Hair growth tonic

Abstract

To provide a hair growth stimulant that is a topical agent exhibiting effects such as promoting hair shaft growth in hairs such as scalp hair, beard hair, eyebrows and / or eyelashes, accelerating gene expression contributing to hair growth in dermal papilla cells, improving hair growth and hair shaft elongation rate, improving hair shaft maximum length, and increasing hair shaft diameter, the hair growth stimulant contains palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diamino hydroxybutyric acid, and phytosphingosine or uses a combination of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diamino hydroxybutyric acid as active ingredients.

Description

Technical Field

[0001] The present invention relates to a hair growth agent. More specifically, the present invention relates to a hair growth agent comprising palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine.

Background Art

[0002] Hair growth repeats growth and shedding following a hair cycle consisting of anagen, catagen, and telogen phases. The symptom of androgenetic alopecia is that the balance of the hair cycle is lost for some reason, the duration of the anagen phase is shortened, the proportion of telogen hairs increases, and the hairs become vellus hairs. Histologically, it has been reported that the size of anagen hair follicles is smaller than that of healthy scalp, the development of dermal papillae is poor, and the capillary network surrounding the hair follicles is also reduced (Non-Patent Document 1).

[0003] Accordingly, demand for external preparations such as hair growth agents that improve hair growth effects and hair type and hair quality is increasing in mammals including humans. To improve hair growth effects and hair type and hair quality, active ingredients that contribute to regulating the hair cycle, which is the life cycle of hair, have been proposed and are being marketed as hair growth agents.

[0004] Vascular endothelial growth factor (VEGF) is a growth factor that specifically acts on vascular endothelial cells isolated from the culture medium of pituitary folliculo-stellate cells, and is known to promote angiogenic processes including proliferation of vascular endothelial cells and enhance vascular permeability. It has been clarified that adenosine, when acted on human dermal papilla cells, promotes the expression of vascular endothelial growth factor (VEGF) (see Non-Patent Document 2).

[0005] For example, the use of minoxidil as an active ingredient in hair growth products has been proposed (see Patent Documents 1-3, etc.), and after human clinical trials, hair growth products containing minoxidil as an active ingredient have been launched. It has been shown that when minoxidil acts on dermal papilla cells, it promotes the expression of vascular endothelial growth factor (VEGF) (see Non-Patent Document 3). However, its medicinal use in Japan is limited to male pattern baldness, and it does not fully meet the needs of a wide range of consumers who desire hair growth effects and improvements in hair type and quality. Adenosine has also shown no major side effects in human clinical trials, and since the mechanism of hair thinning improvement is not directly related to the regulation of sex hormones, adenosine has been proposed and launched as an active ingredient in hair growth products that can be safely used by both men and women (Non-Patent Document 4). However, because there are significant individual differences in its improvement effects, it does not fully meet the needs of a wide range of consumers who desire hair growth effects and improvements in hair type and quality, and improvements are needed.

[0006] Therefore, the inventors diligently conducted research and found that palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyrate have excellent hair growth effects, such as significantly increasing the rate of hair shaft elongation and maximum hair shaft length, and promoting the expression of vascular endothelial growth factor (VEGF) in dermal papilla cells, and are useful as active ingredients in hair growth agents and scalp care agents (see Patent Document 4).

[0007] Phytosphingosine is known as an ingredient in cosmetic raw materials (see Patent Document 5). However, there are no reports on the hair growth effects of phytosphingosine. [Prior art documents] [Patent Documents]

[0008] [Patent Document 1] U.S. Patent No. 4139619 [Patent Document 2] Japanese Patent Application Publication No. 63-150211 [Patent Document 3] Japanese Patent Application Publication No. 63-145217 [Patent Document 4] International Publication No. 2021 / 075219 [Patent Document 5] Patent No. 3220434 [Non-Patent Document 1] Yokoyama, Daisaburo, *Oil Chemistry*, 1995, Vol. 44, No. 4, pp. 266-273. [Non-Patent Document 2] KYUNG-A HWANG et al., Int J Mol Med., 2012, Feb;29(2):195-201 [Non-Patent Document 3] Lachgar S, Charveron M, Gall Y and Bonafe JL:Br J Dermatol 138,407-411(1998) [Non-Patent Document 4] Ritsuko Ehama et al., J.Soc.Cosmet.Chem.Jpn., 2011, Vol.45, No.1: 35-40. [Overview of the Initiative] [Problems that the invention aims to solve]

[0009] The object of the present invention is to provide a hair growth agent that has excellent hair growth effects. [Means for solving the problem]

[0010] The present inventors conducted extensive research to solve the above problems and found that hair growth activity can be achieved by using phytosphingosine as an active ingredient. Furthermore, they discovered that by using palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid along with phytosphingosine as active ingredients, stronger hair growth activity can be achieved than by using palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid or phytosphingosine alone. This led to the completion of the present invention.

[0011] The first means of the present invention to solve the above problems is a hair growth agent characterized by containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients.

[0012] A second means of the present invention for solving the above problems is a hair growth agent for use in combination with phytosphingosine, characterized by containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid as active ingredients.

[0013] A third means of the present invention for solving the above problems is a hair growth agent for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, characterized by containing phytosphingosine as an active ingredient.

[0014] A fourth means of the present invention for solving the above problems is a hair growth agent according to any one of the first to third means of the present invention, for use in promoting hair shaft growth or hair regrowth.

[0015] A fifth means of the present invention for solving the above problems is a hair growth agent according to any one of the first to fourth means of the present invention, used to improve the hair shaft elongation rate.

[0016] A sixth means of the present invention for solving the above problems is a hair growth agent according to any one of the first to fourth means of the present invention, used to improve the maximum length of the hair shaft.

[0017] A seventh means of the present invention for solving the above problems is a hair growth agent according to any one of the first to fourth means of the present invention, used to increase the diameter of the hair shaft.

[0018] The 8th means of the present invention for solving the above problems is the hair growth agent according to any one of the 1st to 4th means of the present invention, which is used for increasing the number of hairs.

[0019] The 9th means of the present invention for solving the above problems is the hair growth agent according to any one of the 1st to 8th means of the present invention, which is in the form of a solution.

[0020] The 10th means of the present invention for solving the above problems is the hair growth agent according to any one of the 1st to 9th means of the present invention, which is used for scalp hair, beard hair, eyebrow hair and / or eyelash hair.

[0021] The 11th means of the present invention for solving the above problems is a method for producing a hair growth agent, characterized by comprising the step of incorporating palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine into a preparation as active ingredients.

[0022] The 12th means of the present invention for solving the above problems is a method for producing a hair growth agent for use in combination with phytosphingosine, characterized by comprising the step of incorporating palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid into a preparation as active ingredients.

[0023] The 13th means of the present invention for solving the above problems is a method for producing a hair growth agent for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, characterized by comprising the step of incorporating phytosphingosine into a preparation as an active ingredient.

[0024] The 14th means of the present invention for solving the above problems is a hair growth agent kit comprising a preparation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, and a preparation containing phytosphingosine.

[0025] A fifteenth means of the present invention to solve the above problems is a hair growth agent kit for use in combination with phytosphingosine, comprising a formulation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

[0026] A sixteenth means of the present invention for solving the above problems is a hair growth agent kit for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, which includes a formulation containing phytosphingosine.

[0027] The seventeenth method of the present invention for solving the above problems is a hair growth method characterized by administering palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients.

[0028] The eighteenth means of the present invention for solving the above problems is a hair growth method that includes administering a hair growth agent described in any one of the first to tenth means of the present invention to a target.

[0029] Another means of solving the above problems according to the present invention is a scalp care agent containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients.

[0030] Furthermore, another means of the present invention for solving the above problems is a method for improving scalp symptoms, which involves administering a scalp care agent containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients to the target.

[0031] Furthermore, another means of the present invention for solving the above problems is a VEGF production promoter for hair papilla cells containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients. [Effects of the Invention]

[0032] The present invention provides an excellent hair growth agent and scalp care agent that promotes hair shaft growth, improves the rate of hair shaft elongation, increases the maximum length of the hair shaft, increases the diameter of the hair shaft, and provides scalp care effects in hair such as scalp hair, tufted hair, eyebrows and / or eyelashes, by incorporating or using palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid and phytosphingosine as active ingredients in a topical hair growth agent. [Brief explanation of the drawing]

[0033] [Figure 1] Figure 1 is a graph showing the changes in VEGF gene expression levels in human dermal papilla cells after 72-hour stimulation with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyrate, phytosphingosine, and palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyrate, and phytosphingosine. [Modes for carrying out the invention]

[0034] The embodiments for carrying out the present invention will be described below. It should be noted that the present invention is not limited to these examples, and various modifications can be made without departing from the spirit of the invention.

[0035] The active ingredients of the hair growth agent and scalp care agent according to the present invention consist of a mixture containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine, or a mixture containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and adenosine.

[0036] The concentrations of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine, which are active ingredients in the hair growth agent and scalp care agent of the present invention, are 0.001 to 20% by weight of the total hair growth agent and scalp care agent. More specifically, they are 0.005 to 10% by weight.

[0037] The hair growth agent and scalp care agent of the present invention may be used as a pharmaceutical product, quasi-drug, cosmetic product including cosmetics for hair, tuft of hair, eyebrows and / or eyelashes and cosmetics for the scalp, and may be used as a formulation having various dosage forms as an external preparation such as ointment, poultices, liniments, lotions, external solutions, powders, creams, gels, emulsions, hair tonics, hair sprays, microneedles, etc., but is not limited to these.

[0038] The hair growth agent and scalp care agent of the present invention can be manufactured by a step of incorporating palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients. Furthermore, the hair growth agent and scalp care agent of the present invention for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid can be manufactured by a step of incorporating phytosphingosine as an active ingredient, and the hair growth agent and scalp care agent for use in combination with phytosphingosine can be manufactured by a step of incorporating palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid as active ingredients. In addition to the above steps, a step of incorporating additives for formulation may be added as desired.

[0039] In the hair growth agent and scalp care agent of the present invention, if palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine are provided in separate formulations, the dosage forms of these formulations may be the same or a combination of different dosage forms, and they may also be provided as a kit for providing formulations of these dosage forms.

[0040] Furthermore, the present invention may also contain additives and other ingredients that are normally permitted to be included in pharmaceuticals, quasi-drugs, cosmetics including cosmetics for hair, tufts of hair, eyebrows and / or eyelashes, and cosmetics for the scalp, to the extent that they do not interfere with the hair growth effect and scalp care effect of the present invention. Examples of these additives include, but are not limited to, excipients, stabilizers, deodorizers, bases, dispersants, diluents, anionic surfactants, amphoteric surfactants, nonionic surfactants, cationic surfactants, anionic polymers, nonionic polymers, ethylene oxide / propylene oxide block copolymers, alcohols, emulsifiers, transdermal absorption enhancers, pH adjusters, preservatives, colorants, oils and fats, mineral oils and other oils, humectants, thickeners, polymers, film-forming agents, UV absorbers, cell activators, humectants, inorganic salts, functional beads / capsules, silicones, metal chelating agents, antioxidants, preservatives, cooling agents, deodorizers, pigments, dyes, fragrances, sugars, amino acids, vitamins, organic acids, organic amines, plant extracts, and viscosity modifiers such as clay minerals and various polymers.

[0041] The hair growth agent and scalp care agent of the present invention may further contain known ingredients that have effects such as hair growth, hair nourishment, and hair care.

[0042] The amount of the active ingredient per dose of the hair growth agent and scalp care agent in the means of the present invention can be adjusted so as to produce the effects of the hair growth agent and scalp care agent of the present invention. The dose can be, for example, 0.005 to 200 mg, more specifically 0.05 to 100 mg, and more specifically 0.5 to 10 mg.

[0043] The number of times the hair growth agent and scalp care agent of the present invention are administered can be one or more times, depending on whether the effects of the hair growth agent and scalp care agent of the present invention are achieved. The number of times the hair growth agent and scalp care agent of the present invention are administered can be, for example, 1 to 6 times per day. More specifically, it can be 1 to 3 times per day, and more specifically, 1 to 2 times per day.

[0044] The hair growth agent and scalp care agent of the present invention relate to promoting hair shaft growth, hair regeneration, and prevention of hair loss, and more preferably to promoting hair shaft growth and hair regeneration.

[0045] In this specification, the term "hair shaft growth promotion" means improving the rate of hair shaft elongation, improving the maximum hair shaft length, and / or increasing the hair shaft diameter.

[0046] In this specification, the term “hair growth” means increasing the number of hairs by promoting the growth of new hairs from hair follicles where hair growth has stopped or has decreased ability to grow in areas where there is no hair (the hair shaft has not emerged from the epidermis) or where there is little hair, and more specifically, shortening the resting phase in the hair cycle and / or restarting a stopped hair cycle.

[0047] In this specification, "having a hair shaft growth promoting effect" means acting favorably on promoting hair shaft growth, and the characteristic exhibiting a hair shaft growth promoting effect is referred to as "hair shaft growth promoting activity." Furthermore, "having a hair growth effect" means acting favorably on hair growth, and the characteristic exhibiting a hair growth effect is referred to as "hair growth promoting activity."

[0048] In this specification, the term "hair loss" refers to the phenomenon of hair shafts falling out of hair follicles, and more specifically, to the increase of inhibitory cytokines that inhibit cell proliferation and the subsequent cell death of those cells. The characteristic exhibiting hair loss prevention effect is referred to as "hair loss prevention activity." Furthermore, "having a hair loss prevention effect" means that the number of hair shafts falling out of hair follicles decreases through the inhibition or reduction of inhibitory cytokines and the suppression of cell death, and is a physiological phenomenon distinct from characteristics that exhibit hair shaft growth promotion or hair regrowth effect.

[0049] In this specification, "scalp symptoms" means symptoms such as dandruff, rough scalp, dry scalp, erythema, itching, and breakouts. In this specification, "improvement of scalp symptoms" means suppression or improvement of dandruff, rough scalp, dry scalp, erythema, itching, and breakouts.

[0050] The hair growth agent of the present invention can be used to improve the hair shaft elongation rate or the maximum hair shaft length. Regarding the hair shaft elongation rate, it can be improved by, for example, up to approximately 110% compared to the hair shaft elongation rate in standard hair cycle data, specifically by approximately 25-110%, and more specifically by approximately 33-110%. Regarding the maximum hair shaft length, it can be improved by, for example, up to approximately 49% compared to the maximum hair shaft length in standard hair cycle data, specifically by approximately 1-49%, and more specifically by approximately 2-49%.

[0051] The hair growth agent of the present invention can be used to increase the diameter of the hair shaft.

[0052] The hair growth agent of the present invention can be used to increase the number of hairs by promoting the growth of new hairs from hair follicles where hair growth has stopped or the ability to grow hair has decreased in areas where there is no hair (the hair shaft has not emerged from the epidermis) or where there is little hair, and more specifically, it can be used to shorten the resting phase in the hair cycle and / or restart a stopped hair cycle.

[0053] The hair growth agent and scalp care agent of the present invention can be used not only for humans but also for animals such as livestock and pets. In one aspect of the present invention, a method for promoting hair growth and a method for improving scalp symptoms are provided, which includes administering a topical preparation containing phytosphingosine and adenosine to subjects including humans and non-human animals such as livestock and pets. [Examples]

[0054] <Test Example 1: Evaluation of VEGF gene expression in human dermal papilla cells>

[0055] The VEGF gene is expressed in dermal papilla cells and is believed to contribute to the promotion of hair shaft growth, improvement of hair shaft elongation rate, improvement of maximum hair shaft length, and increase of hair shaft diameter in scalp hair, tufted hair, eyebrows, and / or eyelashes. Therefore, we evaluated the upregulation of VEGF gene expression in each component using human dermal papilla cells.

[0056] 1. Materials and Methods (1) Human dermal papilla cells and culture medium Human dermal papilla cells (catalog number: CA60205a, derived from a 29-year-old male of Caucasian descent, Toyobo Co., Ltd. (Japan)) were purchased, and the cells were maintained and cultured according to the protocol and then evaluated.

[0057] (2) Drugs For testing purposes, drug solutions of the following concentrations (final concentrations) were prepared and used. Comparative Example 1: 0.1% solution of a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid Comparative Example 2: 3% solution of a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid Example 1: Phytosphingosine 0.3125 μM Example 2: Phytosphingosine 1.25 μM Example 3: Phytosphingosine 1.25 μM and a 0.1% solution of a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid. Example 4: Phytosphingosine 1.25 μM and a 3% solution of a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

[0058] (3) Test method Human dermal papilla cells 6 × 10 3Cells were seeded into 24-well plates at a density of cells per well. After culturing for 1 day in a CO2 incubator (5% CO2, 37°C), the culture medium was replaced with the medium containing each test agent. The cell plates were then returned to the CO2 incubator and cultured for a further 72 hours. After culturing, total RNA was extracted and recovered from each well and reverse transcribed into cDNA. The expression of the VEGF gene was measured using the prepared cDNA by real-time PCR. The expression level of the VEGF gene was calculated as a relative value to the negative control group, using the GAPDH gene as an internal standard.

[0059] The FastGene RNA Basic Kit (catalog number: FG-80250, Nippon Genetics Co., Ltd. (Japan)) was used to recover total RNA from the cells.

[0060] 300 μL of lysis buffer RL was added to each well, and the cells were lysed by pipetting. 300 μL of 70% ethanol was added to the cell lysate and mixed by pipetting. The sample solution was added to a FastGene RNA binding column and centrifuged at 10,000 rpm for 1 minute at room temperature. The filtrate that passed through the column was discarded from the collection tube, and the FastGene RNA binding column was returned to its original collection tube. Then, 600 μL of wash buffer RW1 was added to the FastGene RNA binding column, and it was centrifuged at 10,000 rpm for 1 minute at room temperature. The FastGene RNA binding column was transferred to a new collection tube and set up. 700 μL of wash buffer RW2 was added to the FastGene RNA binding column, and it was centrifuged at 10,000 rpm for 1 minute at room temperature. The FastGene RNA binding column was transferred to a new collection tube and set up. It was centrifuged at 15,000 rpm for 1 minute at room temperature. The FastGene RNA binding column was transferred to a new collection tube and set up. 50 μL of elution buffer RE was added to the center of the FastGene RNA binding column membrane, and the tube was centrifuged at 10,000 rpm for 1 minute at room temperature to recover the purified RNA. The concentration of the recovered RNA was measured using NanoDrop Lite (catalog number: ND-LITE, Thermo Fisher Scientific Co., Ltd.), and the RNA was stored at -80°C until the next cDNA conversion procedure.

[0061] FastGene scriptaseII cDNAsynthesis 5× Ready Mix (catalog number: NE-LS64, Genetics Japan Co., Ltd.) was used for cDNA synthesis. The total RNA generated was diluted with RNase-free water to a concentration of 20 ng / mL in a new tube. 4 μL of FastGene scriptaseII cDNAsynthesis 5× Ready Mix was added to 16 μL of this sample solution and mixed by vortexing. Using a MiniAmp thermal cycler (Thermo Fisher Scientific Co., Ltd.), the mixture was incubated at 25°C for 10 minutes, 42°C for 60 minutes, and 85°C for 5 minutes to synthesize cDNA.

[0062] The cDNA synthesized using the method described above was used for real-time PCR. Each cDNA template dilution was added to the designated wells of a 96-well plate, and THUNDERBIRD SYBR qPCR Mix (catalog number: QPS-201, Toyobo Co., Ltd. (Japan)) and primers were added and mixed. Gene expression was analyzed using the QuantStudio 7 Flex Real-Time PCR System (catalog number: 4485693, Thermo Fisher Scientific Inc.). The PCR reaction consisted of 40 cycles of 5 seconds at 95°C, 30 seconds at 60°C, and 30 seconds at 72°C.

[0063] The VEGF gene-specific primers used in the test and the GAPDH gene-specific primers used as an internal standard are shown below. Primers for detecting VEGF gene expression Forward direction: aggccagcacataggagaga (Sequence ID 1) Reverse direction: acgcgagtctgtgtttttgc (Sequence code 2) Primers for detecting GAPDH gene expression Forward direction: catccctgcctctactggcgctgcc (Sequence ID 3) Reverse direction: ccaggatgcccttgagggggccctc (Sequence code 4)

[0064] The relative expression levels of each gene were calculated as follows. The Ct value (number of PCR cycles) was calculated from the intersection of the amplification curve and threshold line for each gene. The relative expression level was obtained by dividing the Ct value of the target gene by the Ct value of the internal standard GAPDH gene.

[0065] 2. Results Changes in VEGF gene expression levels were measured after human dermal papilla cells were treated with a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyrate, phytosphingosine, and a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyrate, along with phytosphingosine, for 72 hours. The results are shown in Figure 1.

[0066] As shown in Figure 1, when human dermal papilla cells were treated with phytosphingosine for 72 hours, a dose-dependent increase in VEGF gene expression was observed compared to the control group without the treatment (Examples 1-2). Furthermore, it was confirmed that as the amount of phytosphingosine added increased, VEGF gene expression became significantly greater than when adenosine was treated (Comparative Example 1). Moreover, when human dermal papilla cells were treated with a mixed solution of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine for 72 hours, a significantly more pronounced increase in VEGF gene expression was observed compared to when only the mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, or phytosphingosine alone was treated (Examples 3 and 4).

[0067] Thus, it has been confirmed that phytosphingosine is useful as an active ingredient in hair growth and scalp care products because it enhances the expression of the VEGF gene in dermal papilla cells, promoting hair shaft growth, improving the rate of hair shaft elongation, increasing the maximum length of the hair shaft, and increasing the diameter of the hair shaft in hair such as scalp hair, tufted hair, eyebrows, and / or eyelashes. Furthermore, it was confirmed that a combination of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine significantly enhances the expression of the VEGF gene in dermal papilla cells, thereby further strengthening the hair growth effect, and is useful as an active ingredient in hair growth and scalp care products that promotes hair shaft growth, improves the rate of hair shaft elongation, increases the maximum length of the hair shaft, and increases the diameter of the hair shaft in hair such as scalp hair, tufts of hair, eyebrows, and / or eyelashes. [Industrial applicability]

[0068] By means of the present invention, it is possible to provide a new hair growth agent and scalp care agent that contains both phytosphingosine and adenosine as active ingredients, or uses phytosphingosine and adenosine in combination, thereby promoting hair shaft growth, improving the rate of hair shaft elongation, improving the maximum length of hair shafts, and providing scalp care effects, while also significantly increasing the expression level of the VEGF gene in dermal papilla cells.

Claims

1. A hair growth agent characterized by containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients.

2. A hair growth agent for use in combination with phytosphingosine, characterized by containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid as active ingredients.

3. A hair growth agent characterized by containing phytosphingosine as an active ingredient, for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

4. A hair growth agent according to any one of claims 1 to 3, for use in promoting hair shaft growth or hair regrowth.

5. A hair growth agent according to any one of claims 1 to 3, used to improve the rate of hair shaft elongation.

6. A hair growth agent according to any one of claims 1 to 3, used to improve the maximum length of the hair shaft.

7. A hair growth agent according to any one of claims 1 to 3, used to increase the diameter of the hair shaft.

8. A hair growth agent according to any one of claims 1 to 3, used to increase the number of hairs.

9. A hair growth agent according to any one of claims 1 to 3, which is a solution.

10. A hair growth agent according to any one of claims 1 to 3, for use on scalp hair, tuft of hair, eyebrows and / or eyelashes.

11. A method for producing a hair growth agent, characterized by comprising the step of incorporating palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients into the formulation.

12. A method for producing a hair growth agent for use in combination with phytosphingosine, characterized by comprising the step of incorporating palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid as active ingredients into the formulation.

13. A method for producing a hair growth agent for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, characterized by comprising a step of incorporating phytosphingosine as an active ingredient into the formulation.

14. A hair growth kit containing a preparation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, and a preparation containing phytosphingosine.

15. A hair growth kit for use in combination with phytosphingosine, containing a formulation with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

16. A hair growth kit containing a formulation with phytosphingosine, for use in combination with palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyrate.

17. A hair growth method characterized by administering palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine, palmitoyl dipeptide-5 diaminohydroxybutyric acid, and phytosphingosine as active ingredients to a non-human animal.

18. A method for promoting hair growth, comprising administering a hair growth agent according to any one of claims 1 to 3 to a non-human animal.

Images