases). These reads were then processed according to the pipeline used for each method in this document. Processing time was measured by Linux command time. All analysis steps were performed in single-threaded mode using one Intel Xeon CPU and 250GB of memory.

[0134] Results and Discussion It was discovered that pic-BH3 can readily convert 5fC and 5caC to DHU via a previously unknown reductive decarboxylation / deamination reaction (Figure 4). This reaction was shown to be quantitative using MALDI for both single nucleosides and multiple oligonucleotides (Figures 2-3 and 6-1-7-2).

[0135] Using an 11mer 5caC-containing DNA oligo as a model, we screened for chemicals that can react with 5caC (monitored by matrix-assisted laser desorption / ionization mass spectrometry (MALDI)). Certain borane-containing compounds were found to react efficiently with the 5caC oligo, resulting in a molecular weight reduction of 41 Da (Figures 1 and 2). For further testing, pyridineborane and its derivative 2-picolineborane (pic-borane) were selected because they are commercially available and environmentally friendly reducing agents.

[0136] Repeated reactions with a single 5caC nucleoside confirmed that pyridineborane and pic-borane convert 5caC to dihydrouracil (DHU) (Figures 3 and 4B). Interestingly, pyridineborane and pic-borane were also found to convert 5fC to DHU, apparently through a mechanism such as reductive decarboxylation / deamination (Figures 4C, 6-1, and 6-2). The detailed mechanisms of both reactions are still unclear. Quantitative analysis of the borane reaction with DNA oligonucleotides by HPLC-MS / MS confirmed that pic-borane converts 5caC and 5fC to DHU with an efficiency of approximately 98%, and does not have activity toward unmethylated cytosine, 5mC, or 5hmC (Figure 2B).

[0137] As a uracil derivative, DHU can be recognized as thymine by both DNA polymerase and RNA polymerase. Therefore, reduction with borane can induce both the conversion of 5caC to T and the conversion of 5fC to T, and borane reduction can be used for sequencing of 5fC and 5caC at base-level resolution. We refer to this sequencing as pyridineborane sequencing ("PS") (Table 6). The reduction of 5fCT to T with borane can be blocked via hydroxylamine binding (CXSong et al., Genome-wide profiling of 5-formylcytosine reveals its roles in epigenetic priming. Cell 153, 678-691 (2013). Incorporated herein by reference), and the reduction of 5caC to T with borane can be blocked via EDC coupling (X. Lu et al., Chemical modification-assisted bisulfite sequencing (CAB-Seq) for 5-carboxylcytosine detection in DNA. J. Am. Chem. Soc. 135, 9315-9317 (2013). Incorporated herein by reference) (Figures 6-1 and 6-2). This blocking allows for specific sequencing of 5fC or 5caC using PS (Table 6).

[0138] [Table 9]

[0139] Furthermore, in the present invention's process called Tet-assisted pyridine borane sequencing ("TAPS"), 5mC and 5hmC can be oxidized to 5caC using the TET enzyme, and then 5caC can be reduced with borane (Figures 5A-B, Table 1). Since TAPS can induce the C→T conversion of 5mC and 5hmC, it can be used to detect 5mC and 5hmC with base-level resolution.

[0140] In addition, in the process referred to herein as TAPSβ, β-glucosyltransferase (βGT) is used to prevent 5hmC from being oxidized by TET by labeling 5hmC with glucose (M. Yu et al., Base-resolution Analysis of 5-hydroxymethylcytosine in the mammalian genome. Cell 149, 1368-1380 (2012)), and protection against reduction by borane (Figures 7-1 and 7-2), allowing selective sequencing of only 5mC (Figure 5B, Table 1). Subsequently, the 5hmC site can be estimated by subtracting the TAPSβ result from the TAPS measurement result. Alternatively, instead of TET, potassium perruthenate (KRuO4) (MJ Booth et al., Quantitative Sequencing of 5-Methylcytosine and 5-Hydroxymethylcytosine at Single-Base Resolution. Science 336, 934-937 (2012)), a reagent previously used in oxidative bisulfite sequencing (oxBS), can be used as a chemical oxidizing agent to specifically oxidize 5hmC to 5fC (Figures 7-1 and 7-2). This approach is referred to herein as chemically assisted pyridine borane sequencing ("CAPS"), and 5hmC can be specifically sequenced using this approach (Figure 5B, Table 1). Therefore, TAPS and related methods can, in principle, provide a comprehensive system for sequencing all four epigenetic modifications of cytosine (Figure 5B, Table 1, Table 6).

[0141] TAPS alone will also detect existing 5fC and 5caC in the genome. However, given that the levels of 5fC and 5caC in genomic DNA are extremely low under normal conditions, this is acceptable. If it is desired to completely remove the signals of 5fC and 5caC under specific conditions, this can be easily achieved by protecting 5fC with hydroxylamine binding and 5caC with EDC coupling, thereby preventing conversion to DHU.

[0142] The performance of TAPS was evaluated compared to bisulfite sequencing, the current standard and most widely used method for mapping 5mC and 5hmC at base-level resolution. Both Naegleria TET-like oxygenase (NgTET1) and mouse Tet1 (mTet1) were used because they can efficiently oxidize 5mC to 5caC in vitro. To confirm the conversion of 5mC to T, TAPS was applied to model DNA containing fully methylated CpG sites. Restriction enzyme digestion (Figures 8A-B) and Sanger sequencing (Figure 9A) demonstrated that TAPS could effectively convert 5mC to T. TAPSβ and CAPS were also validated by Sanger sequencing (Figure 12).

[0143] TAPS was also applied to genomic DNA (gDNA) derived from mouse embryonic stem cells (mESCs). HPLC-MS / MS quantification revealed, as expected, that 5mC accounted for 98.5% of cytosine modifications in mESC gDNA, with the remainder consisting of 5hmC (1.5%) and trace amounts of 5fC and 5caC, and no DHU (Figure 9B). After oxidation with TET, approximately 96% of the cytosine modifications were oxidized to 5caC, and 3% were oxidized to 5fC (Figure 9B). After reduction with borane, over 99% of the cytosine modifications were converted to DHU (Figure 9B). These results demonstrate that both oxidation with TET and reduction with borane function efficiently on genomic DNA.

[0144] Both oxidation by TET and reduction by borane are mild reactions, showing no significant DNA degradation compared to bisulfite sequencing (Figures 10A-D), resulting in higher DNA recovery rates. Another significant advantage over bisulfite sequencing is that TAPS is non-destructive and can maintain DNA at lengths up to 10kb (Figure 10C). Furthermore, the DNA remains double-stranded after TAPS (Figures 10A-C), and its conversion is unaffected by DNA length (Figures 15A-B).

[0145] In addition, because DHU is close to natural bases, it is compatible with various DNA polymerases, as well as isothermal DNA polymerases or RNA polymerases (Figure 13A-B), and shows no bias during PCR compared to T / C (Figure 14).

[0146] Whole-genome sequencing was performed on two mESC gDNA samples. For comparison, one sample was converted using TAPS, and the other was converted using standard whole-genome bisulfite sequencing (WGBS).

[0147] To evaluate the accuracy of TAPS, spike ins of different lengths were added, either completely unmodified or methylated in vitro using CpG methyltransferase (M.SssI) or GpC methyltransferase (M.CviPI) (using the method described above). For short spike ins (120mer-1 and 120mer-2) containing 5mC and 5hmC, nearly complete conversion was observed for both modifications on both chains in both CpG and non-CpG contexts (Figure 17A-B).

[0148] For WGBS, 200 ng of gDNA was used, while TAPS used 100 ng of gDNA. Three different types of spike-in controls were added to evaluate the accuracy of TAPS. The false negative rate (non-conversion rate of 5mC) was estimated using λDNA with all CpGs fully methylated, the false positive rate (conversion rate of unmodified C) was estimated using a 2kb unmodified amplicon, and the conversion rates of 5mC and 5hmC in different sequence contexts were compared using synthetic oligospikeins containing both methylated C and hydroxymethylated C surrounded by any other base (methylated C for N5mCNN, hydroxymethylated C for N5hmCNN). The 5mC conversion rate was highest when mTet1 and pyridineborane were combined (96.5% with λspikeins, 97.3% with synthetic spikeins), and the conversion rate of unmodified C was lowest (0.23%) (Figures 18A-B and 16). A false negative rate of 2.7%–3.5% and a false positive rate of only 0.23% are comparable to bisulfite sequencing. A recent study found that the average false negative rate for nine commercially available bisulfite kits was 1.7% and the false positive rate was 0.6% (Holmes, EE et al. Performance evaluation of kits for bisulfite-conversion of DNA from tissues, cell lines, FFPE tissues, aspirates, lavages, effusions, plasma, serum, and urine. PLoS One 9, e93933 (2014)). The synthetic spike in suggests that TAPS functions well for both 5mC and 5hmC, and that TAPS is only slightly inferior in non-CpG contexts. The conversion rate at 5hmC was 8.2% lower than at 5mC, and the conversion rate in a non-CpG context was 11.4% lower than in a CpG context (Figure 18A).

[0149] With WGBS data, special software is required for both the alignment and modification calling processes. In contrast, our processing pipeline uses a custom modification calling tool we call "asTair" after a standard genome aligner (bwa). When processing simulated WGBS and TAPS reads (derived from the same partial methylation source sequence), TAPS / asTair was three times faster than WGBS / Bismark (Figure 18C).

[0150] Due to the conversion of almost all cytosines to thymine, WGBS libraries are characterized by an extremely distorted nucleotide composition, which can negatively impact Illumina sequencing. As a result, WGBS reads showed substantially lower sequencing quality scores for cytosine / guanine base pairs compared to TAPS (Figure 18E). To counteract the nucleotide composition bias, at least 10–20% PhiX DNA (a base-balanced control library) is commonly added to WGBS libraries (see, for example, Illumina's Whole-Genome Bisulfite Sequencing on the HiSeq 3000 / HiSeq 4000 Systems). Therefore, we added 15% PhiX to the WGBS library. As a result, the mapping rate in WGBS was significantly lower than in TAPS, due to the reduction in information content of BS-converted reads and the degradation of DNA due to bisulfite treatment (Figure 18D and Table 7).

[0151] [Table 10]

[0152] In other words, for the same sequencing cost (one NextSeq High Output), the average depth of TAPS exceeded that of WGBS (21 times for TAPS, 13.1 times for WGBS; Table 8). Furthermore, TAPS had only a small area left uncovered, and overall, a more uniform coverage distribution was observed even after downsampling to the same sequencing depth as WGBS (interquartile range: 9 for TAPS, 11 for WGBS; Figure 19A and Table 8).

[0153] [Table 11]

[0154] For example, CpG islands (CGIs) were generally covered more by TAPS than by WGBS, even after adjusting for differences in sequencing depth between WGBS and TAPS (Figure 21A), while demethylation within CGIs was similar in both cases (Figure 22). Furthermore, WGBS showed a slight bias towards reduced modification levels in highly covered CpG sites (Figure 23A), while our results suggest that TAPS exhibits only a minimal modification-coverage bias (Figure 23B). These results demonstrate that TAPS dramatically improves sequencing quality while effectively halving sequencing costs compared to WGBS.

[0155] The improved and more uniform genome coverage of TAPS increased the number of CpG sites covered by at least three reads. TAPS covered 88.3% of the total 43,205,316 CpG sites in the mouse genome at this level, compared to only 77.5% with WGBS (Figures 21B and 19B). Both TAPS and WGBS showed increased correlation of methylation measurements across chromosomal regions (Figures 21D and 20). Based on nucleotide-level data, both methods covered 32,755,271 CpG sites with at least three reads (Figure 21B). Within these regions, we defined "modified CpGs" as all CpG locations with a modification level of at least 10% (L. Wen et al., Whole-genome analysis of 5-hydroxymethylcytosine and 5-methylcytosine at base resolution in the human brain. Genome Biology 15, 49 (2014)). Using this threshold, the modification status of 95.8% of CpGs was consistent between TAPS and WGBS. Good agreement between WGBS and TAPS was demonstrated, as 98.5% of all CpGs found to be modified in WGBS, covered by at least three reads, were recalled as modified by TAPS (Figure 21C). When comparing modification levels for each CpG covered by at least three reads in both WGBS and TAPS, a good correlation was observed between TAPS and WGBS (Pearson's r=0.63, p<2e-16, Figure 21E). Notably, TAPS identified a subset of highly modified CpG locations that were overlooked by WGBS (Figure 21E, lower right corner). We further validated seven of these CpGs using orthogonal restriction digestion and real-time PCR assays, confirming that all of them were fully methylated and / or hydroxymethylated (Table 9).

[0156] [Table 12]

[0157] Considering these results, TAPS can directly replace WGBS, and in fact, it shows that methylomes can be examined more comprehensively than WGBS.

[0158] Finally, when TAPS was tested with low-input DNA, it was shown that TAPS functioned even with as little as 1 ng of gDNA, and in some cases, even when reduced to as little as 10 pg of gDNA, close to the single-cell level. TAPS also functioned effectively with 1 ng of circulating cell-free DNA. These results demonstrate the potential of TAPS in low-input DNA and for clinical applications (Figures 24A-C, 25A-B).

[0159] TAPS was tested on three circulating cell-free DNA (cfDNA) samples (CFDNA) derived from one healthy sample, one Barrett's esophagus (Barrett's) sample, and one pancreatic cancer sample, all collected from 1-2 ml of plasma. The standard TAPS protocol is as follows, and each sample was sequenced with approximately 10x coverage. Analysis of the cfDNA TAPS results showed that TAPS enabled high-quality methylome sequencing from cfDNA with limited input, similar to that performed with bulk genomic DNA, including a high 5mC conversion rate (Figure 26A), a low false-positive rate (conversion of unmodified cytosine, Figure 26B), a high mapping rate (Figure 26C), and a low PCR duplication rate (Figure 26D). These results demonstrate the statistical power of TAPS for disease diagnosis from cfDNA.

[0160] TAPS can also detect genetic variants because it can distinguish methylation from C→T genetic variants or single nucleotide polymorphisms (SNPs). TAPS yields different patterns for methylation and C→T SNPs. Specifically, methylation yields T / G reads in the original upper (OT) / original lower (OB) strands and A / C reads in the strands complementary to OT (CTOT) and OB (CTOB), while C→T SNPs yield T / A reads in OT / OB and (CTOB / CTOT) (Figure 27). This further enhances the usefulness of TAPS in obtaining both methylation information and genetic variants, i.e., mutations, in a single experiment and sequencing run. This capability of the TAPS method disclosed herein integrates genomic and epigenic analysis, substantially reducing sequencing costs by eliminating the need for standard whole-genome sequencing (WGS).

[0161] In summary, we developed a series of PS-derived methods for sequencing epigenic modifications of cytosine at base-level resolution without the use of bisulfites, demonstrating the usefulness of TAPS in whole methylome sequencing. TAPS is superior to bisulfite sequencing in that it directly detects 5mC and 5hmC at base-level resolution with high sensitivity and specificity, without affecting unmodified cytosine, using mild enzymatic and chemical reactions, resulting in high-quality and more complete methylome sequencing at half the sequencing cost. Therefore, TAPS has the potential to replace bisulfite sequencing as a new standard in the analysis of methylcytosine and hydroxymethylcytosine in DNA. (Recently reported bisulfite-free 5fC sequencing method: B. Xia et al., Bisulfite-free, base-resolution analysis of 5-formylcytosine at the genome scale. Nat. Methods) Unlike methods that introduce large-scale modifications to cytosine, such as C. Zhu et al., Single-Cell 5-Formylcytosine Landscapes of Mammalian Early Embryos and ESCs at Single-Base Resolution, Cell Stem Cell 20, 720-731 (2017), TAPS converts modified cytosine to DHU, which is close to the native base, and allows this DHU to be "read" as T by a common polymerase. Therefore, TAPS has the potential to be compatible with non-PCR DNA sequencing. TAPS is compatible with a variety of downstream analyses (including, but not limited to, pyrosequencing, methylation-sensitive PCR, restriction digestion, MALDI mass spectrometry, microarrays, and whole-genome sequencing). Because TAPS can hold long DNA, it can be extremely useful when combined with long-read sequencing techniques such as SMRT sequencing and nanopore sequencing to investigate specific regions that are difficult to map. Combining the pull-down method with TAPS can further reduce sequencing costs and add base-level resolution information to low-resolution affinity base maps. This example demonstrates that TAPS has the potential to directly replace WGBS in conventional applications while reducing cost, complexity, and analysis time. This will make epigenetic analysis more widely adopted in academic research and clinical diagnostics.

[0162] Example 2: Endonuclease-concentrated TAPS (eeTAPS) method Spike-in control preparation A 4kb spike-in control was prepared by PCR amplification of the pNIC28-Bsa4 plasmid (Addgene, catalog number 26103) in a reaction mixture containing 1 ng of DNA template, 0.5 μM primer, and 1× Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Scientific). The primer sequences are listed in Table 10. The PCR product was purified using a Zymo-IC column (Zymo Research) and methylated in 50 μL of the reaction mixture with HpaII Methyltransferase (New England Biolabs) for 2 hours at 37°C. The methylated product was purified using 1× AMPure XP beads (Beckman Coulter) according to the manufacturer's protocol. As previously described (Wu, H., Wu, X., Jand Zhang, Y. (2016) Base-resolution profiling of active DNA demethylation using MAB-seq and caMAB-seq. Nat Protoc, 11:1081-1100), CpG-completely methylated λ-DNA was prepared by methylating unmethylated λ-DNA (Promega) with the M.SssI enzyme (New England Biolabs).

[0163] Preparation of carrier DNA Carrier DNA was prepared by PCR amplification of the pNIC28-Bsa4 plasmid (Addgene, catalog number 26103) in a reaction mixture containing 1 ng of DNA template, 0.5 μM primer, and 1 × Phusion High-Fidelity PCR Master Mix with HF Buffer (Thermo Scientific). The primer sequences are listed in Table 10. The PCR product was purified using a Zymo-IC column (Zymo Research), fragmented using Covaris M220, purified with 0.9 × AMPure XP beads, and fragments of 200–500 bp were selected.

[0164] [Table 13]

[0165] mESC culture and genomic DNA isolation E14 mESCs were cultured in DMEM (Invitrogen) on gelatin-coated plates, supplemented with 15% FBS (Gibco), 2 mM l-glutamine (Gibco), 1% non-essential amino acids (Gibco), 1% penicillin / streptavidin (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 1,000 units / ml-1 leukemia inhibitor (Millipore), 1 μM PD0325901 (Stemgent), and 3 μM CHIR99021 (Stemgent). The culture medium was maintained at 37°C and 5% CO2, and subcultured every two days. To isolate genomic DNA, cells were collected by centrifugation for 5 minutes at 1000 g and at room temperature. DNA was extracted using the Quick-DNA Plus Kit (Zymo Research) according to the manufacturer's protocol.

[0166] Expression and Purification of mTet1CD The expression and purification of the mTet1 catalytic domain (mTet1CD) were performed as described above.

[0167] Oxidation by mTet1CD 200 ng of mESC gDNA spiked with 0.5% methylated λ-DNA and 0.025% 2kb unmodified DNA control was oxidized for 80 minutes at 37°C in 50 μl of a reaction mixture containing 50 mM HEPES buffer (pH 8.0), 100 μM ammonium iron(II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 100 mM NaCl, 1.2 mM ATP, and 4 μM mTet1CD. Subsequently, 0.8 U of proteinase K (New England Biolabs) was added to the reaction mixture and incubated for 1 hour at 50°C. The product was purified using a Bio-Spin P-30 Gel Column (Bio-Rad) and 1.8 × AMPure XP beads according to the manufacturer's instructions.

[0168] Screening for endonucleases that digest DHU One μg of mESC gDNA was enzymatically oxidized with mTet1CD as described above. Subsequently, the oxidized DNA in 35 μl of water was reduced in 50 μl of a reaction solution containing 600 mM sodium acetate (pH 4.3) and 1 M pyridineborane using an Eppendorf ThermoMixer for 16 hours at 37°C and 850 rpm. The product was purified using a Zymo-Spin column. Next, 40 ng of TAPS-converted or unconverted DNA was digested using the following enzymes (all from New England Biolabs): USER (catalog number M5505S), Endonuclease IV (catalog number M0304S), Tma Endonuclease III (catalog number M0291S), Endonuclease V (catalog number M0305S), UDG (catalog number M0280S), Tth Endonuclease IV (catalog number M0294S), Fpg (catalog number M0240S), Endonuclease III (Nth) (catalog number M0268S), Endonuclease VIII (catalog number M0299S), and APE1 (catalog number M0282S), according to the manufacturer's protocol. The digested products were purified using 1.8×AMPure XP beads according to the manufacturer's instructions, and 10 ng of each product was run on a 2% agarose gel.

[0169] eeTAPS mESC genomic DNA (200 ng, 50 ng, 10 ng, or 1 ng) was spiked with a 0.05% control of 4 kb methylated in the CCGG sequence context and oxidized with mTet1CD as described above. Subsequently, the oxidized DNA sample in 35 μl of water was reduced in 50 μl of a reaction mixture containing 600 mM sodium acetate solution (pH 4.3) and 1 M pyridineborane using an Eppendorf ThermoMixer for 16 hours at 37°C and 850 r.pm. The product was purified using a Zymo-Spin column. 2U of USER enzyme (New) in CutSmart buffer was added. The converted samples were digested in 20 μL of reaction solution containing England Biolabs for 1 hour at 37°C, and size sorting was performed with 0.35 × ~1 × AMPure XP beads. End repair and A-tailing reactions, as well as ligation of the Illumina Multiplexing adapter, were performed using the KAPA HyperPrep kit according to the manufacturer's protocol. To prepare the control library, 200 ng of unconverted mESC gDNA, including spike-in control, was digested with USER enzyme as described above, size sorted, and used to construct the library. The final sequencing library was amplified for 6 cycles (for 200 ng input), 8 cycles (for 50 ng input), 10 cycles (for 10 ng input), or 14 cycles (for 1 ng input) using KAPA HiFi HotStart ReadyMix, and size sorting was performed with 0.35 × ~1 × AMPure XP beads. Using a NextSeq500 sequencer (Illumina), 80bp pair-ended sequencing was performed on the final library, along with other sequencing libraries.

[0170] rrTAPS 1 μg of mESC gDNA was spiked with 1% CpG-methylated λ and digested with Fast digest Msp1 enzyme (Thermo Scientific) in 50 μL of reaction solution for 30 minutes at 37°C. The digested DNA was purified by phenol / chloroform precipitation. End repair and A-tailing reactions, as well as ligation of the Illumina Multiplexing adapter, were performed using the NEBNext® Ultra® II DNA Library Prep Kit according to the manufacturer's protocol. Subsequently, the ligated library was purified with 1.6×AMPure XP beads and flowed onto a 1% agarose gel. DNA fragments of 100-400 bp were excised and purified using the Monarch® DNA Gel Extraction Kit according to the manufacturer's protocol. The ligated sample on the adapter was spiked with 100 ng of support DNA and double-oxidized with mTet1CD as described above. Oxidized DNA in 35 μl of water was reduced in 50 μl of a reaction mixture containing 600 mM sodium acetate solution (pH 4.3) and 1 M pyridineborane using an Eppendorf ThermoMixer for 16 hours at 37°C and 850 r.pm. The product was purified using a Zymo-Spin column. The final sequencing library was amplified for 6 cycles using KAPA HiFi Uracil(+) Master Mix and purified with 1×AMPure XP beads. NextSeq Using a 500 sequencer (Illumina), paired-end sequencing of 80bp was performed on the final library in conjunction with other sequencing libraries.

[0171] eeTAPS data analysis Raw sequencing reads were processed with TrimGalore (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ) and adapter and quality trimming was performed with the parameter --paired--length35. Cleaned reads were aligned using bwa mem 0.7.17-r1188 (Li, H. and Durbin, R. (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25, 1754-1760) with default parameters. For 4kb model DNA, pNIC28-Bsa4 sequences from 2,627 to 6,911 were used as reference. For mESC gDNA, the mm9 genome was used as reference. Only properly mapped read pairs (read 1 with flags assigned as 83 or 99) were extracted, and coverage was calculated for both endpoints and readthroughs of the entire fragment using bedtools v2.27.1 (Quinlan, A.R. and Hall, IM (2010) BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics, 26, 841-842). When calculating the percentage of cleavage, non-cleaved sites were also taken into consideration. A detailed computation pipeline for analyzing eeTAPS can be found at https: / / gitlab.com / jfeicheng / userenrich. Two technical replicas were sequenced in eeTAPS.When analyzing the effect of sequence depth on eeTAPS, alignment files derived from two replicates were merged, and then subsampled at a ratio of 0.1 to 1 using samtools view (Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. and Genome Project Data Processing, S. (2009) The Sequence Alignment / Map format and SAMtools. Bioinformatics, 25, 2078-2079).

[0172] rrTAPS data analysis Raw sequencing reads were processed with seqtk (https: / / github.com / lh3 / seqtk) using trimfq -b 2, and the leftmost 2bp of each read was trimmed. rrTAPS was processed using Astair 3.2.7 (8). Clean reads were aligned using astair align with the mm9 genome as the reference. Methylated CpG was extracted by astair call.

[0173] Comparison of wgTAPS, eeTAPS, and rrTAPS in mESC wgTAPS data were downloaded from GSE112520 (Liu, YB, Siejka-Zielinska, P., Velikova, G., Bi, Y., Yuan, F., Tomkova, M., Bai, CS, Chen, L., Schuster-Bockler, B. and Song, CX (2019) Bisulfite-free direct detection of 5-methylcytosine and 5-hydroxymethylcytosine at base resolution. Nat Biotechnol, 37, 424-429). Only CpG sites covered by at least four reads were considered covered CpG sites. The number of methylated CpG sites was defined according to the criterion that the CpG methylation level was higher than the first quartile of all CpG methylation levels (0.5 for wgTAPS, 0.28 for eeTAPS). The genome was divided into non-overlapping 100kb windows using bedtools. The CpG island track was downloaded from http: / / hgdownload.soe.ucsc.edu / goldenPath / mm9 / database / cpgIslandExt.txt.gz. The Gene annotation file was downloaded from http: / / hgdownload.soe.ucsc.edu / goldenPath / mm9 / database / refGene.txt.gz. In wgTAPS, methylation was assigned to each window using the average value of methylation. In eeTAPS, CpG sites with a cleavage ratio greater than 0.28 were considered methylated sites, and sites below this cutoff were considered unmethylated sites. The methylation level of each bin was measured as (number of methylated CpGs) / (number of methylated CpGs + number of unmethylated CpGs).Expression data for e14 mESC cell lines were obtained from GEO entry GSE72855 (Neri, F., Rapelli, S., Krepelova, A., Incarnato, D., Parlato, C., Basile, G., Maldotti, M., Anselmi, F. and Oliviero, S. (2017) Intragenic DNA methylation prevents spurious transcription initiation. Nature, 543, 72-77), and using this data, genes were divided into four groups according to their expression levels.

[0174] result Development of eeTAPS To enrich methylated CpG sites for sequencing after the TAPS reaction, we identified endonucleases that specifically cleave TAPS products containing DHU. Ten commercially available endonucleases known to digest DHU or structurally similar nucleotides (uracil, 5-hydroxymethyluracil, dihydrothymine) were tested. Nucleases containing USER, endonuclease VIII, endonuclease III, and Fpg cleaved TAPS-converted DNA, while other nucleases such as APE1 and UDG substantially did not cleave TAPS-converted DNA (Figure 28A). USER was selected because it had the highest cleavage efficiency for TAPS-converted DNA and the least impact on unconverted DNA (Figure 28A).

[0175] Next, methylated sequences were enriched by combining TAPS conversion with USER digestion. First, unfragmented genomic DNA (gDNA) derived from mouse embryonic stem cells (mESCs) was converted with TAPS and digested with USER. The cleavage yielded DNA fragments ranging from 100 bp to 10 kb (Figure 28B). It appears that shorter fragments correspond to densely methylated regions, while longer fragments correspond to sparsely methylated regions of the genome. The fragmented DNA was sorted by size to retain fragments ranging from 200 bp to 1 kb, resulting in a moderate methylation state, and an Illumina sequencing library was prepared (Figures 29A, 28B). A computational pipeline was created to identify and quantify methylated CpG sites. The methylation level was calculated by dividing the number of reads cleaved at each CpG site by the total number of reads cleaved at or covering each CpG site (Figure 29A).

[0176] To evaluate the performance of eeTAPS, a 4kb spike-in model DNA was prepared using HpaII methyltransferase to methylate all CpGs at CCGG sites. This methyltransferase also methylated CpGs at off-target non-CCGG sites to a somewhat lower level. In the model DNA, the agreement between methylation by eeTAPS and methylation by bisulfite was excellent (Pearson correlation coefficient (r) = 0.98) (Figure 28C), supporting the detection power of eeTAPS in quantifying DNA methylation levels (Figure 29B). On the other hand, in a control sample prepared by digesting 4kb of model DNA that was not converted by TAPS using USER enzyme, no CpGs with significant methylation were detected (Figure 29B), demonstrating the high specificity of eeTAPS in detecting methylation. Considering these results, it was shown that eeTAPS can accurately determine the methylation state of DNA in a 4kb model DNA.

[0177] eeTAPS at mESC Having demonstrated the capability of eeTAPS on model DNA, we used eeTAPS to profile CpG methylation in mESC gDNA (Table 11). Since eeTAPS enriches methylated CpGs, it has been suggested that this is a cost-effective method. Indeed, we found that 84.6% of the fragments in eeTAPS were C / G (Figure 31A). Further analysis of the distance between the cleavage site and the nearest CpG identified that 72.7% of cleavage events occurred at CpGs (Figure 31B).

[0178] To further demonstrate this point, eeTAPS was compared with wgTAPS and rrTAPS (Figure 30A, Table 11). First, the number of CpG sites covered by all three methods was compared (CpGs with a coverage greater than 3 were regarded as covered CpGs). For wgTAPS and eeTAPS, the majority of CpG sites were covered (19.3M sites, 92.1% of all CpGs for wgTAPS, and 15.2M sites, 74.2% of all CpGs for eeTAPS), while only about 1.5M sites (7.2% of all CpGs) were covered by rrTAPS (Figure 30B). To further compare the genomic regions covered by these assays, the covered sites were mapped to various genomic regions (Bogu, G.K., Vizan, P., Stanton, L.W., Beato, M., Di Croce, L. and Marti-Renom, M.A. (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819). Intergenic methylation, such as methylation at distal regulatory elements, is also known to be important for gene regulation. We found that wgTAPS and eeTAPS share a similar broad feature distribution, with the majority of covered CpG sites located in heterochromatin (65.6% for wgTAPS, 71% for eeTAPS), whereas rrTAPS is biased toward promoter regions (46% of covered CpGs) (Figure 30B). At 1 CpG resolution, a good correlation was observed between eeTAPS and wgTAPS (r=0.56, Figure 30C), while a very high correlation was observed between rrTAPS and wgTAPS (r=0.92, Figure 31C). Methylation was overestimated in eeTAPS, which is most likely due to the fact that DNA fragments with unmethylated CpGs are longer and amplify less efficiently.

[0179] [Table 14]

[0180] Next, methylated CpG sites covered by different assays were compared. A high degree of consistency is observed for the sites defined as methylated CpG (mCpG) sites between eeTAPS and wgTAPS (82.4% of mCpG sites detected by wgTAPS are also detected by eeTAPS. Figure 30D), while rrTAPS only detects approximately 20.0% of mCpG (Figure 30D). Furthermore, high reproducibility is observed for eeTAPS, with 81% of mCpG observed across replicates (Figure 31D). Taken together, these analyses support that eeTAPS can accurately and reliably detect mCpG sites on a genome-wide scale, and can be a powerful semi-quantitative tool for measuring methylation at single-CpG resolution.

[0181] Comparison of eeTAPS and wgTAPS in genomic features Methylation patterns across different genomic features were compared between eeTAPS and wgTAPS. To quantify the methylation level within a region, the average methylation value was used for wgTAPS, and the ratio of methylated CpG to the total number of detected CpG sites was used for eeTAPS. Highly correlated, chromosome-wide methylation patterns were observed in both eeTAPS and wgTAPS, while eeTAPS overestimated the methylation level (Figures 32A, B). CpG islands (CGIs) are known to have very low DNA methylation, which is reflected in both eeTAPS and wgTAPS (Figure 32C). The correlation of methylation levels measured at CGIs using eeTAPS and wgTAPS was 0.81, which further demonstrates that eeTAPS can accurately capture the methylation status of CpG in various features (Figure 32D).

[0182] Previous studies have shown that DNA methylation in the promoter region is generally inversely correlated with gene expression. We divided genes into four groups according to their expression level and plotted the average methylation from 4kb upstream to 4kb downstream of the transcription start site (TSS). Using both eeTAPS and wgTAPS, we found that highly expressed genes tended to have low methylation levels, while less expressed genes had high methylation levels (Figure 33). We defined (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di) as previously defined. Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long In Noncoding RNAs in Mouse (Mol Cell Biol, 36, 809-819), the methylation distribution was also compared across different chromatin characteristics (Figure 32E, F). Consistent with previous studies, heterochromatin regions were highly methylated, while promoter regions in euchromatin generally showed less CG methylation (Figure 32F).

[0183] Application of eeTAPS to samples with low input levels To evaluate the performance of eeTAPS with low-input samples, we applied 1 ng, 10 ng, and 50 ng of mESC gDNA to eeTAPS, respectively. For the 200 ng mESC DNA sample, the sequencing reads were downsampled by half to match the sequencing depth of the low-input sample. We found that even with 1 ng of DNA, 27% of the mCpG sites identified by wgTAPS were reproduced in eeTAPS. When 50 ng of mESC DNA was used, that percentage increased to 47% (Figure 34A). To further compare the whole-genome methylation profiles using these low-input samples, we binned the genome into a 100 kb window and calculated the average methylation level in each bin (Figure 34B). The observation of consistently high methylation profiles among these low-input samples (r=0.88 at 1 ng, r=0.92 at 20 ng, and r=0.95 at 50 ng compared to eeTAPS at half the amount of 200 ng; Figure 34C) further demonstrates the feasibility of applying eeTAPS to low-input DNA samples.

[0184] The effect of sequencing depth on eeTAPS To evaluate the effect of sequencing depth on the total number of detectable mCpG sites, we downsampled eeTAPS and assessed its performance. The total number of detectable mCpG sites increased with increasing sequencing depth (Figure 35A). However, at a sequencing depth of 4× (70M reads), we were able to successfully detect 74% of mCpG sites (even with 4×eeTAPS, 10.9M of the 14.9M mCpG sites detected by wgTAPS were defined as mCpG). A similar trend was observed in the correlation of methylation across chromosomes and CGI (Figure 35B), with Pearson's correlation coefficient in CGI reaching 0.83 at 4× coverage (Figure 35B). Therefore, we demonstrated that eeTAPS can provide accurate global methylation profiles at a lower sequencing cost compared to WGBS.

[0185] Investigation wgTAPS enabled the most comprehensive quantitative whole-genome methylation analysis with base-level resolution. However, the high cost of whole-genome sequencing and the large amount of data to process still limit the widespread use of methylation analysis in many projects. Since methylated CpG sites constitute only a small fraction of the mammalian genome, whole-genome sequencing is not the most data-efficient approach to investigate methylation status. A more cost-effective approach would be to specifically select only the regions containing methylated CpGs during further sequencing analysis. Reduced-representation sequencing based on restriction enzyme digestion and enrichment of CpG-rich regions, followed by bisulfite sequencing, is a cost-effective methylome analysis approach; however, this method only covers a small fraction of CpG sites in the genome (Meissner, A., Gnirke, A., Bell, GW, Ramsahoye, B., Lander, E., and Jaenisch, R. (2005) Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res, 33, 5868-5877). TAPS is compatible with the Reduced-Representation approach, and we demonstrated that rrTAPS can accurately quantify methylation in a subset of the genome, particularly in CGI. In addition to the well-established biological significance of CpG methylation in gene promoters, intergeneric DNA methylation is attracting attention in extensive research due to its potential involvement in cell fate determination and tumorigenesis. To extend the enrichment approach to genome-wide CpG sites, we further leveraged the advantages of TAPS to directly convert 5mC to DHU, thereby enabling cleavage at these specific modified bases by induction with DHU-sensitive endonucleases.By combining the selective enrichment of these fragments with sequencing, we demonstrated that eeTAPS enables the detection of CpG methylation on a genome-wide scale. This approach is possible because TAPS directly detects methylated cytosines. Unlike conventional antibody-based enrichment methods, eeTAPS offers the possibility of direct methylation detection at a resolution of 1 CpG.

[0186] Using eeTAPS, we demonstrated that genome-wide methylation features can be captured in a cost-effective format with a resolution of 1 CpG, thereby bridging the gap between rrTAPS and wgTAPS. Methylation profiles obtained with eeTAPS across multiple different genomic mechanisms showed high correlation with profiles obtained using wgTAPS. Furthermore, eeTAPS can detect 74% of methylated CpGs detected by wgTAPS with only 70M reads. A possible limitation of eeTAPS (due to variability in the spacing of methylated CpG sites) is that it may only semi-quantitatively measure methylation levels at single CpG sites. In this study, we selected fragments ranging from 200 bp to 1 kb as a proof-of-concept. Nevertheless, the correlation coefficient between wgTAPS and eeTAPS was still good at approximately 0.56. Moreover, we showed that eeTAPS is a cost-effective and promising protocol for detecting methylation in DNA samples with limited input, leveraging the mild nature of the TAPS reaction. [Brief explanation of the drawing]

[0187] [Figure 1]This study screened borane-containing compounds. Borane-containing compounds were screened for the conversion of 5caC to DHU in 11mer oligonucleotides ("oligo"), and the conversion rate was estimated by MALDI. 2-Picolin borane (pic-borane), borampyridine, and tert-butylamine borane were able to completely convert 5caC to DHU, while ethylenediamine borane and dimethylamine borane showed conversion rates of around 30%. No detectable products were measured (not detected) for dichlorohexylamine borane, morpholine borane, 4-methylmorpholine borane, and trimethylamine borane. Other reducing agents, such as sodium borohydride and sodium tri(acetoxy)borohydride, decomposed rapidly in acidic media, resulting in incomplete conversion. Sodium cyanoborohydride was not used because it may form hydrogen cyanide under acidic conditions. Pic-borane and pyridineborane were selected due to their complete conversion, low toxicity, and high stability. [Figure 2] This is a Pic-borane reaction in DNA oligonucleotides. (A) Model DNA containing 5caC, treated with Pic-borane, is characterized by MALDI. Calculated mass (m / z) values ​​are shown above each graph, and observed mass values ​​are shown to the left of the peaks. (B) The conversion rates of dC and various cytosine derivatives were quantified by HPLC-MS / MS. The data are presented as the mean ± standard deviation of three replicates. [Figure 3A]This is a pic-borane reaction of a single nucleoside. The ¹H NMR results follow previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). The ¹H NMR (MeOH-d4, 400 MHz) chart of the pic-borane reaction product of the single nucleoside is shown. δ ppm: 6.28 (t, 1H, J = 7 Hz), 4.30 (m, 1H), 3.81 (m, 1H), 3.63 (m, 2H), 3.46 (m, 2H), 2.65 (t, 2H, J = 6 Hz), 2.20 (m, 1H), 2.03 (m, 1H). [Figure 3B] This is a pic-borane reaction of a single nucleoside. The 13C NMR results follow previous reports on 2'-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). The chart shows the 13C NMR (MeOH-d4, 400 MHz) of the pic-borane reaction product of the single nucleoside. δ ppm: 171.56 (CO), 153.54 (CO), 85.97 (CH), 83.86 (CH), 70.99 (CH), 61.92 (CH2), 36.04 (CH2), 35.46 (CH2), 30.49 (CH2). [Figure 4A] This figure shows the conversion of 5caC to DHU by borane, and a proposed mechanism for the borane reaction of 5caC to DHU. [Figure 4B] This figure shows the conversion of 5fC to DHU by borane and a proposed mechanism for the borane reaction of 5fC to DHU. [Figure 5] (A) This figure shows that the TAPS method converts both 5mC and 5hmC into DHU, and that DHU functions as thymine during replication. (B) This is an overview of the TAPS, TAPSβ, and CAPS methods. [Figure 6-1]This shows the results of MALDI characterization of model DNA oligos containing 5fC and 5caC, treated with pic-borane either with or without blocking 5fC and 5caC. 5fC and 5caC are converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked by a hydroxylamine derivative such as O-ethylhydroxylamine (EtONH2), but this derivative forms an oxime that inhibits conversion by pic-borane. 5caC was blocked by ethylamine via EDC binding, converting it to an amide that blocks conversion by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 6-2] This shows the results of MALDI characterization of model DNA oligos containing 5fC and 5caC, treated with pic-borane either with or without blocking 5fC and 5caC. 5fC and 5caC are converted to dihydrouracil (DHU) by pic-BH3. 5fC was blocked by a hydroxylamine derivative such as O-ethylhydroxylamine (EtONH2), but this derivative forms an oxime that inhibits conversion by pic-borane. 5caC was blocked by ethylamine via EDC binding, converting it to an amide that blocks conversion by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 7-1] This shows the results of MALDI characterization of model DNA oligos containing 5mC and 5hmC, treated with KRuO4 and pic-borane, either with or without 5hmC blocking. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC, and 5gmC could not be converted by pic-borane. 5hmC could be oxidized with KRuO4 to 5fC, and then converted to DHU by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 7-2] This shows the results of MALDI characterization of model DNA oligos containing 5mC and 5hmC, treated with KRuO4 and pic-borane, either with or without 5hmC blocking. 5hmC could be blocked with glucose by βGT and converted to 5gmC. 5mC, 5hmC, and 5gmC could not be converted by pic-borane. 5hmC could be oxidized with KRuO4 to 5fC, and then converted to DHU by pic-borane. Calculated MS (m / z) values ​​are shown above each graph, and observed MS values ​​are shown to the left of the peaks. [Figure 8] Restriction enzyme digestion demonstrated that TAPS can effectively convert 5mC to T. (A) Diagram of the restriction enzyme digestion assay to confirm sequence changes by TAPS. (B) TaqαI digestion test to confirm the conversion from C to T by TAPS. TAPS was performed on a 222 bp model DNA containing five fully methylated CpG sites (5mC) with TaqαI restriction sites, and its unmethylated control (C). As shown in the 5mC, C, and C TAPS, the PCR-amplified 222 bp model DNA can be cleaved by TaqαI into fragments of approximately 160 bp and 60 bp. As shown in the 5mC-TAPS lane, after TAPS on methylated DNA, the T(mC)GA sequence is converted to TTGA and is no longer cleaved by TaqαI digestion. [Figure 9] TAPS is performed on a 222 bp model DNA and mESC gDNA. (A) Sanger sequencing results of a 222 bp model DNA containing five fully methylated CpG sites, and its unmethylated control, before TAPS (5 mC, C) and after TAPS (5 mC TAPS, C TAPS). Only 5 mC is converted to T by the TAPS method. (B) HPLC-MS / MS quantification results of the relative modification levels in the mESC gDNA control after oxidation with NgTET1 and reduction with pic-borane. Data are given as the mean ± standard deviation of three replicates. [Figure 10A] TAPS does not cause significant DNA degradation compared to bisulfite. The images show agarose gel images of 222bp unmethylated DNA, 222bp methylated DNA, and mESC gDNA before cooling in an ice bath. After TAPS, no detectable DNA degradation was observed, the DNA remained double-stranded, and could be seen without cooling. With bisulfite conversion, degradation occurred, the DNA became single-stranded, and could only be seen after cooling on ice. [Figure 10B] TAPS does not cause significant DNA degradation compared to bisulfite. The images show agarose gel images of 222bp unmethylated DNA, 222bp methylated DNA, and mESC gDNA after cooling in an ice bath (B). After TAPS, no detectable DNA degradation was observed, the DNA remained double-stranded, and could be observed without cooling. With bisulfite conversion, degradation occurred, the DNA became single-stranded, and could only be observed after cooling on ice. [Figure 10C] TAPS does not cause significant DNA degradation compared to bisulfite. The images show agarose gels of mESC gDNA of various fragment lengths treated with TAPS and bisulfite, before (left panel) and after (right panel) cooling on ice. The DNA after TAPS retained its double helix and could be directly observed on the gel. Bisulfite treatment resulted in greater sample damage and fragmentation, with the DNA becoming single-stranded and only visible after cooling on ice. As shown in Figure 15, the conversion by TAPS was complete for all gDNA, regardless of fragment length. [Figure 10D] TAPS does not cause significant DNA degradation compared to bisulfite. The images show agarose gel images of a 222 bp model DNA before and after TAPS (three independent repeats), and no detectable degradation was observed after the reaction. [Figure 11]This is a comparison of amplification and melting curves between model DNAs before and after TAPS. A small difference in the amplification curves was observed between the model DNAs before and after TAPS using qPCR assay. The melting curve of methylated DNA (5mC) shifted to a lower temperature after TAPS, suggesting a possible conversion from C to T, which leads to a decrease in Tm. However, no shift was observed in unmethylated DNA (C). [Figure 12] As demonstrated by Sanger sequencing, complete conversion from C to T was induced after TAPS, TAPSβ, and CAPS. Model DNA containing one methylated CpG site and one hydroxymethylated CpG site was prepared as described herein. Conversion with TAPS was performed according to the protocol of oxidation with NgTET1 and reduction with pyridineborane as described herein. Conversion with TAPSβ was performed according to the protocol of blocking 5hmC, oxidation with NgTET1, and reduction with pyridineborane. Conversion with CAPS was performed according to the protocol of oxidation of 5hmC and reduction with pyridineborane. After conversion, 1 ng of the converted DNA sample was PCR amplified with Taq DNA polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC, while CAPS selectively converted 5hmC. None of these three methods converted unmodified cytosine or other bases. [Figure 13A]TAPS is compatible with various DNA polymerases and RNA polymerases, and induces complete C-to-T conversion, as demonstrated by Sanger sequencing. Model DNA and primer sequences containing methylated CpG sites for polymerase testing are described herein. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase, Taq polymerase and Vent exo-polymerase read DHU as T, thus inducing complete C-to-T conversion after PCR. Alternatively, primer extension was performed with biotin-labeled primers and isothermal polymerases, including Klenow fragment, Bst DNA polymerase and phi29 DNA polymerase. The newly synthesized DNA strand was separated using Dynabeads MyOne Streptavidin C1, then amplified by PCR using Taq polymerase and processed for Sanger sequencing. T7 RNA polymerase was able to efficiently bypass DHU and insert adenine opposite the DHU site, which was verified by RT-PCR and Sanger sequencing. [Figure 13B] Certain other commercially available polymerases did not efficiently amplify DNA containing DHU. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil Plus polymerase and Taq polymerase read DHU as T, thus resulting in the induction of complete C-to-T conversion. It was observed that certain other commercially available polymerases, including KAPA HiFi polymerase, Pfu polymerase, Phusion polymerase and NEB Q5 polymerase, exhibited low or no C-to-T conversion (not shown). [Figure 14]No PCR bias was observed with DHU compared to T and C. Model DNA containing one DHU / U / T / C modification was synthesized using the corresponding DNA oligo as described herein. Based on the qPCR reaction, standard curves for each model DNA with DHU / U / T / C modification were plotted, and the model DNA input was serially diluted 1:10 (0.1 pg to 1 ng; all qPCR experiments were performed in triplicates). The slope of the regression between the logarithmic concentration (ng) and the mean Ct was calculated using the SLOPE function in Excel. PCR efficiency was calculated using the formula Efficiency (%) = (10^(-1 / slope) - 1) × 100%. The amplification coefficient was calculated using the formula Amplification coefficient = 10^(-1 / slope). The PCR efficiency for model DNA with DHU, T, or C modifications was almost the same, indicating that DHU can be read as a normal base and does not appear to be a cause of PCR bias. [Figure 15] TAPS completely converted 5mC to T regardless of the length of the DNA fragment. (A) Agarose gel images from the TaqαI digestion assay confirmed complete conversion from 5mC to T in all samples, regardless of the length of the DNA fragment. After TAPS, a 194bp model sequence derived from the λ genome was PCR amplified and digested with the TaqαI enzyme. The PCR product amplified from the unconverted sample was cleavable, but the product amplified from the TAPS-treated sample remained intact, suggesting loss of the restriction site, i.e., complete conversion from 5mC to T. (B) The percentage of conversion from C to T was estimated by quantification of gel bands and was 100% for all DNA fragment lengths tested. [Figure 16] Conversion and false positives were observed under different TAPS conditions. When mTet1 and pyridineborane were combined, the conversion rate of methylated C was the highest (96.5%, calculated with fully CpG-methylated λDNA) and the conversion rate of unmodified C was the lowest (0.23%, calculated with 2kb unmodified spike-in) compared to other conditions using NgTET1 or pic-borane. The values ​​shown above the bars represent the conversion rate ± standard error for all cytosine sites tested. [Figure 17] This shows the conversion rate in short spike-ins. The sequences are (A)120mer-1 and (B)120mer-2, both containing 5mC and 5hmC. Nearly complete conversion occurred at the 5mC and 5hmC sites in both strands. The actual sequences, along with their modification states, are shown above and below. [Figure 18A] TAPS sequencing quality is improved compared to whole-genome bisulfite sequencing (WGBS). The image shows the conversion rates of 5mC and 5hmC in TAPS-treated DNA. Left: Synthetic spike in (CpN) methylated or hydroxymethylated at known locations. [Figure 18B] Improved sequencing quality of TAPS compared to whole-genome bisulfite sequencing (WGBS). False positive rate of TAPS obtained from unmodified 2kb spike-in. [Figure 18C] TAPS offers improved sequencing quality compared to whole-genome bisulfite sequencing (WGBS). The total execution time for TAPS and WGBS is calculated when processing 1 million simulation reads on a single core of an Intel Xeon CPU. [Figure 18D] TAPS sequencing quality is improved compared to whole-genome bisulfite sequencing (WGBS). This is the percentage of all sequenced read pairs (after trimming) that were mapped to the genome. [Figure 18E] TAPS shows improved sequencing quality compared to whole-genome bisulfite sequencing (WGBS). The sequencing quality score per base pair for the first and second reads in all sequenced read pairs was recorded using Illumina BaseSpace. The top image is TAPS, and the bottom image is WGBS. [Figure 19]TAPS provided more uniform coverage than WGBS, with fewer uncovered locations. The coverage depth for (A) all bases and (B) CpG sites was compared between WGBS and TAPS, calculated on both strands. For "TAPS (downsampled)," random reads were selected from all mapped TAPS reads to ensure the median coverage matched the median coverage for WGBS. The last bin shows locations with coverage greater than 50x. [Figure 20] This represents the distribution of modification levels across all chromosomes. The average modification levels across all mouse chromosomes within a 100kb window were weighted by CpG coverage and smoothed using a Gaussian weighted moving average filter with a window size of 10. [Figure 21A] This is a comparison of genome-wide methylome measurements using TAPS and WGBS. The values ​​represent the average sequencing coverage depth across all mouse CpG islands (binned into 20 windows) and 4kbp flanking regions (binned into 50 windows of equal size). To account for differences in sequencing depth, all mapped TAPS reads were downsampled and fitted to the median number of mapped WGBS reads across the entire genome. [Figure 21B] This is a comparison of genome-wide methylome measurements using TAPS and WGBS. The CpG sites covered by at least three reads are defined as follows: TAPS only, both TAPS and WGBS, or WGBS only. [Figure 21C] This is a comparison of genome-wide methylome measurements using TAPS and WGBS. It represents the number of CpG sites covered by at least three reads and with modification levels greater than 0.1 detected by TAPS alone, TAPS and WGBS, or WGBS alone. [Figure 21D]This is a comparison of genome-wide methylome measurements using TAPS and WGBS. It shows examples of chromosomal distribution of modification levels (%) in TAPS and WGBS. The average percentage of modified CpG per 100kb window in mouse chromosome 4 was smoothed using a Gaussian weighted moving average filter with a window size of 10. [Figure 21E] This is a comparison of genome-wide methylome measurements using TAPS and WGBS. The heatmaps show the number of CpG sites covered by at least three reads in both TAPS and WGBS, categorized by the level of modification measured by each method. To improve contrast, the first bin containing unmodified CpGs in both methods has been excluded from the color scale and is indicated by an asterisk. [Figure 22] This represents the modification level around CpG islands. It is the average modification level in CpG islands (binned into 20 windows) and 4kbp flanking regions (binned into 50 windows of equal size). Bins with coverage of less than 3 reads were ignored. [Figure 23] TAPS exhibits less coverage-modification bias than WGBS. All CpG sites are binned according to their coverage, and for each bin, the mean (●) and median (black triangle) of the modification values ​​are shown for WGBS (A) and TAPS (B). The last bin shows CpG sites covered by more than 100 reads. The lines represent linear approximations across data points. [Figure 24]Using dsDNA and ssDNA library preparation kits, gDNA and cell-free DNA TAPS with low input levels were prepared. (A) Using the dsDNA library kit NEBNext Ultra II or KAPA HyperPrep kit, sequencing libraries were successfully constructed using only 1 ng of mouse embryonic stem cell (mESC) genomic DNA (gDNA). Using the ssDNA library kit Accel-NGS Methyl-Seq kit, the amount of input DNA was further reduced to (B) 0.01 ng of mESC gDNA or (C) 1 ng of cell-free DNA. [Figure 25] Using the dsDNA KAPA HyperPrep library preparation kit, TAPS libraries were prepared using small amounts of gDNA and cell-free DNA. Sequencing libraries were successfully constructed using small amounts (A) mESC gDNA and (B) cell-free DNA (approximately 1 ng) with the KAPA HyperPrep kit. Cell-free DNA exhibits a sharp length distribution of approximately 160 bp (nucleosome size) after plasma nuclease digestion. After library construction, the DNA length becomes approximately 300 bp, which corresponds to the sharp band in B. [Figure 26] This is a high-quality cell-free DNA TAPS. (A) Conversion rate of 5mC in cfDNA treated with TAPS. (B) False positive rate in cfDNA treated with TAPS. (C) Percentage of all sequenced read pairs that are uniquely mapped to the genome. (D) Percentage of all sequenced read pairs that are uniquely mapped to the genome after PCR duplicate reads have been removed. CHG and CHH are in a non-CpG context. [Figure 27] TAPS can detect genetic variants. For methylation (MOD, top row) and C→T SNPs (bottom row), separate base distributions were observed in the original upper strand (OT) / original lower strand (OB) (left column), as well as in the strands complementary to OT (CTOT) and OB (CTOB) (right column). [Figure 28]This shows the endonuclease cleavage of TAPS conversion products. (A) Results of digestion of mESC gDNA with different endonucleases before and after TAPS conversion. In TAPS conversion, DHU is introduced in place of methylated cytosine. Endo VIII is endonuclease VIII, Endo IV is endonuclease IV, Tma Endo III is endonuclease III, Tth Endo IV is endonuclease IV, Nth Endo III is Nth endonuclease III, and Endo V is endonuclease V. (B) Representative images of mESC gDNA treated with TAPS before USER digestion, after USER digestion, and after size sorting. (C) Scatter plot showing methylation levels at all CpGs measured by both BS-seq and eeTAPS. [Figure 29A] This is endonuclease-enriched TAPS (eeTAPS). The diagram above shows a schematic of eeTAPS, and the diagram below shows computer-measured CG methylation levels. First, 5-methylcytosine (mC) was converted to dihydrouracil (DHU) using TAPS, and then enriched through USER digestion. Subsequently, size-sorted DNA fragments were prepared, converted into a sequencing library, and amplified by PCR. After read alignment, the CG methylation level was calculated by dividing the number of reads cleaved at each CpG site by the total number of reads cleaved at each CpG site, or the total number of reads covering each CpG site. [Figure 29B] This study validates eeTAPS on a 4kb model DNA. The tracks, from top to bottom, show methylation levels measured by bisulfite sequencing (BS-seq), eeTAPS, and the eeTAPS control. In the eeTAPS control, the DNA was digested using USER enzyme without conversion with TAPS. [Figure 30A]This is a comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. The diagram shows the genome fragmentation methods of wgTAPS, eeTAPS, and rrTAPS. In wgTAPS, genomic DNA is fragmented randomly, whereas in eeTAPS, fragmentation occurs specifically at methylated CpG (mCG) sites, and in rrTAPS, it occurs specifically at CCGG sites. [Figure 30B] This is a comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. The bar plot shows the percentage of CpG sites covered by wgTAPS, eeTAPS, and rrTAPS superimposed on different chromatin features. These chromatin features were defined in a previous study (20). [Figure 30C] This is a comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. The heatmap shows the correlation of methylation levels, determined at a resolution of 1 CpG, using wgTAPS and eeTAPS. Methylation levels were divided into 16 groups for both wgTAPS and eeTAPS. The color indicates the number of CpGs at a given interval. Only sites with coverage greater than 5 in wgTAPS were considered. Pearson's correlation coefficient is shown at the top of the plot. [Figure 30D] This is a comparison of wgTAPS, eeTAPS, and rrTAPS in mESC DNA. The Benn plot shows the overlap of detected mCpG sites in wgTAPS, rrTAPS, and eeTAPS. In both wgTAPS and eeTAPS, CpG sites with methylation levels greater than the first quartile were defined as methylated CpGs. For rrTAPS, the same methylation cutoff value as wgTAPS was used. (In wgTAPS and rrTAPS, CpG sites with methylation levels greater than 0.5 were defined as mCpGs, while in eeTAPS, CpG sites with methylation levels greater than 0.28 were defined as mCpGs.) [Figure 31](A) Nucleotide frequencies at the ends of the sequenced fragments. (B) Bar plot showing the distribution of distances between cleavage sites and the CpG closest to those sites. (C) Heatmap showing the correlation of methylation levels obtained with a resolution of 1 CpG using wgTAPS and rrTAPS. Methylation levels were divided into 16 groups in both wgTAPS and rrTAPS. The color indicates the number of CpGs at a given interval. Only sites with coverage greater than 5 in both wgTAPS and rrTAPS were considered. The Pearson correlation coefficient is 0.92. (D) Overlap of mCpG sites detected by replicating eeTAPS. The replicas were subsampled to the same depth to detect mCpGs. [Figure 32]This shows methylation profiling in different genomic mechanisms using eeTAPS. (A) Methylation levels measured by both eeTAPS (upper line) and wgTAPS (lower line) in chromosome 1 of mESCs. A 100kb window was used, and the moving mean was calculated in R with bw=10 using the movAvg2 function. (B) Density plot showing the correlation of methylation levels in chromosomal bins between eeTAPS and wgTAPS. The mean of methylation levels was calculated in each bin using a 100kb window. Pearson's correlation coefficient is shown at the top of the plot. (C) Mean methylation levels across CpG islands (CGI) and 4kb flanking regions in eeTAPS and wgTAPS. (D) Density plot showing the correlation of methylation levels in CpG islands between eeTAPS and wgTAPS. Pearson's correlation coefficient is shown at the top of the plot. (E) Density plots showing the correlation of methylation levels across different chromatin features in eeTAPS and wgTAPS. These chromatin features were previously defined by histone markers (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819), also shown in (F). Pearson's correlation coefficient is shown at the top of the plot. (F) Box plots showing the distribution of methylation levels across all chromatin features as measured by eeTAPS (lower bars) and wgTAPS (upper bars). [Figure 33] This represents the average methylation distribution around the transcription start site (TSS) in wgTAPS and eeTAPS. Genes were classified according to their expression levels, following the GSE72855 dataset. [Figure 34]This is an analysis using eeTAPS on samples with low input levels. (A) The number of mCpGs detected using eeTAPS with 1 ng, 10 ng, 50 ng, and 200 ng of mESC gDNA input (the number of mCpGs identified by wgTAPS). For 200 ng of mESC, the reads were downsampled by half to adjust the sequencing depth to match the low input sample. A criterion of methylation levels greater than 0.28 was used to assign mCpGs; eeTAPS assigned cleavage levels greater than 1 as mCpGs, while wgTAPS assigned methylation levels greater than 0.5 as mCpGs. The percentages shown above the bars represent the percentage of detected mCpGs (mCpGs detected by wgTAPS are defined as true). (B) A heatmap showing the methylation distribution measured by eeTAPS across the mouse genome using different input levels. Each chromosome is divided into 100kb windows, which are represented by rows in the heatmap. Methylation levels were defined as the number of methylated CpG sites divided by the total number of covered CpG sites within each 100kb window. (C) This is a density plot showing the correlation of methylation between samples with less input relative to a 200ng input sample. Methylation levels were calculated across the entire mouse genome within 100kb windows, as shown in (B). Pearson correlation coefficients are shown for each plot. [Figure 35] This is the result of the eeTAPS sequencing depth analysis. (A) The number of methylated CpGs detected when reads are sampled at a sequencing depth of 1 to 10 ×. The percentages shown above represent the percentage of mCpGs detected by eeTAPS (mCpGs detected by wgTAPS are defined as true). (B) The correlation of methylation in the whole mouse genome (upper line) and CpG islands (CGIs) (lower line) within a 100kb window when reads are sampled at a sequencing depth of 1 to 10 ×.

Claims

1. A borane reducing agent for converting 5-carboxylcytosine (5caC) and / or 5-formylcytosine (5fC) in target DNA to dihydrouracil (DHU) to provide modified target DNA containing one or more DHU; and A kit for cleaving modified target DNA, comprising one or more endonucleases for cleaving the modified target DNA at the location of one or more DHUs, or at a location adjacent to the one or more DHUs.

2. The borane reducing agent is pyridineborane, 2-picolinborane (pic-BH ３ The kit according to claim 1, comprising a component selected from the group consisting of borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride.

3. The kit according to claim 1 or 2, wherein the borane reducing agent is pyridineborane or 2-picolinborane.

4. The kit according to any one of claims 1 to 3, wherein the one or more endonucleases are selected from one or more of the group consisting of aprinic acid / apyrimidine endonuclease 1 (APE1), uracil DNA glycosylase (UDG), endonuclease III, Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, formamidepyrimidine DNA glycosylase (Fpg), and hNEIL1.

5. The kit according to any one of claims 1 to 4, wherein the one or more endonucleases include a combination of uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII.

6. The kit according to any one of claims 1 to 5, further comprising a 10-11 translocation (TET) enzyme or oxidizing agent for converting 5-methylcytosine (5mc) and / or 5-hydroxymethylcytosine (5hmc) in target DNA to 5caC and / or 5fC.

7. The kit according to claim 6, wherein the TET enzyme is selected from the group consisting of human TET1, human TET2, human TET3, mouse TET1, mouse TET2, mouse TET3, Naegleria TET (NgTET), and Coprinopsis cinerea TET (CcTET).

8. The kit according to claim 6 or 7, wherein the TET enzyme is NgTET, mouse TET2, or human TET1.

9. The kit according to claim 6, wherein the oxidizing agent is potassium perruthenate, Cu(II) / TEMPO, potassium ruthenate, or manganese oxide.

10. The kit according to any one of claims 1 to 9, further comprising an adapter DNA molecule for ligating the cleaved modified target DNA.

11. The kit according to claim 10, further comprising an enzyme for ligating the adapter DNA molecule to the cleaved modified target DNA.

Images