Antisense oligonucleotides for RNA editing

Abstract

The present invention relates to a composition comprising a set of two single-stranded antisense oligonucleotides (AONs) for use in deaminating a target adenosine to inosine in a target RNA, wherein one AON is an "editing AON" and the other AON is a "helper AON", wherein the editing AON is complementary to a stretch of nucleotides in the target RNA that includes the target adenosine, the helper AON is complementary to a stretch of nucleotides in the target RNA that is different from the stretch of nucleotides complementary to the editing AON, and the helper AON has a length of 16 to 22 nucleotides, and the editing AON has a length of 16 to 22 nucleotides.

Description

TECHNICAL FIELD

[0001] The present invention relates to the field of medicine, in particular to the field of RNA editing, which targets cellular RNA molecules with antisense oligonucleotides (AONs) to specifically alter target nucleotides present in the target RNA molecules. The present invention aims to correct specific nucleotides, such as mutated nucleotides that may cause disease in target RNA molecules, by engaging (endogenous) enzymes having deaminase activity. BACKGROUND ART

[0002] RNA editing is a natural process by which eukaryotic cells modify the sequence of their RNA molecules, often in a site-specific and precise manner, thereby increasing the repertoire of genome-encoded RNAs by several orders of magnitude. RNA editing enzymes have been described in eukaryotes throughout the animal and plant kingdoms, and these processes play an important role in regulating cellular homeostasis in metazoans ranging from simple organisms (e.g., Caenorhabditis elegans) to humans. Examples of RNA editing are the conversion of adenosine (A) to inosine (I) and the conversion of cytidine (C) to uridine (U), each of which is catalyzed by enzymes called adenosine deaminase and cytidine deaminase, respectively. The most widely studied RNA editing system is the system comprising adenosine deaminase enzymes. Adenosine deaminases are part of a family of enzymes known as adenosine deaminases acting on RNA (ADAR), including the human deaminases hADAR1 and hADAR2, as well as hADAR3. However, deaminase activity has not yet been demonstrated for hADAR3.

[0003] ADARs are multi-domain proteins containing a catalytic domain and two to three double-stranded RNA recognition domains, depending on the enzyme of interest. Each recognition domain recognizes a specific double-stranded RNA (dsRNA) sequence and / or structure. The key function of the catalytic domain is to convert A to I at a nearby, approximately predefined position on the target RNA by deamination of nucleic acid bases, but the catalytic domain also plays a role in recognizing and binding to portions of the dsRNA helix. Inosine, read as guanosine by the cell's translation mechanism, can recode protein sequences if edited adenosine is present in the coding region of mRNA or premRNA. A>I conversion can also occur in the 5' non-coding sequence of the target mRNA (resulting in an extended N-terminal protein), creating a new translation start site upstream of the original start site, or in the 3' UTR or other non-coding portions of the transcription (which can affect RNA processing and / or stability). In addition, A>I conversion can occur in splice elements within introns or exons of premRNA, thereby altering the splicing pattern. As a result, exons may be included (partially or completely) or skipped.

[0004] The use of oligonucleotides to edit target RNA using adenosine deaminase has been reported (e.g., Montiel-Gonzalez et al. 2013. Proc Natl Acad Sci USA 110(45):18285-18290; Vogel et al. 2014. Angewandte Chemie Int Ed 53:267-271; Woolf et al. 1995. Proc Natl Acad Sci USA 92:8298-8302). A disadvantage of the method described by Montiel-Gonzalez et al. (2013) is that it requires a fusion protein consisting of the box B recognition domain of a bacteriophage λN protein genetically fused to the adenosine deaminase domain of a cleaved native ADAR protein. The system requires target cells that are either transduced with a fusion protein, which is the primary obstacle, or transfected with a nucleic acid construct encoding an engineered adenosine deaminase fusion protein for expression. The system described by Vogel et al. (2014) suffers from a similar drawback in that it is unclear how the system is first applied without genetic modification of ADAR, and then cells containing the target RNA are transfected or transduced to supply the cells with this engineered protein. Clearly, this system cannot be readily applied to human use (e.g., in a therapeutic setting). The oligonucleotides of Woolf et al. (1995), which are 100% complementary to the target RNA sequence, appear to be the only ones that function when microinjected into cell extracts or Xenopus oocytes, suffering from a severe lack of specificity and editing almost all adenosine in the target RNA strand that was complementary to the antisense oligonucleotide. Oligonucleotides with a 2'-O-methyl (2'-OMe) modification, each nucleotide having a length of 34 nucleotides, were tested by Woolf et al. (1995) and shown to be inactive.To provide stability against nucleases, a 34-mer RNA modified with 2'-OMe modification at the 5' and 3' ends of 5 nucleotides and phosphorothioate (PS) linkages was also tested. This oligonucleotide in the central unmodified region was shown to facilitate endogenous ADAR-mediated editing of target RNA with terminal modifications that provide protection against exonuclease degradation. However, this system did not demonstrate specific deamination of target adenosine in the target RNA sequence. As described above, nearly all adenosine opposite the unmodified nucleotide in the antisense oligonucleotide was edited (i.e., nearly all adenosine opposite the nucleotide in the central unmodified region when the 5' and 3' ends of the antisense oligonucleotide were modified, or nearly all adenosine in the target RNA strand when the nucleotide was unmodified).

[0005] ADARs are known in the art to be able to act on any dsRNA. Through a process sometimes referred to as "promiscuous editing," the enzyme edits multiple A molecules in the dsRNA. Therefore, there is a need for methods and means to avoid such promiscuous editing and target only specific adenosines in therapeutically applicable target RNA molecules. Vogel et al. (2014) showed that such off-target editing can be suppressed by using 2'-OMe modified nucleotides in the oligonucleotide opposite the adenosine that should not be edited, and that unmodified nucleotides directly opposite the specifically targeted adenosine in the target RNA can be used. However, it was not shown that a specific editing effect at the target nucleotide could be achieved without using recombinant ADAR enzymes covalently bound to AON.

[0006] International Publication No. 2016 / 097212 discloses antisense oligonucleotides (AONs) for targeted editing of RNA, characterized by the presence of a sequence complementary to the target RNA sequence (hereinafter referred to as the "targeting region") and, preferably, a stem-loop structure not complementary to the target RNA (hereinafter referred to as the "recruiting region"). Such oligonucleotides are referred to as "self-looping AONs." The recruiting region functions to recruit a cellular native ADAR enzyme to a dsRNA formed by the hybridization of the target sequence and the targeting region. Because of the recruiting region, neither a conjugated entity nor a modified recombinant ADAR enzyme is required. The recruiting region was a stem-loop structure that mimicked either a native substrate (e.g., the GluB receptor) or a Z-DNA structure known to be recognized by the dsRNA-binding region of an ADAR enzyme. The stem-loop structure may be an intermolecular stem-loop structure formed by two separate nucleic acid chains, or an intramolecular stem-loop structure formed within a single nucleic acid chain. The stem-loop structure of the mobilization moiety described in International Publication No. 2016 / 097212 is intramolecular, formed within the AON itself, and capable of attracting ADAR. International Publication Nos. 2017 / 220751 and International Publication Nos. 2018 / 041973 describe AONs that do not contain a mobilization moiety but are (almost perfectly) complementary to a targeted region, or so-called “fluctuations” or bulges, excluding one or more mismatches. The only mismatch may be a nucleotide opposite the target adenosine, but in other embodiments, the AON was described with respect to numerous bulges and / or fluctuations when the target sequence region was ligated. If the AON sequence was carefully selected to attract ADAR, it appeared that RNA editing could be achieved in vitro, ex vivo, and in vivo with AONs lacking the recruitment moiety and with endogenous ADAR enzymes. "Orphan nucleotides" are defined as nucleotides within the AON that are directly opposite the target adenosine in the target RNA molecule but lack 2'-OMe modification.Orphan nucleotides could also be DNA nucleotides (where the sugar does not have a 2' modification) where the remainder of the AON has a 2'-O-alkyl modification with a sugar (e.g., 2'-OMe), or nucleotides within a so-called "Central Triplet" (= an orphan nucleotide with two directly adjacent nucleotides in the AON) containing (or being DNA) specific chemical modifications that further improved the efficiency of RNA editing and / or increased resistance to nucleases, or nucleotides directly surrounding the central triplet. Such effects could even be further enhanced by using sense oligonucleotides (SONs) that "protect" the AON from degradation. This was described in International Publication No. 2018 / 134301.

[0007] International Publication No. 2019 / 158475, International Publication No. 2019 / 219581, PCT / European Patent No. 2020 / 053283 (unpublished), and PCT / European Patent No. 2020 / 059369 (unpublished) describe RNA editing AONs having specific chemical modifications at very specific positions of the oligonucleotide backbone and / or sugar moieties to increase the stability of the AON and / or the efficiency of RNA editing, and PCT / European Patent No. 2020 / 060291 (unpublished) describes the use of AONs to inhibit RNA editing at specified positions, for example, when (naturally occurring) RNA editing leads to diseases such as those seen in certain cancers and viral infections.

[0008] Despite the various approaches outlined above, RNA editing using antisense oligonucleotides appears to have been primarily achieved using relatively large molecules. The problem is that as AONs become larger, they become more difficult to introduce into cells on their own. Furthermore, long-chain AONs are more easily degraded than short-chain AONs. Therefore, there is still a need for improved, and in this particular case shorter, compounds that can more specifically and efficiently edit endogenous nucleic acids to alleviate disease in mammalian cells, and even in organisms as a whole, by still utilizing (endogenous) cellular pathways and enzymes with deaminase activity, such as the naturally expressed ADAR enzyme. [Overview of the project]

[0009] The present invention relates to a composition comprising a set of two single-stranded antisense oligonucleotides (AONs) for use in the deamination of target adenosine in target RNA, wherein one AON is an “editing AON” and the other AON is a “helper AON”, the editing AON is complementary to a stretch of nucleotides in the target RNA containing target adenosine, the nucleotide in the editing AON directly opposite to the target adenosine is an “orphan nucleotide” which is cytidine unmodified with 2'-OMe or 2'-MOE, the helper AON is complementary to a stretch of nucleotides in the target RNA separate from the stretch of nucleotides complementary to the editing AON, the helper AON has a length of 16 to 22 nucleotides, and the editing AON has a length of 16 to 22 nucleotides. In a preferred embodiment, the helper AON and edited AON form a double-stranded complex in continuum with the target RNA, where the helper AON is complementary to a sequence of nucleotides in the target RNA located 3' to the sequence of nucleotides in the target RNA complementary to the edited AON, and there is no nucleotide gap between the sequences complementary to the helper AON and the edited AON. In a preferred embodiment, this set is configured to recruit an endogenous ADAR enzyme after forming a double-stranded complex with the target RNA to result in the deamination of target adenosine to inosine. In a preferred embodiment, the edited AON is 19, 20, or 21 nucleotides long, and the helper AON is 17, 18, or 19 nucleotides long. As outlined herein, particularly good results were obtained when the edited AON was 21 nucleotides long, the helper AON was 17 nucleotides long, and they were positioned together with respect to the target RNA molecule as a continuum of 38 nucleotides, with no gap between the helper AON and the edited AON. In another preferred embodiment, the orphan nucleotide in the edited AON is the 6th, 7th, or 8th nucleotide from the 5' end.

[0010] In another embodiment, the present invention relates to a method for deamination of at least one target adenosine in an intracellular target RNA, comprising the steps of: supplying a cell with a set of AONs, including helper AONs and edited AONs present in the composition according to the present invention; enabling the AONs to anneal to the target RNA to form a double-stranded nucleic acid molecule; enabling an ADAR enzyme endogenously present in the cell to form a complex with the double-stranded nucleic acid molecule and deaminate the target adenosine in the target RNA to inosine; and optionally, identifying the presence of the deaminated nucleotide in the target RNA.

[0011] The present invention also relates to an in vitro, in vivo, or ex vivo method for deaminating at least one target adenosine present in a target RNA, comprising the steps of: supplying a composition comprising a set of two AONs according to the present invention; enabling the annealing of the AONs to the target RNA to form a double-stranded nucleic acid molecule; enabling an ADAR enzyme to form a complex with the double-stranded nucleic acid molecule and deaminate the target adenosine in the target RNA to inosine; and identifying the presence of the deaminated adenosine in the target RNA.

[0012] The present invention also relates to a single-stranded AON, referred to as an “edited AON,” for use in the deamination of a target nucleotide in a target RNA, wherein the AON is capable of forming a double-stranded complex with the target RNA in the cell, the edited AON is complementary to a sequence of nucleotides in the target RNA containing the target nucleotide, the nucleotide in the edited AON directly opposite the target adenosine is an “orphan nucleotide” not modified with 2'-OMe or 2'-MOE, and the edited AON is characterized by having a length of 16 to 22 nucleotides, preferably 19, 20, or 21 nucleotides, more preferably 21 nucleotides. The present invention provides an edited AON of 16 to 22 nucleotides in length, preferably containing a sequence configured for the deamination of adenosine as the target nucleotide. Despite its short structure, the edited AON of the present invention can engage with an enzyme having deamination activity even in the absence of a helper AON disclosed herein, the target nucleotide being adenosine to be deaminated to inosine by the deamination enzyme. In a preferred embodiment, the edited AON of the present invention comprises at least one nucleotide having a 2'-OMe or 2'-MOE ribose modification, while the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification.

[0013] Brief explanation of the drawing One or more embodiments of the present invention are described herein merely as examples with reference to the accompanying drawings. [Brief explanation of the drawing]

[0014] [Figure 1-1](A) The 5' to 3' target mouse amyloid precursor protein (mAPP) RNA sequence (SEQ ID NO: 1) is shown, with the sequences of 21 antisense oligonucleotides shown below. AON mAPPEx17_39, _62, and _67 have the sequence of SEQ ID NO: 2. AON mAPPEx17_135A, _139A, _140A, and _141A have the sequence of SEQ ID NO: 3. AON mAPPEx17_135B, _136B, _139B, _140B, and _141B have the sequence of SEQ ID NO: 4. AON mAPPEx17_144A and _145A have the sequence of SEQ ID NO: 5. AON mAPPEx17_144B and _145B have the sequence of SEQ ID NO: 6. AON mAPPEx17_136A and mAPPEx17_137A have the sequence of SEQ ID NO: 7. AON mAPPEx17_137B and mAPPEx17_138B have the sequence of SEQ ID NO: 8. AON mAPPEx17_138A has the sequence of SEQ ID NO: 9. The chemical modifications of each AON are provided in (B): an asterisk indicates a phosphorothioate (PS) bond between two nucleosides; lowercase nucleotides without an underline are modified with 2'-OMe; lowercase nucleotides with an underline are modified with 2'-MOE; uppercase nucleotides are DNA; and a bold uppercase C represents an orphan nucleotide (DNA) directly opposite adenosine in the target sequence that needs editing. [Figure 1-2] The explanation is the same as in Figure 1-1. [Figure 2]The editing percentages in in vitro biochemical assays achieved by using 38nt-length mAPPEx17-62 as a single AON and a positive control for RNA editing are shown in comparison to the levels achieved with i) a set of split AONs including 19nt-length mAPPEx17-139A as a helper AON and 19nt-length mAPPEx17-139B as the editing AON; and ii) a set of split AONs including 17nt-length mAPPEx17-144A as a helper AON and 21nt-length mAPPEx17-144B as the editing AON. Both sets were clearly shown to be capable of providing proper and rapid high levels of RNA editing, with the 17 / 21nt set (mAPPEx17-144A and -B) functioning similarly to the 38nt positive control AON (mAPPEx17-62) and functioning slightly more efficiently than the 19 / 19nt set (mAPPEx17-139A and -B). [Figure 3] The editing percentages in in vitro biochemical assays achieved by using 38nt-length mAPPEx17-67 as a single AON and a positive control for RNA editing are shown in comparison to the levels achieved with i) a set of split AONs containing 19nt-length mAPPEx17_140A as a helper AON and 19nt-length mAPPEx17_140B as an editing AON; ii) a set of split AONs containing 19nt-length mAPPEx17_141A as a helper AON and 19nt-length mAPPEx17_141B as an editing AON; and iii) a set of split AONs containing 17nt-length mAPPEx17-145A as a helper AON and 21nt-length mAPPEx17_145B as an editing AON. All three sets were able to provide significant RNA editing, with the mAPPEx17_145A and -B sets outperforming the other two sets. [Figure 4]The percentage of editing achieved in in vitro biochemical assays using 38nt-length mAPPEx17_62 as a single AON and as a positive control for RNA editing is shown in comparison to the levels achieved with i) a set of split AONs including 19nt-length mAPPEx17-139A as a helper AON and 19nt-length mAPPEx17-139B as an editing AON; ii) mAPPEx17_139B as a single editing AON; iii) a set of split AONs including 17nt-length mAPPEx17-144A as a helper AON and 21nt-length mAPPEx17-144B as an editing AON; and iv) mAPPEx17_144B as a single editing AON. Both sets resulted in efficient RNA editing, but high levels of RNA editing were also obtained when using the editing AON mAPPEx17_144B alone. In contrast, using mAPPEx17_139B as an editing AON did not demonstrate a high level of editing when used alone. [Figure 5] The percentage of editing achieved in in vitro biochemical assays by using 38nt-length mAPPEx17_67 as a single AON and as a positive control for RNA editing is shown in comparison to the levels achieved with i) a set of split AONs including 19nt-length mAPPEx17_141A as a helper AON and 19nt-length mAPPEx17_141B as the editing AON; ii) mAPPEx17_141B as the single editing AON; iii) a set of split AONs including 17nt-length mAPPEx17_145A as a helper AON and 21nt-length mAPPEx17_145B as the editing AON; and iv) mAPPEx17_145B as the single editing AON. As shown in Figure 3, the sets of mAPPEx17_141A and -B showed moderate levels of RNA editing, and the use of single mAPPEx17_141B as the editing AON did not result in high levels of editing. The levels achieved with the mAPPEx17_145A and -B set were equivalent to those shown in Figure 3, and the use of a single mAPPEx17_145B as the editing AON demonstrated a proper level of RNA editing. [Figure 6]The percentage of edits obtained after transfection with various sets of edited AONs and helper AONs, as well as after transfection with separate edited AONs without co-transfection of the cells with helper AONs, is shown. As shown, sets of AONs and single edited AONs can recruit ADARs endogenously present in cells to result in the deamination of target adenosine. Negative controls were untransfected samples (NT), mock transfected samples, and transfection with control scrambled AONs. Two positive control AONs, mAPPEx17_62 and _67 (each 38nt long), were able to reach approximately 13% to 28% edit, but sets and single AONs were also able to result in RNA editing, with the sets mAPPEx17_140A / B, mAPPEx17_141A / B, mAPPEx17_145A / B, and the single edited AON mAPPEx17_141B performing best. [Figure 7]Editing percentages in in vitro biochemical assays were achieved by using 38nt-length mAPPEx17_39 as a single AON and a positive control for RNA editing, i) a set of split AONs including 19nt-length mAPPEx17-135A as a helper AON and 19nt-length mAPPEx17-135B as the editing AON; ii) 18nt-length mAPPEx17-136A as a helper AON and 19nt-length mAPPEx17-136B as the editing AON. The performance is shown in comparison to the levels achieved with the following sets of AONs: iii) a set of AONs with a 2nt gap including an 18nt-length mAPPEx17-137A as a helper AON and an 18nt-length mAPPEx17-137B as an editing AON; and a set of AONs with a 3nt gap including a 17nt-length mAPPEx17-138A as a helper AON and an 18nt-length mAPPEx17-138B as an editing AON. Split AONs can still achieve RNA editing even though they do not form complementary continuous sequences together (in other words, a "gap" exists when they bind to the target RNA), but they appear to be less efficient than split AONs that have two continuous sequences and no gap is formed. See the performance of the mAPPEx17_135A and -B sets and the single 38nt-length mAPPEx17_39 AON. [Modes for carrying out the invention]

[0015] Detailed explanation All of the aforementioned RNA-editing antisense oligonucleotides (AONs, also often referred to herein and elsewhere as “edited oligonucleotides,” and frequently abbreviated as “EONs”) consist of a single sequence of nucleotides in a single molecule having a sequence that is either fully complementary or partially complementary to the target RNA sequence. While it is desirable to have AONs of relatively short length, to date, the most optimal and tested AONs have been approximately 35–60 nucleotides in length. This is generally much longer than typical AONs used for exon skipping, splice regulation, or transcription / translation inhibition. Such AONs generally have an optimal length of 16–24 nucleotides. Common limiting factors for AON-based therapies are the ability of oligonucleotides to be taken up by cells (when delivered by themselves, or “naked” without the application of a delivery vehicle), their distribution in the body, and their resistance to nuclease-mediated degradation. Those skilled in the art will be aware that various chemical modifications can help overcome such limitations, and these have been described in detail in the art. Examples of such currently commonly used chemical modifications include 2'-O-methyl (2'-OMe) and 2'-O-methoxyethyl (2'-MOE) modifications of sugars, as well as the use of phosphorothioated (PS) bonds between nucleosides. PCT / European Patent No. 2020 / 059369 (unpublished) describes the use of methylphosphonate (MP) bond modifications at specific positions surrounding orphan nucleotides in AONs. It has also been found that in AONs, phosphonoacetate bond modifications and / or unlocked nucleic acid (UNA) ribose modifications at some, but not all, positions appeared to be compatible with the effective involvement of enzymes having nucleotide deamination activity and subsequent deamination (PCT / European Patent No. 2020 / 053283, unpublished).While the properties of phosphonoacetate and UNA modification were known, their compatibility with the involvement of enzymes possessing nucleotide deamination activity and deamination reactions was unknown. In UNA modification, there is no carbon-carbon bond between the 2' and 3' carbon atoms of the ribose. Therefore, UNA-ribose modification increases local flexibility in oligonucleotides. UNA can result in effects such as improved pharmacokinetic properties due to improved resistance to degradation. UNA may also be involved in reducing toxicity and mitigating off-target effects. Due to significant interference with binding with enzymes possessing nucleotide deaminase activity, UNA-ribose modification should preferably be avoided in orphan nucleotides. UNA-ribose modification may only occur in AONs, but UNA modification can be present in addition to modification of the ribose 2' group, either at a different position or at the same position as UNA modification. The ribose 2' group of the AON can be independently selected from 2'-H (i.e., DNA), 2'-OH (i.e., RNA), 2'-OMe, 2'-MOE, 2'-F, or 2'-4'-bond (e.g., locked nucleic acid (LNA)), or other 2' substitutions. The 2'-4' bond can be selected from linkers known in the art, such as methylene linkers or restricted ethyl linkers (cEt). Nevertheless, because AONs used to date are relatively long, concerns remain and limitations may arise regarding their distribution in vivo, cell entry, and the efficiency of RNA editing in vivo. The inventors of the present invention have now found solutions to these problems, as outlined herein. The inventors have attempted to use a set of AONs (preferably having only two oligonucleotides in the set), and subsequently achieved efficient RNA editing using only a single short-chain AON.

[0016] The present invention relates to a composition comprising a set of two single-stranded antisense oligonucleotides (AONs) for use in the deamination of a target nucleotide (preferably adenosine) in a target RNA, wherein one AON is an "edited AON" and the other AON is a "helper AON," the edited AON is complementary to a sequence of nucleotides in the target RNA containing the target adenosine, the nucleotide in the edited AON directly opposite the target nucleotide is an "orphan nucleotide" not modified with 2'-OMe or 2'-MOE (when the target nucleotide is adenosine, the orphan nucleotide is preferably cytidine), the helper AON is complementary to a sequence of nucleotides in a target RNA other than the sequence of nucleotides complementary to the edited AON, the helper AON has a length of 16 to 22 nucleotides, and the edited AON has a length of 16 to 22 nucleotides. In a preferred embodiment, the helper AON and the edited AON form a double-stranded complex in continuum with the target RNA, and the helper AON is complementary to the edited AON, located at the 3' end of a sequence of nucleotides in the target RNA, and there are no nucleotide gaps between the sequences complementary to the helper AON and the edited AON. This means that the AONs do not overlap to be complementary to the same sequence or part of the target RNA. As shown herein, RNA editing can be achieved even with a gap of 1, 2, or 3 nucleotides between the helper AON and the edited AON, and the best results were obtained when the helper AON and the edited AON were continuously aligned to the target RNA molecule without gaps. Preferably, the helper AON is 100% complementary to the target RNA. Preferably, the edited AON is perfectly complementary to the target RNA, except in cases where there is a mismatch between the orphan nucleotide and the target nucleotide. In a preferred embodiment, this set can form a double-strand complex with the target RNA, and then recruit endogenous ADAR enzymes to result in deamination of the target nucleotide.

[0017] The nucleotide numbering of the edited AON is such that the orphan nucleotide is designated 0, and the nucleotide 5' to the orphan nucleotide is designated +1. The counting increments positively towards the 5' end, increments negatively (-) towards the 3' end, and the first nucleotide 3' to the orphan nucleotide is -1.

[0018] The numbering of the internucleotide linkages of the edited AON is such that linkage number 0 is the 5' linkage from the orphan nucleotide, and the linkage positions in the oligonucleotide increment positively (+) towards the 5' end and increment negatively (-) towards the 3' end.

[0019] Preferably, the edited AON comprises one or more phosphorothioate (PS) linkages. Preferably, the PS linkages connect the 4, 5, 6, 7, or 8 most terminal nucleotides at each end of the edited AON. More preferably, the PS linkages are present at linkage positions +6, +5, +4, +3, +2, and +1 of the edited AON, for example when the edited AON is 21 nucleotides in length. Also preferably, the PS linkages are present at linkage positions -7, -8, -9, -10, -11, -12, and -13 of the edited AON, for example when the edited AON is 21 nucleotides in length.

[0020] Preferably, the edited AON comprises at least one nucleotide having a sugar moiety that includes a 2'-OMe modification. In a 21 nt long AON according to the present invention, preferred positions for the 2'-OMe modification at the 5' end of the AON are nucleotide positions +2, +3, +4, +5, +6, and / or +7 (preferably all nucleotides located 5' to the +1 position). In a 21 nt long AON according to the present invention, preferred positions for the 2'-OMe modification at the 3' end of the AON are nucleotide positions -2, -5, -6, -7, -8, -9, -10, -11, -12, and / or -13. It is preferred that the sugar moieties of all nucleotides located 3' to the -4 position are modified with 2'-OMe groups.

[0021] Preferably, the editing AON comprises at least one nucleotide having a sugar moiety that includes a 2'-MOE modification. Preferred positions for nucleotides having a 2'-MOE modification are position +1 and / or position -4 of the editing AON.

[0022] Preferably, the orphan nucleotide has a 2'-H on its sugar moiety and is therefore referred to as a DNA nucleotide. The nucleotides on the 3' side and / or 5' side of the orphan nucleotide are also DNA, and more preferably, the nucleotide on the 3' side (position -1) is DNA.

[0023] Preferably, the editing AON has the following structure:

[0024] [Chemical Formula] comprises at least one methylphosphonate (MP) internucleoside linkage according to the structure.

[0025] A preferred position for the MP linkage in the editing AON according to the present invention is linkage position -1, whereby the nucleoside at position -1 is connected to the nucleoside at position -2, but other positions for the MP linkage are not explicitly excluded.

[0026] Preferably, the editing AON comprises at least one nucleotide having a sugar moiety that includes a 2'-fluoro (2'-F) modification. A preferred position for the nucleotide having a 2'-F modification is position -3 of the editing AON.

[0027] Preferably, the editing AON comprises at least one phosphonoacetate internucleoside linkage.

[0028] Preferably, the editing AON according to the present invention comprises at least one nucleotide comprising an unlocked nucleic acid (UNA) ribose modification.

[0029] The preferred modifications outlined above can also be introduced into helper AONs, but these AONs do not suffer from the instability problems seen in edited AONs, in that the orphan nucleotides cannot have 2' modifications such as 2'-OMe or 2'-MOE, and should preferably be DNA for proper function. Helper AONs preferably include four PS-binding modifications at each end of the AON, thereby connecting five terminal nucleosides at each end. In addition, helper AONs are preferably fully modified with 2'-OMe and / or 2'-MOE modifications, although the number of nucleotides having 2'-OMe or 2'-MOE modifications may vary. Generally, DNA is not present in helper AONs, but it is not explicitly excluded. Helper AONs may be 100% complementary to the target RNA, but may also include one or more mismatches, fluctuations, or bulges that can add the ability to recruit deaminase enzymes.

[0030] Preferably, the edited AON is 19, 20, or 21 nucleotides long, the orphan nucleotide is the 6th, 7th, or 8th nucleotide from the 5' end, and the helper AON is 17, 18, or 19 nucleotides long. The present invention further relates to compositions for use in accordance with the present invention, further comprising a pharmaceutically acceptable carrier.

[0031] The present invention relates to a single-stranded AON, referred to as an "edited AON," for use in the deamination of a target nucleotide in a target RNA, wherein the AON is capable of forming a double-stranded complex with the target RNA in the cell, the edited AON is complementary to a sequence of nucleotides in the target RNA containing the target nucleotide, the nucleotide in the edited AON directly opposite the target adenosine is an "orphan nucleotide" not modified with 2'-OMe or 2'-MOE, and the edited AON is characterized by having a length of 16 to 22 nucleotides, preferably 19, 20, or 21 nucleotides, more preferably 21 nucleotides. The present invention provides an edited AON of 16 to 22 nucleotides in length, preferably containing a sequence configured for the deamination of adenosine as the target nucleotide. Despite its short structure, the edited AON of the present invention can engage with enzymes having deamination activity even in the absence of a helper AON disclosed herein, preferably the target nucleotide is adenosine to be deaminated to inosine by a deaminationase. In a preferred embodiment, the edited AON of the present invention comprises at least one nucleotide having a 2'-OMe or 2'-MOE ribose modification, while the orphan nucleotide does not have a 2'-OMe or 2'-MOE ribose modification.

[0032] The compositions or single edited AONs according to the present invention are preferably used to treat cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, albinism, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, epidermolysis bullosa (dystrophic type), Fabry disease, factor V Leiden-associated disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), and inherited polyagglutination syndrome. It is used to treat or prevent genetic disorders selected from the group consisting of (e.g., syndrome), Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy type I and type II, neurofibromatosis, Niemann-Pick disease types A, B and C, NY-eso1 related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disorders, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome types I, II and III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer.

[0033] The present invention also relates to a method for deamination of at least one target adenosine in an intracellular target RNA, comprising the steps of: supplying a cell with a set of AONs including a helper AON and an edited AON according to the present invention, or a single edited AON according to the present invention; enabling the AON to anneal to the target RNA to form a double-stranded nucleic acid molecule; enabling an ADAR enzyme endogenously present in the cell to form a complex with the double-stranded nucleic acid molecule and deaminate a target nucleotide (preferably adenosine) in the target RNA; and optionally identifying the presence of the deaminated nucleotide in the target RNA. The identification step in the method of the present invention may include sequencing a region of target RNA, wherein the region includes the position of a target nucleotide; evaluating the presence of a functional, elongated, full-length and / or wild-type protein if the target nucleotide is adenosine at a UGA or UAG stop codon and is edited to a UGG codon by deamination; evaluating whether the splicing of the premRNA has been modified by deamination if the target RNA is premRNA; or using functional readout, wherein the deaminated target RNA encodes a functional, full-length, elongated and / or wild-type protein.

[0034] The present invention also relates to an in vivo, ex vivo, or in vitro method for deamination of at least one target adenosine present in a target RNA, comprising the steps of supplying a set of two AONs according to the present invention or a single edited AON according to the present invention, enabling the annealing of the AONs to the target RNA to form a double-stranded nucleic acid molecule, enabling an ADAR enzyme to form a complex with the double-stranded nucleic acid molecule and deaminate the target adenosine in the target RNA to inosine, and identifying the presence of the deaminated adenosine in the target RNA.

[0035] In all aspects of the present invention, the enzyme having nucleotide deaminase activity is preferably an ADAR enzyme, more preferably ADAR1 or ADAR2. In a highly preferred embodiment, the edited AON is an RNA-edited single-stranded AON targeting premRNA or mRNA, the target nucleotide is preferably adenosine in the target RNA, the adenosine is deaminated to inosine, and the inosine is read as guanosine by the translation mechanism. In a further preferred embodiment, the adenosine is located at a UGA or UAG stop codon and edited to a UGG codon, or the two target nucleotides are two adenosines at a UAA stop codon, the codon is edited to a UGG codon by deamination of both target adenosines, and the two nucleotides in the oligonucleotide are mismatched with the target nucleic acid.

[0036] The helper AONs and edited AONs according to the present invention may include nucleoside bond modifications other than, or in addition to, PS linker modifications. In one embodiment, such other nucleoside bond may be a phosphonoacetate or methylphosphonate modified bond. In another embodiment, the nucleoside bond may be a phosphodiester, the OH group of the phosphodiester being substituted with alkyl, alkoxy, aryl, alkylthio, acyl, -NR1R1, alkenyloxy, alkynyloxy, alkenylthio, alkynylthio, -S-Z+, -Se-Z+, or -BH3-Z+, where R1 is independently hydrogen, alkyl, alkenyl, alkynyl, or aryl, Z+ is an ammonium ion, alkylammonium ion, heteroaromatic iminium ion, or heterocyclic iminium ion, any of which may be primary, secondary, tertiary, or quaternary, or Z is a monovalent metal ion. The use of PS bond modification is preferred.

[0037] In the edited AONs of the present invention, the orphan nucleotide generally comprises a deoxyribose having a 2'-H group, and preferably does not contain a ribose having a 2'-OMe or 2'-MOE modification. Furthermore, the edited AONs of the present invention generally further include a 2'-MOE modification at another position within the AON. The same is true for helper AONs. The AONs of the present invention preferably do not contain the mobilization moiety described in International Publication Brochure 2016 / 097212. The AONs of the present invention do not contain a moiety that can form an intramolecular stem-loop structure. The AONs do not contain a 5'-terminal O6-benzylguanine modification. The AONs do not contain a 5'-terminal amino modification. The AONs are not covalently bound to a SNAP tag domain. The numbering of nucleotide interlinks in the AONs of the present invention is such that linkage number 0 is a 5' linkage from an orphan nucleotide, which itself is the "0" nucleotide.

[0038] The present invention also relates to an AON, which can target an early stop codon (PTC) present in (pre)mRNA to modify the adenosine present in the stop codon to inosine (read as G), thereby resulting in translational read-through and a full-length functional protein. The teachings of the present invention are applicable to all genetic disorders that can be targeted with an AON and treated by RNA editing, as outlined herein. One example is Usher syndrome type II, caused by a mutation in the USH2A gene.

[0039] In one embodiment, the present invention relates to an AON (or a set of two AONs) that can form a double-stranded complex with an intracellular target RNA molecule for use in deamination of a target adenosine in disease-associated splice mutations present in a target RNA molecule, wherein the orphan nucleotide of the edited AON does not have 2'-OMe modification, and the nucleotide direct 5' and / or 3' from the orphan nucleotide (together with the orphan nucleotide, the nucleotides form a central triplet) has sugar modification and / or base modification, which stabilizes and / or more effectively results in the AON through RNA editing, preferably modified so that at least one bond in the AON includes a PS modification. In a preferred embodiment, at least one internucleoside bond connecting two nucleosides has an MP modification. If two nucleotides in the edited AON are DNA, all others may be RNA and may be modified with 2'-OMe or 2'-MOE. In one embodiment, each of the AONs or AONs (in the case of two sets) according to the present invention contains two, three, or four mismatches, fluctuations, and / or bulges with the complementary target RNA region. Preferably, the nucleotide opposite the target adenosine is cytidine, deoxycytidine, uridine, deoxyuridine, or debase. International application PCT / US2020 / 037580 (unpublished) describes using a cytidine analog at the orphan nucleotide position to increase the RNA editing efficiency of the AON. This is because such a cytidine analog interacts more strongly with the ADAR enzyme. Incorporating a cytidine analog (such as pseudoisocytidine (piC) or Benner's base Z (dZ)) at the orphan nucleotide position is also a preferred embodiment of the present invention. When the nucleotide opposite the target adenosine is cytidine or deoxycytidine, the AON contains at least one mismatch with the target RNA molecule. When the nucleotide opposite the target adenosine is uridine or deoxyuridine, the AON can be 100% complementary and will not have any mismatch, fluctuation, or bulge in relation to the target RNA.However, in one embodiment, one or more further mismatches, fluctuations, and / or bulges may exist between the AON and the target RNA, regardless of whether the nucleotide opposite the target adenosine is cytidine, deoxycytidine, pseudoisocytidine, Benner's base Z, uridine, or deoxyuridine. In another preferred embodiment, the nucleotide directly 5' and / or 3' from the orphan nucleotide comprises ribose having a 2'-OH group, or deoxyribose having a 2'-H group, or a mixture of the two. Thus, the central triplet having the orphan nucleotide in the middle consists of DNA-DNA-DNA, DNA-DNA-RNA, DNA-RNA-DNA, DNA-RNA-RNA, RNA-DNA-DNA, RNA-DNA-RNA, RNA-RNA-DNA, or RNA-RNA-RNA, where the orphan nucleotide does not have a 2'-OMe modification (in the case of RNA), and neither one nor both of the surrounding nucleotides have a 2'-OMe modification. In this case, all other nucleotides of the AON preferably have a 2'-O-alkyl group, preferably a 2'-OMe group, or a 2'-MOE group, or any modification disclosed herein. Fluctuations, mismatches, and / or bulges of the AON of the present invention with respect to the target sequence do not prevent the hybridization of the oligonucleotide to the target RNA sequence, but the ADAR present in the cell at the target adenosine site adds to the efficiency of RNA editing. Those skilled in the art can determine whether hybridization still occurs under physiological conditions. The AON of the present invention can recruit (engage) mammalian ADAR enzymes present in cells, the ADAR enzymes containing their native dsRNA-binding domain found in wild-type enzymes. The AON of the present invention can utilize endogenous cellular pathways and naturally available ADAR enzymes or enzymes with ADAR activity (which may be ADAR-like enzymes not yet identified) to specifically edit the target adenosine of the target RNA sequence.As disclosed herein, the single-stranded AONs of the present invention, despite being significantly shorter than those previously shown in the field of RNA editing, are capable of deaminating specific targets, such as adenosine, on target RNA molecules. Ideally, only one nucleotide is deaminated; or, one, two, or three additional nucleotides are deaminated, but preferably only one. The AONs of the present invention are designed for and can be used with a variety of nucleotide deaminase enzymes, such as ADAR. ADAR is preferably expressed naturally, but can also be produced artificially (e.g., by recombinant expression or protein synthesis). ADAR may be wild-type or can be modified. Modified recombinant ADAR expression is not required, in conjunction with the features of the AONs of the present invention. The AONs of the present invention are not particularly limited with respect to conjugated substances that bind to the AON. However, they do not require conjugated substances that bind to the AON. Therefore, AONs lacking conjugated substances that bind to the AON form a preferred embodiment. The presence of a long recruitment moiety that is not complementary to the target RNA sequence is not required. As a result, AONs lacking long recruitment moieties that are not complementary to the target RNA sequence form a preferred embodiment. The AONs of the present invention are smaller than those used in the art for RNA editing, but can still recruit endogenous ADARs and result in site-directed RNA editing, as shown herein. The editing AONs of the present invention can (with or without the assistance of a helper AON) engage with a substance, preferably an enzyme, having deamination activity, which is preferably endogenously present in cells, preferably mammals, more preferably human cells, to result in the deamination of target nucleotides in a target nucleic acid molecule. The preferred target nucleic acid molecule is an RNA molecule. The double-stranded AON / target nucleic acid molecule complex interacts by Watson-Crick base pairing. In one preferred embodiment of the present invention, the AON contains one or more MP bonds at binding sites 0, -2, -4, and / or -6. In a particularly preferred embodiment, the AON contains MP bonds at positions 0 and / or -2.In one preferred embodiment, the AON comprises at least one nucleotide including at least one PS, at least one phosphonoacetate internucleotide bond, and / or an unlocked nucleic acid (UNA) ribose modification. In a more preferred embodiment, the PS bond is present at both ends of the AON, connecting up to 3, 4, or 5 nucleosides at each end. As outlined herein, previous RNA editing AONs were in the 35–40 nt length range, but the present invention demonstrates that single AONs in the 19, 20, and 21 nucleotide range can also mobilize ADARs and result in RNA editing.

[0040] In another preferred embodiment, the AON of the present invention further comprises one or more nucleotides comprising a substitution at the 2' position of ribose, the substitution being selected from the group consisting of -OH;-F; substituted or unsubstituted, linear or branched lower (C1-C10) alkyl, alkenyl, alkynyl, alkaryl, allyl, or aralkyl, interrupted by one or more heteroatoms;-O-, S-, or N-alkyl;-O-, S-, or N-alkenyl;-O-, S-, or N-alkynyl;-O-, S-, or N-allyl;-O-alkyl-O-alkyl;-methoxy;-aminopropoxy;-methoxyethoxy(2'-MOE);-dimethylaminooxyethoxy; and-dimethylaminoethoxyethoxy. The AON of the present invention is preferably 16, 17, 18, 19, 20, 21, or 22 nucleotides long, and preferably 21 nucleotides long. The helper AON according to the present invention is preferably 16, 17, 18, 19, 20, 21, or 22 nucleotides long, and preferably 17 nucleotides long.

[0041] In another embodiment, the present invention relates to a pharmaceutical composition comprising an AON (or a set of two AONs according to the present invention) and a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier is known to those skilled in the art.

[0042] In another embodiment, the present invention relates to cystic fibrosis, Harler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, albinism, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, (dystrophic) epidermolysis bullosa, Fabry disease, factor V Leiden-associated disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), hereditary polyaggregation syndrome, Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, I The present invention relates to the use of an AON or a set of two AONs (edited AON and helper AON) according to the present invention in the manufacture of a pharmaceutical for the treatment of a genetic disorder preferably selected from the group consisting of type A and type II myotonic dystrophy, neurofibromatosis, Niemann-Pick disease types A, B and C, NY-eso1 related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disorders, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome types I, II and III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer.

[0043] In another embodiment, the present invention relates to a method for deamination of at least one target nucleotide, preferably adenosine, present in a target nucleic acid molecule, preferably an RNA target molecule, within a cell, comprising the steps of: supplying a cell with an edited AON according to the present invention, a set of two AONs according to the present invention (edited AON + helper AON), or a pharmaceutical composition according to the present invention; enabling the annealing of the AON to the target nucleic acid molecule; enabling a mammalian enzyme having nucleotide deaminase activity to deaminate the target nucleotide in the target nucleic acid molecule; and optionally identifying the presence of the deaminated nucleotide in the target nucleic acid molecule. The mammalian enzyme having nucleotide deaminase activity engaged by the use of the AON according to the present invention is preferably an adenosine deaminase enzyme capable of modifying the target nucleotide in the target nucleic acid molecule, the target nucleotide being preferably adenosine deaminated to inosine. Any step in identifying the presence of a deaminated nucleotide is preferably by sequencing a region of a target nucleic acid molecule to determine if the region contains a deaminated target nucleotide; assessing the presence of a functional, elongated, full-length, and / or wild-type protein if the target nucleotide is an adenosine located at a UGA or UAG stop codon and edited to a UGG codon by deamination; assessing the presence of a functional, elongated, full-length, and / or wild-type protein if two target adenosines are located at a UAA stop codon and edited to a UGG codon by deamination of both target adenosines; assessing whether the splicing of the premRNA has been altered by deamination if the target RNA molecule is a premRNA; or by using functional readout to determine if the deaminated target nucleic acid molecule encodes a functional, full-length, elongated, and / or wild-type protein.

[0044] In another embodiment, the present invention relates to a method for treating a subject, preferably a subject in need thereof, the subject suffering from a genetic disorder resulting from a mutation involving the appearance of adenosine (e.g., PTC), wherein deamination of the adenosine to inosine would alleviate, prevent, or improve the disease, and the method comprises the steps of: administering an edited AON according to the present invention or a set of two AONs according to the present invention (edited AON + helper AON) or a pharmaceutical composition according to the present invention to the subject; enabling the formation of a double-stranded nucleic acid complex between the AON and its specific and complementary target nucleic acid in the cells of the subject; enabling the engagement of an endogenously present enzyme having deamination activity, such as hADAR1 or hADAR2; and enabling the enzyme to deaminate the target adenosine of the target nucleic acid molecule to inosine, thereby alleviating, prevent, or improving the genetic disorder. The genetic disorders that can be treated according to this method are preferably, but not limited to, the genetic disorders listed herein (see above).

[0045] definition The terms “adenine,” “guanine,” “cytosine,” “thymine,” “uracil,” and “hypoxanthine” (nucleic acid bases in inosine) refer to nucleic acid bases in themselves, as used herein. The terms “adenosine,” “guanosine,” “cytidine,” “thymidine,” “uridine,” and “inosine” refer to nucleic acid bases bound to (deoxy)ribosyl sugars. The term “nucleoside” refers to nucleic acid bases bound to (deoxy)ribosyl sugars that do not have a phosphate group. A “nucleotide” consists of a nucleoside and one or more phosphate groups. Therefore, the term “nucleotide” refers to each nucleic acid base-(deoxy)ribosyl-phospholinker, as well as any chemical modifications of the ribose moiety or phospho group. Therefore, this term includes nucleotides containing locked doribosyl moieties (containing 2'-4' crosslinks containing a methylene group or any other group), unlocked nucleic acids (UNAs), phosphodiesters, phosphonoacetates, phosphotryesters, phosphorothioates (PS), phosphoro(di)thioates, methyl(ene)phosphonates (MP), and nucleotides containing linkers such as phosphoramidate linkers. Sometimes, the terms adenosine and adenine, guanosine and guanine, cytidine and cytosine, uracil and uridine, thymine and thymidine / uridine, inosine and hypoxanthine are used interchangeably to refer to the corresponding nucleic acid bases on the one hand and nucleosides or nucleotides on the other. Sometimes, the terms nucleic acid base, nucleoside, and nucleotide are used interchangeably unless the context clearly requires otherwise, for example, when a nucleoside is bound to a neighboring nucleoside and the bond between these nucleosides is modified. In this case, the nucleoside can be considered a modified linker, or the nucleotide can be considered a modified nucleotide. As mentioned above, a nucleotide consists of a nucleoside and one or more phosphate groups.The terms “ribonucleoside” and “deoxyribonucleoside,” or “ribose” and “deoxyribose,” are used as they are used in the art. Whenever “antisense oligonucleotide,” “oligonucleotide,” “EON,” or “AON” refers to both oligonucleotides and deoxyoligonucleotides unless the context indicates otherwise. Whenever “oligonucleotide” refers to an oligonucleotide, it may contain the base A, G, C, U, or I. Whenever “deoxyoligonucleotide” refers to a deoxyoligonucleotide, it may contain the base A, G, C, T, or I.

[0046] In a preferred embodiment, the AON of the present invention is an oligonucleotide that may include chemical modifications and may include deoxynucleotides (DNA) at certain specific positions. The terms oligonucleotide, oligo, ON, oligonucleotide composition, antisense oligonucleotide, AON, (RNA)-edited oligonucleotide, EON, and RNA (antisense) oligonucleotide can be used interchangeably herein. Whenever a nucleotide in an oligonucleotide construct such as cytosine is referred to, it includes 5-methylcytosine, 5-hydroxymethylcytosine, and β-D-glucosyl-5-hydroxy-methylcytosine; whenever adenine is referred to, it includes N6-methyladenine and 7-methyladenine; whenever uracil is referred to, it includes dihydrouracil, 4-thiouracil, and 5-hydroxymethyluracil; and whenever guanine is referred to, it includes 1-methylguanine. Whenever a nucleoside or nucleotide is referred to, it includes ribofuranose derivatives such as 2'-desoxy and 2'-hydroxy, and 2'-O-substituted variants such as 2'-O-methyl, as well as other modifications including 2'-4' crosslinking variants. Whenever an oligonucleotide is referred to, the bond between the two mononucleotides can be a phosphodiester bond, as well as modifications thereof, including linkers of phosphonoacetates, phosphodiesters, phosphotryesters, PS, phosphoro(di)thioates, MP, and phosphoramidates.

[0047] The term "comprising" encompasses "including" and "consisting," for example, a composition "containing X" may consist exclusively of X or may contain something additional, such as X + Y. The term "about" with respect to a numerical value X is arbitrary and means, for example, X ± 10%. The word "substantially" does not exclude "completely," for example, a composition "substantially not containing Y" may not contain Y at all. In connection with this, the word "substantially" may be omitted from the definitions of this invention.

[0048] As used herein, the term “complementary” refers to the fact that AON hybridizes to the target sequence under physiological conditions. This term does not mean that each nucleotide of AON has perfect pairing with its corresponding nucleotide in the target sequence. In other words, while AON may be complementary to the target sequence, mismatches, fluctuations, and / or bulges may exist between AON and the target sequence, while AON still hybridizes to the target sequence so that cellular RNA editing enzymes can edit the target adenosine under physiological conditions. Thus, the term “substantially complementary” also means that, despite the presence of mismatches, fluctuations, and / or bulges, there are sufficiently matched nucleotides between AON and the target sequence so that AON hybridizes to the target RNA under physiological conditions. As described herein, AONs may be complementary, but may also include one or more mismatches, fluctuations, and / or bulges with the target sequence, insofar as the AON can hybridize to its target under physiological conditions.

[0049] In nucleic acid sequencing terminology, "downstream" refers to a point further away along the 3' direction of the sequence, while "upstream" refers to the opposite. Therefore, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon on the sense strand, but downstream of the stop codon on the antisense strand.

[0050] The reference to “hybridization” typically refers to specific hybridization, excluding nonspecific hybridization. Specific hybridization can be performed under selected experimental conditions using techniques well known in the art to ensure that many of the stable interactions between the probe and target are in a state where the probe and target have at least 70%, preferably at least 80%, and more preferably at least 90% sequence identity. The term “mismatch” is used herein to refer to opposing nucleotides in a double-stranded RNA complex that do not form perfect base pairs according to the rules of Watson-Crick base pairing. Mismatched nucleotides are GA, CA, UC, AA, GG, CC, and UU pairs. In some embodiments, the AON of the present invention contains fewer than four mismatches, e.g., 0, 1, or 2 mismatches. Fluctuation base pairs are GU, IU, IA, and IC base pairs.

[0051] The AON of the present invention, more specifically, includes a nucleotide directly opposite a target nucleotide present on a target RNA molecule. The nucleotide in the AON directly opposite a target nucleotide is defined herein as an "orphan nucleotide." A "central triplet" is defined as a region within the AON consisting of an orphan nucleotide and its 3' and 5' neighboring nucleotides (hence, a central triplet = three nucleotides with an orphan nucleotide in the center).

[0052] The term “splice mutation” refers to a mutation in a gene encoding premRNA, where the splicing mechanism is impaired, resulting in a disruption of the splicing of introns from exons. This abnormal splicing causes subsequent translation to deviate from the frame, leading to premature termination of the encoded protein. Often, such shorter proteins are rapidly degraded and lack any functional activity as described herein. The exact mutation does not need to be a target for RNA editing; a nearby or adjacent adenosine nucleotide of the splice mutation may be the target nucleotide, and conversion to I may correct the splice mutation back to normal. Those skilled in the art are familiar with methods for determining whether normal splicing is restored after RNA editing of adenosine within the site or region of a splice mutation.

[0053] The AON according to the present invention can be chemically modified almost entirely of the nucleoside by, for example, supplying a 2'-O-methylated sugar moiety (2'-OMe) and / or a 2'-O-methoxyethyl sugar moiety (2'-MOE) to the nucleoside. However, the orphan nucleotide is preferably devoid of 2'-OMe modification, and in a more preferred embodiment, at least one adjacent nucleotide, and in a preferred embodiment, both of the two adjacent nucleotides flanking each nucleotide opposite the target adenosine, are further devoid of 2'-OMe modification. Complete modification in which all nucleotides of the AON have 2'-OMe modification results in a non-functional oligonucleotide insofar as RNA editing (as known in the art) is performed, presumably because it interferes with ADAR activity at the targeted site. Generally, adenosine in target RNA can be protected from editing by generating a nucleotide opposite it at a 2'-OMe group, or by generating guanine or adenine as the opposing base, and these two nucleic acid bases can also reduce the editing of the opposing adenosine. Various chemical properties and modifications are known in the field of oligonucleotides that can be readily used according to the present invention. The normal nucleoside bond between nucleotides can be modified by mono- or dithioateation of the phosphodiester bond to obtain a phosphorothioate ester or phosphorodithioate ester, respectively. Other modifications of the nucleoside bond, including amidation and peptide linkers, are also possible. MP bonds can be formed using known chemical properties.

[0054] It is known in the art that RNA editing substances (e.g., human ADAR enzymes) edit dsRNA structures by altering their specificity depending on several factors. One important factor is the degree of double-strand complementarity that results in the dsRNA sequence. Perfect double-strand complementarity usually results in a catalytic domain of the hADAR that deaminates adenosine in a non-characteristic way and reacts with any adenosine it encounters. The specificity of hADAR1 and 2 can be enhanced by introducing chemical modifications and / or ensuring some mismatches in the dsRNA, which may help position the dsRNA-binding domain in ways that are not yet clearly defined. Alternatively, the deamination reaction itself can be enhanced by generating an AON containing a mismatch opposite the adenosine being edited. The mismatch is preferably created by generating a targeting moiety having a cytidine opposite the adenosine being edited. Alternatively, uridine can be used opposite adenosine, but naturally, no "mismatch" occurs due to the U-A pairing. Deamination of adenosine in the target chain yields inosine, which is "read" as G by the cell's biochemical mechanisms for the most biochemical processes. Thus, after the A-to-I conversion, the mismatch is resolved because I can perfectly base-pair with the opposing C in the targeted portion of the oligonucleotide construct according to the present invention. After the mismatch is resolved by editing, the substrate is released, releasing the oligonucleotide construct-edited substance complex from the target RNA sequence, which is then available for downstream biochemical processes such as splicing and translation. The on / off ratio is also important because the targeted oligonucleotide should not bind too tightly to the target RNA. The desired level of specificity for editing the target RNA sequence may depend on the target. Following the instructions in this patent application, a person skilled in the art could design complementary parts of an oligonucleotide as needed and, with some trial and error, obtain the desired results.

[0055] RNA editing molecules present in cells are typically naturally occurring proteinaceous, such as ADAR enzymes found in metazoans, including mammals. Preferably, the cellular editing substance is an enzyme, more preferably an adenosine deaminase or cytidine deaminase, and even more preferably an adenosine deaminase. These are enzymes that possess ADAR activity. Of particular interest are human ADAR, hADAR1, and hADAR2, including any of its isoforms. RNA editing enzymes known in the art include RNA-acting adenosine deaminases (ADARs), as well as cytidine deaminases, such as hADAR1 and hADAR2 in human or human cells, for which oligonucleotide constructs according to the present invention can be appropriately designed. hADAR1 is known to exist in two isoforms, a longer 150 kDa inducible interferon and a shorter 100 kDa form, and is produced by alternative splicing from normal premRNA. As a result, the level of 150 kDa isoforms available in cells may be affected by interferons, particularly interferon-γ (IFN-γ). hADAR1 is also induced by TNF-α. This presents an opportunity to develop combination therapies in which IFN-γ or TNF-α and the AON according to the present invention are administered to the patient simultaneously or sequentially, either as a combined product or as separate products, in any order. Certain disease conditions may already coincide with high levels of IFN-γ or TNF-α in certain tissues of the patient, creating further opportunities for more specific editing of diseased tissues. It will be understood by those skilled in the art that the degree to which the editing substance is reoriented to other target sites within the cell can be modulated by altering the affinity of the AON according to the present invention to the recognition domain of the editing molecule. The precise modification can be determined through some trial and error, as well as by computational methods based on the structural interaction between the AON and the recognition domain of the editing molecule. In addition, the degree to which AON recruits and reorients editing substances present in cells can be adjusted by the administration and regimen of AON. This is usually determined by the (in vitro) experimenter or clinician in clinical trials.

[0056] This invention relates to the modification of target RNA sequences in eukaryotic cells, preferably metazoan cells, more preferably mammalian cells, and most preferably human cells. The invention can be used with cells derived from any organ, such as skin, lungs, heart, kidneys, liver, pancreas, intestines, muscle, glands, eyes, brain, blood, etc. The invention is particularly suited to modifying the sequences of cells, tissues, or organs involved in a disease state of (human) subject. Cells can be located in vitro, ex vivo, or in vivo. One advantage of the invention is that it can be used with cells in a living organism, but also with cells under culture. In some embodiments, cells are treated ex vivo and then introduced into a living organism (e.g., reintroduced into the organism of their origin). The invention can also be used to edit target RNA sequences in cells within so-called organoids. Organoids are considered three-dimensional in vitro derived tissues, but are driven using specific conditions to produce individual isolated tissues. In a therapeutic setting, organoids are useful because they can be derived from the patient's cells in vitro, and can be reintroduced to the patient as autologous material that is less likely to be rejected than conventional transplants. The cells being treated generally have gene mutations. Mutations can be heterozygous or homozygous. The present invention is typically used to modify point mutations such as N-to-A mutations (where N can be G, C, or U (T at the DNA level)), preferably G-to-A mutations, or N-to-C mutations (where N can be A, G, or U (T at the DNA level)), preferably U-to-C mutations.

[0057] While we do not wish to restrict theories, it is believed that RNA editing by hADAR1 and hADAR2 occurs in the nucleus during transcription or splicing, or in the cytoplasmic primary transcript where, for example, mature mRNA, miRNA, or ncRNA can be edited. Different isoforms of editing enzymes are known to be differentially localized; for example, the 100kDa isoform of hADAR1 is more common in the nucleus, while the 150kDa isoform of hADAR1 is more common in the cytoplasm. RNA editing by cytidine deaminase is thought to occur at the mRNA level.

[0058] Many genetic disorders are caused by a G-to-A mutation, and adenosine deamination at the mutated target adenosine, particularly when PTC is involved, reverses the mutation to the codon at which the functional full-length and / or wild-type protein is generated; therefore, these are preferred target diseases. Preferred examples of genetic disorders that can be prevented and / or treated with oligonucleotides according to the present invention are any disease in which one or more modifications of adenosine at the target RNA result in a (potentially) beneficial change. Particularly preferred are Usher syndrome, Stargardt disease, and cystic fibrosis.

[0059] It should be clear that the targeted editing according to the present invention can be applied to any adenosine (or cytosine), whether it is mutated or wild-type nucleotide or not. For example, editing can be used to create RNA sequences with different properties. Such properties may be coding properties (resulting in proteins with different sequences or lengths that give rise to the properties or functions of the modified protein) or binding properties (causing inhibition or overexpression of the RNA itself or its target or binding partner; the entire expression pathway can be modified by recording a miRNA or its homologous sequence on the target RNA). Protein function or localization can be altered by functional domains or recognition motifs, and are not limited to, signal sequences, targeting or localization signals, recognition sites for proteolytic cleavage or translation-related or post-translational modifications, enzyme catalytic sites, binding sites for binding partners, signals for degradation or activation, etc. These and other forms of RNA, as well as protein "engineering," are encompassed by the present invention in medical or bioengineering as diagnostic, preventive, therapeutic, or investigative tools, etc., whether or not they intend to prevent, delay, or treat disease, or for any other purpose.

[0060] The amount, dosage, and administration regimen of AON administered may vary depending on the cell type, the disease being treated, the target population, the mode of administration (e.g., systemic vs. topical), the severity of the disease, and the acceptable level of side effects. These can and should be evaluated through trial and error during in vitro studies, preclinical studies, and clinical trials. The test is particularly straightforward if phenotypic changes occur that are readily detectable by the modified sequence. Higher doses of AON may compete for binding to nucleic acid editing substances (e.g., ADAR) within the cell, thereby depleting the amount of non-RNA editing substance, but any such effects on a given AON and a given target are revealed by standard administration tests.

[0061] One suitable testing technique involves delivering AON to a cell line or test organism, and then taking biopsy samples at various points in time thereafter. The target RNA sequence can be evaluated in the biopsy samples, and the percentage of cells with modification can then be easily determined. Once this test is performed, the information can be retained thereafter, and future deliveries can be made without the need to take biopsy samples. Therefore, the method of the present invention may include a step of identifying the presence of a desired change in the target RNA sequence of cells, thereby verifying that the target RNA sequence is modified. This step typically involves sequencing the relevant portion of the target RNA, or its cDNA copy (or, if the target RNA is premRNA, a cDNA copy of its splicing product), as described above, so that the sequence change can be easily verified. Alternatively, the change can be evaluated at the protein level (length, glycosylation, function, etc.), or by some functional readout, such as (induced) current, if the protein encoded by the target RNA sequence is, for example, an ion channel.

[0062] After RNA editing occurs within a cell, the modified RNA can be diluted over time by, for example, cell division or the limitation of the half-life of the edited RNA. Therefore, in terms of practical therapeutic applications, the method of the present invention may involve repeated delivery of AON until sufficient target RNA has been modified to provide a visible benefit to the patient and / or maintain that benefit over time.

[0063] Since the AON of the present invention is particularly suitable for therapeutic use, the present invention provides a pharmaceutical composition comprising the AON of the present invention and a pharmaceutically acceptable carrier. In some embodiments of the present invention, the pharmaceutically acceptable carrier may be simply a saline solution. This may be usefully isotonic or hypertonic, particularly for intrapulmonary delivery. The present invention also provides a delivery device (e.g., syringe, inhaler, nebulizer) comprising the pharmaceutical composition of the present invention.

[0064] The present invention also provides AONs for use in methods for altering target RNA sequences in mammals, preferably human cells, as described herein. Similarly, the present invention provides AONs for use in the manufacture of pharmaceuticals for altering target RNA sequences in mammals, preferably human cells, as described herein.

[0065] The present invention also relates to a method for deamination of at least one specific target adenosine present in a target RNA sequence within a cell, comprising the steps of: supplying the AON according to the present invention to a cell; enabling the uptake of the AON by the cell; enabling the annealing of the AON to a target RNA molecule; enabling a mammalian ADAR enzyme containing a native dsRNA-binding domain found in the wild-type enzyme to deaminate the target adenosine in the target RNA molecule to inosine; and optionally, identifying the presence of inosine in the RNA sequence.

[0066] In a preferred embodiment, depending on the maximum deamination effect of conversion from A to I, the identification steps include sequencing the target RNA, assessing the presence of a functional, elongated, full-length, and / or wild-type protein, assessing whether the splicing of the premRNA has been altered by deamination, or using functional readout to determine whether the deaminated target RNA encodes a functional, full-length, elongated, and / or wild-type protein. Since deamination of adenosine to inosine can result in a protein that is no longer plagued by mutated A at the target site, the identification of deamination to inosine may also include functional readout, e.g., assessment of the presence of a functional protein, or further, assessment of whether the disease caused by the presence of adenosine is (partially) reversed. Functional assessments for each of the diseases described herein generally follow methods known to those skilled in the art. Very suitable methods for identifying the presence of inosine after deamination of target adenosine are, of course, RT-PCR and sequencing, using methods well known to those skilled in the art.

[0067] The AON according to the present invention is appropriately administered in aqueous solution, for example, physiological saline, or in suspension, optionally containing additives, excipients, and other components suitable for pharmaceutically acceptable use, at a concentration in the range of 1 ng / ml to 1 g / ml, preferably 10 ng / ml to 500 mg / ml, more preferably 100 ng / ml to 100 mg / ml. The dosage may appropriately be in the range of about 1 μg / kg to about 100 mg / kg, preferably about 10 μg / kg to about 10 mg / kg, more preferably about 100 μg / kg to about 1 mg / kg. Administration may be by inhalation (e.g., by nebulizer), intranasal, oral, injection or infusion, intravenous, subcutaneous, intradermal, intracranial, intravitreous, intramuscular, intratracheal, intraperitoneal, rectal, etc. Administration may be in solid form, powder, pill, gel, eye drops, or any other form suitable for pharmaceutically acceptable use in humans. [Examples]

[0068] [Example 1] Design of split antisense oligonucleotides for editing from A to I. The inventors of this invention recognized that a single 38nt-long RNA-editing antisense oligonucleotide (AON) could present problems not only in terms of the efficiency of RNA editing in vivo but also in terms of manufacturing. It was considered unclear how efficiently such a relatively “large” AON could enter cells in vivo without the use of transfection agents. In particular, no solution to this was mentioned in the present state of the art, and therefore the inventors investigated the use of two short AONs, one corresponding to the 5' portion of a longer AON and the other to the longer 3' portion of this longer AON. The AON corresponding to the 5' portion is a “helper AON,” and the AON corresponding to the 3' portion is considered an “editing AON” because it contains an “orphan nucleotide” that opposes adenosine, the target of editing in the target RNA molecule. As a model, (pre)mRNA encoding mouse amyloid precursor protein (mAPP) was selected as the target. Figure 1A shows the sequence of the target mAPP mRNA, as well as the sequences of three 38-nucleotide AONs, designated mAPPEx17-39, -62, and -67, all of which have different chemical modifications and serve as positive controls (Figure 1B). It was initially found that mAPPex17-62 could induce editing of adenosine (bold and underlined in Figure 1A) in the target sequence at exon 17 of mAPP wild-type (pre)mRNA (data not shown). As mentioned above, a length of 38 nucleotides is very common for most RNA-edited AONs used in the field of RNA editing. The inventors decided to divide the AON sequence into two separate parts by first symmetrically dividing the 38nt AON sequence by generating four different sets of AONs, each AON being 19nt long, and then by asymmetrically dividing the 38nt AON sequence, and by dividing the 38nt AON sequence into two parts, leaving a gap of 1, 2, or 3 nucleotides between the shorter AONs, as follows. Symmetry partitioning: mAPPEx17-135A(19nt) and mAPPEx17-135B(19nt) mAPPEx17-139A(19nt) and mAPPEx17-139B(19nt) mAPPEx17-140A(19nt) and mAPPEx17-140B(19nt) mAPPEx17-141A(19nt) and mAPPEx17-141B(19nt) Asymmetric partitioning: mAPPEx17-144A (17nt) and mAPPEx17-144B (21nt) mAPPEx17-145A (17nt) and mAPPEx17-145B (21nt) Gap division: mAPPEx17-136A (18nt) and mAPPEx17-136B (19nt) - 1nt gap mAPPEx17-137A(18nt) and mAPPEx17-139B(18nt) - 2nt gap mAPPEx17-138A (17nt) and mAPPEx17-138B (18nt) - 3nt gap

[0069] AONs labeled "A" are also referred to as "helper AONs," and AONs labeled "B" are also referred to as "edited AONs." The AONs had various chemical modifications along with the single 38nt AON used as a positive control in each experiment. The AONs had various RNA / DNA, PS-binding, 2'-OMe, and / or 2'-MOE modifications (see Figure 1B for details). All AONs had the 2' position of the sugar moiety completely modified with either 2'-O-methyl or 2'-O-methoxyethyl, except for the nucleotide opposite the A to be edited (orphan nucleotide) and two surrounding nucleotides (one on the 5' side and one on the 3' side) (these three nucleotides were DNA) (see Figure 1B). The number of PS-bindings varied, as can be seen in Figure 1B. It should be recognized that other asymmetric splits other than 17 / 21 are also possible (A / B: 18 / 20, 20 / 18, 21 / 17).

[0070] [Example 2] Use of a split AON set for editing A to I in in vitro biochemical assays. The editing potency of all sets referenced above was measured by in vitro biochemical editing assays and compared to a positive control 38nt AON with similar chemical modifications.

[0071] To obtain mAPP target RNA, an mAPP G block (IDT) containing the T7 promoter sequence and (part of) the mAPP sequence was used as a template, and PCR was performed using the forward primer 5'-CTCGACGCAAGCCATAACAC-3' (SEQ ID NO: 10) and the reverse primer 5'-TGGACCGACTGGAAACGTAG-3' (SEQ ID NO: 11). The PCR product was then used as a template for in vitro transcription. A MEGAscript T7 transcription kit was used for this reaction. The RNA was purified on a urea gel, then extracted with 50 mM Tris-Cl pH 7.4, 10 mM EDTA, 0.1% SDS, and 0.3 M NaCl buffer, and purified with phenol-chloroform. The purified RNA was used as a target for a biochemical editing assay.

[0072] All single AONs and sets of symmetric / asymmetric / gapded AONs were annealed to mAPP target RNA in a 1:3 ratio of target RNA to AON (200 nM target RNA and 600 nM AON) in buffer (5 mM Tris-Cl pH 7.4, 0.5 mM EDTA, and 10 mM NaCl). The samples were heated at 95°C for 3 minutes and then slowly cooled to room temperature. The editing reaction was then performed. Double-stranded nucleic acid complexes were mixed with protease inhibitors (cOmplete®, Mini, EDTA-free protease I, Sigma-Aldrich), RNase inhibitors (RNasin, Promega), poly(A) (Qiagen), tRNA (Invitrogen), and editing reaction buffer (15 mM Tris-Cl, pH 7.4, 1.5 mM EDTA, 3% glycerol, 60 mM KCl, 0.003% NP-40, 3 mM MgCl2, and 0.5 mM DTT) to achieve final concentrations of 6 nM AON and 2 nM target RNA. The reaction was initiated by adding purified ADAR2 (GenScript) to the mixture to a final concentration of 6 nM. Incubation was continued at 37°C for predetermined times (0 seconds, 30 seconds, 1 minute, 2 minutes, 5 minutes, 10 minutes, 25 minutes, and 50 minutes). Each reaction was stopped by adding 95 μl of boiling 3 mM EDTA solution.

[0073] Next, a 6 μl aliquot of the stopped reaction mixture was used as a template for cDNA synthesis using a Maxima reverse transcriptase kit (Thermo Fisher) along with random hexamer primers (Thermo Fisher Scientific). Initial RNA denaturation was performed at 95°C for 5 minutes in the presence of primers and dNTPs, followed by gentle cooling to 10°C. First strand synthesis was then performed in a total volume of 20 μl using an extension temperature of 62°C, according to the manufacturer's instructions.

[0074] The product was amplified for pyrosequencing analysis by PCR with 1 μl of cDNA as a template using the Amplitaq Gold 360 DNA polymerase kit (Applied Biosystems) according to the manufacturer's instructions. The following primers were used at a concentration of 10 μM: pyrosequence forward mAPP, 5'-AACTGGTGTTCTTTGCTGAAGAT-3' (SEQ ID NO: 12), and pyrosequence reverse mAPP biotin, 5'-5BiosG / CATGATGGATGGATGTGTACTGT-3' (SEQ ID NO: 13). The latter primer also contains a conjugated biotin at its 5' end as needed for automated processing during the pyrosequencing reaction. PCR was performed using the following thermal cycling protocol: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 30 seconds at 95°C, 30 seconds at 58°C, and 30 seconds at 72°C, as well as final extension at 72°C for 7 minutes.

[0075] The nucleotide incorporated into the edited position during PCR, as a base pair of inosine with cytidine during cDNA synthesis in the reverse transcription reaction, is guanosine. The percentage of guanosine (edited) versus adenosine (unedited) was defined by pyrosequencing. Pyrosequencing of the PCR product and the following data analysis were performed using a PyroMark Q48 Autoprep instrument (QIAGEN) according to the manufacturer's instructions, with a 10 μl input of the PCR product and 4 μM of the following sequencing primer: mAPP sequence, 5'-TCGGACTCATGGTGG-3' (SEQ ID NO: 14). The setting, specifically defined for this target RNA strand, included two sets of sequence information. The first set defined the sequence for the instrument to analyze, and in the case of purines, the possibility of a position containing either adenosine or guanosine is indicated by "R": GCGGCGTTGTCATRGCAACCGTGATTGTCATCACCCTGGTGATGTTGAAGAAGAA (SEQ ID NO: 15). The distribution order was defined for this analysis as follows: TGCGCGTGTCACTAGCACGTGATGTCATCAC (Sequence ID 16). The instrumental analysis shows the results for selected nucleotides as the percentage of adenosine and guanosine detected at that position; therefore, the extension from A to I at the selected position is measured by the percentage of guanosine at that position.

[0076] In the first experiment, a single 38nt AON mAPPEx17_62 was compared to two sets: i) a symmetric set containing mAPPEx17_139A and -B, and ii) an asymmetric set containing mAPPEx17_144A and -B. Figure 2 shows the results of this experiment. Surprisingly, it was found that the combination of the two short AONs could be applied to proper RNA editing, and the asymmetric set performed better than the positive control AON. The symmetric set of AONs also yielded significant RNA editing, although at a slightly slower rate than the long AON and the asymmetric set.

[0077] In the second experiment, a single 38nt AON mAPPEx17_67 was compared with three sets: i) a symmetric set containing mAPPEx17_140A and -B, ii) an asymmetric set containing mAPPEx17_141A and -B, and iii) an asymmetric set containing mAPPEx17_145A and -B. Figure 3 shows the results of this experiment. All three sets could be applied to proper RNA editing, and good results were obtained with all sets, but the asymmetric sets were found to function better than the two symmetric sets. The higher editing efficacy of the asymmetric split AON may be due to the (preferred) positioning of the split based on structural data of the ADAR2 / RNA complex (not shown) and the RBD2 region of ADAR2. To the best of our knowledge, the inventors of this invention are the first to demonstrate that RNA editing can be achieved using two oligonucleotides with relatively short lengths of 16–22nt. As will be obvious to those skilled in the art, “asymmetry” in this context means that the length of the split AON is based on the original length of the control AON, which is 38 nucleotides. If its base sequence is, for example, 34 nucleotides (4 nucleotides are cleaved from the 3' end of the long-chain AON), then the lengths of the two split AONs will be equal (17 nt each) and will be considered “symmetrical.” The same is true for a positive control AON that is, for example, 36 nucleotides long. Naturally, if the positive control is, for example, 37 nt or 35 nt long, the split will always be “asymmetrical.” Thus, the terms “symmetry” and “asymmetry,” as used herein, are merely based on the various splits of the original positive control AON, and therefore these terms are applied to some extent arbitrarily.

[0078] [Example 3] Use of a set of split AONs and a single short-chain edited AON for A-to-I editing in in vitro biochemical assays. Next, under the same experimental setup as described above, we investigated whether RNA editing was possible using only a single short-chain edited AON (type "B" of the split AON) without applying a helper AON (type "A" of the split AON). For this purpose, a single 38nt AON mAPPEx17_67 was compared with two sets of AONs and two single short-chain edited AONs, as follows: i) a symmetric set containing mAPPEx17_139A and -B, ii) a single edited AON mAPPEx17_139B, iii) an asymmetric set containing mAPPEx17_144A and -B, and iv) a single edited AON mAPPEx17_144B. Figure 4 shows the results of this experiment. Surprisingly, it was found that the use of a single mAPPEx17_144B AON (21nt) resulted in significant RNA editing, nearly reaching the levels obtained when the same AON was used with its helper AON and when a positive control was used. This demonstrates that the inventors were able to achieve RNA editing using a short AON of 21 nucleotides, which is highly noteworthy considering what has been understood in this field until now. In this experiment, this single short AON achieved an even higher level of RNA editing than when mAPP139A and -B were used together as a set. The editing AON mAPPEx17_144B was further enhanced in potency when used in combination with its helper AON mAPPEx17_144A.

[0079] Further experiments compared a single 38nt mAPPEx17_67 with two sets of AONs and two other single short-chain edited AONs, as follows: i) a symmetric set containing mAPPEx17_141A and -B, ii) a single edited AON mAPPEx17_141B, iii) an asymmetric set containing mAPPEx17_145A and -B, and iv) a single edited AON mAPPEx17_145B. Figure 5 shows the results of this experiment. The symmetric set of mAPPEx17_141A and -B did not work well, but the single short-chain mAPPEx17_145B worked better (though not very effectively), and this was further enhanced by the addition of the helper AON mAPPEx17_145A. In this case as well, the asymmetric set (generated in terms of positive control) was shown to work better than the symmetric set of AONs.

[0080] These experiments demonstrate that using asymmetrically split AONs and 21nt-edited AONs alone yields satisfactory RNA editing results. However, the variability observed between different single AONs, compared to the presence of long-chain positive controls and helper AONs, is likely due to the precise length, the initiation of the AON at the 5' and / or 3' positions, and the chemical modifications present in each of these single AONs. Further optimization is needed to provide the best combination of chemical modifications (e.g., PS binding position, 2'-OMe and 2'-MOE modification positions, the possibility of introducing other or additional (2') modifications at certain positions, the number and / or position of DNA nucleotides). The length and chemical modifications must be adjusted according to the specific (pre)mRNA being targeted, and therefore cannot rule out the possibility of dependence on the specific sequence of the target RNA. In any case, the inventors of this invention were the first to demonstrate, to the best of their knowledge, that RNA editing can be achieved using short oligonucleotides of 19–21 nucleotides in length.

[0081] [Example 4] The use of a set of split AONs and a single short-chain edited AON to perform A-to-I editing in cells by mobilizing endogenous ADARs. Next, we investigated whether split AONs (both in combination and individually as edited AONs) could edit wild-type endogenous mAPP RNA in cells. For this purpose, we used mouse retinal pigment epithelial (RPE) cells carrying the wild-type APP gene. Briefly, 24 hours before transfection, 2.5 × 10⁶ cells were used per 6-well plate. 5 Nine cells were seeded. Transfection was performed with 100 nM AON and Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions (1:2 ratio, 1 μg AON vs. 2 μl Lipofectamine 2000). Untransfected (NT), mock transfection, and scrambled oligonucleotides (scr-mAPP-3, see Figure 1B) were used together as negative controls. RNA was extracted from cells 48 hours after transfection using the Direct-zol RNA MiniPrep (Zymo Research) kit according to the manufacturer's instructions, and cDNA was prepared using the Maxima reverse transcriptase kit (Thermo Fisher) according to the manufacturer's instructions, with a combination of random hexamer and oligo dT primers. The cDNA was diluted 5-fold, and 1 μL of this dilution was used as a template for digital droplet PCR (ddPCR). A ddPCR assay for absolute quantification of nucleic acid target sequences was performed using the BioRad QX-200 Droplet Digital PCR system. Diluted cDNA obtained from the RT cDNA synthesis reaction was used in a 21 μl total mixture of reaction concoctions containing ddPCR Supermix (Bio Rad) for probes that did not contain dUTP. Taqman SNP genotyping assays were then performed using the following forward and reverse primers, combined with the following gene-specific probes: Forward primer: 5'-CAACATCACCAGGGTGATGAC-3' (SEQ ID NO: 17) Reverse primer: 5'-CATCATCGGACTCATGGTGG-3' (SEQ ID NO: 18) Wild-type probe (HEX NFQ labeled): 5'- / 5HEX / CGT T+GT CAT+A+G+C AAC CGT / 3IABkFQ / -3' (SEQ ID NO: 19) Mutant probe (FAM NFQ labeled): 5'- / 56-FAM / CGT TGT CAT+G+G+C AAC CG / 3IABkFQ / -3' (SEQ ID NO: 20)

[0082] A total volume of 21 μl of PCR mix containing cDNA was packed into the middle column of a ddPCR cartridge (BioRad) using a multichannel pipette. The replication was split into two cartridges. The bottom column was packed with 70 μl of droplet-generating oil (BioRad) for the probe. After replacing the rubber gasket, droplets were generated using a QX200 droplet generator. 42 μl of the oily emulsion from the top column of the cartridge was transferred to a 96-well PCR plate. The PCR plate was sealed with tin foil at 170°C for 4 minutes using a PX1 plate sealer, and then the following PCR program was performed: 1 cycle of enzyme activation at 95°C for 10 minutes, 40 cycles of denaturation at 95°C and annealing / extension at 55.8°C for 1 minute, and 1 cycle of enzyme inactivation at 98°C for 10 minutes followed by storage at 8°C. After PCR, the plate was read out with a QX200 droplet reader and analyzed.

[0083] The results shown in Figure 6 demonstrate that all edited AONs, used alone or in combination with their corresponding helper AONs, were capable of editing mAPP target RNA in mouse RPE cells and recruiting endogenous ADARs within these cells. mAPPex17-140A+B, mAPPex17-141A+B, and mAPPex17-145A+B showed very similar RNA editing levels, although lower in potency compared to target RNA editing by the 38nt-length AONs mAPPex17-62 and mAPPex17-67, but higher than the mAPPex17-139A+B and mAPPex17-144A+B sets. Note that this experiment used transfection reagents and differs from what occurs in vivo or in vitro without transfection reagents (gymnotic uptake). In transfection, oligonucleotide length is not particularly important, but in the absence of transfection reagents, it is known that longer oligonucleotides are less likely to enter cells. Figure 6 also reveals that single edited AONs mAPPEx17_139B, -140B, -141B, -144B, and -145B all resulted in RNA editing. This indicates that even such short RNA-edited oligonucleotides can recruit endogenous ADARs and result in RNA editing of endogenous targets. This was a surprising observation.

[0084] [Example 5] Use of split and gapped AON sets for A-to-I editing in in vitro biochemical assays. Next, the inventors investigated whether it was necessary for the split AONs to be complementary to a continuous sequence in the target RNA in order to produce RNA editing, or whether proper editing could be obtained even with small gaps of 1, 2, or 3 nucleotides between the split AONs. To this end, the same biochemical assays considered in Examples 2 and 3 were applied. A single 38nt mAPPEx17_39 was compared to three sets of split (gapded) AONs and one symmetry set of two continuous AONs, each 19nt long, as follows: i) a symmetry set containing mAPPEx17_135A and -B, ii) a 1nt gap set containing mAPPEx17_136A and -B, iii) a 2nt gap set containing mAPPEx17_137A and -B, and iv) a 3nt gap set containing mAPPEx17_138A and -B. For specific chemical modifications of these AONs, see Figure 1B. Figure 7 shows the results of this experiment. All sets demonstrated the ability to produce RNA editing. This indicates that a gap is acceptable between two AONs in a set of oligonucleotides. However, it was also observed that the efficacy of RNA editing decreased when a gap was present. This suggests that it is preferable for the two split AONs to have sequences that provide complete 100% complementarity to a continuous sequence of nucleotides in the target sequence. Interestingly, the mAPPEx17_135A+B combination showed a level and rate of RNA editing comparable to that observed with the positive control mAPPEx17_39. This also indicates that deamination of target adenosine to inosine in the target (pre)mRNA molecule can be achieved using two separate oligonucleotides ranging from 17 to 21 nucleotides. The invention described in this specification may encompass the following embodiments. [1] A composition comprising a set of two single-stranded antisense oligonucleotides (AONs) for use in the deamination of a target adenosine in a target RNA, wherein one AON is an "edited AON" and the other AON is a "helper AON," the edited AON being complementary to a sequence of nucleotides in the target RNA containing the target adenosine, the nucleotide in the edited AON directly opposite the target adenosine being an "orphan nucleotide" which is cytidine unmodified with 2'-OMe or 2'-MOE, the helper AON being complementary to a sequence of nucleotides in the target RNA other than the sequence of nucleotides complementary to the edited AON, the helper AON having a length of 16 to 22 nucleotides, and the edited AON having a length of 16 to 22 nucleotides. [2] The composition according to [1], wherein the helper AON and edited AON form a continuous double-stranded complex with the target RNA, the helper AON is complementary to a sequence of nucleotides in the target RNA located at the 3' end of the sequence of nucleotides in the target RNA that is complementary to the edited AON, and there are no nucleotide gaps between the sequence complementary to the helper AON and the edited AON. [3] The composition according to [1] or [2] above, wherein the helper AON is 100% complementary to the target RNA. [4] The composition according to any one of [1] to [3] above, wherein the edited AON is completely complementary to the target RNA, except for a mismatch with cytidine opposite the target adenosine. [5] The composition according to any one of [1] to [4], wherein the set is configured to form a double-stranded complex with the target RNA, and then recruit an endogenous ADAR enzyme to bring about the deamination of the target adenosine to inosine. [6] The composition according to any one of [1] to [5] above, wherein the edited AON comprises one or more phosphorothioate (PS) bonds. [7] The composition according to any one of [1] to [6] above, wherein the edited AON comprises at least one nucleotide having a sugar moiety including a 2'-OMe modification, and / or at least one nucleotide having a sugar moiety including a 2'-MOE modification. [8] The composition according to any one of [1] to [7] above, wherein the orphan nucleotide has a 2'-H in the sugar portion (DNA). [9] The composition according to [8] above, wherein the 5' nucleotide and / or 3' nucleotide of the orphan nucleotide is DNA.

[10] The composition according to any one of the above [1] to [9], wherein the edited AON comprises at least one phosphonoacetate nucleoside bond, at least one methylphosphonate nucleoside bond, and / or at least one nucleotide comprising an unlocked nucleic acid (UNA) ribose modification.

[11] The composition according to any one of the above [1] to

[10] , wherein the edited AON is 19, 20, or 21 nucleotides long, the orphan nucleotide is the 6th, 7th, or 8th nucleotide from the 5' end, and the helper AON is 17, 18, or 19 nucleotides long.

[12] The composition according to any one of the above [1] to

[11] , further comprising a pharmaceutically acceptable carrier.

[13] Cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, Albinism, Amyotrophic lateral sclerosis, Asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth disease, Chronic obstructive pulmonary disease (COPD), Distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, Epidermolysis bullosa (dysphagia), Fabry disease, Factor V Leiden-associated disorder, Familial adenomatous polyposis, Galactosemia, Gaucher disease, Glucose-6-phosphate dehydrogenase, Hemophilia, Hereditary hemochromatosis, Hunter syndrome, Huntington's disease, Inflammatory bowel disease (IBD), Hereditary polyaggregation syndrome, Leber congenital amaurosis (e.g., LCA10), Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome, Mucopolysaccharidosis, Muscular dystrophy, Type I A composition according to any one of the above [1] to

[12] for use in the therapy of, preferably for treatment or prevention of, genetic disorders preferably selected from the group consisting of myotonic dystrophy type II, neurofibromatosis, Niemann-Pick disease types A, B and C, NY-eso1-associated cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disorders, prothrombin mutation-related disorders (e.g., prothrombin G20210A mutation), pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome (e.g., Usher syndrome types I, II and III), X-linked immunodeficiency, Sturge-Weber syndrome, and cancer.

[14] A method for deamination of at least one target adenosine in intracellular target RNA, (i) The step of supplying the cells with a set of AONs including helper AONs and edited AONs as defined in any one of the above [1] to

[11] , (ii) A step of enabling the annealing of the AON to the target RNA to form a double-stranded nucleic acid molecule, (iii) a step that enables an ADAR enzyme endogenously present in the cell to form a complex with the double-stranded nucleic acid molecule, thereby enabling the deamination of the target adenosine in the target RNA to inosine, and (iv) Optionally, the step of identifying the presence of deaminated nucleotides in the target RNA. A method that includes this.

[15] Step (iv) is, a) Sequencing the region of the target RNA that includes the location of the target adenosine, b) If the target adenosine is present in the UGA or UAG stop codon and edited to the UGG codon by deamination, evaluate the presence of functional, elongated, full-length and / or wild-type protein. c) If the target RNA is a premRNA, evaluate whether the splicing of the premRNA has been modified by deamination, or d) Using functional readout such that the deaminated target RNA encodes a functional, full-length, elongated, and / or wild-type protein. The method described in

[14] above, including the method described in

[14] above.

[16] A method for deamination of at least one target adenosine present in a target RNA, (i) A step of supplying two sets of AONs characterized by any one of the above [1] to

[11] , (ii) A step of enabling the annealing of the AON to the target RNA to form a double-stranded nucleic acid molecule, (iii) A step in which the ADAR enzyme forms a complex with the double-stranded nucleic acid molecule, enabling the deamination of the target adenosine in the target RNA to inosine, and (iv) A method comprising the step of identifying the presence of deaminated adenosine in the target RNA.

Claims

1. A composition comprising a set of two single-stranded antisense oligonucleotides (AONs) for use in the deamination of target adenosine in target RNA, One AON is "Edit AON," and the other AON is "Helper AON." The helper AON and edited AON form a continuous double-stranded complex with the target RNA, and there are 0 to 3 nucleotide gaps between the sequences complementary to the helper AON and the edited AON. The edited AON is complementary to a sequence of nucleotides in the target RNA containing the target adenosine. The nucleotide in the edited AON directly opposite the target adenosine is an "orphan nucleotide" which is cytidine not modified with 2'-OMe or 2'-MOE, and the orphan nucleotide has a 2'-H in its sugar portion (DNA), and the 5' and 3' nucleotides of the orphan nucleotide are DNA. The helper AON is 100% complementary to a sequence of nucleotides in the target RNA that is different from the sequence of nucleotides complementary to the edited AON, and the helper AON is complementary to a sequence of nucleotides in the target RNA located 3' to the sequence of nucleotides in the target RNA that is complementary to the edited AON. The aforementioned edited AON is completely complementary to the target RNA, except for the mismatch with cytidine opposite the target adenosine. The helper AON has a length of 17 to 19 nucleotides, the edited AON has a length of 18 to 21 nucleotides, and the orphan nucleotide is the 6th, 7th, or 8th nucleotide from the 5' end. The set is configured to form a double-stranded complex with the target RNA, and then recruit an endogenous ADAR enzyme to bring about the deamination of the target adenosine to inosine. The edited AON comprises one or more phosphorothioate (PS) bonds, and the edited AON comprises at least one nucleotide having a sugar moiety including a 2'-OMe modification, and / or at least one nucleotide having a sugar moiety including a 2'-MOE modification.

2. The composition according to claim 1, wherein the edited AON comprises at least one nucleotide comprising at least one phosphonoacetate nucleoside bond, at least one methylphosphonate nucleoside bond, and / or an unlocked nucleic acid (UNA) ribose modification.

3. The composition according to claim 1 or 2, further comprising a pharmaceutically acceptable carrier.

4. The composition according to any one of claims 1 to 3 for use in therapy.

5. Cystic fibrosis, Hurler syndrome, α-1-antitrypsin (A1AT) deficiency, Parkinson's disease, Alzheimer's disease, albinism, amyotrophic lateral sclerosis, asthma, β-thalassemia, CADASIL, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, epidermolysis bullosa (dystrophic type), Fabry disease, factor V Leiden-associated disorder, familial adenomatous polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington's disease, inflammatory bowel disease (IBD), hereditary polyaggregation syndrome, Leber congenital amaurosis, Lesch-Nyhan syndrome, Lynch syndrome, Marfan syndrome A composition according to any one of claims 1 to 3, for use in the treatment or prevention of a genetic disorder selected from the group consisting of syndromes, mucopolysaccharidosis, muscular dystrophy, type I and type II myotonic dystrophy, neurofibromatosis, Niemann-Pick disease types A, B and C, NY-eso1 related cancer, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary disorders, prothrombin mutation-related disorders, prothrombin G20210A mutation, pulmonary hypertension, (autosomal dominant) retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-Sachs disease, Usher syndrome, X-linked immunodeficiency, Sturgey-Weber syndrome, and cancer.

6. An in vitro or ex vivo method for deamination of at least one target adenosine in intracellular target RNA, (i) A step of supplying the cells with a set of AONs including a helper AON and an edit AON as defined in any one of claims 1 to 3. (ii) A step of enabling the annealing of the AON to the target RNA to form a double-stranded nucleic acid molecule, (iii) A step that enables the ADAR enzyme endogenously present in the cell to form a complex with the double-stranded nucleic acid molecule, thereby enabling the deamination of the target adenosine in the target RNA to inosine, and (iv) Optionally, a step of identifying the presence of the deaminated nucleotide in the target RNA. In vitro or ex vivo methods, including those mentioned above.

7. Step (iv) is a) A step of sequencing the region of the target RNA that includes the location of the target adenosine, b) If the target adenosine is present in a UGA or UAG stop codon and edited to a UGG codon by deamination, a step of evaluating the presence of a functional, elongated, full-length and / or wild-type protein. c) If the target RNA is a premRNA, a step of evaluating whether the splicing of the premRNA has been modified by deamination, or d) A step using functional readout, wherein the deamination of the target RNA encodes a functional, full-length, elongated, and / or wild-type protein. The in vitro or ex vivo method according to claim 6, including the method described in claim 6.

8. An in vitro or ex vivo method for deamination of at least one target adenosine present in target RNA, (i) A step of supplying two sets of AONs characterized by any one of claims 1 to 3, (ii) A step of enabling the annealing of the AON to the target RNA to form a double-stranded nucleic acid molecule, (iii) A step in which the ADAR enzyme forms a complex with the double-stranded nucleic acid molecule, enabling the deamination of the target adenosine in the target RNA to inosine, and (iv) A step of identifying the presence of deaminated adenosine in the target RNA. In vitro or ex vivo methods, including those mentioned above.

Images