Sugar-linked polynucleotide

Abstract

The present invention addresses the problem of providing a technique for effectively exerting the activity of a polynucleotide in the brain. The problem is solved by a compound represented by general formula (1) [In the formula, Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide. Lk represents a divalent group that is a linker. Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide.], or a salt thereof, or solvates thereof.

Description

sugar-linked polynucleotides

[0001] The present invention relates to compound-linked polynucleotides and the like.

[0002] Nucleic acid medicines, which aim to control the expression of genes that cause disease and thereby achieve treatment or prevention, have attracted considerable attention in recent years. Nucleic acid medicines are classified into various types based on their mechanism of action and the structure of the nucleic acids that serve as their active ingredients. Many of them are characterized by their ability to control the expression of target genes in a sequence-specific manner. Therefore, it is expected that this will lead to new treatments for many intractable diseases for which no effective treatments have been found.

[0003] Because the brain has a blood-brain barrier, nucleic acid drugs generally cannot pass through it. Therefore, there is a need for a technology that allows nucleic acid drugs to effectively exert their activity in the brain. Patent Document 1 reports a technology in which drugs such as nucleic acids are encapsulated in micelles modified with glucose and aspartic acid and transported within brain cells. However, when used as a pharmaceutical, a great deal of effort is required to control the quality of the drug, including particle size distribution, micelle morphology, surface charge, membrane thermodynamic properties, and active ingredient encapsulation rate.

[0004] International Publication No. 2017 / 002979

[0005] An objective of the present invention is to provide a technique for effectively exerting the activity of polynucleotides in the brain.

[0006]

[0006] In view of the above problems, the present inventors have conducted extensive research and found that by linking a monosaccharide to a polynucleotide via a linker, the activity of the polynucleotide can be effectively exerted in the brain. Based on this finding, the present inventors have conducted further research and completed the present invention. That is, the present invention encompasses the following aspects.

[0007] Item 1. General formula (1):

[0008]

[0009] [wherein Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide, Lk represents a divalent group that is a linker, and Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide], or a salt thereof, or a solvate thereof.

[0010] Item 2. The compound or salt thereof, or a solvate of the compound or salt according to Item 1, wherein the monosaccharide is a ligand for glucose transporter 1.

[0011] Item 3. The compound or salt thereof, or a solvate of the compound or salt according to Item 1 or 2, wherein the monosaccharide is a hexose.

[0012] Item 4. The compound or salt thereof, or a solvate of the compound or salt according to Item 3, wherein Ms is a monovalent group formed by removing a hydrogen atom from the hydroxy group at the 4- or 6-position of the monosaccharide.

[0013] Item 5. The compound or salt thereof, or a solvate of the compound or salt according to any one of Items 1 to 4, wherein the linker is a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom and / or a linking structure.

[0014] Item 6. The compound or salt thereof, or a solvate of the compound or salt according to Item 5, wherein the linking structure includes a linking structure containing a triazole ring and / or a linking structure containing an amide bond.

[0015] Item 7. The compound or salt thereof, or a solvate of the compound or salt according to any one of Items 1 to 6, wherein Lk has 6 or more atoms constituting the main chain.

[0016] Item 8. The compound or salt thereof, or solvate of the compound or salt according to any one of Items 1 to 7, wherein Pn is a monovalent group formed by removing one atom or group from the terminal nucleotide of the polynucleotide.

[0017] Item 9. The compound or salt thereof, or a solvate of the compound or salt according to any one of Items 1 to 8, wherein Pn is a monovalent group formed by removing one hydrogen atom from the phosphate group of the terminal nucleotide of the polynucleotide.

[0018] Item 10. The compound or salt thereof, or a solvate of the compound or salt according to any one of Items 1 to 9, wherein the polynucleotide is an antisense polynucleotide, siRNA, miRNA, miRNA precursor, aptamer, guide RNA, mRNA, DNA (antigene nucleic acid), or a DNA / RNA heteroduplex.

[0019] Item 11. A medicine containing the compound or salt thereof according to any one of items 1 to 10, or a solvate of the compound or salt.

[0020] Item 12. The pharmaceutical agent according to Item 11, which is for delivery to the brain.

[0021] Item 13. A reagent containing the compound according to any one of items 1 to 10, or a salt thereof, or a solvate thereof.

[0022] According to the present invention, a technique for effectively exerting the activity of a polynucleotide in the brain can be provided, specifically, a glycoconjugated polynucleotide having a specific structure can be provided.

[0023] Figure 6 shows the results of measuring Malat1 expression levels in the brain in Example 6. The vertical axis shows the relative value of Malat1 expression levels. The horizontal axis shows the administered sample. ** indicates that the p-value against saline is less than 0.01 when a Tukey test is performed. ‡ indicates that the p-value against naked ASO is less than 0.01 when a Tukey test is performed. Figure 7 shows the results of measuring Malat1 expression levels in the brain in Example 7. The vertical axis shows the relative value of Malat1 expression levels. The horizontal axis shows the administered sample. The values ​​on the horizontal axis indicate the amount of ASO administered (unit: μg). * indicates that the p-value against naked ASO is less than 0.05 when a Tukey test is performed. Figure 8 shows the results of measuring Malat1 expression levels in the brain in Example 8. The vertical axis shows the relative value of Malat1 expression levels. The horizontal axis shows the administered sample. ** indicates that the p-value against saline is less than 0.01 when a Tukey test is performed. The graph shows the results of measuring Malat1 expression levels in the brain in Example 10. The vertical axis indicates the relative value of Malat1 expression levels. The horizontal axis indicates the administered sample. * and ** indicate that the p-values ​​against saline are less than 0.05 and less than 0.01, respectively, when a Tukey test is performed. ‡ indicates that the p-value against naked ASO2 is less than 0.01 when a Tukey test is performed. The graph shows the results of measuring Malat1 expression levels in each tissue (horizontal axis) in Example 11. The vertical axis indicates the relative value of Malat1 expression levels. The conjugate ASO administered is shown in the upper part of the graph. The graph shows the results of measuring Malat1 expression levels in the brain in Example 12. The vertical axis indicates the relative value of Malat1 expression levels. The horizontal axis indicates the administered sample. ** indicates that the p-value against saline is less than 0.01 when a Tukey test is performed. # indicates that the p-value against naked ASO2 is less than 0.05 when a Tukey test is performed. 1 shows the measurement results of Malat1 expression levels in the brain in Example X. The vertical axis shows the relative value of Malat1 expression levels, and the horizontal axis shows the administered sample.

[0024] In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0025] 1. Glycoconjugated Polynucleotides In one aspect, the present invention provides a glycoconjugated polynucleotide having the general formula (1):

[0026]

[0027] (Herein, this invention relates to a compound represented by the formula (hereinafter, this invention may be referred to as "glycoconjugated polynucleotide of the present invention"), or a salt thereof, or a solvate thereof (hereinafter, this invention may be referred to as "active ingredient of the present invention"). This will be explained below.

[0028] In general formula (1), Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide.

[0029] Preferably, the monosaccharide is a ligand for glucose transporter 1. The glucose transporter 1 gene in humans is, for example, the gene (SLC2A1 gene) with NCBI Gene ID: 6513, and those in other animals are either publicly known or can be easily identified based on sequence identity analysis with known animal genes. Therefore, the amino acid sequence and coding sequence of glucose transporter 1 can be easily obtained from publicly known information.

[0030] The term "ligand for glucose transporter 1" refers to a molecule that binds to glucose transporter 1 expressed on the cell membrane and is transported into the cell via glucose transporter 1, and is not particularly limited thereto. Whether or not a substance is a ligand can be determined based on publicly known information or according to publicly known methods (for example, in accordance with the information or methods described in Reference 1: Life Sci Alliance. 2021 Feb 3;4(4):e202000858. doi: 10.26508 / lsa.202000858. Print 2021 Apr., Reference 2: J Dairy Sci. 2012 Mar;95(3):1188-97. doi: 10.3168 / jds.2011-4430., Reference 3: Biochemistry. 1992 Oct 27;31(42):10414-20. doi: 10.1021 / bi00157a032.).

[0031] From the viewpoint of function as a ligand for glucose transporter 1, the monosaccharide is particularly preferably a hexose. Examples of hexoses include glucose, mannose, galactose, N-acetylglucosamine, fructose, allose, talose, gulose, altrose, idose, psicose, sorbose, and tagatose. These may be in either the D- or I-form, with the D-form being particularly preferred. Some of the hydroxyl groups may be reduced and replaced with hydrogen atoms, or some of the hydroxyl groups may be protected with known protecting groups (e.g., alkyl groups) or substituted with functional groups such as sulfate groups or halogen atoms. Examples of such derivatives include 2-deoxyglucose, 3-O-alkylglucose (e.g., 3-O-methylglucose), 1-O-alkylglucose (e.g., 1-O-nonylglucose), and 1-deoxy-1-fluoroglucose. Among these, from the viewpoint of function as a ligand for glucose transporter 1, glucose, mannose, galactose, and glucosamine are preferred, with glucose being particularly preferred.

[0032] In Ms, the atom removed from the monosaccharide is typically a hydrogen atom in a hydroxy group. Furthermore, an example of a group removed from the monosaccharide is a hydroxy group. Ms is preferably a monovalent group obtained by removing a hydrogen atom from a hydroxy group of a monosaccharide. When the monosaccharide is a hexose, Ms is preferably a monovalent group obtained by removing a hydrogen atom from a hydroxy group at the 2-, 3-, 4-, or 6-position of the monosaccharide, and particularly preferably a monovalent group obtained by removing a hydrogen atom from a hydroxy group at the 4- or 6-position of the monosaccharide.

[0033] In a more specific embodiment, Ms is preferably represented by general formula (M1) or general formula (M2):

[0034]

[0035] [In the formula: R m1 , R m2 and R m3are the same or different and represent a hydroxy group, an optionally substituted alkoxy group, a halogen atom, or a hydrogen atom.], and particularly preferably a monovalent group represented by general formula (M1).

[0036] The alkoxy group includes both linear and branched groups. The alkoxy group is preferably linear. The number of carbon atoms in the alkoxy group is not particularly limited and is, for example, 1 to 15, preferably 1 to 12, more preferably 1 to 10, even more preferably 1 to 6, and particularly preferably 1 to 4. Specific examples of the alkoxy group include a methoxy group, an ethoxy group, an n-propoxy group, an isopropoxy group, an n-butoxy group, an isobutoxy group, a sec-butoxy group, a tert-butoxy group, a pentoxy group, a hexoxy group, an octoxy group, and a nonoxy group. The alkoxy group may be substituted with a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom.

[0037] The halogen atom is not particularly limited and examples thereof include a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, etc. Among these, a fluorine atom is particularly preferred.

[0038] R m1 , R m2 and R m3 Among R, at least one is preferably a hydroxy group, and more preferably at least two are hydroxy groups. m1 , R m2 and R m3 are particularly preferably all hydroxy groups.

[0039] In a more specific embodiment, the general formula (M1) or the general formula (M2) is preferably the general formula (M1a) or the general formula (M2a):

[0040]

[0041] [In general formula (M1) and general formula (M2): R m1 , R m2 and R m3 is the same as above.]

[0042] In general formula (1), Lk represents a divalent group that is a linker.

[0043] The linker is not particularly limited as long as it is interposed between Ms and Pn and has a structure that allows for flexible operation. The linker may consist of only a chain structure, or may contain a chain structure and a ring structure. The chain structure may be linear or branched. When the chain structure is branched, monosaccharides may be linked to the branched chain, and in this case, two or more monosaccharides are linked to the glycoconjugated polynucleotide of the present invention. In this case, general formula (1) can be, for example, general formula (1A):

[0044]

[0045] It can be. Lk a and L.K. b are defined as LK, and p is, for example, 2 to 10, 2 to 5, 2 to 4, 2 to 3, or 3.

[0046] More specifically, the linker is preferably a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom and / or a linking structure. When at least one carbon atom constituting the main chain is replaced with a heteroatom and / or a linking structure, the number of replaced carbon atoms is, for example, 1 to 5, preferably 1 to 3, and more preferably 1 to 2.

[0047] The hydrocarbon chain is preferably an alkylene group. The alkylene group may be either linear or branched, but is preferably linear. The number of carbon atoms constituting the main chain of the alkylene group (the chain connecting Ms and Pn) is preferably 6 or more, from the viewpoint of the activity of the polynucleotide in the brain. The number of carbon atoms is more preferably 6 to 40, even more preferably 8 to 30, and even more preferably 10 to 20.

[0048] Examples of heteroatoms include oxygen atoms, sulfur atoms, and nitrogen atoms. When at least one carbon atom constituting the main chain of an alkylene group is replaced with an oxygen atom, specifically, —CH2— in the main chain of the alkylene group is replaced with, for example, —O—. When at least one carbon atom constituting the main chain of an alkylene group is replaced with a sulfur atom, specifically, —CH2— in the main chain of the alkylene group is replaced with, for example, —S—, —S(═O)2—, —S(═O)—. When at least one carbon atom constituting the main chain of an alkylene group is replaced with a nitrogen atom, specifically, —CH2— in the main chain of the alkylene group is replaced with, for example, —NR— (R is a hydrogen atom or a hydrocarbon group (preferably an alkyl group, more preferably an alkyl group having 1 to 8 carbon atoms)).

[0049] The linking structure is not particularly limited as long as it is a divalent group that is a bond structure formed by the reaction of two identical or different reactive groups. Examples of the reactive group include an amino group, a carboxy group, a hydroxy group, a ketone group, an ethynyl group, a vinyl group, an azide group, an epoxy group, an aldehyde group, an oxylamino group, a thiol group, an isocyanate group, and an isothiocyanate group.

[0050] Examples of reactions between reactive groups are as follows: Amino groups are known to react with carboxy groups (or groups formed by esterifying carboxy groups with N-hydroxysuccinimide (NHS)) to form amide bonds. Ethynyl groups are known to undergo 1,3-dipolar cycloaddition with azide groups to form 1,2,3-triazole rings. Cyclooctyne is known to undergo 1,3-dipolar cycloaddition with azide groups to form 1,2,3-triazole rings. Amino groups are known to react with carboxy groups to form amide bonds. Carboxy groups are known to react with hydroxy groups to form ester bonds. Carboxy groups are known to react with thiol groups to form thioester bonds. Phosphate groups are known to react with hydroxy groups to form phosphodiester bonds. Vinyl groups are known to react with thiol groups to form bonds. Epoxy groups are known to react with amino and thiol groups to form bonds. Aldehyde groups react with amino groups to form Schiff bases, which can be reduced to form bonds. The oxylamino group reacts with a ketone group or an aldehyde group to form an oxime.

[0051] In one embodiment of the present invention, the linking structure may comprise at least one linking structure selected from the group consisting of a linking structure containing a triazole ring, a linking structure containing an amide bond, a linking structure containing a (3-thio)succinimide, a disulfide bond, a phosphodiester bond, and an intracellularly cleavable peptide linking bond. In one embodiment of the present invention, the linking structure may comprise a linking structure containing a triazole ring and / or a linking structure containing an amide bond. More specifically, the linking structure containing a triazole ring may be, for example, a 1,2,3-triazole ring, or a fused ring (e.g., bicyclic or tricyclic) of a 1,2,3-triazole ring with another ring (e.g., a 3- to 8-membered ring). More specifically, the fused ring may be, for example, a ring represented by the formula (Cy):

[0052]

[0053] The linking structure containing an amide bond can be, for example, an amide bond (—CO—NR—) or —O—CO—NR— (wherein R is the same as above).

[0054] In a more specific embodiment, Lk is preferably represented by the general formula (L1):

[0055]

[0056] [In the formula: R l1 and R l2 are the same or different and represent a single bond or a linking structure. l3 and R l5 R may be the same or different and represent a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. l4 represents a single bond or a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. *1 is the site connecting to Ms, and *2 is the site connecting to Pn.] is a divalent group represented by the formula:

[0057] The hydrocarbon chain, in which at least one carbon atom constituting the main chain may be replaced with a heteroatom, may contain a biodegradable structure, such as a peptide structure containing a peptidase recognition / cleavage sequence (e.g., Val-Ala), or a disulfide bond.

[0058] In one embodiment of the present invention, R l1 is a linking structure containing a triazole ring, and R l2 is a linking structure containing an amide bond. In another embodiment of the present invention, R l1 and R l4 is a single bond, and R l2 is a linking structure containing an amide bond.

[0059] In a preferred embodiment of the present invention, R l3 and R l5 The number of atoms constituting the main chain of R is 3 to 10, more preferably 4 to 8, and particularly preferably 5 to 7. In a preferred embodiment of the present invention, R l3 and R l5is a hydrocarbon chain, more preferably an alkylene group, and particularly preferably a linear alkylene group. In these preferred embodiments, the activity of the polynucleotide in the brain can be significantly exerted.

[0060] In general formula (1), Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide.

[0061] Polynucleotides are not particularly limited and may be DNA, RNA, or other known chemically modified, as exemplified below. To prevent degradation by hydrolases such as nucleases, the phosphate residues of each nucleotide may be substituted with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, and phosphorodithioate. The hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, such as by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, etc. Also preferably used are BNA (LNA), in which the conformation of the sugar moiety is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety of the nucleotide.

[0062] Nucleic acid bases constituting polynucleotides include not only typical bases in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases such as hypoxanthine (I) and modified bases. Modified bases include, for example, pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, and the like. Examples include xanthine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, and xanthine.

[0063] The polynucleotide may be linked to another molecule or modified with a radioisotope. Examples of other molecules include fluorescent labels. Examples of fluorescent labels include fluorescein, rhodamine, Texas Red, tetramethylrhodamine, carboxyrhodamine, phycoerythrin, 6-FAM™, Cy®3, Cy®5, and the Alexa Fluor® series. The position of the linkage / modification is not particularly limited and can be, for example, the end of the polynucleotide.

[0064] The polynucleotide can be a single-stranded polynucleotide or a double-stranded polynucleotide.

[0065] The polynucleotide is, for example, an 8-50 base polynucleotide consisting of a sequence capable of binding to a target sequence in a target gene. The length of the polynucleotide is, for example, 8 bases or more, 9 bases or more, 10 bases or more, 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, or 15 bases or more, and is 500 bases or less, 200 bases or less, 100 bases or less, 50 bases or less, 40 bases or less, 30 bases or less, 25 bases or less, or 20 bases or less.

[0066] In the present invention, when the polynucleotide is a double-stranded polynucleotide, the second strand is a polynucleotide consisting of a sequence capable of binding to a first strand polynucleotide consisting of a sequence capable of binding to a target sequence in a target gene. This second strand is, for example, 8 to 500 bases, 8 or more bases, 9 or more bases, 10 or more bases, 11 or more bases, 12 or more bases, 13 or more bases, 14 or more bases, or 15 or more bases in length, and is 500 or less bases, 200 or less bases, 100 or less bases, 60 or less bases, 50 or less bases, 40 or less bases, 30 or less bases, 25 or less bases, or 20 or less bases in length. The length of the second strand may be the same as that of the first strand, or it may be one or more bases shorter than the first strand, as long as it binds to the first strand, or it may be longer than the first strand by adding one or more bases to one or both sides of the binding site with the first strand. As used herein, "one or several bases" refers to 1 to 10, 1 to 5, 1 to 3, or 1 or 2 bases. The preferred length of the second strand depends on the length of the first strand. For example, the second strand may be 50% or more, 60% or more, 70% or more, 50 to 100%, 60 to 100%, or 70 to 100% of the length of the first strand.

[0067] The term "binding" of a polynucleotide to a target sequence refers to the ability of multiple different single-stranded polynucleotides or nucleic acids to form a double- or more-stranded nucleic acid due to the complementarity of the nucleic acid bases. Preferably, it refers to the ability to form a double-stranded nucleic acid. The melting temperature (Tm) of the double- or more-stranded nucleic acid, which is an indicator of the thermal stability of the binding, is not particularly limited.

[0068] The melting temperature (Tm) of a double-stranded nucleic acid can be determined, for example, as follows: Equimolar polynucleotides and target RNAs are mixed in a buffer solution (8.1 mM NaHPO, 2.68 mM KCl, 1.47 mM KHPO, and pH 7.2), heated at 95°C for 5 minutes, and then slowly cooled to room temperature to allow annealing and form double-stranded nucleic acids. The temperature of the double-stranded nucleic acid is heated from 20°C to 95°C at a heating rate of 0.5°C / min, and the change in absorbance (A) at 260 nm with temperature (T) is measured. A graph of dA / dT vs. T is created from the measurement results, and the temperature at which the value of dA / dT is maximized on this graph, i.e., the temperature at which the change in A with T is greatest, is defined as the Tm of the double-stranded nucleic acid.

[0069] The melting temperature (Tm) is, for example, 40°C or higher, preferably 50°C or higher.

[0070] As used herein, "complementary" refers to two different single-stranded polynucleotides or nucleic acids that are in a pairing relationship capable of forming a double-stranded nucleic acid. Preferably, the base sequences of the double-stranded regions are completely complementary, but one or several mismatches may be present, as long as the double-stranded nucleic acid can be formed and the desired function (e.g., expression suppression or regulation) can be exerted. "One or several mismatches" refers to one to four, preferably one to three, and more preferably one or two mismatches, depending on the length of the polynucleotide. The polynucleotide preferably has 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more complementarity to the base sequence of the double-stranded region. Alternatively, the polynucleotide may have complete (100%) complementarity.

[0071] The polynucleotide is preferably one primarily intended for use by introduction into cells, and examples of such polynucleotides include antisense polynucleotides, siRNAs, miRNAs, miRNA precursors, aptamers, guide RNAs, mRNAs, DNAs (antigene nucleic acids), and DNA / RNA heteroduplexes.

[0072] In Pn, the atom removed from the polynucleotide typically includes a hydrogen atom in a phosphate group or a hydroxy group, and in Pn, the group removed from the polynucleotide typically includes a phosphate group, a hydroxy group, etc.

[0073] Pn is preferably a monovalent group obtained by removing one atom or group from the terminal nucleotide of a polynucleotide, and particularly preferably a monovalent group obtained by removing one hydrogen atom from the phosphate group of the terminal nucleotide of a polynucleotide. The terminal may be either the 5'-end or the 3'-end, but the 5'-end is preferred from the viewpoint of the activity of the polynucleotide in the brain.

[0074] In a more specific embodiment, Pn is preferably represented by the general formula (P1):

[0075]

[0076] [In the formula: R p1 represents a monovalent group formed by removing a phosphate group from the terminal nucleotide of a polynucleotide.] R p1 is preferably a monovalent group formed by removing a phosphate group from the 5'-terminal nucleotide of a polynucleotide.

[0077] The salt of the glycosylated polynucleotide of the present invention is not particularly limited, and examples thereof include metal salts such as alkali metal salts such as sodium salt, potassium salt, and lithium salt, alkaline earth metal salts such as calcium salt and magnesium salt, aluminum salt, iron salt, zinc salt, copper salt, nickel salt, and cobalt salt; inorganic salts such as ammonium salt, t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl -amine salts such as organic salts such as phenethylamine salts, piperazine salts, tetramethylammonium salts, and tris(hydroxymethyl)aminomethane salts; inorganic acid salts such as hydrohalogen salts such as hydrofluoride, hydrochloride, hydrobromide, and hydroiodide, nitrate, perchlorate, sulfate, and phosphate; organic acid salts such as lower alkanesulfonates such as methanesulfonate, trifluoromethanesulfonate, and ethanesulfonate, arylsulfonates such as benzenesulfonate and p-toluenesulfonate, acetate, malate, fumarate, succinate, citrate, tartrate, oxalate, and maleate; and amino acid salts such as glycine salt, lysine salt, arginine salt, ornithine salt, glutamate, and aspartate.

[0078] The solvates of the glycoconjugated polynucleotide or salts thereof of the present invention are not particularly limited, and examples thereof include solvates with solvents such as water, ethanol, glycerol, and acetic acid.

[0079] The glycoconjugated polynucleotides of the present invention can be synthesized by various methods. For example, the glycoconjugated polynucleotides of the present invention can be synthesized according to the following scheme.

[0080]

[0081] [Wherein: Ms, Lk, and Pn are the same as above. 1 and Lk 2are the same or different and represent a divalent group that is a linker. 1 and Y 2 are the same or different and represent a reactive group.

[0082] Lk 1 or Lk 2 The above description of the linker is used to explain the linker represented by Y 1 or Y 2 The reactive group represented by the formula (I) can be explained by the above explanation of the reactive group.

[0083] The compound represented by the general formula (a) and the compound represented by the general formula (b) may be commercially available or may be synthesized according to a known method.

[0084] The reaction conditions can be set according to the type of reactive group and in accordance with publicly known information. For example, the reaction conditions in Examples 1 and 4 described below can be referenced.

[0085] The progress of the reaction can be monitored by conventional methods such as chromatography. After the reaction is complete, the solvent is removed by distillation, and the product can be isolated and purified by conventional methods such as chromatography and recrystallization. The structure of the product can also be determined by MALDI-TOF-MS, elemental analysis, MS (ESI-MS), IR analysis, and the like. 1 H-NMR, 13 It can be identified by C-NMR or the like.

[0086] 2. Uses The glycoconjugated polynucleotide of the present invention, or a salt thereof, or a solvate thereof (the active ingredient of the present invention) can effectively exert its polynucleotide activity in the brain even when used alone without forming a complex with other substances. The activity of the polynucleotide refers to the physiological activity of the polynucleotide, specifically, for example, the activity of inhibiting the expression of a target gene, the activity of inhibiting the function of a target nucleic acid (e.g., miRNA, mRNA, or their precursors, etc.) (e.g., inhibiting the expression of a target gene), the activity of inhibiting the function of a target molecule (e.g., a target molecule of an aptamer), etc.

[0087] The active ingredient of the present invention can be used for various purposes aimed at introduction into brain cells, such as for brain delivery (preferably for delivery into brain cells), medicines, reagents, etc. (hereinafter, these may be collectively referred to as "the agent of the present invention").

[0088] The agent of the present invention is not particularly limited as long as it contains the active ingredient of the present invention, and may further contain other ingredients as necessary. The other ingredients are not particularly limited as long as they are pharmaceutically acceptable ingredients, and examples thereof include excipients, binders, disintegrants, lubricants, colorants, flavorings, and, if necessary, stabilizers, emulsifiers, absorption enhancers, surfactants, pH adjusters, preservatives, antioxidants, bulking agents, wetting agents, surface activators, dispersants, buffers, preservatives, solubilizers, soothing agents, etc.

[0089] The mode of use of the agent of the present invention is not particularly limited, and an appropriate mode of use can be adopted depending on the type of agent. For example, the agent of the present invention can be used in vitro (e.g., added to a culture medium for cultured cells) or in vivo (e.g., administered to an animal).

[0090] The target of application of the agent of the present invention is not particularly limited, and examples thereof include various mammals such as humans, monkeys, mice, rats, dogs, cats, rabbits, etc.; animal cells, etc. The type of cell is also not particularly limited, and examples thereof include neurons such as cone cells, astrocytes, granule cells, retinal ganglion cells, and Purkinje cells; glial cells such as microglia, astrocytes, oligodendrocytes, ependymal cells, Schwann cells, and satellite cells; and the like.

[0091] When the agent of the present invention is administered to an animal, the administration route is not particularly limited as long as the desired effect is obtained, and it can be administered to mammals, including humans, by either oral administration or parenteral administration (e.g., intravenous injection, intramuscular injection, subcutaneous administration, rectal administration, transdermal administration, or topical administration). The preferred administration route is parenteral administration. Dosage forms for oral administration and parenteral administration and their preparation methods are well known to those skilled in the art, and can be prepared according to conventional methods by mixing the active ingredient with a pharmaceutically acceptable carrier, etc.

[0092] Dosage forms for parenteral administration include injectable preparations (e.g., drip infusions, intravenous injections, intramuscular injections, subcutaneous injections, and intradermal injections), topical preparations (e.g., ointments, poultices, lotions, creams, and gels), suppositories, inhalants, ophthalmic preparations, eye ointments, nasal drops, ear drops, and liposomes. For example, injectable preparations are prepared by dissolving the oligopeptide of the present invention in distilled water for injection, to which solubilizing agents, buffers, pH adjusters, isotonicity agents, soothing agents, preservatives, stabilizers, and the like can be added as needed. The pharmaceuticals of the present invention can also be made into lyophilized preparations for immediate preparation.

[0093] The agent of the present invention may further contain other drugs that are effective in treating or preventing diseases. The agent of the present invention may also contain ingredients such as bactericides, anti-inflammatory agents, cell activators, vitamins, and amino acids, as needed.

[0094] The content of the active ingredient of the present invention in the agent of the present invention depends on the mode of use, the subject to which it is applied, the condition of the subject to which it is applied, etc., and is not limited thereto, but can be, for example, 0.0001 to 95% by weight, preferably 0.001 to 50% by weight.

[0095] The dosage of the agent of the present invention when administered to an animal is not particularly limited as long as it is an effective amount that exerts a pharmacological effect, and is generally 0.1 to 1000 mg / kg body weight, preferably 0.5 to 50 mg / kg body weight per day in the case of oral administration, and 0.01 to 100 mg / kg body weight, preferably 0.1 to 10 mg / kg body weight per day in the case of parenteral administration. The above dosage is preferably administered once a day or in 2 to 3 divided doses, and can be increased or decreased as appropriate depending on the age, pathological condition, and symptoms.

[0096] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.

[0097] Reference Example 1. Synthesis of Compound 2

[0098]

[0099] To a solution of glycine ethyl ester hydrochloride (14.0 g, 100 mmol) in water (20 mL) was added dichloromethane (40 mL), and the mixture was stirred at −15 °C. To this stirred mixture was added an ice-cold solution of sodium nitrite (8.28 g, 120 mmol, 1.2 eq.) in water (40 mL), followed by an ice-cold solution of H2SO4 (270 μL, 5 mmol, 0.05 eq.) in water (9.32 mL) over 10 min. After stirring for an additional 1 h, the reaction was quenched by the addition of saturated aqueous sodium bicarbonate at the same temperature. The mixture was partitioned between dichloromethane and water, and the contents were extracted twice with dichloromethane from the aqueous layer. The combined organic layers were washed with saturated brine, dried over sodium sulfate, and evaporated to give the ethylglycine diazo derivative. 1,5-Cyclooctadiene (86.5 g, 800 mmol, 8 eq.) was dissolved in dichloromethane (100 mL) in a separate flask, and rhodium(II) acetate dimer (508 mg, 1.15 mmol, 0.0115 eq.) was added to the solution at room temperature. To this stirred solution, a solution of the ethylglycine diazo derivative (entire amount) in dichloromethane (30 mL) was slowly added over 2 h. The volatiles were evaporated, and the residue was purified by column chromatography (SiO2, hexane:EtOAc = 50:1) to give compound 2 (16.09 g, 82.8 mmol, 83%) as a colorless oil. The diastereomers were not separated from each other and were used directly in the next step. 1 H NMR (400 MHz, CDCl) δ 5.57–5.66 (m, 2H), 4.07–4.14 (m, 2H), 2.50 (tt, J = 11.6, 3.9 Hz, 1H), 2.25–2.34 (m, 1H), 2.16–2.24 (m, 2H), 2.01–2.12 (m, 2H), 1.78–1.87 (m, 1H), 1.36–1.59 (m, 3H), 1.26 (tt, J = 7.1, 2.6 Hz, 3H), 1.18 (t, J = 4.6 Hz, 1H). The NMR spectrum of this compound was consistent with that reported.

[0100] Reference Example 2. Synthesis of Compound 3

[0101]

[0102] To a stirred suspension of lithium aluminum hydride (3.14 g, 82.8 mmol, 1.0 eq.) in diethyl ether (200 mL) on an ice bath, a solution of compound 2 (16.1 g, 82.8 mmol) in diethyl ether (300 mL) was slowly added over 1 h. After adding water at the same temperature, the resulting mixture was passed through a Celite pad. The filtrate was evaporated to give the alcohol. To a stirred solution of the resulting alcohol in dichloromethane (70 mL), a solution of bromine (14.5 g, 91.08 mmol, 1.1 eq.) in dichloromethane (70 mL) was slowly added over 1 h. After adding saturated aqueous sodium bisulfite, the mixture was partitioned between dichloromethane and water at the same temperature, and the contents were extracted twice with dichloromethane. The organic layers were combined, washed with saturated sodium hydroxide, washed with NaCl, dried over sodium sulfate, and evaporated to give the dibromo derivative. To a stirred solution of the dibromo derivative in THF (500 mL) on an ice bath, t-BuOK (1 M in THF, 248 mL, 248 mmol, 3 eq) was added over 1 min and stirred under reflux for 2 h. After the mixture was cooled to room temperature, saturated aqueous ammonium chloride was added. The resulting mixture was partitioned between dichloromethane and water, and the contents were extracted twice with dichloromethane. The organic layers were combined, washed with saturated aqueous NaCl, dried over sodium sulfate, and evaporated. The resulting residue was purified by column chromatography (SiO2, hexane:EtOAc = 3:1) to give compound 3 (4.73 g, 31.46 mmol, 38% (3 steps)) as a yellow oil. Compound 3 was used in the next step without diastereomeric separation. 1H NMR (400 MHz, CDCl) δ 4.12 (q, J = 7.2 Hz, 1H), 3.73 (d, J = 7.8 Hz, 1H), 3.55 (t, J = 3.2 Hz, 2H), 2.13-2.44 (m, 10H), 2.05 (s, 1H), 1.30-1.66 (m, 6H), 1.24-1.28 (m, 1H), 0.88-0.99 (m, 1H), 0.64-0.74 (m, 3H). The NMR spectrum of this compound was consistent with that reported.

[0103] Reference Example 3. Synthesis of Compound 4

[0104]

[0105] To a stirred mixture of compound 3 (4.73 g, 31.5 mmol) and pyridine (6.34 mL, 78.7 mmol, 2.5 eq.) in dichloromethane (150 mL) on an ice bath, 4-nitrophenyl chloroformate (7.93 g, 39.3 mmol, 1.25 eq.) was added. After stirring for 30 min, saturated aqueous ammonium chloride was added. The mixture was partitioned between dichloromethane and water, and the organic layer was washed with 1 M hydrochloric acid, saturated aqueous sodium bicarbonate, and saturated brine, dried over sodium sulfate, and evaporated. The resulting residue was purified by column chromatography (SiO2, hexane:EtOAc = 15:1) to give compound 4 (7.14 g, 22.7 mmol, 72%) as a yellow oil. Compound 4 was used in the next step without separating the diastereomers. 1 H NMR (400 MHz, CDCl) δ 8.29 (d, J = 9.2 Hz, 3H), 7.38-7.41 (m, 3H), 4.41 (d, J = 8.2 Hz, 1H), 4.22 (d, J = 6.4 Hz, 2H), 2.17-2.47 (m, 11H), 1.24-1.62 (m, 6H), 1.02-1.11 (m, 1H), 0.80-0.90 (m, 3H). The NMR spectrum of the compound was consistent with that reported.

[0106] Reference Example 4. Synthesis of Compound 6

[0107]

[0108] 1,6-Dibromohexane (7.32 g, 30 mmol, 3 eq.) was dissolved in DMSO (60 mL) and stirred at room temperature. To this solution, a DMSO solution of sodium azide (0.65 g, 10 mmol, 1 eq., 20 mL) was added dropwise over 10 minutes. Ten minutes after the completion of the addition, the disappearance of the starting materials was confirmed by TLC. The mixture was concentrated under reduced pressure and purified by column chromatography (SiO2, hexane → tetrahydrofuran) to give compound 6 (2.01 g, 9.74 mmol, 97%) as a yellow oil. 1 H-NMR (400 MHz, CDCl3) δ 3.42 (t, J = 6.6 Hz, 2H), 3.28 (t, J = 6.9 Hz, 2H), 1.91-1.84 (m, 2H), 1.66-1.57 (m, 3H), 1.52-1.37 (m, 4H). The NMR spectrum of the compound was consistent with that reported.

[0109] Reference Example 5. Synthesis of Compound 8

[0110]

[0111] D-(+)-Glucose (1.8 g, 10 mmol, 1 eq.) and zinc chloride (2.04 g, 15 mmol, 1.5 eq.) were dissolved in acetone (40 mL), and concentrated sulfuric acid (108 μL, 13 mmol, 1.3 eq.) was slowly added and the mixture was stirred at room temperature. After 20 h, the disappearance of the starting material was confirmed by TLC. The mixture was neutralized with saturated aqueous sodium bicarbonate and filtered through Celite. The filtrate was partitioned between diethyl ether and water, and the organic layer was extracted three times and combined. The combined organic layer was dried over saturated brine and sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (SiO2, hexane:ethyl acetate = 2:1) to give compound 8 (2.14 g, 8.23 ​​mmol, 82%) as a white solid. The resulting white solid was recrystallized from a hot hexane-ethyl acetate mixed solvent (4:1) to give colorless fibrous crystals. 1H-NMR (400 MHz, CDCl3) δ 5.95 (d, J = 3.7 Hz, 1H), 4.54-4.52 (m, 1H), 4.39-4.30 (m, 2H), 4.20-4.15 (m, 1H), 4.07 (dd, J = 7.8, 2.7 Hz, 1H), 3.99 (q, J = 4.6 Hz, 1H), 2.59 (d, J = 3.7 Hz, 1H), 1.65 (s, 1H), 1.50 (s, 3H), 1.45 (s, 3H), 1.37 (s, 3H), 1.32 (s, 3H). 13 C-NMR (101 MHz, CDCl3) δ 111.9, 109.8, 105.4, 85.2, 81.3, 75.2, 73.5, 67.7, 27.0, 26.9, 26.3, 25.3, LRMS (ESI): m / z283 [M+Na] + . HRMS (ESI-TOF): Calcd for C 12 H 20 O6Na [M+Na] + : 283.1152, Found: 283.1176.

[0112] Reference example 6. Synthesis of Compound 9

[0113]

[0114] Under an argon atmosphere, compound 8 (520 mg, 2 mmol, 1 eq.) was dissolved in DMF (20 mL), and 60% sodium hydride in mineral oil (160 mg, 4 mmol, 2 eq.) was added and stirred at room temperature. After 10 min, tetrabutylammonium iodide (887 mg, 2.4 mmol, 1.2 eq.) and compound 6 (495 mg, 2.4 mmol, 1.2 eq.) were added. After 16 h, the disappearance of the starting material was confirmed by TLC, and water was added to quench the sodium hydride. The mixture was then separated with ethyl acetate and water, and the organic layer was extracted twice and mixed. The combined organic layer was dried over saturated brine and sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (SiO2, hexane:ethyl acetate = 10:1) to give compound 9 (503 mg, 1.31 mmol, 65%) as a white solid. 1 H-NMR (400 MHz, CDCl3) δ 5.87 (d, J = 3.7 Hz, 1H), 4.53-4.49 (m, 1H), 4.35-4.27 (m, 1H), 4.13-4.06 (m, 2H), 3.99 (dd, J = 8.7, 6.0 Hz, 1H), 3.85 (d, J = 3.2 Hz, 1H), 3.64-3.58 (m, 1H), 3.55-3.47 (m, 1H), 3.27 (t, J = 6.9 Hz, 2H), 1.61 (s, 2H), 1.60-1.55 (m, 3H), 1.50 (s, 3H), 1.43 (s, 3H), 1.41-1.37 (m, 4H), 1.35 (s, 3H), 1.32 (d, J = 4.6 Hz, 3H). 13 C-NMR (101 MHz, CDCl3) δ 111.9, 109.0, 105.4, 82.7, 82.2, 81.3, 72.6, 70.5, 67.4, 51.5, 29.7, 28.9, 27.0, 26.9, 26.6, 26.4, 25.8, 25.6., LRMS (ESI): m / z 408 [M+Na] + HRMS (ESI-TOF): Calcd for C 18 H31 N3O6Na [M+Na] + : 408.2105, Found: 408.2102.

[0115] Reference Example 7. Synthesis of Compound 10

[0116]

[0117] Compound 9 (308 mg, 0.8 mmol, 1 eq.) was added to 80% trifluoroacetic acid / water (8 mL) and stirred at room temperature. After 10 minutes, the disappearance of the starting materials was confirmed by TLC, and the mixture was concentrated under reduced pressure. The mixture was then purified by column chromatography (SiO2, ethyl acetate → chloroform:methanol = 10:1) to give compound 10 (154 mg, 0.50 mmol, 63%) as a white solid. 1 H-NMR (400 MHz, DMSO-D6) δ 6.63-6.58 (m, 1H), 6.28 (dd, J = 22.7, 4.8 Hz, 0H), 4.92-4.80 (m, 2H), 4.54-4.45 (m, 1H), 4.38-4.25 (m, 1H), 3.70-3.54 (m, 3H), 3.50-3.35 (m, 1H), 3.24 (q, J = 9.6 Hz, 2H), 3.17-3.05 (m, 2H), 2.99-2.91 (m, 1H), 1.54-1.48 (m, 4H), 1.37-1.31 (m, 4H). 13 C-NMR (101 MHz, DMSO-D6) δ 96.9, 85.2, 76.7, 74.6, 72.1, 71.8, 69.7, 61.1, 50.6, 29.8, 28.3, 26.1, 25.2, LRMS (ESI): m / z328 [M+Na] + HRMS (ESI-TOF): Calcd for C 12 H 23 N3O6Na [M+Na] + : 328.1479, Found: 328.1479.

[0118] Reference Example 8. Synthesis of Compound 13

[0119]

[0120] 6-Bromohexanoic acid (1.95 g, 10 mmol, 1 eq.) was dissolved in tetrahydrofuran (20 mL), and t-butyl alcohol (2.85 mL, 30 mmol, 3 eq.) and trifluoroacetic anhydride (4.16 mL, 30 mmol, 1 eq.) were added and stirred at room temperature. After 20 h, the loss of mass was confirmed by TLC, and the mixture was separated with ethyl acetate and water. The organic layer was dried over saturated brine and sodium sulfate and concentrated under reduced pressure to give compound 13 (2.48 g, 9.88 mmol, 99%) as a clear oil. 1 H-NMR (400 MHz, CDCl3) δ 3.40 (q, J = 7.0 Hz, 2H), 2.21 (t, J = 7.3 Hz, 2H), 1.89-1.81 (m, 2H), 1.63-1.55 (m, 2H), 1.48-1.44 (m, 2H), 1.41 (d, J = 7.3 Hz, 8H). The NMR spectrum of the compound was consistent with that reported.

[0121] Reference Example 9. Synthesis of Compound 14

[0122]

[0123] Under an argon atmosphere, compound 8 (260 mg, 1 mmol, 1 eq.) was dissolved in DMF (10 mL), and 60% sodium hydride / mineral oil (60 mg, 80 mmol, 2 eq.) was added. The mixture was stirred at room temperature. After 10 min, tetrabutylammonium iodide (369 mg, 1 mmol, 1 eq.) and compound 13 (251 mg, 1 mmol, 1 eq.) were added. After 24 h, the disappearance of the starting material was confirmed by TLC, and water was added to quench the sodium hydride. The mixture was then separated with ethyl acetate and water. The organic layer was dried over saturated brine and sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (SiO2, hexane:ethyl acetate = 20:1) to give compound 14 (242 mg, 0.56 mmol, 56%) as a white solid. 1H-NMR (400 MHz, CDCl3) δ 5.87 (d, J = 3.7 Hz, 1H), 4.57-4.52 (m, 1H), 4.34-4.29 (m, 1H), 4.15-4.06 (m, 2H), 3.98 (td, J = 7.1, 1.1 Hz, 1H), 3.89-3.84 (m, 1H), 3.63-3.47 (m, 2H), 2.21 (t, J = 7.1 Hz, 2H), 1.59 (td, J = 14.4, 7.0 Hz, 4H), 1.51 (d, J = 7.3 Hz, 3H), 1.44 (d, J = 0.9 Hz, 9H), 1.42 (s, 3H), 1.39-1.25 (m, 8H). 13 C-NMR (101 MHz, CDCl3) δ 173.2, 111.8, 109.0, 105.4, 82.7, 82.2, 81.3, 80.1, 72.6, 70.5, 67.4, 35.6, 29.5, 28.2, 27.0, 26.9, 26.4, 25.7, 25.5, 24.9, LRMS (ESI): m / z 453 [M+Na] + HRMS (ESI-TOF): Calcd for C 22 H 38 O8Na [M+Na] + : 453.2459, Found: 453.2455.

[0124] Reference Example 10. Synthesis of Compound 15

[0125]

[0126] Compound 14 (242 mg, 0.56 mmol, 1 eq.) was added to 80% trifluoroacetic acid / water (5 mL) and stirred at room temperature. After 10 minutes, the disappearance of the starting material was confirmed by TLC, and the mixture was concentrated under reduced pressure. The resulting mixture was then purified by column chromatography (SiO2, ethyl acetate → chloroform:methanol = 10:1) to give compound 15 (139 mg, 0.47 mmol, 85%) as a pale pink oil. 1H-NMR (400 MHz, CD3OD) δ 5.07 (s, 1H), 4.45 (d, J = 5.5 Hz, 1H), 3.85-3.75 (m, 3H), 3.69-3.61 (m, 1H), 3.51-3.39 (m, 2H), 3.18-3.11 (m, 1H), 2.35-2.28 (m, 2H), 1.63 (t, J = 7.1 Hz, 4H), 1.43 (q, J = 7.3 Hz, 2H). 13C-NMR (101 MHz, CD3OD) δ 177.8, 98.2, 94.1, 83.4, 78.0, 74.0, 73.0, 62.8, 34.9, 31.0, 26.7, 25.9, LRMS (ESI): m / z 317 [M+Na] + HRMS (ESI-TOF): Calcd for C 12 H 22 O8Na [M+Na] + : 317.1207, Found: 317.1204.

[0127] Reference Example 11. Synthesis of Compound 16

[0128]

[0129] Compound 15 (139 mg, 0.47 mmol, 1 eq.) was dissolved in dimethylformamide (5 mL), and NHS (218 mg, 1.89 mmol, 4 eq.) and EDC·HCl (109 mg, 0.57 mmol, 1.2 eq.) were added and stirred at room temperature. After 3 h, the disappearance of the starting materials was confirmed by TLC. After concentration under reduced pressure, the mixture was purified by column chromatography (SiO2, ethyl acetate → chloroform:methanol = 20:1) to give compound 16 (101 mg, 0.26 mmol, 54%) as a pale pink oil. 1H-NMR (400 MHz, DMSO-D6) δ 6.62 (d, J = 6.9 Hz, 1H), 6.31 (d, J = 4.6 Hz, 1H), 4.89-4.81 (m, 2H), 4.53-4.48 (m, 1H), 4.39-4.26 (m, 1H), 4.10 (q, J = 5.3 Hz, 1H), 3.67-3.50 (m, 4H), 3.47-3.38 (m, 1H), 3.25 (t, J = 9.2 Hz, 1H), 3.17 (q, J = 2.6 Hz, 1H), 3.13-3.09 (m, 1H), 2.99-2.91 (m, 1H), 2.67-2.64 (m, 2H), 1.57 (dq, J = 41.6, 7.1 Hz, 4H), 1.41-1.36 (m, 2H). 13 C-NMR (101 MHz, CD3OD) δ 171.9, 170.3, 98.2, 94.1, 86.4, 83.5, 78.0, 76.2, 73.9, 73.8, 71.5, 62.8, 62.7, 31.5, 30.8, 26.5, 26.3, 25.5, LRMS (ESI): m / z 414 [M+Na] + , HRMS (ESI-TOF): Calcd for C 16 H 25 NO 10 Na [M+Na] + : 414.1371, Found: 414.1355.

[0130] Reference Example 12. Synthesis of Compound 17

[0131]

[0132] Compound 17 (14.7 mg, 0.039 mmol, 82%) was obtained as a colorless oil by synthesis according to Reference Examples 4 to 7, using an appropriate compound instead of Compound 5.

[0133] Reference Example 13: Synthesis of Compound 18

[0134]

[0135] Compound 18 (18.9 mg, 0.048 mmol, quant.) was obtained as a colorless oil by synthesis according to Reference Examples 4 to 7, using appropriate compounds instead of Compound 5 and Compound 7.

[0136] Reference Example 14. Synthesis of Compound 19

[0137]

[0138] Antisense oligonucleotides (ASOs (naked ASOs)) against the mouse Malat1 gene (NR_002847.3) were synthesized by Yamasa Shoyu Co., Ltd. The ASO sequence is as follows: 5(L)^T(L)^A(L)^g^t^t^c^a^c^t^g^a^a^T(L)^G(L)^5(L) (SEQ ID NO: 1) [Lower Case = DNA / N(L) = LNA / 5(L) = LNA_5mC / ^ = Phosphorothioated / N(6) = amino C6 linker]

[0139] Compound 19 is a compound in which an amino-C6 linker is attached to the phosphate group at the 5' end of ASO. Compound 19 was synthesized by Yamasa Shoyu Co., Ltd.

[0140] Reference Example 15. Synthesis of Compound 20

[0141]

[0142] Compound 20 is a compound in which an amino-C6 linker is attached to the phosphate group at the 3' end of ASO. Compound 20 was synthesized by Yamasa Shoyu Co., Ltd.

[0143] Example 1. Synthesis of Compound A

[0144]

[0145] Compound A was synthesized as follows. A 10 mM aqueous solution of compound 19 (100 μL, 1 mmol) was mixed with a 100 mM DMSO solution of compound 4 (short-BCN-PNP) (100 μL, 10 eq.) and DIPEA (10 μL, 57 eq.) and shaken at 40°C for 3 hours. After confirming the disappearance of compound 19 by reverse-phase HPLC, crude purification was performed by two ethanol precipitations. The pellet was dissolved in distilled water (250 μL) to obtain 4 mM BCN-modified oligonucleotide (N-ASO). The concentration was determined by measuring UV absorption at 260 nm. Next, this 4 mM BCN-modified oligonucleotide (N-ASO) (75 μL, 300 nmol) was mixed with a 50 mM DMSO solution of compound 10 (100 μL). If the solution dissolved quickly at 40°C, it was left as is. If the suspension remained, DMSO (75 μL) was added and the mixture was shaken at 40°C for 3 hours. After confirming the disappearance of N-ASO by reverse-phase HPLC, crude purification was performed by ethanol precipitation, followed by purification by HPLC. The target eluted solution was concentrated using a centrifugal concentrator and then dissolved in distilled water. This solution was confirmed to be the target compound A by MALDI-TOF-MS, and then converted into a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound A showed a calculated value [MH]. - :5953.89, Actual value [MH] - :5953.40.

[0146] Example 2. Synthesis of Compound B

[0147]

[0148] Compound B was synthesized according to Example 1 using compound 17 instead of compound 10, and converted into a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound B showed a calculated value of [MH]. - :6029.94, Actual value [MH] - :6028.36.

[0149] Example 3. Synthesis of Compound C

[0150]

[0151] Compound C was synthesized according to Example 1 using compound 18 instead of compound 10, and converted into a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound C showed a calculated value of [M−H]. - :6029.94, Actual value [MH] - :6028.95.

[0152] Example 4. Synthesis of Compound D

[0153]

[0154] A 6 mM aqueous solution of compound 19 (50 μL, 300 pmol), a 60 mM DMSO solution of compound 16 (50 μL, 10 eq.), and DMSO (50 μL) were combined and the reaction mixture was shaken (1200 rpm) at 40 °C for 3 h. After confirming the disappearance of the starting oligonucleotide by reverse-phase HPLC, the reaction mixture was diluted with 0.1 M TEAA and purified by reverse-phase HPLC. The resulting compound was confirmed to be the desired compound D by MALDI-TOF-MS, and then converted to a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound D showed a calculated value of [M−H]. - :5748.63, actual measured value [MH]-:5748.00.

[0155] Example 5. Synthesis of Compound E

[0156]

[0157] Compound E was synthesized according to Example 1 using compound 20 instead of compound 19, and converted into a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound E showed a calculated value of [M−H]. - :5953.89, Actual value [MH] - :5953.92.

[0158] Example 6. Mouse Administration Test 1 (ASO Administration and Organ Harvesting) Seven mice (Balb / c, female, 5 weeks old) were purchased from Japan SLC, Inc. and transported to an animal testing facility. After an acclimation period of at least 5 to 7 days, a saline solution of conjugated ASO (compound A) prepared at 100 μg per mouse was administered once into the tail vein. As a control, a saline solution of unconjugated ASO (ASO not bound to a ligand or linker: "naked ASO") prepared at 100 μg per mouse was administered once into the tail vein. Saline was used as a negative control.

[0159] Seventy-two hours after ASO administration, mice were anesthetized by intraperitoneal injection of a triple anesthetic mixture (medetomidine, midazolam, and butorphanol). After laparotomy, the mice were sacrificed by exsanguination through abdominal aorta incision. 25–50 mg of tissue fragments were collected and placed in 2 mL tubes of 96-well Collection Microtubes (Qiagen) containing 500 μL of RNAprotect Tissue Reagent (Thermo) per tube. The tissue fragments were stored immersed in the reagent at −30°C. Tissue fragments were collected from the following 12 organs: liver, kidney, spleen, pancreas, heart, lung, stomach, colon, brain, skeletal muscle, mammary gland (adipose tissue), and skin.

[0160] Total RNA was extracted from the collected tissue fragments using the MagMAX mirVana Total RNA Isolation Kit (Thermo; hereafter referred to as the mirVana kit). The 96-well collection microtubes containing the tissue fragments were centrifuged (1000 × g, 3 min, 4°C) to remove the RNAprotect Tissue Reagent. The lysis buffer (supplemented with 0.7% 2-mercaptoethanol) and one stainless steel bead (5 mm diameter, QIAGEN) were added to each collection microtube. The tissue fragments were homogenized at room temperature at 30 Hz for 2 min, repeating this process five or more times using a TissueLyser II (QIAGEN).

[0161] Total RNA was extracted and purified from tissue homogenates according to the mirVana kit protocol, and the process was automated using a KingFisher Flex (Thermo). The concentration of each RNA sample was determined using the Quant-iT RiboGreen RNA Assay Kit (Thermo). Reverse transcription products were prepared from approximately 10 ng of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo). The reactions were performed according to the kit protocol. Real-time PCR was performed on each reverse transcription product using PowerUp SYBR Green Master Mix (Thermo). The internal PCR control was Gapdh, except for lung samples, where the internal control was 18S rRNA. PCR reactions were performed using a StepOnePlus Real-Time PCR System (Thermo) and consisted of 45 cycles of heat treatment at 95°C for 20 seconds, followed by denaturation at 95°C for 3 seconds and extension at 60°C for 30 seconds. The expression level of Malat1 was analyzed by comparing the Ct values ​​obtained from the amplification curves of Malat1 and the internal control (ΔΔCt method).

[0162] The PCR primer sequences used in the above tests are as follows: mMalat1_F4: 5'-d(ACATTCCTTGAGGTCGGCAA)-3' (SEQ ID NO: 2) mMalat1_R4: 5'-d(CACCCGCAAAGGCCTACATA)-3' (SEQ ID NO: 3) mGapdh_F3: 5'-d(TCACCACCATGGAGAAGGC)-3' (SEQ ID NO: 4) mGapdh_R3: 5'-d(GCTAAGCAGTTGGTGGTGCA)-3' (SEQ ID NO: 5) m18SrRNA_F1: 5'-d(GTAACCCGTTGAACCCCATT)-3' (SEQ ID NO: 6) m18SrRNA_R1: 5'-d(CCATCCAATCGGTAGTAGCG)-3' (SEQ ID NO: 7).

[0163] The results are shown in Figure 1. Administration of naked ASO did not reduce the expression level of the target gene (Malat1) in brain tissue. On the other hand, although data is omitted, administration of naked ASO reduced the expression level of the target gene in other tissues. In contrast, administration of compound A significantly reduced the expression level of the target gene in brain tissue. This demonstrates that by linking a monosaccharide to a polynucleotide via a linker, the activity of the polynucleotide can be effectively exerted in the brain.

[0164] In addition, additional tests were conducted and it was confirmed that the effect of compound A in inhibiting the expression of the target gene in the brain is dose-dependent, that glycoconjugated polynucleotides other than compound A (e.g., compounds B to E) also have the effect of inhibiting the expression of the target gene in the brain, and that the effect of inhibiting the expression in the brain can be exerted even when the target sequence in the target gene is changed.

[0165] Example 7. Administration test 2 to mice The doses of conjugated ASO (compound A) and unconjugated ASO (naked ASO) were varied and tested in the same manner as in Example 6, and the expression level of the target gene (Malat1) in brain tissue was measured.

[0166] The results are shown in Figure 2. When naked ASO was administered, the expression level of the target gene (Malat1) in brain tissue did not change at any concentration. In contrast, when compound A was administered, the expression level of the target gene in brain tissue decreased in a concentration-dependent manner. Furthermore, even in the high-dose administration group (1000 μg group), no toxicity such as deaths or liver enlargement was observed.

[0167] Example 8. Administration test 3 to mice. Conjugated ASO (compounds B and C) and unconjugated ASO (naked ASO) were used at a dose of 100 μg, and the test was conducted in the same manner as in Example 6, and the expression level of the target gene (Malat1) in brain tissue was measured.

[0168] The results are shown in Figure 3. When compounds B and C were administered, the expression level of the target gene in brain tissue tended to be further reduced. This indicates that the sugar structure linked to the polynucleotide via a linker is a substrate for Glut1, and that differences in the spacer directly bound to the sugar do not have a significant effect, allowing the activity of the polynucleotide to be effectively exerted in the brain.

[0169] Example 9. Synthesis of Compound X Compound X was synthesized in the same manner as Compound A, except that an antisense oligonucleotide (naked ASO2) with a different base sequence against the mouse Malat1 gene (NR_002847.3) was used. The results of MALDI-TOF-MS of Compound X showed a calculated value [MH] - :5988.90, Actual value [MH] - :5989.44.

[0170] Example 10. Administration test 4 to mice. A test was conducted in the same manner as in Example 6 using a conjugated ASO (Compound X) and an unconjugated ASO (naked ASO2) at a dose of 100 μg, and the expression level of the target gene (Malat1) in brain tissue was measured.

[0171] The results are shown in Figure 4. Administration of naked ASO 2 (second sequence) slightly reduced the expression level of the target gene (Malat1) in brain tissue. In contrast, administration of compound X significantly reduced the expression level of the target gene in brain tissue. This demonstrates that linking a monosaccharide to a polynucleotide with a different target sequence via a linker can also effectively exert the activity of the polynucleotide in the brain.

[0172] Example 11. Administration test 5 to mice. Conjugated ASOs (Compound A, Compound X) and unconjugated ASOs (naked ASO, naked ASO2) were administered at a dose of 100 μg in the same manner as in Example 6, and the expression level of the target gene (Malat1) in each tissue was measured.

[0173] The results are shown in Figure 5. In both cases of Compound A and Compound X, the expression level of the target gene was significantly reduced only in the brain.

[0174] Example 12 Administration Test 6 in Mice A test was conducted in the same manner as in Example 6 using conjugated ASOs (compound D and compound E) and unconjugated ASO (naked ASO) at a dose of 100 μg, and the expression level of the target gene (Malat1) in each tissue was measured.

[0175] The results are shown in Figure 6. Administration of naked ASO did not change the expression level of the target gene (Malat1) in brain tissue. In contrast, administration of compounds D and E further reduced the expression level of the target gene in brain tissue. This demonstrates that sugars linked to polynucleotides via linkers can effectively exert the activity of polynucleotides in the brain without being significantly affected by the linker structure or binding position.

[0176] Example 13. Synthesis of Compound F

[0177]

[0178] Compound F was synthesized as follows. A 6 mM aqueous solution of compound 19 (50 μL, 0.3 μmol) was mixed with a 72 mM DMSO solution of the trivalent linker PNP (42 μL, 10 eq.) and DIPEA (3 μL, 57 eq.) and shaken at 40°C for 3 hours. After confirming the disappearance of compound 19 by reverse-phase HPLC, crude purification was performed by two ethanol precipitations. The pellet was dissolved in distilled water (50 μL) and mixed with a 100 mM DMSO solution of compound 10 (30 μL, 10 eq.). The mixture was shaken at 40°C for 3 hours. The reaction mixture was purified by HPLC. The eluted solution was concentrated using a centrifugal concentrator and then dissolved in distilled water. This solution was confirmed to be the desired compound F by MALDI-TOF-MS and then converted to a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound F showed a calculated value [M−H]. - :7476.62, Actual value [MH] - :7475.28.

[0179] Example 14. Synthesis of Compound G

[0180]

[0181] Compound G was synthesized as follows. A 6 mM aqueous solution of compound 19 (50 μL, 0.3 μmol) was mixed with a 24 mM DMSO solution of Fmoc-Val-Ala-PAB-PNP (35 μL, 2.8 eq.) and 100 mM sodium borate buffer (80 μL, pH 9.3) and shaken at 50°C for 1 h. A 24 mM DMSO solution of Fmoc-Val-Ala-PAB-PNP (35 μL, 2.8 eq.) was added and the mixture was shaken at 50°C for 1 h, followed by purification by ethanol precipitation. The pellet was dissolved in distilled water (80 μL), piperidine (20 μL) was added, and the mixture was shaken at 50°C for 1 h. After ethanol precipitation, the major product was isolated by HPLC, lyophilized, and then redissolved in distilled water (80 μL). From this point on, compound G was synthesized in the same manner as compound A, and after confirming its identity by MALDI-TOF-MS, it was converted into a sodium salt suitable for use in in vivo experiments. The MALDI-TOF-MS results for compound G showed a calculated value of [MH]. - :6273.2, Actual measurement value [MH] - :6276.1.

[0182] Example 15 Administration Test 7 in Mice A test was conducted in the same manner as in Example 6 using conjugated ASOs (compound F and compound G) and unconjugated ASO (naked ASO) at a dose of 100 μg, and the expression level of the target gene (Malat1) in each tissue was measured.

[0183] The results are shown in Figure 7. Administration of naked ASO did not change the expression level of the target gene (Malat1) in brain tissue. In contrast, administration of the aforementioned compounds D and E reduced the expression level of the target gene in brain tissue. Administration of compounds F and G further reduced the expression level of the target gene in brain tissue. This suggests that while the linker structure connecting the linker and sugar to the polynucleotide has little effect, changes in the sugar valence or biodegradable linkers may enable polynucleotides to exert their activity more effectively in the brain.

Claims

1. General formula (1): 【Chemistry 1】 [In the formula, Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide that is a ligand of glucose transporter 1. Lk represents a divalent group that is a linker having 6 or more atoms constituting the main chain. Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide.] or a salt thereof, or a solvate thereof.

2. (delete)

3. The compound or a salt thereof, or a solvate thereof according to claim 1 , wherein the monosaccharide is a hexose.

4. The compound or salt thereof, or a solvate thereof according to claim 3 , wherein the Ms is a monovalent group obtained by removing a hydrogen atom from a hydroxy group at the 4- or 6-position of the monosaccharide.

5. The compound or salt thereof, or a solvate thereof according to claim 1 , wherein the linker is a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom and / or a linking structure.

6. The compound or a salt thereof, or a solvate thereof according to claim 5 , wherein the linking structure comprises a linking structure containing a triazole ring and / or a linking structure containing an amide bond.

7. (delete)

8. The compound or salt thereof, or a solvate thereof according to claim 1 , wherein Pn is a monovalent group formed by removing one atom or group from a terminal nucleotide of the polynucleotide.

9. The compound or salt thereof, or a solvate thereof according to claim 1 , wherein Pn is a monovalent group formed by removing one hydrogen atom from a phosphate group of a terminal nucleotide of the polynucleotide.

10. The compound or salt thereof, or a solvate thereof according to claim 1 , wherein the polynucleotide is an antisense polynucleotide, an siRNA, an miRNA, an miRNA precursor, an aptamer, a guide RNA, an mRNA, a DNA (antigene nucleic acid), or a DNA / RNA heteroduplex.

11. A medicine comprising the compound or a salt thereof according to any one of claims 1, 3 to 6, and 8 to 10, or a solvate thereof.

12. The pharmaceutical composition according to claim 11, which is for delivery to the brain.

13. A reagent comprising the compound according to any one of claims 1, 3 to 6, and 8 to 10, or a salt thereof, or a solvate thereof.

Images