Kit for diagnosing alzheimer's disease and pharmaceutical composition for treating alzheimer's disease

Abstract

Disclosed are a kit for diagnosing Alzheimer's disease and a pharmaceutical composition for treating Alzheimer's disease that use EDIL3 or a nucleic acid that encodes EDIL3 as an indicator or a target.

Description

Kit for diagnosing Alzheimer's disease and pharmaceutical composition for treating it

[0001] The present disclosure relates to kits for the diagnosis and pharmaceutical compositions for the treatment of Alzheimer's disease.

[0002] Alzheimer's disease (Alzheimer's type dementia) is one of the major types of dementia and is a neurodegenerative disease characterized by neuropathological lesions such as neuronal loss and senile plaques in the brain parenchyma (Non-Patent Document 1).

[0003] Apolipoprotein E (hereinafter also referred to as "APOE") alleles are known to be one of the genetic risk factors for the development of Alzheimer's disease. APOE has three major variants, ε2, ε3, and ε4, distinguished by the amino acids at residues 112 and 158 (hereinafter referred to as APOE2, APOE3, and APOE4, respectively). APOE2 is a variant in which residues 112 and 158 are cysteine ​​and cysteine, respectively. APOE3 is a variant in which residues 112 and 158 are cysteine ​​and arginine, respectively. APOE4 is a variant in which residues 112 and 158 are arginine, respectively. Among these, APOE4 is particularly a genetic risk factor for the onset of Alzheimer's disease, and it has been reported that, compared with a human subject having a homozygous allele of APOE3, the probability of developing Alzheimer's disease in a human subject having a heterozygous allele of APOE4 is approximately 3.68 times higher, and the probability of developing Alzheimer's disease in a human subject having a homozygous allele of APOE4 is approximately 12.50 times higher (Non-Patent Document 2).

[0004] Synaptic dysfunction is widely considered to be one of the earliest and most important lesions observed before neurodegeneration in Alzheimer's disease (Non-Patent Documents 3 and 4). Indeed, human subjects with APOE4 alleles exhibit immature dendritic spine morphology and abnormal brain activity (Non-Patent Documents 5 and 6). Furthermore, experiments using rodent models have shown that human APOE4 adversely affects the function and morphological integrity of synapses (Non-Patent Documents 5, 7-10).

[0005] D. J. Selkoe and J. Hardy, "The amyloid hypothesis of Alzheimer’s disease at 25 years.", EMBO Mol. Med. 8, 595-608 (2016).Yu Yamazaki et al., "Apolipoprotein E and Alzheimer disease: pathobiology and targeting strategies.", Nat. Rev. Neurol. 15, 501-518 (2019).R. D. Terry et al., "Physical basis of cognitive alterations in Alzheimer’s disease: synapse loss is the major correlate of cognitive impairment.", Ann. Neurol. 30, 572-80 (1991).S. T. DeKosky and S. W. Scheff, "Synapse loss in frontal cortex biopsies in Alzheimer’s disease: correlation with cognitive severity.", Ann. Neurol. 27, 457-64 (1990).Y. Ji et al., "Apolipoprotein E isoform-specific regulation of dendritic spine morphology in apolipoprotein E transgenic mice and Alzheimer’s disease patients.", Neuroscience 122, 305-15 (2003).N. Filippini et al., "Distinct patterns of brain activity in young carriers of the APOE-epsilon4 allele.", Proc. Natl. Acad. Sci. U. S. A. 106, 7209-14 (2009).B. L. Trommer et al., "ApoE isoform affects LTP in human targeted replacement mice.", Neuroreport 15, 2655-8 (2004).K. M. Korwek et al., "ApoE isoform-dependent changes in hippocampal synaptic function.", Mol. Neurodegener. 4, 21 (2009).S. B. Dumanis et al., "ApoE4 decreases spine density and dendritic complexity in cortical neurons in vivo.", J. Neurosci. 29, 15317-22 (2009).Y. Tensaouti et al., "ApoE Regulates the Development of Adult Newborn Hippocampal Neurons.", eNeuro5 (4), ENEURO.0155-18.2018, (2018).N. Ichiyanagi et al., "Establishment of In Vitro FUS-Associated Familial Amyotrophic Lateral Sclerosis Model Using Human Induced Pluripotent Stem Cells.", Stem cell reports 6, 496-510 (2016).Alexandra Grubman et al., "A single-cell atlas of entorhinal cortex from individuals with Alzheimer's disease reveals cell-type-specific gene expression regulation", Nature Neuroscience 22(12): 2087-2097 (2019).Tetsuya Akiyama et al., "Aberrant axon branching via Fos-B dysregulation in FUS-ALS motor neurons.", eBioMedicine 45, 362-378 (2019).

[0006] The present disclosure aims to provide kits for diagnosing and pharmaceutical compositions for treating Alzheimer's disease.

[0007] The present inventors have discovered that human astrocytes (hereinafter also referred to as "iPast") obtained by differentiating induced pluripotent stem cells (iPSCs) carrying the APOE4 allele highly express EDIL3 (EGF-Like Repeats and Discoidin I-Like Domains Protein 3, also known as DEL-1 or Developmental Endothelial Locus-1), a protein contained in the extracellular matrix, and that when primary neurons are cultured in the presence of EDIL3 in the cell culture medium, morphological abnormalities, a phenotype of Alzheimer's disease, are observed.

[0008] The present disclosure relates to, for example, the following: [1] A kit for diagnosing or aiding in the diagnosis of Alzheimer's disease, comprising: a nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3-binding fragment thereof. [2] The kit according to [1], including instructions for use. [3] A diagnostic agent or diagnostic aid for Alzheimer's disease, comprising: a nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3-binding fragment thereof. [4] A nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3-binding fragment thereof, for use in diagnosing or aiding in the diagnosis of Alzheimer's disease. [5] Use of a nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3-binding fragment thereof in the manufacture of a kit, diagnostic agent, or diagnostic aid for diagnosing or assisting in the diagnosis of Alzheimer's disease. [6] The kit according to [1] or [2]; the diagnostic agent or diagnostic aid according to [3]; the nucleic acid primer, nucleic acid probe, antibody, or EDIL3-binding fragment according to [4]; or the use according to [5], wherein the subject to be diagnosed has the APOE4 genotype. [7] A method for assisting the diagnosis of Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject. [8] A method for assisting the diagnosis of Alzheimer's disease, comprising detecting the presence or absence of the APOE4 genotype in a subject, and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject.[9] A method for collecting data for diagnosing Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

[10] A method for collecting data for diagnosing Alzheimer's disease, comprising detecting the presence or absence of an APOE4 genotype in a subject, and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject.

[11] A method for diagnosing Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

[12] A method for diagnosing Alzheimer's disease, comprising detecting the presence or absence of an APOE4 genotype in a subject, and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject.

[13] A method for assisting in the diagnosis of Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject.

[14] A method for assisting in the diagnosis of Alzheimer's disease, comprising detecting the presence or absence of an APOE4 genotype in a subject, and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from the subject.

[15] A method for collecting data for the diagnosis of Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject.

[16] A method for collecting data for the diagnosis of Alzheimer's disease, comprising detecting the presence or absence of an APOE4 genotype in a subject, and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from the subject.

[17] A method for diagnosing Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject.

[18] A method for diagnosing Alzheimer's disease, comprising detecting the presence or absence of an APOE4 genotype in a subject, and quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from the subject.

[19] The method according to any one of

[13] to

[18] , wherein quantifying EDIL3 comprises contacting a biological sample obtained from the subject with an anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[20] The method according to any one of

[13] to

[19] , wherein the biological sample is cerebrospinal fluid, plasma, serum, whole blood, saliva, sputum, nipple secretion, urine, sweat, tissue, cells (including glial cells), or pancreatic juice.

[21] The method according to any one of [7] to

[20] , wherein a higher quantified amount of EDIL3 compared to a control indicates that the subject has Alzheimer's disease or is highly likely to have Alzheimer's disease.

[22] A method for treating Alzheimer's disease, comprising administering a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease to a subject determined to have a higher EDIL3 amount quantified by the method according to any one of [7] to

[21] , compared to a control.

[23] The method according to

[22] , wherein the pharmaceutical composition or therapeutic agent comprises a therapeutically effective amount of a substance that inhibits EDIL3.

[24] The method according to

[23] , wherein the EDIL3 inhibitor is a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function.

[25] The method according to any one of [7] to

[24] , wherein the subject has the APOE4 genotype.

[26] A pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising a substance that inhibits EDIL3.

[27] A substance that inhibits EDIL3 for use in treating Alzheimer's disease.

[28] Use of a substance that inhibits EDIL3 in the manufacture of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease.

[29] A method for treating Alzheimer's disease, comprising administering an EDIL3 inhibitor to a patient in need thereof.

[30] The pharmaceutical composition or therapeutic agent according to

[26] , the substance according to

[27] , the use according to

[28] , or the therapeutic method according to

[29] , wherein the EDIL3 inhibitor is a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function.

[31] The pharmaceutical composition or therapeutic agent according to

[26] or

[30] , the substance according to

[27] or

[30] , the use according to

[28] or

[30] , or the method of treatment according to

[29] or

[30] , wherein the substance that inhibits EDIL3 is a nucleic acid that suppresses the expression of EDIL3.

[32] The pharmaceutical composition or therapeutic agent according to

[26] or

[30] , the substance according to

[27] or

[30] , the use according to

[28] or

[30] , or the method of treatment according to

[29] or

[30] , wherein the substance that inhibits EDIL3 is an anti-EDIL3 antibody or an antigen-binding fragment thereof.

[33] The pharmaceutical composition or therapeutic agent according to

[26] or

[30] , the substance according to

[27] or

[30] , the use according to

[28] or

[30] , or the method of treatment according to

[29] or

[30] , wherein the substance that inhibits EDIL3 is a compound against EDIL3.

[34] The pharmaceutical composition or therapeutic agent, substance, use, or method of treatment according to

[33] , wherein the compound against EDIL3 is a low molecular weight compound.

[35] The pharmaceutical composition or therapeutic agent according to any one of

[26] and

[30] to

[34] , or the use according to any one of

[28] and

[30] to

[34] , wherein the pharmaceutical composition or therapeutic agent is for treating a human subject having an APOE4 genotype.

[36] The substance according to any one of

[27] and

[30] to

[34] , or the method of treatment according to any one of

[29] to

[34] , wherein the subject to be treated is a human subject having an APOE4 genotype.

[37] A method of screening for a substance that inhibits EDIL3, comprising culturing neurons in a medium containing EDIL3 and a test substance; and detecting an Alzheimer's disease phenotype from the neurons.

[38] A method for screening for a substance that inhibits EDIL3, comprising: introducing a nucleic acid for expressing EDIL3 into a cell or a microorganism; culturing the cell or microorganism; recovering a culture supernatant obtained by culturing the cell or microorganism; culturing neurons in a medium containing the recovered culture supernatant and a test substance; and evaluating the Alzheimer's disease phenotype from the neurons.

[39] A method for screening for a substance that inhibits EDIL3, comprising culturing EDIL3-expressing cells and neurons in a medium containing a test substance; and detecting an Alzheimer's disease phenotype from the neurons.

[40] The screening method according to any one of

[37] to

[39] , wherein the neurons are neurons having the APOE4 genotype.

[41] The screening method according to any one of

[37] to

[40] , wherein the EDIL3 inhibitor is a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function.

[42] The screening method according to any one of

[37] to

[41] , wherein the EDIL3 inhibitor is a substance for treating Alzheimer's disease.

[43] The screening method according to any one of

[37] to

[42] , wherein the EDIL3 inhibitor is administered to a human subject having the APOE4 genotype and suffering from Alzheimer's disease.

[44] A method for screening for an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising: culturing neurons in a medium containing EDIL3 and a test substance; and detecting an Alzheimer's disease phenotype in the neurons.

[45] A method for screening for an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising: introducing a nucleic acid for expressing EDIL3 into cells or microorganisms; culturing the cells or microorganisms; recovering a culture supernatant from culture of the cells or microorganisms; culturing neurons in a medium containing the recovered culture supernatant and a test substance; and evaluating an Alzheimer's disease phenotype in the neurons.

[46] A method for screening for an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising: culturing cells expressing EDIL3 and neurons in a medium containing a test substance; and detecting an Alzheimer's disease phenotype in the neurons.

[47] The screening method according to any one of

[44] to

[46] , wherein the nerve cells are nerve cells having the APOE4 genotype.

[48] ​​The screening method according to any one of

[44] to

[47] , wherein assessing the Alzheimer's disease phenotype from the neurons comprises assessing the morphology of the neurons.

[49] The screening method according to any one of

[44] to

[48] , wherein assessing the Alzheimer's disease phenotype from the neurons comprises detecting a change in the number of spines in the neurons.

[50] The screening method according to any one of

[44] to

[49] , wherein the pharmaceutical composition or therapeutic agent is administered to a human subject having an APOE4 genotype.

[51] A method for screening for a substance that inhibits EDIL3, comprising: culturing cells that express EDIL3 in a medium containing a test substance; and assessing the expression or secretion of EDIL3.

[52] The screening method according to

[51] , wherein assessing the expression or secretion of EDIL3 involves quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3.

[53] The screening method according to

[51] or

[52] , wherein assessing the expression or secretion of EDIL3 comprises quantifying EDIL3 in the medium.

[54] The screening method according to any one of

[52] or

[53] , wherein the quantification of EDIL3 is carried out using an anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[55] The screening method according to any one of

[51] to

[54] , wherein the substance that inhibits EDIL3 is a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function.

[56] The screening method according to any one of

[51] to

[55] , wherein the substance that inhibits EDIL3 is a substance for treating Alzheimer's disease.

[57] The screening method according to any one of

[51] to

[56] , wherein the substance that inhibits EDIL3 is administered to a human subject with an APOE4 genotype suffering from Alzheimer's disease.

[58] The screening method according to any one of

[37] to

[57] , wherein the substance that inhibits EDIL3 is a nucleic acid that suppresses the expression of EDIL3, an anti-EDIL3 antibody or an antigen-binding fragment thereof, or a compound against EDIL3.

[59] The screening method according to

[58] , wherein the compound against EDIL3 is a low molecular weight compound.

[0009] According to one embodiment of the present disclosure, a kit for diagnosing or assisting in the diagnosis of Alzheimer's disease can be provided. According to one embodiment of the present disclosure, a diagnostic agent or diagnostic aid for Alzheimer's disease can be provided. According to one embodiment of the present disclosure, a method for diagnosing or assisting in the diagnosis of Alzheimer's disease can be provided. According to one embodiment of the present disclosure, a method for collecting data for diagnosing Alzheimer's disease can be provided.

[0010] According to one embodiment of the present disclosure, a pharmaceutical composition or a therapeutic agent for treating Alzheimer's disease can be provided. According to one embodiment of the present disclosure, a method for treating Alzheimer's disease can be provided.

[0011] According to one embodiment of the present disclosure, there is provided a method for screening for a substance that inhibits EDIL3. According to one embodiment of the present disclosure, there is provided a method for screening for an active ingredient of a pharmaceutical composition or therapeutic agent for the treatment of Alzheimer's disease.

[0012] FIG. 1 shows an outline of the method used in Example 1 to generate an allele in which a gene encoding APOE4 was knocked into an APOE3 allele (wild-type allele). FIG. 2 shows the results of PCR amplification of the genes of five iPSC clones (#86 to #90) into which the alleles generated in Example 1 were introduced, followed by gel electrophoresis. FIG. 3 shows the results of sequencing the genes of five iPSC clones into which the alleles generated in Example 1 were introduced. FIG. 4 shows an outline of the method used in Example 1 to induce iPSCs into astrocytes. FIG. 5 shows representative morphologies of astrocytes derived from iPSCs with the APOE4 / 4 genotype (E4 / E4 (#87-5)) and astrocytes derived from iPSCs with the APOE3 / 3 genotype, 201B7 (E3 / E3 (201B7)). Figure 6 shows a fluorescent image of iPast in Example 1, where the astrocyte markers S100β, GFAP, and CD44 were immunofluorescently stained and the nuclei were stained with Hoechst. Figure 7 shows the percentage of positive cells in the fluorescent image of S100β, GFAP, and CD44 shown in Figure 6 in Example 1. Figure 8 shows the results of measuring the expression levels of mRNA encoding APOE protein (APOE), the astrocyte marker S100β, and β-actin (ACTB) in Example 2. Figure 9 shows the results of quantifying the expression levels of APOE protein and β-actin expressed by each iPast by Western blotting in Example 2. Figure 10 shows the results of examining the amount of APOE in the culture medium in which each iPast was cultured by ELISA in Example 2. Figure 11 shows the results of mass spectrometry of trypsin-treated APOE fragments in the culture external solution of iPast having the APOE3 / 3 genotype and iPast having the APOE4 / 4 genotype in Example 2. Figure 12 shows an outline of the co-culture of iPast having the APOE4 / 4 genotype or iPast having the APOE3 / 3 genotype with mouse primary neurons in Example 3. Figure 13 shows representative fluorescent images of mouse primary neurons transfected with Actin-GFP in Example 3.Figure 14 shows fluorescent images of dendrites in mouse primary neurons co-cultured with iPast having the APOE4 / 4 genotype or iPast having the APOE3 / 3 genotype in Example 3. Figure 15 shows the number of dendritic spines observed per 1 μm of dendrite in fluorescent images acquired similarly to Figure 14 in Example 3. Figure 16 shows the number of dendritic spines observed per 1 μm of dendrite for each dendritic spine shape in fluorescent images acquired similarly to Figure 14 in Example 4. Figure 17 shows the results of clustering analysis of genes with differential expression levels between iPast having the APOE4 / 4 genotype and iPast having the APOE3 / 3 genotype in Example 4, as a heat map of the logFC z-score of iPast having the APOE4 / 4 genotype relative to iPast having the APOE3 / 3 genotype. Figure 18 shows the results of principal component analysis (PCA) of the transcriptomes of iPast with the APOE3 / 3 genotype and iPast with the APOE4 / 4 genotype in Example 4. Figure 19 shows the results of Figure 17 as a two-dimensional plot in Example 4. Figure 20 shows the results of quantitative reverse transcription PCR quantification of CDKN1A and EDIL3, whose expression levels were increased in iPast with the APOE4 / 4 genotype, and β-actin, an indicator of cell number, in Example 4. Figure 21 shows the results of measurement of the expression levels of genes known to be specifically expressed in Pan-Reactive, A1-like reactive (A1 specific), or A2-like reactive (A2 specific) astrocytes in Example 5, using a method similar to that in Example 4. FIG. 22 shows the results of measuring the expression levels of genes known to be specifically expressed in Pan-Reactive, A1-like reactive (A1 specific), or A2-like reactive (A2 specific) astrocytes in Example 5 using a method similar to that used in Example 4.Figure 23 is a Venn diagram showing the overlap between 119 mRNAs found in Example 4 in which RNA levels were increased in iPast with the APOE4 / 4 genotype compared to iPast with the APOE3 / 3 genotype, and 491 genes whose single nucleotide polymorphisms were found to be potentially associated with Alzheimer's disease in a genome-wide association study in Non-Patent Document 12. Figure 24 shows the results of evaluating the amount of EDIL3 protein in lysed iPast and the culture medium (CM) used to culture iPast, using fragment analysis, in Example 6. Figure 25 shows the results of evaluating the expression level of EDIL3 in lysed iPast by Western blotting, in Example 6. Figure 26 shows the results of evaluating the amount of EDIL3 secreted into the culture medium used to culture iPast, using Western blotting, in Example 6. Figure 27 shows the results of Western blotting analysis of the amount of EDIL3 in HEK293 cells transduced with EDIL3 and their culture medium, as shown in Example 7. Figure 28 shows a protocol for assessing the effect of exposure to EDIL3 on mouse primary neurons by culturing mouse primary neurons cultured in culture medium containing HEK293 cells transduced with EDIL3 during days 16 to 21 (DIV16-21), as shown in Example 7. Figure 29 shows Actin-GFP fluorescence images in dendrites of mouse primary neurons cultured in culture medium containing HEK293 cells transduced with EDIL3, and the results of quantifying the number of dendritic spines per μm, as shown in Example 7. Figure 30 shows the results of quantifying the number of dendritic spines per μm in the dendrites of mouse primary neurons after culturing in a culture medium containing HEK293 cells transduced with EDIL3, according to the shape of the dendritic spine, in Example 7. Figure 31 shows the expression level of EDIL3 in iPast cells with the APOE4 / 4 genotype transfected with shEDIL3 or shcontrol, in Example 8.Figure 32 shows, in Example 8, fluorescent images of Actin-GFP in dendrites of mouse primary neurons cultured in culture medium containing iPast cells transfected with shEDIL3 or shcontrol, and the results of quantifying the number of dendritic spines per μm. Figure 33 shows, in Example 9, fluorescent images obtained by immunofluorescently staining the parietal lobes of postmortem brains of Alzheimer's disease patients and humans without Alzheimer's disease symptoms. Figure 34 shows, in Example 9, the area of ​​amyloid plaques in the brains of Alzheimer's disease patients. Figure 35 shows, in Example 9, the percentage of GFAP-positive cells as a function of distance from amyloid plaques in the brains of Alzheimer's disease patients. Figure 36 shows, in Example 9, the fluorescence intensity derived from labeled anti-EDIL3 antibodies as a function of distance from amyloid plaques in the brains of Alzheimer's disease patients.

[0013] Hereinafter, embodiments for carrying out the present disclosure will be described, but the present disclosure is not limited to the following embodiments.

[0014] The terms "a," "an," "the," and similar terms as used in the context of this disclosure (especially in the context of the claims) are to be construed as encompassing both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0015] <First Aspect> A first aspect of the present disclosure is a kit for diagnosing or aiding in the diagnosis of Alzheimer's disease, comprising a nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3-binding fragment thereof. In one embodiment, the first aspect of the present disclosure may also be a diagnostic agent or diagnostic aid for Alzheimer's disease, comprising a nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3; a nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or an anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[0016] EDIL3 (EGF-Like Repeats and Discoidin Domains 3), also known as DEL1 (Developmental endothelial locus-1), is one of the proteins that constitute the extracellular matrix. Extracellularly secreted EDIL3 is known to play a role in regulating epithelial-mesenchymal transition (EMT), among other things. EDIL3 is biosynthesized and secreted by a wide variety of cells in the human body, with mRNA expression particularly high in brain cells. Secreted EDIL3 is also known to be distributed in the blood, etc. Human EDIL3 is known to exist in two isoforms: isoform 1 represented by SEQ ID NO: 1 and isoform 2 represented by SEQ ID NO: 2. The EDIL3 according to the present disclosure is preferably mammalian EDIL3, more preferably human EDIL3, and the human EDIL3 may be either isoform 1 or 2.

[0017] The present inventors have found that neurons exposed to EDIL3 in a culture environment exhibit an Alzheimer's disease phenotype. More specifically, they have found that neurons exposed to EDIL3 in a culture environment exhibit a decrease in the density of the number of dendritic spines. Therefore, without wishing to be bound by any theory, by measuring the content of EDIL3, or a nucleic acid encoding it, whose presence in an environment in which neurons reside causes neuronal morphological abnormalities associated with Alzheimer's disease, for example, it is possible to predict that a subject may be suffering from Alzheimer's disease based on a high content of EDIL3 or a nucleic acid encoding it in a sample collected from the subject. That is, in one embodiment, the first aspect of the present disclosure may also be a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject. In these cases, quantifying EDIL3 may include contacting a biological sample obtained from the subject with an anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

[0018] The EDIL3-encoding mRNA in a nucleic acid primer or nucleic acid probe for detecting an EDIL3-encoding mRNA is not limited as long as it is a nucleic acid that gives EDIL3 when translated. For example, it may be an mRNA that encodes a protein having an amino acid sequence identity of 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% to that of EDIL3 shown in SEQ ID NO: 1 or SEQ ID NO: 2. In another embodiment, it may be an mRNA that encodes a protein having an amino acid sequence identity of 95% or more to that of EDIL3 shown in SEQ ID NO: 1 or SEQ ID NO: 2. In still another embodiment, it may be an mRNA that encodes EDIL3 shown in SEQ ID NO: 1 or SEQ ID NO: 2. In these cases, EDIL3 encoded by such a nucleic acid may retain its physiological function (e.g., integrin-binding ability). Furthermore, detecting an mRNA encoding EDIL3 using a nucleic acid primer or nucleic acid probe for detecting an mRNA encoding EDIL3 may mean directly detecting the mRNA encoding EDIL3 (i.e., detecting the mRNA encoding EDIL3 itself) or indirectly, although in another embodiment, direct detection is also acceptable. Indirectly detecting an mRNA encoding EDIL3 may mean detecting a nucleic acid that is spliced ​​to give an mRNA encoding EDIL3, i.e., a precursor mRNA of an mRNA encoding EDIL3. Examples of such a precursor mRNA of an mRNA encoding EDIL3 include the nucleic acid shown in SEQ ID NO: 3 or SEQ ID NO: 4. Examples of an mRNA encoding EDIL3 obtained by splicing the precursor mRNA shown in SEQ ID NO: 3 or SEQ ID NO: 4 include the nucleic acid shown in SEQ ID NO: 5, which is an mRNA encoding EDIL3 isoform 1 (SEQ ID NO: 1), and the nucleic acid shown in SEQ ID NO: 6, which is an mRNA encoding EDIL3 isoform 2 (SEQ ID NO: 2).Thus, in one embodiment of the first aspect of the present disclosure, the nucleic acid primer or nucleic acid probe for detecting mRNA encoding EDIL3 may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the nucleic acid shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6; in another embodiment, a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 90% or more identity to the nucleic acid shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6; in yet another embodiment, a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 90% or more identity to the nucleic acid shown in SEQ ID NO:5 or SEQ ID NO:6; in yet another embodiment, a nucleic acid primer or nucleic acid probe for detecting the nucleic acid shown in SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6; and in yet another embodiment, a nucleic acid primer or nucleic acid probe for detecting the nucleic acid shown in SEQ ID NO:5 or SEQ ID NO:6. In these cases, EDIL3 encoded by such a nucleic acid may retain its physiological function (e.g., integrin-binding ability).

[0019] The nucleic acid primer or nucleic acid probe for detecting a cDNA complementary to an mRNA according to the first aspect of the present disclosure is a cDNA complementary to the target mRNA by the nucleic acid primer or nucleic acid probe for detecting an mRNA encoding EDIL3 as described above. Examples of such a cDNA include the nucleic acid shown in SEQ ID NO: 7, which is a cDNA complementary to SEQ ID NO: 5, and the nucleic acid shown in SEQ ID NO: 8, which is a cDNA complementary to SEQ ID NO: 6. Therefore, in one embodiment of the first aspect of the present disclosure, the nucleic acid primer or nucleic acid probe for detecting a cDNA complementary to an mRNA encoding EDIL3 may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% homology to the nucleic acid shown in SEQ ID NO: 7 or SEQ ID NO: 8; in another embodiment, it may be a nucleic acid primer or nucleic acid probe for detecting a nucleic acid having 90% or more homology to the nucleic acid shown in SEQ ID NO: 7 or SEQ ID NO: 8; and in still another embodiment, it may be a nucleic acid primer or nucleic acid probe for detecting the nucleic acid shown in SEQ ID NO: 7 or SEQ ID NO: 8; in these cases, EDIL3 encoded by an mRNA complementary to such a cDNA may retain its physiological function (e.g., the ability to bind to integrin).

[0020] The nucleic acid primer according to the present disclosure may be any nucleic acid primer that can bind to DNA or RNA and promote a nucleic acid replication reaction catalyzed by a DNA polymerase or an RNA polymerase. The target DNA or RNA present in a solution can be amplified using such a nucleic acid primer, and then the target DNA or RNA can be evaluated (detected and / or quantified) by measuring the nucleic acid concentration in the solution by absorbance measurement or the like. The base length of the nucleic acid primer according to the present disclosure is not particularly limited, and may be, for example, 5 or more bases, 8 or more bases, 10 or more bases, 12 or more bases, 13 or more bases, 14 or more bases, 15 or more bases, 16 or more bases, 17 or more bases, or 18 or more bases, or 100 or less bases, 50 or less bases, 40 or less bases, 35 or less bases, 30 or less bases, 27 or less bases, 25 or less bases, 24 or less bases, 23 or less bases, or 22 or less bases, and examples of the base length range may be 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases, or 18 to 22 bases. Furthermore, the nucleic acid primer according to the first aspect of the present disclosure has a region (complementary region) complementary to the mRNA or cDNA to be detected, and the proportion of the sequence of the complementary region that is complementary to the sequence of the nucleic acid primer binding site of the mRNA or cDNA to be detected that is complementary to the base sequence (number of bases) belonging to the complementary region may be 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%, or in another embodiment, 90% or more, or in another embodiment, 100%. The base length of the complementary region in the nucleic acid primer according to the first aspect of the present disclosure is not particularly limited and may be, for example, 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases, or 18 to 22 bases.Furthermore, the nucleic acid primer according to the first aspect of the present disclosure may have, in addition to the complementary region, a region (additional region) that is not complementary to the sequence of the complementary region, and the additional region may be provided at the 5' end and / or the 3' end of the primer, and the base length of the additional region may be, for example, 1 base, 2 bases, 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, or 10 bases.

[0021] A specific example of a nucleic acid primer according to the first aspect of the present disclosure is a nucleic acid primer having a complementary region to at least one of the nucleic acids set forth in SEQ ID NOs: 3 to 8. In another embodiment, the nucleic acid primer according to the first aspect of the present disclosure may be a nucleic acid comprising a nucleotide sequence that is 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% identical to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10, or in another embodiment, a nucleic acid comprising a nucleotide sequence that is 90% or more identical to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10, or in yet another embodiment, a nucleic acid comprising a nucleotide sequence that is 100% identical to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10, or a nucleic acid consisting of a nucleotide sequence that is 90% or more identical to the nucleic acid set forth in SEQ ID NO: 9 or SEQ ID NO: 10. SEQ ID NO: 9: AGCATACCGAGGGGATACATT SEQ ID NO: 10: CAAGGCTCAACTTCGCATTCA

[0022] The nucleic acid probe according to the present disclosure is not particularly limited as long as it binds to DNA or RNA and can evaluate (detect and / or quantify) the bound DNA or RNA by a signal emitted by the nucleic acid probe. Specific examples include nucleic acid probes that can be used in the FISH (Fluorescence In Situ Hybridization) method or the Invader assay method, which detect the presence of DNA or RNA by a fluorescent signal, and nucleic acid probes that can be used in the RACE (Rapid Amplification of cDNA ends) method, which detects the presence of a nucleic acid by amplifying a portion of DNA or RNA by reverse transcription polymerase chain reaction (RT-PCT). The nucleic acid probe according to one embodiment of the first aspect of the present disclosure has a region (complementary region) complementary to the mRNA or cDNA to be detected, and the percentage of the sequence of the complementary region that is complementary to the sequence of the nucleic acid probe-binding site of the mRNA or cDNA to be detected may be 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% of the base sequence (number of bases) belonging to the complementary region, or in another embodiment, 90% or more, or in another embodiment, 100%. The base length of the complementary region in the nucleic acid probe according to the first aspect of the present disclosure is not particularly limited, and may be, for example, 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases, or 18 to 22 bases. A specific example of the nucleic acid probe according to the first aspect of the present disclosure is a nucleic acid probe having a region complementary to at least one of the nucleic acids shown in SEQ ID NOs: 3 to 8.

[0023] The anti-EDIL3 antibody according to the present disclosure is not particularly limited as long as it is an antibody capable of binding to EDIL3. Commercially available anti-EDIL3 antibodies can be used, and such anti-EDIL3 antibodies can be purchased from, for example, Abcam (ab190692) and Thermo Fisher Scientific (Invitrogen, PA5-27994).

[0024] The EDIL3-binding fragment according to the present disclosure is not particularly limited as long as it is an antigen-binding fragment capable of binding to EDIL3, and examples thereof include F(ab') ２ The fragment may be a Fab' fragment, a Fab fragment or an Fv fragment.

[0025] In one embodiment, the anti-EDIL3 antibody or its EDIL3-binding fragment may be labeled for signal detection, for example, with a fluorescent dye or a protein tag such as a FLAG tag.

[0026] According to a first aspect of the present disclosure, by quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject, it is possible to aid in the diagnosis of Alzheimer's disease, collect data for the diagnosis of Alzheimer's disease, or perform a diagnosis, specifically, to aid in the diagnosis of, collect data for the diagnosis of, or perform a diagnosis of, the onset, or progression of Alzheimer's disease. One embodiment thereof is described below.

[0027] The subject of the present disclosure may be a human subject suffering from Alzheimer's disease (AD, Alzheimer's dementia) or a human subject likely to suffer from Alzheimer's disease. In these cases, whether a human subject has or is likely to have Alzheimer's disease may be determined by methods commonly performed by those skilled in the art. Examples of human subjects suffering from or likely to have Alzheimer's disease include those whose cognitive function has been suggested to be impaired or likely to be impaired by a cognitive function test such as the Mini Mental State Examination (MMSE), those whose brains show deposition of proteins known to accumulate in Alzheimer's disease patients, such as amyloid beta and tau protein, or whose cerebrospinal fluid levels are higher than those observed, and those whose brain metabolic function has been impaired or whose brain tissue has atrophy. In these cases, the Alzheimer's disease may be sporadic or familial Alzheimer's disease, and in another embodiment, it may be sporadic Alzheimer's disease. In these cases, the Alzheimer's disease may be late-onset Alzheimer's disease (LOAD) occurring in people aged 65 or older or early-onset Alzheimer's disease (EOAD) occurring in people under 65 years of age, or in another embodiment, late-onset Alzheimer's disease. In other words, the subject in one embodiment of the first aspect of the present disclosure may be either 65 years of age or older or younger than 65 years of age, or in another embodiment, 65 years of age or older.

[0028] In one embodiment, the subject according to the present disclosure may be a subject with the APOE4 genotype (an APOE4-positive subject). Apolipoprotein E (hereinafter also referred to as "APOE") is a lipid-binding protein that binds to the low-density lipoprotein receptor and is one of the proteins involved in lipid metabolism. APOE alleles are known as one of the genetic risk factors for the development of Alzheimer's disease. There are three major variants of APOE: ε2, ε3, and ε4, distinguished by the amino acids at residues 112 and 158 (hereinafter referred to as APOE2, APOE3, and APOE4, respectively). APOE2 is a variant in which residues 112 and 158 are cysteine ​​and arginine, respectively. APOE3 is a variant in which residues 112 and 158 are cysteine ​​and arginine, respectively. APOE4 is a variant in which residues 112 and 158 are arginine. Among these, APOE4 is particularly a genetic risk factor for the development of Alzheimer's disease. It has been reported that, compared with a human subject having a homozygous allele of APOE3, a human subject having a heterozygous allele of APOE4 has a 3.68-fold higher probability of developing Alzheimer's disease, and a human subject having a homozygous allele of APOE4 has a 12.50-fold higher probability of developing Alzheimer's disease (Non-Patent Document 2). The present inventors have found that EDIL3 is secreted in particularly large amounts in cells from subjects having the APOE4 genotype, and that when cultured in a culture medium containing EDIL3, the neurons exhibit an Alzheimer's disease phenotype. In the present disclosure, a subject having the APOE4 genotype may be a subject having a homozygous or heterozygous genotype of APOE4, or in another embodiment, a subject having a homozygous genotype of APOE4.In other words, in the present disclosure, a subject having the APOE4 genotype may be a subject having the APOE4 / 4, APOE3 / 4 or APOE2 / 4 genotype, or a subject having the APOE4 / 4 or APOE3 / 4 genotype, and in a preferred embodiment, a subject having the APOE4 / 4 genotype.

[0029] According to one embodiment of the first aspect of the present disclosure, a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease may include detecting the presence or absence of an APOE4 allele in a subject (evaluating whether the subject has an APOE4 genotype). Detecting the presence or absence of an APOE4 allele in a subject can be performed, for example, by collecting a biological sample from the subject and evaluating the presence or absence of an APOE4 allele in the biological sample. The biological sample in this case is not particularly limited as long as it can be used to evaluate the presence or absence of an APOE4 allele. Examples of the biological sample include cerebrospinal fluid, plasma, serum, whole blood, saliva, sputum, nipple secretions, urine, sweat, tissue, cells (including glial cells), and pancreatic juice. In another embodiment, the biological sample may be plasma, serum, or whole blood. The biological sample may be obtained from the brain or central nervous system of the subject, including cerebrospinal fluid. Furthermore, the method for detecting the presence or absence of the APOE4 allele in a subject may be a method commonly used by those skilled in the art, such as a method using a sequencer such as a next-generation sequencer (NGS), an invader assay method, a FISH (Fluorescence In Situ Hybridization) method, an immunostaining method, a PCR-RFLP (Restriction Fragment Length Polymorphism) method, a PCR-SSCP (Single Strand Conformation Polymorphism) method or a TaqMan method, or an MLPA (Multiplex Ligation-dependent Probe Amplification) method.

[0030] In the first aspect of the present disclosure, quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject is typically carried out by quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample collected from the subject. That is, in another embodiment, the first aspect of the present disclosure may also be a method for assisting in the diagnosis of Alzheimer's disease, a method for collecting data for diagnosing Alzheimer's disease, or a method for diagnosing Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample obtained from a subject. In these cases, quantifying EDIL3 may comprise contacting the biological sample obtained from the subject with an anti-EDIL3 antibody or an EDIL3-binding fragment thereof. The biological sample collected from the subject is not particularly limited and may be, for example, cerebrospinal fluid, plasma, serum, whole blood, saliva, sputum, nipple secretion, urine, sweat, tissue, cells (including glial cells), or pancreatic juice, and in another embodiment, may be cerebrospinal fluid, plasma, serum, or whole blood, or in another embodiment, may be cerebrospinal fluid. The biological sample may be obtained from the brain or central nervous system region of the subject, including cerebrospinal fluid.

[0031] Quantification of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a biological sample can be performed by a method commonly used by those skilled in the art, for example, quantitative PCR (qPCR) or quantitative reverse transcription PCR (RT-qPCR) using the nucleic acid primers according to an embodiment of the first aspect of the present disclosure, FISH, Invader assay, or RACE using the nucleic acid probe according to an embodiment of the first aspect of the present disclosure, or ELISA or Western blotting using the anti-EDIL3 antibody or an EDIL3-binding fragment thereof according to an embodiment of the first aspect of the present disclosure, in accordance with protocols commonly used by those skilled in the art.

[0032] In a first aspect of the present disclosure, when the amount (concentration) of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 obtained by quantification in a subject is high, it is possible to assist in the diagnosis of the presence, onset, or progression of Alzheimer's disease in the subject, or the possibility or high probability of Alzheimer's disease, collect data for diagnosis, or perform a diagnosis. More specifically, if the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject is greater than a predetermined value (control), data can be collected to assist in or diagnose that the subject is suffering from or likely to suffer from Alzheimer's disease. The predetermined value may be, for example, the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a control subject, and the control subject may be a subject not suffering from Alzheimer's disease, an APOE4-negative subject (e.g., a subject having the APOE3 / 3 genotype), or an APOE4-negative subject (e.g., a subject having the APOE3 / 3 genotype) and not suffering from Alzheimer's disease. In one embodiment, the predetermined value may be the upper limit of a 68% or 95% confidence interval when the distribution of the amounts of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control subjects is fitted as a normal distribution, or may be 1.1-fold, 1.2-fold, 1.3-fold, 1.5-fold, 1.7-fold, 2-fold, 3-fold, 4-fold, 5-fold, 7-fold, 10-fold, 15-fold, or 20-fold the mean or median amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control subjects. In one embodiment, the quantification of the mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the subject may be based on a measured value (e.g., absorbance or fluorescence intensity) obtained by the method described above, instead of the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3, or may be based on a comparison of the measured value with a predetermined value obtained by a method similar to that described above.

[0033] Another aspect of the present disclosure may be a method for treating Alzheimer's disease, comprising administering a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease to a subject in whom the amount of EDIL3 quantified in the method for assisting in the diagnosis of Alzheimer's disease, the method for collecting data for diagnosing Alzheimer's disease, or the method for diagnosing Alzheimer's disease according to an embodiment of the first aspect of the present disclosure is determined to be higher than that of a control. In one embodiment, the pharmaceutical composition or therapeutic agent in these cases may comprise a therapeutically effective amount of a substance that inhibits EDIL3 according to the second aspect of the present disclosure described below. The substance that inhibits EDIL3 may be, for example, a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function. In addition, the pharmaceutical composition or therapeutic agent in these cases may comprise, for example, an anti-amyloid beta antibody (e.g., an anti-amyloid beta protofibril antibody) or an agent that inhibits the production or accumulation of amyloid beta in the brain.

[0034] The kit according to the first aspect of the present disclosure may further include instructions for use (package insert), which may be in paper form or may be electronic. In one embodiment, the instructions may describe content corresponding to one embodiment of the method for assisting in the diagnosis of Alzheimer's disease, the method for collecting data for diagnosing Alzheimer's disease, or the method for diagnosing Alzheimer's disease according to the first aspect of the present disclosure.

[0035] <Second Aspect> A second aspect of the present disclosure is a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising a substance that inhibits EDIL3. One embodiment of the second aspect of the present disclosure is a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, wherein the substance that inhibits EDIL3 is a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function. A particular embodiment of the second aspect of the present disclosure is a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising a therapeutically effective amount of a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function.

[0036] A "pharmaceutical composition" or "therapeutic agent" in this disclosure is understood to mean a substance that produces a desired effect in a tissue, animal, mammal, human, or other subject.

[0037] In this disclosure, "treating" and its derivatives refer to therapeutic therapy. With reference to a specific condition, treating means (1) ameliorating the condition or one or more biological manifestations of the condition; (2) interfering with (a) one or more points in the biological cascade leading to or causing the condition, or (b) one or more biological manifestations of the condition; (3) alleviating one or more symptoms, effects, or side effects associated with the condition, or one or more symptoms, effects, or side effects associated with the condition or its treatment; or (4) slowing the progression of the condition or one or more biological manifestations of the condition. As used herein, "slowing" the progression of Alzheimer's disease means postponing, preventing, slowing, retarding, stabilizing, and / or prolonging the progression of the disease and / or slowing progression, or altering the underlying disease course and / or process once it has developed. This delay can be of varying lengths of time, depending on the history of the disease and / or the individual being treated. As will be apparent to one of skill in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. A method that "delays" the progression of Alzheimer's disease is one that reduces the probability of disease onset within a given period of time and / or reduces the extent of the disease within a given period of time, including stabilizing one or more symptoms attributable to the disease (e.g., abnormalities in memory, problem-solving, language, calculation, visuospatial perception, judgment and / or behavior, inability to care for oneself), compared to the absence of the method. Such comparisons may generally be based on clinical trials using a sufficient number of subjects to achieve statistically significant results. The progression of Alzheimer's disease can be detected using standard clinical techniques such as standard neurological examinations, patient interviews, neuroimaging, detection of changes in specific protein levels in serum or cerebrospinal fluid (e.g., amyloid peptides and / or tau), computed tomography (CT), magnetic resonance imaging (MRI), and / or positron emission tomography (PET) brain imaging of amyloid or tau."Progression," as used herein, may also refer to the progression of a disease, which may initially be undetectable, and may include onset, recurrence, worsening, and / or development.

[0038] In this disclosure, a "therapeutically effective amount" refers to an amount that is effective to elicit a desired biological or pharmaceutical response in a tissue system, animal, or human. In one embodiment, a therapeutically effective amount refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result (e.g., amelioration or prevention of symptoms, or prolongation of survival). In one embodiment, a therapeutically effective amount is an amount that does not exceed the maximum tolerated dose.

[0039] The "pharmaceutical composition" or "therapeutic agent" of the present disclosure can be administered by injection, oral, nasal, transdermal, pulmonary, or ophthalmic route. Examples of injections include intravenous, subcutaneous, intradermal, and intraarterial injections, as well as local injections into target cells or organs, such as spinal injections. Examples of dosage forms of the pharmaceutical composition or therapeutic agent for oral administration include tablets, powders, granules, syrups, capsules, and oral liquids. Examples of dosage forms of the pharmaceutical composition or therapeutic agent for parenteral administration include injections, drips, eye drops, ointments, suppositories, suspensions, poultices, lotions, aerosols, and plasters, and in one embodiment, the pharmaceutical composition or therapeutic agent is an injection or drip. The pharmaceutical composition or therapeutic agent according to the present disclosure can be formulated, for example, by a method described in the 18th Edition of the Japanese Pharmacopoeia (JP), the United States Pharmacopoeia (USP), or the European Pharmacopoeia (EP).

[0040] The present inventors have found that neurons exposed to EDIL3 in the pericellular environment exhibit an Alzheimer's disease phenotype. More specifically, they have found that neurons exposed to EDIL3 in the pericellular environment exhibit a decrease in the density of dendritic spines. Therefore, without wishing to be bound by any theory, it is believed that if the amount of EDIL3 in the environment of neurons in a subject with Alzheimer's disease can be reduced by using a substance that suppresses EDIL3 expression, promotes EDIL3 degradation, or inhibits EDIL3 function, Alzheimer's disease can be treated by suppressing neuronal dysfunction (e.g., neuronal morphological abnormalities), which are phenotypes of Alzheimer's disease. That is, the second aspect of the present disclosure may, in one embodiment, be a method for treating Alzheimer's disease, comprising administering a substance that inhibits EDIL3 to a patient in need thereof, and in another embodiment, may be a method for treating Alzheimer's disease, comprising administering a substance that suppresses the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3 to a patient in need thereof.

[0041] In the present disclosure, a substance that inhibits EDIL3 means a substance that can suppress the action of EDIL3 on nerve cells in a subject to which it is administered, and may be, for example, a substance that suppresses the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

[0042] The substance that suppresses the expression of EDIL3 is not particularly limited as long as it is a substance that can suppress the expression of EDIL3 in the body of a subject, but in one embodiment, it may be a nucleic acid that suppresses the expression of EDIL3. Examples of such a nucleic acid that suppresses the expression of EDIL3 include an antisense nucleic acid (ASO) or siRNA (small interfering RNA) that targets EDIL3. The base length of the nucleic acid contained in these antisense nucleic acids or siRNAs is not particularly limited as long as it is capable of suppressing the expression of EDIL3, and may be, for example, 5 or more bases, 8 or more bases, 10 or more bases, 13 or more bases, 15 or more bases, 17 or more bases, 18 or more bases, 19 or more bases, 20 or more bases, or 21 or more bases, or 100 or less bases, 70 or less bases, 50 or less bases, 40 or less bases, 35 or less bases, 30 or less bases, 27 or less bases, 25 or less bases, 24 or less bases, or 23 or less bases, and examples of the base length range may be 5 to 100 bases, 8 to 70 bases, 10 to 50 bases, 13 to 40 bases, 15 to 35 bases, 17 to 30 bases, 18 to 27 bases, 19 to 25 bases, 20 to 24 bases, or 21 to 23 bases. Furthermore, the nucleic acid (e.g., antisense nucleic acid or siRNA) that suppresses the expression of EDIL3 according to the second aspect of the present disclosure has a region (complementary region) complementary to mRNA or cDNA encoding EDIL3, and the percentage of complementarity between the sequence of the complementary region and the sequence of the binding site of the nucleic acid that suppresses the expression of EDIL3 in mRNA or cDNA encoding EDIL3 may be 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100% of the base sequence (number of bases) belonging to the complementary region, or in another embodiment, 90% or more, or in another embodiment, 100%. The base length of the complementary region in the nucleic acid that suppresses the expression of EDIL3 according to the second aspect of the present disclosure is not particularly limited, and may be, for example, 5 to 100 bases, 8 to 50 bases, 10 to 40 bases, 12 to 35 bases, 13 to 30 bases, 14 to 27 bases, 15 to 25 bases, 16 to 24 bases, 17 to 23 bases, or 18 to 22 bases.Furthermore, the nucleic acid that suppresses the expression of EDIL3 according to the second aspect of the present disclosure may have, in addition to the complementary region, a region (additional region) that is not complementary to the sequence of the complementary region, and the additional region may be located at the 5'-end and / or 3'-end of the nucleic acid, and the base length of the additional region may be, for example, 1 base, 2 bases, 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, or 10 bases. In these cases, the mRNA or cDNA encoding EDIL3 targeted by the antisense nucleic acid or siRNA is the same as that described in the first aspect of the present disclosure.

[0043] The substance that promotes the degradation of EDIL3 is not particularly limited as long as it is a substance that can promote the degradation of EDIL3 in the body of a subject, but in one embodiment, the substance that promotes the degradation of EDIL3 may be an anti-EDIL3 antibody or an antigen-binding fragment thereof. As such an anti-EDIL3 antibody or antigen-binding fragment thereof, the anti-EDIL3 antibody and antigen-binding fragment thereof described in the first aspect of the present disclosure can be used.

[0044] In the present disclosure, inhibiting the function of EDIL3 means inhibiting neuronal dysfunction caused by EDIL3. In the present disclosure, a substance that inhibits the function of EDIL3 means a substance that inhibits neuronal dysfunction caused by EDIL3. The substance that inhibits the function of EDIL3 may be, for example, a compound that inhibits the function of EDIL3 (a compound specific to EDIL3), and the compound specific to EDIL3 may be a low-molecular-weight compound (e.g., a compound with a molecular weight of 1,000 or less). Furthermore, the substance that inhibits the function of EDIL3 may be, for example, a low-molecular-weight compound, a nucleic acid, a peptide, or an anti-EDIL3 antibody or an antigen-binding fragment thereof that inhibits neuronal dysfunction caused by EDIL3, and these may have binding affinity to EDIL3 or an EDIL3-binding site in neurons or its related proteins.

[0045] In one embodiment, the substance that inhibits EDIL3 according to the second aspect of the present disclosure may be a nucleic acid that suppresses the expression of EDIL3, an anti-EDIL3 antibody or an antigen-binding fragment thereof, or a compound against EDIL3, and in another embodiment, it may be a nucleic acid that suppresses the expression of EDIL3, or an anti-EDIL3 antibody or an antigen-binding fragment thereof.

[0046] According to a second aspect of the present disclosure, Alzheimer's disease can be treated by administering a substance that inhibits EDIL3 to a subject (e.g., a patient in need thereof). The subject according to the second aspect of the present disclosure is the same as the subject described in the first aspect of the present disclosure. The pharmaceutical composition or therapeutic agent according to one embodiment of the second aspect of the present disclosure may be for treating a subject having the APOE4 genotype. The subject of the treatment method according to one embodiment of the second aspect of the present disclosure may be a human subject having the APOE4 genotype. Furthermore, the Alzheimer's disease according to the second aspect of the present disclosure is the same as the Alzheimer's disease described in the first aspect of the present disclosure.

[0047] In one embodiment of the second aspect of the present disclosure, the dosage of the substance that inhibits EDIL3 may be, for example, 0.0001 μg to 10,000 mg of the composition per day in terms of the amount of active ingredient when administered to a human adult male (body weight 60 kg).

[0048] A pharmaceutical composition or therapeutic agent according to one embodiment of the second aspect of the present disclosure may further contain other components in addition to an EDIL3 inhibitor. Such other components may include additives commonly used in the pharmaceutical technology field, such as excipients, buffers, stabilizers, antioxidants, binders, disintegrants, fillers, emulsifiers, and flow regulators.

[0049] <Third Aspect> A third aspect of the present disclosure is a method for screening for a substance that inhibits EDIL3, comprising culturing neurons in a medium containing a test substance (i.e., contacting the test substance with the neurons, or exposing the neurons to the test substance). According to the screening method of the third aspect of the present disclosure, a substance that inhibits EDIL3 is selected from among the test substances. The EDIL3 inhibitor selected by the screening method of the third aspect of the present disclosure may be, for example, a substance that suppresses EDIL3 expression, a substance that promotes EDIL3 degradation, or a substance that inhibits EDIL3 function. In one embodiment, the EDIL3 inhibitor selected by the screening method of the third aspect of the present disclosure may be a nucleic acid that suppresses EDIL3 expression, an anti-EDIL3 antibody or an antigen-binding fragment thereof, or a compound specific to EDIL3, and the compound specific to EDIL3 may be a low-molecular-weight compound. Furthermore, the neurons in the screening method of the third aspect of the present disclosure may be neurons with an APOE4 genotype.

[0050] The present inventors have found that the presence of EDIL3 in an environment in which neurons reside results in the manifestation of an Alzheimer's disease phenotype, which is thought to be the cause of neuronal dysfunction. Thus, without wishing to be bound by any theory, an EDIL3 inhibitor may exhibit a therapeutic effect on Alzheimer's disease by inhibiting EDIL3 in a subject to which it is administered. That is, in the third aspect of the present disclosure, the EDIL3 inhibitor may be a substance for treating Alzheimer's disease (a substance for use as an active ingredient in a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease), or may be a substance administered to a human subject with the APOE4 genotype and suffering from Alzheimer's disease. In these cases, "inhibiting EDIL3" and "a substance that inhibits EDIL3" are defined in the same way as described in the second aspect of the present disclosure.

[0051] A first embodiment of the third aspect of the present disclosure is a method for screening for a substance that inhibits EDIL3, comprising culturing neurons in a medium containing EDIL3 and a test substance; and detecting an Alzheimer's disease phenotype in the neurons. The first embodiment of the third aspect of the present disclosure may also be a method for screening for an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising culturing neurons in a medium containing EDIL3 and a test substance; and detecting an Alzheimer's disease phenotype in the neurons, and the pharmaceutical composition or therapeutic agent may be one for administration to a human subject having the APOE4 genotype.

[0052] In one embodiment, the screening method according to the first embodiment of the third aspect of the present disclosure comprises culturing neurons in a medium containing EDIL3 and a test substance (exposure step); and detecting an Alzheimer's disease phenotype from the neurons (detection step).

[0053] In the exposure step, neuronal cells are exposed to EDIL3 in the presence of a test substance. The neuronal cells are not particularly limited, but are preferably primary neurons or iPSC-derived neurons. Primary neurons are preferably mammalian (e.g., human, mouse, or rat)-derived primary neurons, and iPSC-derived neurons are preferably iPSC-derived neurons prepared from mammalian (e.g., human, mouse, or rat) cells. The exposure step can be performed by culturing neuronal cells in a medium typically used by those skilled in the art for culturing neuronal cells, to which EDIL3 and the test substance have been added. The concentrations of EDIL3 and the test substance in the medium are not particularly limited; multiple media containing EDIL3 and the test substance at different concentrations (e.g., 0.01 μM, 0.1 μM, 1 μM, 10 μM, and / or 100 μM) may be tested, and screening may be performed based on the concentration dependency. The exposure time in the exposure step is not particularly limited as long as it is an exposure time that allows detection of an Alzheimer's disease phenotype when exposed to the same concentration of EDIL3 in the absence of a test substance, and may be, for example, 1 to 30 days, 2 to 15 days, or 3 to 10 days. The culture conditions are those commonly used by those skilled in the art (e.g., 37°C, 5% CO２ The nerve cells may be primary neurons, and the number of days in culture (DIV) for the primary neurons used in screening is not particularly limited, and may be, for example, 1 to 50, 3 to 40, 6 to 30, 9 to 27, 11 to 25, 14 to 23, or 16 to 21.

[0054] The test substance in the screening method according to the third aspect of the present disclosure is not particularly limited, but may be a substance that has low cell membrane permeability and can persist in the extracellular environment when administered to a human subject, since EDIL3 is a protein present in the extracellular matrix. The test substance in the screening method according to the third aspect of the present disclosure may be, for example, a test substance contained in a library constructed (constructed) of substances expected to have some physiological activity. Examples of such libraries include a compound library containing small molecule compounds (e.g., a molecular weight of 50 to 10,000 or 100 to 2,000), a nucleic acid library (aptamer library) containing nucleic acids (e.g., 10 to 100 bp or 20 to 50 bp), a peptide library containing peptides (e.g., 4 to 50 residues or 6 to 20 residues), or an antibody library containing anti-EDIL3 antibodies or antigen-binding fragments thereof. All of the candidate substances contained in such a library may be used as the test substance, or only some of the candidate substances preselected based on cell membrane permeability, in vivo stability, pharmacokinetics, or the like may be used as the test substance.

[0055] EDIL3 according to a first embodiment of the third aspect of the present disclosure may be artificially synthesized. Furthermore, EDIL3 according to a first embodiment of the third aspect of the present disclosure may be secreted from cells expressing EDIL3. The EDIL3-expressing cells may be cells that express EDIL3 under physiological conditions or cells overexpressing EDIL3 by transduction. However, from the viewpoint of exposing neurons to a large amount of EDIL3 to facilitate morphological changes and thereby improving screening efficiency, cells overexpressing EDIL3 by transduction are preferred. That is, the first embodiment of the third aspect of the present disclosure may be a screening method comprising: introducing a nucleic acid for expressing EDIL3 into cells or microorganisms; culturing the cells or microorganisms; recovering a culture supernatant from the culture of the cells or microorganisms; culturing neurons in a medium containing the recovered culture supernatant and a test substance; and evaluating the Alzheimer's disease phenotype from the neurons. In this case, introducing a nucleic acid for expressing EDIL3 into a cell or a microorganism; culturing the cell or microorganism; and recovering the culture supernatant from which the cell or microorganism has been cultured can be carried out according to methods commonly performed by those skilled in the art using materials and reagents commonly used by those skilled in the art for cell culture and transduction, within the scope of secreting an effective amount of EDIL3 into the recovered culture supernatant.

[0056] In the detection step, the Alzheimer's disease phenotype is detected and evaluated for the neurons exposed to EDIL3 in the presence of the test substance in the exposure step. As a result of the evaluation in the detection step, a test substance in which the Alzheimer's disease phenotype in the neurons is not detected or is detected but suppressed is selected as a substance that inhibits EDIL3 or an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease.

[0057] The evaluation of the Alzheimer's disease phenotype in neurons in the detection step is not particularly limited as long as it can determine whether or not Alzheimer's disease can be induced based on the presence or absence of a phenotype or the severity of the phenotype. For example, it may involve evaluating the morphology, transcriptome, metabolites, or proteome of neurons. From the viewpoint of simplicity, in another embodiment, it may involve evaluating the morphology of neurons. When the evaluation of the Alzheimer's disease phenotype in neurons in the detection step involves evaluating the morphology of neurons, from the viewpoint of simplicity, the neurons may be fluorescently labeled. The fluorescent labeling may be, for example, transduction of a cytoplasmically or plasma membrane-localized fluorescent protein (e.g., GFP or DsRed) or introduction of a fluorescent protein into a cytoskeletal protein such as actin. The evaluation of the Alzheimer's disease phenotype in neurons may include, for example, detecting a change in the number (density) of neuronal spines. The present inventors have found that a decrease in neuronal spine density is observed in primary neurons cultured in the presence of EDIL3.

[0058] As an example of evaluation in the detection step, for example, a test substance in which an Alzheimer's disease phenotype is not detected in neurons, or is detected but suppressed, is selected as a substance that inhibits EDIL3 or an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease. In this case, "an Alzheimer's disease phenotype is not detected" may be determined by a method commonly used by those skilled in the art, and may mean, for example, that no qualitative difference in phenotype is observed between neurons exposed to EDIL3 and those not exposed to EDIL3, or that no statistically significant difference in quantitative phenotype (e.g., dendritic spine density) is observed. Furthermore, the phrase "an Alzheimer's disease phenotype is detected but suppressed" may be determined by a method commonly used by those skilled in the art, and may mean, for example, that an Alzheimer's disease phenotype (e.g., dendritic spine density) is detected at a statistically significant level in comparison with neurons not exposed to EDIL3, but the p-value between neurons not exposed to EDIL3 is smaller when compared with neurons exposed to EDIL3 in the absence of the test substance, or that an Alzheimer's disease phenotype is significantly suppressed in comparison with neurons exposed to EDIL3 in the absence of the test substance (e.g., a decrease in dendritic spine density is significantly suppressed).

[0059] A second embodiment of the third aspect of the present disclosure is a method for screening for a substance that inhibits EDIL3, comprising culturing EDIL3-expressing cells and neurons in a medium containing a test substance (co-culturing EDIL3-expressing cells and neurons, a co-culturing step); and detecting an Alzheimer's disease phenotype in the neurons (a detection step). The second embodiment of the third aspect of the present disclosure may also be a method for screening for an active ingredient of a pharmaceutical composition or therapeutic agent for treating Alzheimer's disease, comprising culturing EDIL3-expressing cells and neurons in a medium containing a test substance; and detecting an Alzheimer's disease phenotype in the neurons.

[0060] The second embodiment of the third aspect of the present disclosure can be carried out in the same manner as the first embodiment of the third aspect of the present disclosure, except that the EDIL3 to which the neurons are exposed is EDIL3 secreted by cells that express EDIL3. That is, the co-culture step in the second embodiment of the third aspect of the present disclosure can be carried out in the same manner as the exposure step according to the first embodiment of the third aspect of the present disclosure, except that EDIL3 or a culture supernatant containing EDIL3 is not added to the culture environment of the neurons, and instead, co-culture is performed with cells that express EDIL3. In this case, the period for co-culturing the EDIL3-expressing cells and the neurons in the co-culture step is not particularly limited, as long as it is a period during which an Alzheimer's disease phenotype can be detected when the cells are similarly co-cultured in the absence of the test substance, and may be, for example, 1 to 30 days, 2 to 15 days, or 3 to 10 days. The culture conditions can be those typically used by those skilled in the art (e.g., 37°C, 5% CO ２ , 100% humidity). Furthermore, the co-culture in the co-culture step may be performed by, for example, first attaching the EDIL3-expressing cells and the neuronal cells to a culture vessel in a spatially separated state using a culture insert or the like, and then culturing both cells in the same culture medium by removing the culture insert or the like. Furthermore, the detection step in the second embodiment of the third aspect of the present disclosure may be performed in the same manner as the exposure step in the first embodiment of the third aspect of the present disclosure.

[0061] According to a second embodiment of the third aspect of the present disclosure, EDIL3-expressing cells may be cells that express EDIL3 under physiological conditions or cells in which EDIL3 has been overexpressed by transduction. Cells that express EDIL3 under physiological conditions may be, for example, glial cells, and the glial cells may be, for example, astrocytes. EDIL3 transduction in cells that have been overexpressed by transduction can be performed according to methods commonly employed by those skilled in the art using materials and reagents commonly employed for transduction. Thus, the cells transduced with EDIL3 are not particularly limited and may be, for example, glial cells such as astrocytes, or cultured cell lines (cell lines) in which protein transduction is commonly performed, such as HEK293 cells, HeLa cells, or NIH3T3 cells.

[0062] A third embodiment of the third aspect of the present disclosure is a method for screening for a substance that inhibits EDIL3, comprising culturing cells that express EDIL3 in a medium containing a test substance (contacting step); and evaluating the expression or secretion of EDIL3 (evaluating step).

[0063] The EDIL3-expressing cells in the third embodiment of the third aspect of the present disclosure can be the same as the EDIL3-expressing cells in the second embodiment of the third aspect of the present disclosure. The contacting step in the third embodiment of the third aspect of the present disclosure can be carried out in the same manner as the exposing step in the first embodiment of the third aspect of the present disclosure, except that the EDIL3-expressing cells are used instead of neuronal cells, and the EDIL3-expressing cells are not exposed to EDIL3 that is not derived from the EDIL3-expressing cells.

[0064]

[0042] Evaluating EDIL3 expression or secretion in the evaluation step according to a third embodiment of the third aspect of the present disclosure may involve quantifying EDIL3-encoding mRNA, cDNA complementary to the mRNA, or EDIL3 in cells expressing the EDIL3, a cell lysate prepared from the cells, or a culture supernatant obtained by culturing the cells. As a specific example, it may involve quantifying EDIL3 in a medium (a culture supernatant obtained by culturing the EDIL3-expressing cells). In this case, EDIL3 may be quantified using, for example, an anti-EDIL3 antibody or an EDIL3-binding fragment thereof. Quantifying EDIL3-encoding mRNA, cDNA complementary to the mRNA, or EDIL3 according to a third embodiment of the third aspect of the present disclosure may be performed by the same method as described in the first aspect of the present disclosure.

[0065] In the evaluation step according to the third embodiment of the third aspect of the present disclosure, for example, if the expression or secretion of EDIL3 in cells expressing EDIL3 exposed to the test substance (EDIL3-expressing cells to be evaluated) is lower than the expression or secretion of EDIL3 in cells expressing EDIL3 prepared in the same manner but not contacted with the test substance (control), the test substance can be selected as a substance that inhibits EDIL3. For example, if the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in EDIL3-expressing cells exposed to the test substance is lower than the amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control, the test substance can be selected as a substance that inhibits EDIL3. For example, if the average amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in EDIL3-expressing cells exposed to the test substance is 0.9-fold or less, 0.8-fold or less, 0.7-fold or less, 0.6-fold or less, 0.5-fold or less, 0.4-fold or less, 0.3-fold or less, 0.2-fold or less, or 0.1-fold or less than the average amount of mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in the control, the test substance may be selected as a substance that inhibits EDIL3.

[0066] The terms "comprising" or "including" as used herein are intended to be open-ended and inclusive, unless the context clearly dictates otherwise, and do not exclude additional, unrecited features, but rather encompass the closed terms "consisting of" or "consisting essentially of."

[0067] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by a person skilled in the art to which this invention belongs. Terms used herein should be interpreted as having a meaning consistent with the meaning in this specification and the related technical field, and should not be interpreted in an idealized or overly formal sense, unless otherwise defined.

[0068] The present disclosure will be described in more detail below using examples, but the present disclosure is not limited to the following examples. Note that induced pluripotent stem cells (iPS cells) will also be referred to as iPSCs, and human astrocytes obtained by inducing iPSCs will also be referred to as iPasts.

[0069] <Experimental Methods> Unless otherwise specified, the examples were carried out according to the experimental methods described below.

[0070] Study Design: Our goal was to clarify the detailed molecular mechanisms underlying astrocyte APOE4-mediated synaptic pathophysiology in Alzheimer's disease (AD). We first generated a human astrocyte cell model (iPast) derived from isogenic iPSCs expressing APOE3 or APOE4. After confirming that APOE3 / 3 and APOE4 / 4 iPasts exhibited an overall astrocytic profile regardless of genotype, we developed a coculture system of human iPasts and mouse primary hippocampal neurons using culture inserts to examine the effects of astrocytic factors on synaptic integrity. We tested the hypothesis that the APOE4 astrocytic toxic factor induces dendritic spine degeneration. Two independent clones (#87 and #89) were used entirely for isogenic iPSCs carrying the APOE4 / 4 genotype. The sample size was selected based on our extensive experience with iPast culture. For molecular / biochemical results, at least three culture batches were used for each experimental genotype. Transcriptome analysis was performed using three culture batches of parent APOE3 / 3 iPast and one culture batch of isogenic iPast carrying each APOE4 / 4 genotype (#87-5, #87-8, #89-1, and #89-8). All animal experiments were performed in accordance with the National Institute of Health Sciences and the Ministry of Education, Culture, Sports, Science and Technology (MEXT) Guidelines for Experimental Animals and were approved by the Keio University Animal Care and Use Committee in accordance with the same guidelines (approval number 15093). Human ethics were approved by the Keio University School of Medicine Ethics Committee (approval number: 20080016).

[0071] <Culturing of undifferentiated iPSCs> A healthy control human iPS cell line, 201B7 (36-year-old female, Caucasian), was cultured in StemFit / AK02N (Ajinomoto Co., Inc.) in the absence of feeder cells (feeder-free cultures). iPSCs were passaged every 7 days using 0.5x TrypLE select (Thermo Fisher Scientific) to a density of 1.5x10 ４Cells were seeded at 1.5 μg / ml iMatrix-511 silk (Laminin-511 E8, Nippi)-coated 6-well plates at 1 cell / well in the presence of 10 μM Y27632 (Nacalai). The medium was changed every 2 days. For on-feeder iPSC cultures, cells were grown on mitomycin C-treated SNL mouse fibroblast feeder cells in human ESC medium: Dulbecco's modified Eagle's medium: nutrient mixture F-12 (DMEM / F12, Sigma) containing 20% ​​knockout serum replacement (KSR, Life Technologies), 0.1 mM non-essential amino acids (NEAA, Sigma), 0.1 mM 2-mercaptoethanol (Sigma), and 4 ng / ml fibroblast growth factor 2 (FGF-2, PeproTech) at 3% CO. ２ The mixture was maintained in an atmosphere containing

[0072] <Statistical Analysis> Data are shown as mean ± standard error (Mean ± S.E.). Statistical significance was defined as p<0.05. Data were analyzed using R version 4.0.0 (The R Foundation) or Prism software (GraphPad Software, Ver. 8.2.0).

[0073] <Construction of APOE targeting vector for gene editing> To construct a targeting vector for the APOE allele, first, 3.36 kb of genomic DNA containing exons 3 and 4 was amplified by PCR using the primer pair 5'-GGGCTGCGTTGCTGGTCACATT-3' (SEQ ID NO: 27) and 5'-ACCCCATCTCCACACACACCAC-3' (SEQ ID NO: 28) and genomic DNA of ax7111 iPSCs harboring APOE4 / 4 as a template, and subcloned into pCR-Blunt II-TOPO vector (Invitrogen). After sequence confirmation, a 1.10 kb left arm fragment (L1) encompassing the third exon of the APOE gene, a 1.23 kb right arm fragment (R1), and a 0.47 kb right arm fragment (R2) whose combined right arm encompasses the fourth exon of the APOE gene were amplified by PCR using the above plasmid as a template. The PCR primers for the left arm L1 were 5'-CAACTTTGTATAATAAAGTTGAGTGCAGTGGCGGGATCTCG-3' (SEQ ID NO: 11) and 5'-ATGATTATCTTTCTAGGGTTAACGACAGGGGCAGAATGAAACC-3' (SEQ ID NO: 12), and the primer for the right arm R1 was 5'-CAGACTATCTTTCTAGGGTTAACTGGGTCTCTGCTG The primers for the right arm R1 were 5'-CCATGGGATCCCACGCCACCCCGTGCCTCCTG-3' (SEQ ID NO: 15) and 5'-CAACTTTGTATAGAAAGTTGAGGAGTTTTGAGACCTGCCTGG-3' (SEQ ID NO: 16). These genomic fragments were used as the 5'-(L1) and 3'-(R1 and R2) homologous regions in the APOE targeting vector. The L1 fragment was subcloned into the HpaI site in the pENTR2-L3-HpaI-PBL-R1 plasmid (#403) using the In-Fusion HD Cloning Kit (Takara Bio).Both the R1 and R2 fragments were subcloned into the HpaI site of the pENTR2-R2-PBR-HpaI-L4 plasmid (#404) using the In-Fusion HD Cloning Kit. The targeting plasmid was constructed by a modified Multisite Gateway-based method according to Non-Patent Document 11. These plasmids, each with a 5'- or 3'-targeting arm, were confirmed by Sanger sequencing and then constructed into a backbone vector (#0042, pUC-DEST-R3R4) along with a selectable marker cassette plasmid (#0102, pENTR-L1-PGK-puroΔTK-L2) using Gateway LR Clonase II enzyme mixture (Thermo Fisher Scientific). To select iPSC clones carrying the targeted allele, the selectable marker cassette plasmid contained a puroΔTK (a truncated fusion protein of puromycin N-acetyltransferase and herpes simplex virus type 1 thymidine kinase) cassette flanked by two inverted terminal repeats (ITRs), allowing removal of the puroΔTK gene with piggyBac transposase. To generate a plasmid expressing a single guide RNA (sgRNA) for APOE genome editing, the following oligonucleotides were annealed and inserted into the Bbs I site of pSpCas9(BB)-2A-GFP (Addgene, PX458), which allows simultaneous expression of Streptococcus pyogenes Cas9 (SpCas9) and GFP. The oligonucleotides used for APOE sgRNA1 were 5'-CACCGGCCCCCCCAAGACTTAGCGAC-3' (SEQ ID NO: 17) and 5'-AAACGTCGCTAAGTCTTGGGGGGCC-3' (SEQ ID NO: 18), and the oligonucleotides used for APOE sgRNA2 were 5'-CACCGCGGGGTGGCGTGGGGGTCGCA-3' (SEQ ID NO: 19) and 5'-AAAACTGCGACCCCACGCCACCCCGC-3' (SEQ ID NO: 20).

[0074] Generation of isogenic iPSCs expressing APOE4 / E4: To generate iPSCs carrying the targeted APOE4 / E4 allele, 201B7 iPSCs were electroporated with the targeting vector along with two sgRNA expression plasmids. After 48 hours, puromycin was added to the culture at 1.0 μg / ml, and surviving iPSC clones were selected after puromycin selection. Genomic DNA surrounding the target region of all 36 iPSC clones was first amplified by PCR using the primer pair for APOE genomic cloning described above, which encompassed both homologous recombination arms. Next, nested PCR was performed using the primer pair 5'-AAGAAGCATTTGTGGAGCACC-3' (SEQ ID NO: 21) and 5'-TGAATCTTTATTAAACTAGG-3' (SEQ ID NO: 22), which encompassed the two sgRNA target sequences. Nine iPSC clones were positive for proper homologous recombination in both alleles, generating a 4795-bp band representing the targeted allele. These homozygous clones were further analyzed by digesting the sgRNA2 sequence with the de novo BamHI site. Three of the nine iPSC clones were confirmed to have de novo BamHI sites in both alleles. Furthermore, sequencing of the targeted alleles of two clones (#87 and #89) confirmed APOE4 / 4. To generate iPSCs with the correct APOE4 / 4 allele, the selection cassette was removed by introducing a plasmid expressing the excision-only piggyBac transposase (PBx) into the established targeted clones, followed by selection under 10 μM ganciclovir treatment for 10 days. Finally, two successful APOE4 / 4 clones were obtained from each targeted clone (#87-5, #87-8, #89-1, and #89-8).

[0075] <Induction of iPSC-derived astrocytes (iPast)> iPSC colonies were cultured overnight in a suspension containing no FGF-2 and 10 μM Y-27632 (Nacalai, San Diego, CA, USA) at 3% CO ２Embryoid bodies (EBs) were formed in humidified air at 17°C. From the next day, EBs were suspended in EB medium (DMEM / F12 containing 5% KSR, 1% L-glutamine, 0.8% NEAA, 0.1 mM 2-mercaptoethanol, and penicillin / streptomycin) to promote neural differentiation. The medium contained 3 μM SB431542 (Sigma) and 3 μM CHIR99021 (Focus Biomolecules) from days 1 to 3, 1 μM retinoic acid (Sigma) from days 4 to 7, and 1 μM retinoic acid and 1 μM purmorphamine (Cayman Chemical) from days 7 to 16. On day 16, EBs were removed and 1-4 × 10 cells were cultured in neurosphere medium consisting of a medium hormone mixture (MHM) supplemented with 2% B-27 (Nacalai), 0.8% NEAA, 1 μM purmorphamine, 20 ng / mL FGF-2, and 10 ng / mL epidermal growth factor (EGF, PeproTech). ５ cells / mL in 5% CO ２ The cells were cultured in suspension in humidified air at 4°C. The medium was changed every 4-6 days to allow the formation of primary neurospheres. On day 32, primary neurospheres were isolated and cultured at 1-4 x 10 cells / ml in neurosphere medium without purmorphamine. ５ On day 48, secondary neurospheres were dissociated and cultured at a density of 4 × 10 cells / mL in Matrigel (Corning)-coated 6-well plates in brain differentiation medium consisting of MHM containing 2% B-27, 0.8% NEAA, 10 ng / mL brain-derived neurotrophic factor (BDNF, R&D), and 10 ng / mL glial cell line-derived neurotrophic factor (GDNF, Alamone). ５ ~1 x 10 ６ cells / well in 5% CO ２ The cells were cultured in a humidified atmosphere at 87°C. The medium was changed every 7 days. When the cultures reached near confluence, iPasts were dissociated into single cells using Accutase (Nacalai). The dissociated cells were cultured in a 6-well plate coated with Matrigel at approximately 1 × 10 ６ The cells were passaged at a concentration of 1000 cells / well.

[0076] iPast culture and induction of A1 reactivity: Unless otherwise specified, iPasts were maintained in iPast differentiation medium. iPast cultures were harvested for analysis between passages 7 and 15. iPasts were also stored in serum-free CellBanker® 2 (Zenoaq). An A-1-like phenotype was induced by treating iPasts with a TIC cocktail (30 ng / ml TNFα (AF-300-01A, Peprotech), 3 ng / ml IL-1α (200-01A, Peprotech), and 400 ng / ml C1q (PRO-554L, Prospec)) in DMEM / F12 medium for 24 hours.

[0077] <Karyotype Analysis> G-banding analysis of iPS cell lines was performed by LSI Medience Corporation (Tokyo, Japan).

[0078] Quantitative reverse transcription PCR (qRT-PCR) Total RNA was purified using the RNeasy Mini Kit (QIAGEN) and reverse transcribed in the presence of random hexamers. qRT-PCR reactions were performed with cDNA and gene-specific primers using TB Green Premix Ex Taq II (TAKARA BIO Inc.) in a ViiA7 System (Applied Biosystems). Analysis was performed using at least three independent cultures, and the threshold cycle (Ct) values ​​of interest were normalized to those of GAPDH. The sequences of the primers used for EDIL3 and GAPDH are as follows: EDIL3: 5'-AGCATACCGAGGGGATACATT-3' (SEQ ID NO: 9) and 5'-CAAGGCTCAACTTCGCATTCA-3' (SEQ ID NO: 10) GAPDH: 5'-AGGCTGAGAACGGGAAGCTT-3' (SEQ ID NO: 23) and 5'-ACTCCACGACGTACTCAGCG-3' (SEQ ID NO: 24)

[0079] <Construction of Expression Plasmid> For the plasmid expressing human EDIL3 under the CAGGS promoter, the PCR product was first subcloned into the XbaI-EcoRI site of the pCAGGS vector and then confirmed by sequencing. The human EDIL3 cds fragment (1,446 base pairs) was amplified from human brain cDNA using specific primers with the sequences 5'-ATTTCTAGAATCATGAAGCGCTCGGTAGC-3' (SEQ ID NO: 25) and 5'-TAAGAATTCTCATTCCTCCTCCTGTGCAGC-3' (SEQ ID NO: 26).

[0080] Western analysis: Cultured cells were homogenized in RIPA buffer (50 mM Tris-Cl (pH 7.6), 150 mM NaCl, 0.5 mM EDTA, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, Complete protease inhibitor cocktail (Roche), 1 mM PMSF). Equal amounts of cell lysates (10-20 μg / lane) or culture medium were separated on an ExtraPage One precast gel (Nacalai Tesque) and transferred to a PVDF membrane. The membrane was blocked in 5% nonfat milk / Tris buffer solution (TBS) for 1 hour and incubated with specific antibodies: goat anti-ApoE (1:1000, AB947, Millipore), rabbit anti-EDIL3 (1:1000, ab190692, abcam), and mouse anti-actin (1:10000, A1978, Sigma). The membrane was then incubated with IRDye800 CW- or IRDye680-conjugated secondary antibodies (LI-COR Bioscience). Signals were detected and quantified using an Odyssey Infrared Imaging System (LI-COR Bioscience).

[0081] Immunocytochemistry: iPast or iPSC cultures in multiwell plates were fixed with 4% paraformaldehyde, blocked with a solution containing 5% FBS and 0.1% Triton X-100 for 1 hour at room temperature, and then incubated overnight at 4°C with primary antibodies: rat anti-GFAP (1:500, #13-0300, Thermofisher), mouse anti-S100β (1:500, S2532, Sigma), mouse anti-CD44 (1:200, MA5-13890, Thermofisher), rabbit anti-MAP2 (1:200, AB5622, Millipore), or mouse anti-SSEA-4 (1:500, abcam, ab16287). Cultures were then washed in phosphate-buffered saline and incubated with the appropriate Alexa Fluor (405, 488, 555, or 647)-conjugated secondary antibody (Invitrogen) for 1 h at room temperature. Signals were detected with an LSM 700 confocal microscope (Carl-Zeiss).

[0082] Enzyme-linked immunosorbent assay (ELISA) for APOE: iPast cultures were maintained in 12-well plates for 3 to 7 days. The harvested medium was centrifuged to remove insoluble material and stored at -80°C until analysis. After harvesting, cells were lysed in RIPA buffer, and protein concentration was measured by BCA protein assay (Pierce). 96-well plates were coated overnight at 4°C with ApoE antibody (AB947, Millipore) in 0.1 M carbonate buffer. The plates were blocked with 1% nonfat milk in PBS and then washed three times with PBST. Recombinant apoE3 (PeproTech) was used as a standard for ELISA quantification. Samples were appropriately diluted and incubated overnight at 4°C. The plates were washed and incubated with biotin-conjugated goat anti-ApoE antibody (1:10,000, Meridian Life Science) for 2 hours at room temperature. After incubation with streptavidin-horseradish peroxidase (1:1,000, Fitzgerald Industries) for 90 minutes at room temperature, the plates were stained by adding tetramethylbenzidine ultrasensitive substrate (T5569, Sigma) and incubating for approximately 5 minutes. The reaction was repeated in 1 M H２ SO ４ The plate was stopped at 450 nm and read at 450 nm using an iMark microplate reader (Bio-Rad). Each APOE concentration was normalized to the protein level of the culture.

[0083] Size Exclusion Chromatography (SEC) Approximately 8 ml of iPast medium in a 10 cm dish incubated for 7 days was concentrated using an Amicon Ultra Ultracel-30K (30 kDa cutoff, Millipore). The concentrated medium (approximately 0.7 ml) was loaded onto a Superdex 200 Increase 10 / 300 GL column (GE Healthcare). The column was developed with phosphate buffer (pH 7.4) containing 50 mM sodium phosphate and 150 mM NaCl at a flow rate of 0.5 ml / min. The eluate was monitored at 280 nm and collected in 0.5 ml fractions. A small aliquot of each fraction was analyzed by ELISA using the method described above.

[0084] Immunoprecipitation of APOE Particles: Streptavidin-conjugated agarose beads (Sigma) were incubated with biotin-conjugated goat anti-ApoE antibody (K74180B, Meridian Life Science) for 2 hours at room temperature with shaking. The anti-ApoE-agarose beads were mixed with iPast-conditioned medium overnight at 4°C. After washing, the agarose beads were resuspended in 100 μl of TBS with 0.1% Triton X-100. The amount of cholesterol dissolved in the supernatant was measured by Amplex Red cholesterol assay (Invitrogen). The beads were then suspended in 100 μl of 0.1 M glycine buffer (pH 2.5) and immediately neutralized with Tris-HCl (pH 8.8). The amount of APOE in the mixture was measured by APOE ELISA. The amount of APOE-associated cholesterol was determined by dividing the amount of total cholesterol by the amount of total APOE in the eluate.

[0085] <Intracellular lipid staining> For measurement of neutral lipid accumulation, iPasts were plated at 1 × 10 on a 96-well microplate μCLEAR (greiner, Cat# 655096) coated with 5% Matrigel (Corning) in PBS.４ Cells were seeded at 1000 x g / well. iPasts were incubated in DMEM / F12 supplemented with 2% FBS (Sigma) for 2 weeks. iPasts were treated with dimethyl sulfoxide (DMSO) or oleic acid (OA) (final concentration 200 μM) at 37°C for 16 hours. For neutral lipid staining, iPasts were treated with LipiBlue (final concentration 0.1 μM, Dojindo), calcein-AM (final concentration 1 μg / mL, Dojindo), or DRAQ5 (final concentration 5 μM, Cosmo Bio) in medium at 37°C for 1 hour. iPasts were then washed twice with DMEM / F12 and fixed with 4% paraformaldehyde in PBS at 4°C for 16 hours. Fixed cells were imaged using an IN Cell Analyzer 6000 (Cytiva), and a set of 4 x 4 fields was collected from each well using a 20x objective. Images were analyzed using In Cell Developer Toolbox version 1.92 (Cytiva). Round lipid particles stained with LipiBlue were counted in calcein-AM-positive cells. Round or oval nuclei stained with DRAQ5 were counted to identify cell number.

[0086] <Mouse primary hippocampal neuronal culture> Hippocampi from wild-type C57BL / 6J pups were dissected and treated with 0.25% trypsin for 12 minutes at 37°C. Cells were cultured at 65,000 cells / cm. ２ The cells were plated onto 12 mm glass coverslips (Costar) coated with poly-D-lysine (Sigma) at a density of 100 μg / ml. Primary hippocampal neurons were cultured in Neurobasal medium (Thermo Fisher Scientific) supplemented with 1% B27 and 1× GlutaMAX for 16 to 21 days in culture (DIV 16-21).

[0087] Neuronal Morphological Analysis: Primary neurons were sparsely transfected with a plasmid expressing actin-EGFP and a plasmid expressing DsRed protein at day 5-6 of culture (DIV 5-6) using Lipofectamine 2000 (Thermo Fisher Scientific). During the last 4-6 days, approximately 1 × 10 ５iPasts cells were co-cultured using Transwell 0.4 μm MemBrane Inserts (Corning). Cultures were fixed with 4% paraformaldehyde, permeabilized, blocked, and incubated overnight at 4°C with chicken anti-GFP (1:1000, Aveslab, GFP-1010) and rabbit anti-RFP (1:500, MBL, PM005) antibodies. Samples were then washed and incubated for 1 hour at room temperature with the appropriate Alexa Fluor® 488- or 555-conjugated secondary antibody (Invitrogen). After washing with PBS, coverslips were mounted on slides using ProLong Gold AntiFAde Reagent (Invitrogen). GFP-positive neurons were imaged using an LSM700 confocal microscope with a 63x lens. Each of these images was acquired in a z-stack with an average of 6-8 slices spaced 0.5 μm apart. The number of spines on secondary or tertiary neurites was counted using ImageJ software (NIH), and spine density was calculated by dividing the number of spines by the neurite length. DsRed signals were acquired using a confocal microscope with a 10x lens. Neurite complexity was analyzed using the ImageJ plugin, Sholl Analysis.

[0088] Mass Spectrometry Analysis: iPasts were maintained in the same iPast differentiation medium, but without phenol red. Proteins in the conditioned medium were denatured with 2 M urea in 100 mM Tris-HCl, pH 8.5, by sonication on ice for 10 min, reduced and alkylated with 10 mM tris(2-carboxyethyl)phosphine (Thermo Fisher Scientific) and 40 mM 2-chloroacetamide (FUJIFILM Wako), and digested overnight with 0.5 μg LysC and 0.5 μg trypsin. The resulting peptides were purified using a reverse-phase SDB-XC StageTip. After TMT (Tandem Mass Tag) labeling, the labeled peptides were fractionated into nine fractions using a high pH reverse-phase peptide fractionation kit (Thermo Fisher Scientific) with an elution solution containing the following concentrations of ACN: 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 35%, and 60%. An LC / MS / MS system consisting of an UltImate 3000 RSLC nano pump (Thermo Fisher Scientific) and an Orbitrap Fusion Lumos tribrid mass spectrometer (Thermo Fisher Scientific) equipped with a FAIMSpro interface (Thermo Fisher Scientific) was used. All fractions were divided into four parts and analyzed in quadruplicate at different FAIMS compensation voltages of -40, -55, -70, and 85. Peptides were injected using an HTC-PAL autosampler (CTC Analytics) and loaded onto a 15 cm fused silica emitter packed with 3 μm ReproSil-Pur C18-AQ (Nikkyo Technos). They were separated by the following linear gradient (solvent A, 0.1% formic acid; solvent B, 0.1% formic acid in 80% ACN): fractions 1–4: 5–10% B in 5 min, 10–30% B in 70 min, 30–99% B in 5 min, and 99% B in 10 min; fractions 5–9: 5–15% B in 5 min, 15–35% B in 70 min, 35–99% B in 5 min, and 99% B in 10 min. The flow rate was set at 300 nL / min. Peptides were ionized at 2000 V.All MS1 spectra were acquired on an Orbitap analyzer at a resolution of 120,000 in the m / z range of 400–1600. For subsequent MS / MS analysis, fragment ions were selected and isolated in the fastest possible mode (cycle time = 3 s, isolation window = 1.4 m / z), activated by collision-induced dissociation (collision energy = 35), and detected on an ion trap analyzer in turbo mode. For TMT-reporter ion quantification, MS3 scans were performed in synchronous precursor scan mode by isolating the top 10 intense fragment ions. For all scans, the maximum injection time was set to "auto." For MS and MS2 scans, the AGC target value was set to "normal" and for MS3 scans, it was set to 250%. The dynamic exclusion time was set to 30 s. The raw LC / MS / MS data were processed using MaxQuant (v. 1.6.17.0). Database searches were performed against the UniprotKB / SwissProt (March 2019) human database, which contains the human APOE4 sequence and concatenated isoforms. The following parameters were applied: 10-plex TMT quantification at the MS3 level, a precursor mass tolerance of 4.5 ppm, a fragment ion mass tolerance of 0.5 Da, and a minimum peptide length of 7 amino acids. Cysteine ​​carbamidomethylation was defined as a fixed modification, while methionine oxidation and acetylation at the protein N-terminus were defined as variable modifications. False discovery rates were estimated by searching against a reverse decoy database and filtered to <1% at the peptide-spectrum match and protein levels. TMT-reporter intensities were log2 transformed and normalized by the trimmed mean of M values.

[0089] Transcriptome analysis: Total RNA was purified using the RNeasy Mini Kit or RNeasy Micro Kit (QIAGEN). RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). 500 ng of total RNA was reverse transcribed, biotin-labeled, and hybridized to a Clariom S Array (Affymetrix) according to the protocol detailed by Affymetrix. Data were obtained from iPasts of APOE3 / 3 (201B7, n = 3 independent culture lots) and APOE4 / 4 (#87-5, #87-8, #89-1, #89-8, n = 4 lines total). Raw data were normalized using the Robust Multichip Analysis (RMA) algorithm. PCA and cluster heatmaps were analyzed using differentially expressed genes with logFC>0.5 or logFC<-0.5 (FDR p-val<0.05).

[0090] <Knockdown of EDIL3> The plasmids used for lentivirus production were pENTR4-H1, pCS-RfA-CG, pCMV-VSV-G, and pCAG-HIVgp. These plasmids were provided by the RIKEN BioResource Research Center (RIKEN BRC) through the National Bioresource Project of the Ministry of Education, Culture, Sports, Science and Technology of Japan (cat. RDB04395, RDB04390, RDB04392, and RDB04394). A knockdown lentivirus shuttle vector was constructed by inserting siRNA oligo DNA into the donor plasmid pENTR4-H1. The shuttle vector for knockdown contained the target sequence of an shRNA designed against human EDIL3 mRNA (5'-GTGGAATAGTACAGATCT-3', SEQ ID NO: 29), and the negative control contained a nonfunctional shRNA (5'-TAAGGTTAAGTCGCCCCTCG-3', SEQ ID NO: 30). These vectors were recombined into the lentiviral shuttle plasmid pCS-RfA-CG using the Gateway system. All constructs were confirmed by Sanger sequencing. These shuttle plasmids were packaged into self-inactivating lentiviruses according to the method described in Non-Patent Document 13.

[0091] Human brain tissue preparation. Postmortem human brain tissue was obtained from the Brain Bank for Aging Research (BBAR) at the Tokyo Metropolitan Institute of Gerontology and Gerontology under institutional ethics committee approval (approval number: R21-125). All AD cases met the Consortium to Establish a Registry for Alzheimer's Disease (CERAD) criteria for a definite diagnosis of AD. Parietal gray matter [BA = 39 / 40] from four AD patients and two healthy controls was analyzed.

[0092] Immunohistochemical staining and quantitative analysis of human brain tissue. Brain tissue was fixed in 4% paraformaldehyde, embedded in paraffin wax, and cut into 6-μm-thick sections. After deparaffinization, brain sections were immersed in Target retrieval solution (S1699, DAKO) and boiled in a microwave oven for 10 minutes. After blocking with PBS containing 3% normal goat serum and 1% bovine serum albumin, sections were incubated overnight at 4°C with rabbit anti-EDIL3 antibody (1:200, #12580-1-AP, Proteintech), rat anti-GFAP antibody (1:500, #13-0300, Thermofisher), and mouse anti-Aβ antibody (1:200, 12B2, IBL). Sections were then washed three times for 5 minutes in PBS, followed by incubation for 2 hours in the dark with Alexa Fluor (488, 555, or 647)-conjugated secondary antibodies (Invitrogen) in PBS containing 3% normal goat serum at room temperature. Nuclei were counterstained with Hoechst 33342. Fluorescent signals were detected using an LSM 700 confocal microscope (Carl-Zeiss). Histological analysis was performed as described below. Concentric rings were drawn around the amyloid plaque at 10-μm increments in radius using ImageJ. The number of astrocytes (cells positive for both GFAP and Hoechst 33342) was manually counted for each ring, and the astrocyte ratio was calculated by dividing the number of astrocytes by the total number of cells (Hoechst 33342-positive nuclei). For EDIL3 accumulation levels, the fluorescence intensity of EDIL3 was calculated for the plaque area and the radial concentric rings. In each group, at least 13 plaques in total were analyzed in the postmortem brains of two AD patients.

[0093] Example 1 Preparation of isogenic iPSC-derived astrocytes carrying APOE4 / 4 variants According to the method described in the experimental method section, isogenic iPSC-derived astrocytes carrying APOE4 / 4 variants were prepared.

[0094] First, isogenic iPSCs harboring the APOE4 / 4 variant were prepared. Figure 1 shows an outline of the method for generating an allele by knocking in the gene encoding APOE4 to an APOE3 allele (wild-type allele). Figure 2 shows the results of gel electrophoresis analysis of five iPSC clones (#86-#90) into which the allele was introduced after PCR amplification. Of the five clones #86-#90, #87 and #89 detected a band with a molecular weight corresponding to the targeting vector used in the generation. Furthermore, as shown in the sequencing results in Figure 3, the 112th amino acid in #80, a control iPSC with a homozygous APOE3 / 3 genotype, was cysteine, whereas the 112th amino acid in #87 and #89 was arginine, which corresponds to the APOE4 sequence. From these results, two clones, #87 and #89, were selected as iPSCs having the APOE4 / 4 genotype.

[0095] Next, iPSCs with the APOE4 / 4 genotype were induced to develop into astrocytes. A schematic diagram of the astrocyte induction method is shown in Figure 4 . Figure 5 shows the representative morphologies of astrocytes derived from iPSCs with the APOE4 / 4 genotype (E4 / E4 (#87-5)) and astrocytes derived from 201B7 iPSCs with the APOE3 / 3 genotype (E3 / E3 (201B7)). Furthermore, astrocytes obtained through this induction process (iPast) were immunofluorescently stained for the astrocyte markers S100β, GFAP, and CD44, and the nuclei were stained with Hoechst. Fluorescent images of the iPast nuclei are shown in Figure 6 , and the fluorescence intensities of S100β, GFAP, and CD44 in the fluorescent images are shown in Figure 7 (mean ± standard error, n = 3-6, ns: Not Significant). As shown in these figures, cells induced to become astrocytes from iPSCs with the APOE4 / 4 genotype showed similar morphology and marker expression to cells induced to become astrocytes from 201B7 iPSCs with the APOE3 / 3 genotype, demonstrating that iPSCs with the APOE4 / 4 genotype were induced to become astrocytes.

[0096] Example 2: Examination of apoE protein expression levels in astrocytes derived from iPSCs with the APOE4 / 4 genotype. The gene dosage and expression levels of various proteins, including APOE protein, were examined for astrocytes (iPast) derived from iPSCs with the APOE4 / 4 genotype prepared in Example 1 using the method described in the Experimental Methods section. Figure 8 shows the results of measuring the expression levels of mRNA encoding APOE protein (APOE), the astrocyte marker S100β, and β-actin (ACTB). Figure 8 shows no significant difference in the expression level of mRNA encoding APOE protein between iPast with the APOE4 / 4 genotype and iPast with the APOE3 / 3 genotype. On the other hand, according to the results of quantifying the expression levels of APOE protein and β-actin expressed by each iPast by Western blotting, as shown in Figure 9, the expression level of APOE protein in iPast with the APOE4 / 4 genotype was reduced to approximately 50% of that in iPast with the APOE3 / 3 genotype, and the difference in expression levels between the two was significant (in Figure 9, * indicates a p-value of less than 0.05).

[0097] Next, because APOE is a protein secreted extracellularly, the amount of APOE in the culture medium in which each iPast was cultured was examined. The results of examining the amount of APOE by ELISA are shown in Figure 10. As shown in Figure 10, the amount of APOE secreted by iPast with the APOE4 / 4 genotype was small, although there was no significant difference compared to the amount of APOE secreted by iPast with the APOE3 / 3 genotype. Specifically, the secretion amount in 201B7-derived iPast was 16.78 ± 3.82 ng / μ g, the secretion amount in #87 clone-derived iPast was 7.36 ± 1.75 ng / μ g, the secretion amount in #87 clone-derived iPast was 13.37 ± 2.65, and the p value between 201B7-derived iPast and #87 clone-derived iPast in Dunnett's test was 0.06, and the p value between 201B7-derived iPast and #89 clone-derived iPast was 0.59. As shown in Figure 11, the APOE3-derived fragment was detected from the culture extracellular solution of iPast with the APOE3 / 3 genotype, and the APOE4-derived fragment was detected from the culture extracellular solution of iPast with the APOE4 / 4 genotype, respectively, in a mutually exclusive manner. From the above, it was shown that iPast with the APOE4 / 4 genotype secreted less APOE, although this was not significantly lower, than iPast with the APOE3 / 3 genotype.

[0098] <Example 3: Examination of neuronal morphological changes in neurons co-cultured with iPast> Based on the results of Example 2, in order to clarify the effect of iPast secretions on neuronal morphology, iPast with the APOE4 / 4 genotype or iPast with the APOE3 / 3 genotype were co-cultured with mouse primary neurons, and the morphological changes were examined.

[0099] Figure 12 shows a schematic diagram of the coculture of iPast with the APOE4 / 4 genotype or iPast with the APOE3 / 3 genotype with mouse primary neurons. In the coculture system, iPast was cultured in a culture insert. As shown in the representative fluorescent images in Figure 13, dendritic spines could be clearly observed fluorescently in mouse primary neurons transfected with Actin-GFP. Figure 14 shows fluorescent images of dendrites in mouse primary neurons cocultured with iPast with the APOE4 / 4 genotype or iPast with the APOE3 / 3 genotype, and Figure 15 shows the number of dendritic spines observed per μm of dendrite. In Figure 15, * indicates a p-value of less than 0.05 in Tukey's test, and *** indicates a p-value of less than 0.001 in Tukey's test. Interestingly, primary neurons co-cultured with iPast having the APOE4 / 4 genotype exhibited a significant decrease in dendritic spine density. Furthermore, as shown in Figure 16 , the morphology of dendritic spines showed a significant decrease in mature mushroom-type spines, whereas immature filopodia-type spines significantly increased. These results suggest that the morphological changes observed in this example were greater than the difference in APOE secretion levels observed in Example 2, suggesting that the decrease in dendritic spines in primary neurons in the presence of iPast having the APOE4 / 4 genotype is caused by a secretory substance other than APOE protein.

[0100] Example 4: Search for mRNAs whose expression levels change in iPast with the APOE4 / 4 genotype To elucidate the molecular mechanism by which the reduction in dendritic spines of primary neurons occurs in the presence of iPast with the APOE4 / 4 genotype, we performed microarray analysis (transcriptome analysis) using total RNA to search for genes whose expression levels differ between iPast with the APOE4 / 4 genotype and iPast with the APOE3 / 3 genotype. The analysis was performed according to the method described in "Transcriptome analysis" in the Experimental Methods section.

[0101] Figure 17 shows the results of the clustering analysis as a heat map of the z-score (score obtained by normalizing logFC so that the mean is 0 and the standard deviation is 1) of iPast with the APOE3 / 3 genotype versus iPast with the APOE4 / 4 genotype. Figure 18 shows the results of principal component analysis (PCA) of the transcriptomes of iPast with the APOE3 / 3 genotype and iPast with the APOE4 / 4 genotype. Figure 19 is a two-dimensional plot of the results of Figure 17. These results revealed that iPast with the APOE3 / 3 genotype and iPast with the APOE4 / 4 genotype have similar yet distinct transcriptomes. Furthermore, as shown in the results in Figure 20, among the mRNAs found, CDKN1A and EDIL3, whose expression levels were increased in iPast with the APOE4 / 4 genotype, and β-actin (ACTB), an indicator of cell number, were also quantified by quantitative reverse transcription PCR (qRT-PCR), confirming that their expression levels were increased in iPast with the APOE4 / 4 genotype compared to iPast with the APOE3 / 3 genotype.

[0102] Example 5: Examination of expression levels of immune-related genes Among the mRNAs whose expression levels varied between iPast with the APOE3 / 3 genotype and iPast with the APOE4 / 4 genotype found in Example 4, the expression levels of immune-related genes known to be associated with the progression of Alzheimer's disease were examined in detail. The expression levels of genes known to be specifically expressed in Pan-Reactive, A1-like reactive (A1 specific), or A2-like reactive (A2 specific) astrocytes were measured using a method similar to that used in Example 4. The results are shown in Figures 21 and 22. According to these results, in the Pan-Reactive and A2-like reactive astrocyte markers, no significant difference was observed between iPast with the APOE3 / 3 genotype and iPast with the APOE4 / 4 genotype, while in the A1-like reactive astrocyte markers, an increase in expression was observed in iPast with the APOE4 / 4 genotype. However, since the increase was small compared to the degree of neuronal morphological changes found in Example 3, it was suggested that the neuronal morphological changes due to co-culture with iPast with the APOE4 / 4 genotype are related to genes other than the immune-related genes examined in Example 4.

[0103] Example 6: Search for secreted substances from iPast with the APOE4 / 4 genotype that cause neuronal morphological changes We investigated secreted substances from iPast with the APOE4 / 4 genotype that cause morphological changes in neurons resulting from co-culture with iPast with the APOE4 / 4 genotype. First, as shown in FIG. 23 , 119 mRNAs whose RNA amounts were increased in iPast with the APOE4 / 4 genotype compared to iPast with the APOE3 / 3 genotype, as found in Example 4, and 491 genes (AD GWAS genes, AD SNPs) whose single nucleotide polymorphisms were found to be potentially associated with Alzheimer's disease in a genome-wide association study in Non-Patent Document 12, were found to be common to EDIL3 (EGF-Like Repeats and Discoidin Domains 3), GPC6 (Glypican 6), FAM20C (Family with sequence similarity 20 member C), and MACROD2 (Mono-ADP Ribosylhydrolase 2) and found four genes. Subsequently, with regard to EDIL3, the amount of EDIL3 protein in iPast lysates and the culture medium (CM) in which iPast was cultured was evaluated by mass spectrometry. As shown in Figure 24, the expression and secretion levels of EDIL3 in iPast with the APOE4 / 4 genotype were significantly higher than those in iPast with the APOE3 / 3 genotype. Furthermore, iPast was lysed and the expression level of EDIL3 protein was evaluated by Western blotting. As shown in Figure 25, the expression level of EDIL3 in iPast with the APOE4 / 4 genotype was significantly higher than that in iPast with the APOE3 / 3 genotype. Furthermore, the amount of EDIL3 secreted into the culture medium in which iPast was cultured was also evaluated by Western blotting. As shown in Figure 26, the amount of EDIL3 secreted by iPast with the APOE4 / 4 genotype was significantly greater than that of iPast with the APOE3 / 3 genotype.In Figures 24 to 26, data are shown as mean ± standard error (Mean ± S.E., n = 3 (Figure 24), n = 4-5 (Figures 24 and 25)), and * and *** mean that the p-values ​​in the Student's t-test were less than 0.05 and less than 0.001, respectively. From the above results, EDIL3 was found to be a candidate secreted substance by iPast with the APOE4 / 4 genotype that causes the morphological changes in neurons resulting from co-culture with iPast with the APOE4 / 4 genotype.

[0104] Example 7: Examination of the effect of EDIL3 secreted by cells overexpressing EDIL3 on mouse primary neurons To examine the effect of EDIL3 discovered in Example 6 on mouse primary neurons, EDIL3 was overexpressed in a cultured cell line, and the effect of EDIL3 secreted extracellularly by the cells on the morphology of mouse primary neurons was examined.

[0105] HEK293 cells were transduced with EDIL3 by standard methods using a plasmid for expressing EDIL3 constructed according to the method described in "Construction of Expression Plasmid" in the Experimental Methods section. HEK293 cells transduced with the fluorescent protein DsRed instead of EDIL3 were used as a control (nc). Western blotting performed in the same manner as in Example 6 demonstrated that EDIL3 was transduced into the cells and that EDIL3 was secreted extracellularly from the cells, as shown in Figure 27. Therefore, the culture medium in which EDIL3-transduced HEK293 cells were cultured was collected, and mouse primary neurons were cultured in the culture medium between days 16 and 21 (DIV16-21) as shown in Figure 28. The effects of exposure to EDIL3 on mouse primary neurons were evaluated. Figure 29 shows the Actin-GFP fluorescence image (left) and the quantification results of the number of dendritic spines per μm (right) in the dendrites of cultured mouse primary neurons. In Figure 29, *** indicates a p-value of less than 0.001 in the Student's t-test. Figure 29 shows that the number of dendritic spines was significantly reduced in mouse primary neurons exposed to EDIL3 in the culture medium compared to the control. Furthermore, when examining the dendritic spine shape, as shown in Figure 30, there was a significant decrease in mushroom-type spines, similar to the trend in the results of Example 3.

[0106] <Example 8: Examination of the effect of EDIL3 secreted by cells on mouse primary neurons by comparing co-cultured iPast with and without EDIL3 knockdown> To examine the effect of EDIL3 discovered in Example 6 on mouse primary neurons, the morphology of mouse primary neurons co-cultured with iPast having the APOE4 / 4 genotype in which EDIL3 was knocked down was evaluated.

[0107] shEDIL3 shown in SEQ ID NO: 29 was introduced into iPast having the APOE4 / 4 genotype using a lentivirus, and EDIL3 was knocked down. As a control, iPast having the APOE4 / 4 genotype were prepared into which shcontrol shown in SEQ ID NO: 30 was introduced instead of shEDIL3. The expression levels of EDIL3 protein in these iPast having the APOE4 / 4 genotype were evaluated by Western blotting, and the results are shown in Figure 31, showing that EDIL3 expression was significantly suppressed in iPast introduced with shEDIL3. Similarly, iPast introduced with shEDIL3 or shcontrol were prepared for iPast having the APOE3 / 3 genotype. shEDIL3: 5'-GTGGAATATGTACAGATCT-3' (SEQ ID NO: 29) shcontrol: 5'-TAAGGTTAAGTCGCCCCTCG-3' (SEQ ID NO: 30)

[0108] The prepared iPast with the APOE4 / 4 genotype or iPast with the APOE3 / 3 genotype transfected with shEDIL3 or shcontrol were co-cultured with mouse primary neurons using the same protocol as in Example 7, and the morphology of the mouse primary neurons was evaluated. Figure 32 shows the fluorescent image of Actin-GFP in the dendrites of cultured mouse primary neurons (left) and the results of quantifying the number of dendritic spines per μm (right). The results in Figure 32 are shown as mean ± standard error (Mean ± S.E., n = 17 neurons from 3 independent culture batches), and *** indicates a p-value of less than 0.001 in Tukey's test. 32, mouse primary neurons cocultured with iPast having the APOE4 / 4 genotype and transfected with shcontrol (i.e., EDIL3 was not knocked down) showed a significant decrease in the number of dendritic spines, whereas mouse primary neurons cocultured with iPast having the APOE4 / 4 genotype and transfected with shEDIL3 (i.e., EDIL3 was knocked down) showed a similar number of dendritic spines to mouse primary neurons cocultured with iPast having the APOE3 / 3 genotype, significantly suppressing the decrease in the number. The results of Examples 7 and 8 demonstrated that EDIL3 has the effect of reducing dendritic spines in primary neurons, i.e., the secreted product of iPast having the APOE4 / 4 genotype, which has the effect of reducing dendritic spines in primary neurons, is EDIL3.

[0109] Example 9: Evaluation of EDIL3 levels in amyloid plaques in the brains of Alzheimer's disease patients with the APOE4 genotype Based on the above results, we investigated whether EDIL3 protein accumulation was observed in amyloid plaques in the postmortem brains of Alzheimer's disease patients with the APOE4 genotype.

[0110] Samples collected from the parietal lobes of postmortem brains of Alzheimer's disease patients (two with the APOE3 / 3 genotype and two with the APOE3 / 4 genotype) or controls without symptoms of Alzheimer's disease were immunofluorescently stained for EDIL3, amyloid beta (Aβ), and GFAP, and cell nuclei were stained with Hoechst. Fluorescent images of the stained samples are shown in Figure 33. As shown in Figure 33, EDIL3 accumulation, indicated by the arrows, was observed in amyloid plaques in the brains of Alzheimer's disease patients, whereas no EDIL3 accumulation was observed in amyloid plaques in the brains of control patients. The area of ​​amyloid plaques in the brains of Alzheimer's disease patients is also shown in Figure 34 (n = 13-26). The proportion of GFAP-positive cells (number of cells showing GFAP fluorescent images / number of Hoechst-stained cells) as a function of distance from amyloid plaques in the brains of Alzheimer's disease patients is shown in Figure 35. Figure 36 shows the fluorescence intensity from labeled anti-EDIL3 antibodies as a function of distance from amyloid plaques in the brains of Alzheimer's disease patients. The data in Figures 35 and 36 are shown as results for 13 to 26 amyloid plaques, and ns and *** indicate p-values ​​of 0.05 or greater and less than 0.0001, respectively, in Sidak's multiple comparisons test following a two-way ANOVA. Figure 34 shows no significant difference in the size of amyloid plaques between Alzheimer's disease patients with or without the APOE4 genotype. Furthermore, Figure 35 shows no significant difference in the proportion of GFAP-positive cells between Alzheimer's disease patients with or without the APOE4 genotype, revealing that there is no increase in astrocytes in the brains of patients with the APOE4 genotype. Furthermore, according to Figure 36, in the brains of patients with the APOE4 genotype, the fluorescence intensity was significantly higher in the region of the concentric circles around the amyloid plaques that overlapped with the amyloid plaques (circles at a distance of 0 μm) compared to the brains of patients without the APOE4 genotype, and significant accumulation of EDIL3 was observed near the amyloid plaques.These results suggest that EDIL3 is involved in Alzheimer's disease in humans, particularly in patients with the APOE4 genotype. These results also suggest that in the brains of patients with Alzheimer's disease (particularly in the brains of patients with the APOE4 genotype), EDIL3 deposits in excess together with amyloid β peptide, causing synaptic damage in the vicinity of the plaques.

Claims

1. Nucleic acid primers or probes for detecting mRNA encoding EDIL3; A nucleic acid primer or nucleic acid probe for detecting cDNA complementary to the mRNA; or A compound comprising an anti-EDIL3 antibody or its EDIL3-binding fragment, A kit for the diagnosis or assistance in the diagnosis of Alzheimer's disease.

2. The kit according to claim 1, wherein the subject of the diagnosis is a subject having the APOE4 genotype.

3. A kit according to claim 1 or 2, including an instruction manual.

4. A method for collecting data for the diagnosis of Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

5. A method for assisting the diagnosis of Alzheimer's disease, comprising quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3 in a subject.

6. The method according to claim 4 or 5, wherein a subject has Alzheimer's disease or is likely to have Alzheimer's disease if the amount of quantified EDIL3 is higher than that of a control.

7. The method according to claim 4 or 5, comprising detecting the presence or absence of the APOE4 genotype in a subject.

8. A pharmaceutical composition for the treatment of Alzheimer's disease, comprising a substance that inhibits EDIL-3.

9. The pharmaceutical composition according to claim 8, wherein the substance that inhibits EDIL3 is a substance that suppresses the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.

10. The pharmaceutical composition according to claim 8 or 9, wherein the substance that inhibits EDIL3 is a nucleic acid that suppresses the expression of EDIL3, an anti-EDIL3 antibody, or an EDIL3-binding fragment thereof.

11. The pharmaceutical composition according to claim 8 or 9, which is a pharmaceutical composition for the treatment of human subjects having the APOE4 genotype.

12. Culturing nerve cells in a culture medium containing EDIL3 and the test substance; and This includes detecting the Alzheimer's disease phenotype from the aforementioned nerve cells. A screening method for substances that inhibit EDIL-3.

13. Introducing nucleic acids for expressing EDIL3 into cells or microorganisms; Culturing the aforementioned cells or microorganisms; To collect the culture supernatant obtained by culturing the aforementioned cells or microorganisms; Culturing nerve cells in a culture medium containing the culture supernatant and the test substance; and This includes detecting the Alzheimer's disease phenotype from the aforementioned nerve cells. A screening method for substances that inhibit EDIL-3.

14. The screening method according to claim 12 or claim 13, wherein the nerve cells are nerve cells having the APOE4 genotype.

15. The screening method according to claim 12 or 13, wherein detecting the Alzheimer's disease phenotype from the nerve cells includes detecting a change in the number of nerve cell spines.

16. The screening method according to claim 12 or 13, wherein the substance that inhibits EDIL3 is a substance for the treatment of Alzheimer's disease.

17. Culturing cells expressing EDIL3 in a culture medium containing the test substance; and This includes evaluating the expression or secretion of EDIL3. A screening method for substances that inhibit EDIL-3 for the treatment of Alzheimer's disease.

18. The screening method according to claim 17, wherein evaluating the expression or secretion of EDIL3 involves quantifying mRNA encoding EDIL3, cDNA complementary to the mRNA, or EDIL3.

19. The screening method according to claim 17 or 18, wherein the quantification of EDIL3 is performed using an anti-EDIL3 antibody or an EDIL3-binding fragment thereof.

20. The screening method according to any one of claims 12, 13, 17, and 18, wherein the substance that inhibits EDIL3 is a substance that suppresses the expression of EDIL3, a substance that promotes the degradation of EDIL3, or a substance that inhibits the function of EDIL3.