Method for producing desired substance using plant having suppressed resistance

Abstract

The purpose of the present invention is to provide a method for expressing a desired substance at a high level in a plant.　Provided are: a method for producing a plant having suppressed resistance to a pathogen, the method comprising suppressing or disrupting the expression of a gene involved in a resistance mechanism in a plant; a method for producing a plant having suppressed resistance to a pathogen, the method comprising overexpressing a gene involved in the decomposition of salicylic acid (SA) in a plant; a transgenic plant body or the like or a genome-edited plant body each produced by the method; and a method for producing a desired protein using the plant body.

Description

Method for producing target substance using resistance-suppressed plant

[0001] The present invention relates to a method for producing a plant in which pathogen-induced resistance is suppressed. The present invention also provides transformed plant cells, transformed plants, or genome-edited plants obtained by the production method. The present invention also relates to a method for producing a target substance using the transformed plant cells, transformed plants, or genome-edited plants.

[0002] Plants are constantly exposed to various stresses, including changes in their growth environment, infection by pathogens, and damage by insects and herbivores. Such stresses harm plant growth, reduce agricultural crop yields, and result in significant economic losses. To overcome these stresses, plants have developed unique self-defense mechanisms (resistance mechanisms or immune responses) against each stress. For example, plants synthesize abscisic acid (ABA) when sensing environmental changes (e.g., drought, low temperature, high salt concentration), salicylic acid (SA) when infected by pathogens, and jasmonic acid (JA) when damaged by insects. These self-defense mechanisms are regulated by a network of signaling pathways for these plant hormones.

[0003] Known pathogen resistance mechanisms include local resistance induced at the site of pathogen infection and systemic acquired resistance induced in tissues distant from the infection site. The former type of resistance is primarily induced by pathogen recognition via plant pattern recognition receptors (PRRs) or nucleotide-binding domain and leucine-rich repeat receptors (NLRs). Meanwhile, the latter type of resistance is induced in tissues distant from the infection site as a defense mechanism against secondary infection, triggered by local resistance induction. In both cases, SA-mediated signaling plays an important role.

[0004] As the self-defense mechanisms of plants have been elucidated, numerous developments have been made in terms of conferring resistance, such as strengthening the self-defense mechanisms and breeding resistant plants by crossing with closely related varieties or wild species. For example, Patent Document 1 discloses the AtPPR1 gene to improve plant resistance to Phytophthora infestans, and Patent Document 2 discloses a method for producing transgenic plants that overproduce jasmonic acid (JA). Patent Document 3 discloses a method for downregulating the Arabidopsis thaliana C-type protein phosphatase gene, which functions as a negative regulator of plant defense pathways. Patent Document 4 relates to a method for increasing SAR gene expression and enhancing broad-spectrum disease resistance.

[0005] However, because most transient expression systems generally utilize the infection and proliferation mechanisms of plant pathogens, when attempting to introduce a foreign gene into a plant to produce a desired protein, the expression of the foreign gene is suppressed by the activation of the plant's self-defense mechanisms, resulting in a problem of reduced production of the desired protein depending on the type of host plant, the size of the foreign gene, etc.

[0006] Furthermore, Non-Patent Document 1 reports that when recombinant plant species were produced in which genes related to gene silencing, a major function of plant resistance mechanisms, were suppressed and the expression of target genes in these plants was examined, the expression levels of green fluorescent protein were higher in recombinant plants in which the expression of the DCL2 and DCL4 genes was significantly reduced compared to the wild-type plants.

[0007] US Patent Application Publication No. 2021-0301299 US Patent Application Publication No. 2013-0111632 US Patent No. 7,910,801 International Publication No. 00 / 53762

[0008] "Technical Evaluation Report (Terminal Evaluation) for the Demonstration Research and Development Project for Genetically Modified Plant Manufacturing Using Closed Plant Factories" (https: / / www.meti.go.jp / policy / tech_evaluation / c00 / C0000000H28 / 161227_plant_factory_2nd / plant_factory_2nd.html)

[0009] Therefore, there has been a demand for a method for producing a target substance in a plant at a high level.

[0010] As a result of extensive research to solve the above-mentioned problems, the present inventors have succeeded in overexpressing a target protein in a plant in which the resistance mechanism is suppressed, based on the reverse idea of ​​overcoming the plant's inherent self-defense mechanism, which differs from conventional resistance-conferring technologies. Specifically, the present inventors have discovered that plants in which the pathogen resistance mechanism is suppressed can be produced by suppressing or disrupting the expression of a gene involved in the resistance mechanism in a plant, or by overexpressing a gene involved in SA degradation in a plant. Furthermore, the present inventors have discovered that the above-mentioned methods can be used to produce transformed plant cells or transformed plants (hereinafter referred to as "transformed plants, etc.") or genome-edited plants in which the expression of a gene involved in the resistance mechanism is suppressed or disrupted, or transformed plants in which a gene involved in SA degradation is overexpressed. Furthermore, the present inventors have discovered that the resistance mechanism is not fully activated in the above-mentioned transformed plants, etc., or genome-edited plants, and therefore the target protein can be overexpressed. This discovery led to the completion of the present invention.

[0011] That is, the present invention provides the following: (1) A method for producing a plant with suppressed pathogen resistance, the method comprising suppressing or disrupting the expression of a gene involved in the resistance mechanism in a plant. (2) The method according to (1), wherein the gene involved in the resistance mechanism is selected from genes involved in the salicylic acid (SA) biosynthetic pathway and genes involved in SA signal transduction. (3) The method according to (2), wherein the gene involved in the SA biosynthetic pathway is selected from the group consisting of a phenylalanine ammonia-lyase (PAL) gene, an isochorismate synthase (ICS) gene, an EDS1 (enhanced disease susceptibility 1) gene, an EDS5 (enhanced disease susceptibility 5) gene, a phytoalexin deficiency 4 (PAD4) gene, a salicylic acid decarboxylase (SDC) gene, a salicylic acid glucoside hydrolase gene, an AIM1 (abnormal inflorescence meristem 1) gene, an avrPphB susceptible 3 (PBS3) gene, an EPS1 (enhanced pseudomonas susceptibility 1) gene, a SARD1 (SAR-deficient 1) gene, and a calmodulin-binding protein 60g (CBP60g). (4) The method according to (2) or (3), wherein the gene involved in SA signaling is selected from the group consisting of the NPR1 (nonexpressor of pathogenesis-related genes 1) gene and the NPR3 / 4 gene. (5) The method according to any one of (1) to (4), comprising the steps of: (i) preparing a nucleic acid construct for suppressing or disrupting the gene involved in the resistance mechanism; (ii) introducing the nucleic acid construct into plant cells or plant tissues; and (iii) culturing the plant cells or plant tissues into which the nucleic acid construct has been introduced to produce a plant in which the nucleic acid construct is expressed.(6) The method according to (5), wherein the nucleic acid construct is a first nucleic acid construct comprising a nucleic acid sequence complementary to the mRNA of a gene involved in the resistance mechanism or a transcript thereof. (7) The method according to (6), wherein in the first nucleic acid construct, the nucleic acid sequence complementary to the mRNA of a gene involved in the resistance mechanism or a transcript thereof is selected from the group consisting of antisense RNA, an RNA interference (RNAi) molecule, and a virus-induced gene silencing (VIGS) molecule. (8) The method according to (6) or (7), wherein the first nucleic acid construct comprises, in this order, an expression promoter sequence functional in the plant, a nucleic acid sequence complementary to the mRNA of a gene involved in the resistance mechanism or a transcript thereof, and an optionally used terminator sequence functional in the plant. (9) The method according to any one of (1) to (4), comprising: (i) preparing a second nucleic acid construct comprising a nucleic acid sequence encoding a genome editing-associated protein having a target site in a gene involved in the resistance mechanism; (ii) introducing the nucleic acid construct into a plant cell or plant tissue; and (iii) culturing the plant cell or plant tissue into which the nucleic acid construct has been introduced to produce a plant body having a mutation introduced into the gene sequence. (10) The method according to (9), wherein, in the second nucleic acid construct, the genome editing-associated protein comprises a protein selected from the group consisting of a Cas protein, a zinc finger nuclease, and a TAL effector nuclease. (11) The method according to (10), wherein, in the second nucleic acid construct, the genome editing-associated protein further comprises a nucleic acid sequence recognition module and / or a guide RNA. (12) The method according to any one of (9) to (11), wherein the second nucleic acid construct comprises, in this order, an expression promoter sequence that functions in the plant, a nucleic acid sequence that encodes the genome editing-related protein, and an optionally used terminator sequence that functions in the plant. (13) The method according to any one of (5) to (8), wherein the introduction of the nucleic acid construct into the plant in step (ii) is carried out using a transient expression system.(14) The method according to (13), wherein the transient expression system is selected from agroinfiltration, plant virus vectors, and agroinfection combining these. (15) The method according to (14), wherein the plant viral vector is selected from the group consisting of a full viral vector and a deconstructed viral vector, namely, tobacco mosaic virus (TMV), plum pox virus (PPV), turnip vein clearing virus (TVCV), potato virus X (PVX), bean yellow dwarf virus (BEYDV), alfalfa mosaic virus (AIMV), cucumber mosaic virus (CMV), cowpea mosaic virus (CPMV), zucchini yellow mosaic virus (ZYMV), tobacco rattle virus (TRV), apple latent spherical virus (ACMV), brome mosaic virus (BMV), tomato mosaic virus (ToMV), tomato yellow leaf curl virus (TYLCV), and tomato golden mosaic virus (TGMV). (16) The method according to (14), wherein the agroinfection is performed using a combination of CMV and Agrobacterium T-DNA. (17) The method according to any one of (5) to (8), wherein the introduction of the nucleic acid construct into the plant in the step (ii) is performed by infiltrating or injecting a solution containing the nucleic acid construct into the plant. (18) A method for producing a plant with suppressed pathogen resistance, comprising overexpressing a gene involved in salicylic acid (SA) degradation in the plant. (19) The method according to (18), wherein the gene involved in SA degradation is selected from the group consisting of salicylate glycosyltransferase (SGT) genes, UGT74F1, UGT74F2, UGT76B1 or UGT75B1 genes, salicylate-3-hydroxylase (S3H) genes, salicylate-5-hydroxylase (S5H) genes, and salicylate hydroxylase (nahG) genes. (20) The method according to (19), wherein the gene involved in SA degradation is the SGT gene.(21) The method according to any one of (18) to (20), comprising the steps of: (i) preparing a nucleic acid construct for overexpressing the gene involved in SA degradation; (ii) introducing the nucleic acid construct into plant cells or plant tissues; and (iii) culturing the plant cells or plant tissues into which the nucleic acid construct has been introduced to produce a plant in which the nucleic acid construct is expressed. (22) The method according to (21), wherein the nucleic acid construct is a third nucleic acid construct comprising a nucleic acid sequence of part or all of a gene involved in SA degradation. (23) The method according to (21) or (22), wherein the third nucleic acid construct comprises, in this order, an expression promoter sequence functional in the plant, a nucleic acid sequence of part or all of a gene involved in SA degradation, and an optionally used terminator sequence functional in the plant. (24) The method according to any one of (21) to (23), wherein the introduction of the nucleic acid construct into the plant in the step (ii) is carried out using a transient expression system. (25) The method according to (24), wherein the transient expression system is selected from agroinfiltration, a plant virus vector, and agroinfection, which is a fusion of these. (26) The method according to (25), wherein the plant viral vector is selected from the group consisting of a full viral vector and a deconstructed viral vector, namely, tobacco mosaic virus (TMV), plum pox virus (PPV), turnip vein clearing virus (TVCV), potato virus X (PVX), bean yellow dwarf virus (BEYDV), alfalfa mosaic virus (AIMV), cucumber mosaic virus (CMV), cowpea mosaic virus (CPMV), zucchini yellow mosaic virus (ZYMV), tobacco rattle virus (TRV), apple latent spherical virus (ACMV), brome mosaic virus (BMV), tomato mosaic virus (ToMV), tomato yellow leaf curl virus (TYLCV), and tomato golden mosaic virus (TGMV). (27) The method according to (25), wherein the agroinfection is a combination of CMV and Agrobacterium T-DNA.(28) The method according to any one of (21) to (27), wherein the introduction of the nucleic acid construct into the plant in step (ii) is carried out by infiltrating or injecting a solution containing the nucleic acid construct into the plant. (29) A transformed plant cell or transformed plant, or a genome-edited plant, in which expression of a gene involved in a resistance mechanism is suppressed or disrupted, obtained by the method according to any one of (1) to (17). (30) The transformed plant cell or transformed plant, or genome-edited plant according to (29), in which the gene involved in the resistance mechanism is the NPR1 gene. (31) The transformed plant cell or transformed plant, or genome-edited plant according to (29), in which the gene involved in the resistance mechanism is the EDS1 gene. (32) The transformed plant cell or transformed plant, or genome-edited plant according to (29), in which the gene involved in the resistance mechanism is the PAD4 gene. (33) The transformed plant cell or plant, or genome-edited plant, according to (29), wherein the gene involved in the resistance mechanism is a PAL gene. (34) The transformed plant cell or plant, or genome-edited plant, according to (29), wherein the gene involved in the resistance mechanism is an ICS gene. (35) A transformed plant cell or plant, in which a gene involved in SA degradation is overexpressed, obtained by the method according to any one of (18) to (28). (36) The transformed plant cell or plant according to (35), wherein the gene involved in SA degradation is an SGT gene. (37) A method for producing a target protein using a plant, comprising: producing transformed plant cells or transformed plants, or genome-edited plants, in which expression of a gene involved in a resistance mechanism is suppressed or disrupted by the method according to any one of (5) to (17); and introducing a fourth nucleic acid construct for expressing the target protein in a plant into the plant cells or plant tissue before, simultaneously with, or after step (ii), thereby producing a transformed plant in which the nucleic acid construct is expressed.(38) A method for producing a target protein using a plant, comprising: producing transformed plant cells or transformed plants in which a gene involved in SA degradation is overexpressed by the method according to any one of (18) to (28); and introducing a fourth nucleic acid construct for expressing the target protein in a plant into the plant cells or plant tissue before, simultaneously with, or after step (ii), thereby producing a transformed plant in which the nucleic acid construct is expressed. (39) A method for producing a target protein using a plant, comprising introducing a fourth nucleic acid construct for expressing the target protein in a plant into the transformed plant cells or transformed plants, or genome-edited plants according to any one of (29) to (36), and cultivating the transformed plant cells or transformed plants into which the nucleic acid construct has been introduced, thereby producing a transformed plant in which the nucleic acid construct is expressed. (40) The method according to any one of (37) to (39), wherein the fourth nucleic acid construct comprises a nucleic acid sequence encoding a protein of interest. (41) The method according to (40), wherein the fourth nucleic acid construct comprises, in this order, an expression promoter sequence functional in the plant, a nucleic acid sequence encoding the protein of interest, and an optional terminator sequence functional in the plant. (42) The method according to any one of (37) to (41), wherein the fourth nucleic acid construct is introduced into the plant using a transient expression system. (43) A transformed plant cell or transformed plant, or a genome-edited plant, which produces a protein of interest, obtained by the method according to any one of (37) to (42).

[0012] According to the present invention, it is possible to produce a plant with suppressed pathogen resistance by suppressing or disrupting the expression of a gene involved in the resistance mechanism in a plant or by overexpressing a gene involved in SA degradation in a plant. Furthermore, according to the present invention, it is possible to highly express a target protein in a plant.

[0013] FIG. 1 is a diagram showing the structure of a plant expression vector (pGPTV-IR-NPR) containing an inverted repeat sequence (IR-NPR) of a partial sequence of the NPR gene. In the diagram, "pAg7" represents the agropine synthetic gene terminator, "HPT" represents the hygromycin resistance gene, "NOSp" represents the nopaline synthase (NOS) promoter, and "Promoter" represents the promoter derived from strawberry vein binding virus (SVBV). "NPR" represents the antisense and sense strands of a 400-bp partial sequence of the NPR gene (SEQ ID NO: 1), in that order. "Terminator" represents the heat shock protein-derived terminator. FIG. 2 is a diagram showing the structure of a plant expression vector (pBI-iPAL) for iPAL. In the figure, "NOSp" represents the NOS promoter, "NPTII" represents the kanamycin resistance gene, "NOSt" represents the transcription terminator in the 3' untranslated region of the NOS gene, and "35Sp" represents the cauliflower mosaic virus (CaMV)-derived promoter. "NbPAL" represents the sense strand and antisense strand of a 157-bp partial sequence (SEQ ID NO: 6) of the PAL gene derived from Nicotiana benthamiana (Nb), in that order. Figure 3 is a schematic diagram showing the structure of the iICS plant expression vector (pBI-iICS). In the figure, "NOSp" represents the NOS promoter, "NPTII" represents the kanamycin resistance gene, "NOSt" represents the transcription terminator in the 3' untranslated region of the NOS gene, and "35Sp" represents the cauliflower mosaic virus (CaMV)-derived promoter. "NbICS" represents the sense strand and antisense strand of a 153-bp partial sequence (SEQ ID NO: 9) of the Nb-derived ICS gene, in that order. 4 is a diagram showing the structure of the SGT plant expression vector (pGPTV-HPT-SGT). In the figure, "pAg7" represents the agropine synthetic gene terminator, "HPT" represents the hygromycin resistance gene, "NOSp" represents the NOS promoter, "Promoter" represents the strawberry vein binding virus (SVBV)-derived promoter, "NbSGT" represents the 1368 bp Nb-derived SGT gene (SEQ ID NO: 12), and "NOSt" represents the transcription terminator of the 3' untranslated region of the NOS gene.Figure 5 is a photograph showing the results of Western blot analysis performed to determine the expression level of SGT protein accumulated in SGT-transformed Nicotiana benthamiana tobacco obtained by plant tissue culture. Figure 6 is a photograph showing the results of Western blot analysis of green fluorescent protein (GFP) transiently expressed by agroinfiltration to examine the expression level of the target protein (GFP) using NPR-suppressed Nicotiana benthamiana (IR-NPR-transformed Nicotiana benthamiana) obtained by plant tissue culture. The bottom of the figure shows the accumulation level of the target protein (GFP) (relative value when the wild-type is set to 1) and the amount of NPR gene mRNA (relative value when the wild-type is set to 1) in the inoculated plants. Figure 7 is a photograph showing the results of Western blot analysis of GFP transiently expressed by agroinfiltration to examine the expression level of the target protein (GFP) using PAL-suppressed Nicotiana benthamiana (iPAL-transformed Nicotiana benthamiana) obtained by plant tissue culture. The lower part of the figure shows the accumulation of the target protein (GFP) in the inoculated plants (relative to the wild-type value of 1), the amount of PAL gene mRNA (relative to the wild-type value of 1), and the amount of SA (nmol SA / g dry weight) in the inoculated plants. Figure 8 shows the results of RT-PCR analysis of the ICS gene expression level in ICS-suppressed plants (iICS-transformed N. benthamiana) obtained by plant tissue culture. When the expression level of the ICS gene in wild-type (WT) plants was set to 1, four lines (Nos. 13, 43, 5, and 14) were obtained as ICS-suppressed plants in which the expression level was reduced to 0.4 or less. Figure 9 shows the results of Western blot analysis of GFP transiently expressed by CMV-agroinfection (vacuum infiltration) in SGT-transformed N. benthamiana (overexpressing plants) obtained by plant tissue culture to examine the expression level of the target protein (GFP). Expression of the target protein (GFP) in the inoculated plants was confirmed only in the veins of the wild-type plants, but in both the veins and mesophyll of the SGT-overexpressing plants.Figure 10 shows photographs of GFP fluorescence in the leaves of the SGT-transformed tobacco (SGT-overexpressing plants, top two leaves) and wild-type tobacco (wild-type plants, bottom two leaves) shown in Figure 9. The light areas of the photograph (green in the original photograph) indicate the GFP-expressing regions, and the dark areas (black in the original photograph) indicate the regions where GFP emission is not clearly observed. Figure 11 shows the results of measuring the amounts of salicylic acid (SA) and SA metabolites (SAG, SGE) accumulated in the SGT-overexpressing plants and wild-type plants shown in Figure 10. While SA and SA metabolites were barely detectable in plants not inoculated with Agrobacterium (CMV-agroinfection vector), SA and SA metabolites were detected in plants inoculated with Agrobacterium (CMV-agroinfection vector), and the accumulation of more SA metabolites was detected in the SGT-overexpressing plants than in the wild-type plants. Figure 12 is a diagram showing the structure of a plant expression vector (pEgP237-2A-GFP-NPRgRNA) for guide RNA expression (Ueta R et al., Sci Rep 7:507, 2017). In the figure, "AtU6-26" represents the AtU6-26 promoter, "gRNA" represents the guide RNA, "35SpΩ" represents the sequence in which the Ω sequence, a translation enhancer, is added to the 35S promoter derived from cauliflower mosaic virus, "CAS9" represents Cas9, "NLS" represents the nuclear localization signal, "2A" represents the 2A self-cleaving peptide, "Terminator" represents the Arabidopsis thaliana-derived terminator, and "Km. ｒ " indicates a kanamycin resistance gene, respectively. "NPRg526," "NPRg524," and "NPRg417" ​​indicate specific guide RNAs, each having the nucleotide sequence of SEQ ID NOs: 22 to 24. FIG. 13 is a diagram schematically showing the structure of a plant expression vector for guide RNA expression (pEgP237-2A-GFP-NPRgRNA). In the figure, "AtU6-26" indicates the AtU6-26 promoter, "gRNA" indicates the guide RNA, "35SpΩ" indicates a sequence in which the Ω sequence, which is a translation enhancer, has been added to the 35S promoter derived from cauliflower mosaic virus, "CAS9" indicates Cas9, "NLS" indicates a nuclear localization signal, "2A" indicates a 2A self-cleaving peptide, "Terminator" indicates an Arabidopsis-derived terminator, and "Kmｒ" indicates a kanamycin resistance gene, respectively. "ICSg362," "ICSg121," and "ICSg95" indicate specific guide RNAs, each having the nucleotide sequences of SEQ ID NOS: 25 to 27. Figure 14 is a photograph showing the results of Western blot analysis of an antibody (IgG) transiently expressed by agroinfiltration to examine the expression level of a target protein (IgG) using NPR genome-edited Nicotiana benthamiana (NPRg526 no. 72-3) obtained by plant tissue culture. The bottom of the figure shows the accumulation amount of the target protein (IgG) in the inoculated plant (relative value with the wild-type defined as 1). Figure 15 is a photograph showing the results of Western blot analysis of an IgG transiently expressed by agroinfiltration to examine the expression level of a target protein (IgG) using ICS genome-edited Nicotiana benthamiana obtained by plant tissue culture. The lower part of the figure shows the accumulation of the target protein (IgG) in the inoculated plants (relative to the wild-type, which is set to 1) and the SA content (nmol SA / g dry weight) in the inoculated plants. Figure 16 is a schematic diagram showing the timeline of an example in which the target protein (GFP) was expressed after obtaining EDS1-suppressed tobacco and PAD4-suppressed tobacco by the VIGS method. The photographs reveal the fluorescence of GFP expressed in these plants. The light areas of the photographs (green in the original photographs) indicate GFP-expressing regions, and the dark areas of the photographs (black in the original photographs) indicate regions where GFP emission is not clearly visible. The numbers in the "Examination of gene silencing by VIGS using quantitative RT-PCR" section indicate the relative expression levels of the EDS1 gene in EDS1-suppressed tobacco or the PAD4 gene in PAD4-suppressed tobacco, when the expression level of the EDS1 gene or PAD4 gene in wild-type plants (without gene silencing) is set to 1. Figure 17 is a photograph showing the results of Western blot analysis of GFP transiently expressed by agroinfiltration in order to examine the expression level of the target protein (GFP) using the EDS1 expression-suppressed tobacco and the PAD4 expression-suppressed tobacco shown in Figure 16.The bottom of the figure shows the amount of target protein (GFP) accumulated in the inoculated plants (relative to the wild-type value of 1) and the amount of SA (nmol SA / g dry weight) in the inoculated individuals. Figure 18 is a schematic diagram showing the structure of a plant expression vector for guide RNA expression (pEgP237-2A-GFP-EDSgRNA). In the figure, "AtU6-26" is the Atu6-26 promoter, "gRNA" is the guide RNA, "35SpΩ" is the sequence in which the Ω sequence, a translation enhancer, is added to the 35S promoter derived from cauliflower mosaic virus, "CAS9" is Cas9, "NLS" is the nuclear localization signal, "2A" is the 2A self-cleaving peptide, "Terminator" is the Arabidopsis-derived terminator, and "Km. ｒ" indicates a kanamycin resistance gene, respectively. "EDSg715," "EDSg533," "EDSg429," and "EDSg322" indicate specific guide RNAs, each having the nucleotide sequences of SEQ ID NOs: 47 to 50. Figure 19 is a photograph showing the results of Western blot analysis of GFP transiently expressed by agroinfiltration to examine the expression level of the target protein (GFP) using SGT-transformed Nicotiana benthamiana obtained by plant tissue culture. The bottom of the figure shows the accumulation amount of the target protein (GFP) in the inoculated plant (relative value when the wild-type is set to 1). Figure 20 is a photograph showing the results of Western blot analysis of an antibody (IgG) transiently expressed by agroinfiltration to examine the expression level of the target protein (IgG) using NPR genome-edited Nicotiana benthamiana obtained by plant tissue culture. Genetically fixed plants of the NPR genome-edited N. benthamiana progeny (NPRg526 no. 72-3-40) shown in Figure 14 (the plant expression vector in Figure 12 was isolated by genetic techniques and is not included) and plants (NPRg524 no. 567) obtained by genome editing using a different guide RNA (NPRg524) were used. The bottom of the figure shows the accumulation amount of the target protein (IgG) in the inoculated plants (relative value when the wild type is set to 1). Figure 21 is a photograph showing the results of Western blot analysis of an antibody (IgG) transiently expressed by agroinfiltration to examine the expression level of the target protein (IgG) using NPR genome-edited N. benthamiana obtained by plant tissue culture. A plant (NPRg524 no. 444) obtained by genome editing using guide RNA (NPRg524) was used. The amount of target protein (IgG) accumulated in the inoculated plants (relative value when the wild type is set to 1) is shown at the bottom of the figure.

[0014] The present invention will be described in detail below with reference to specific embodiments. However, the present invention is not limited to the following embodiments and can be practiced with appropriate modifications.

[0015] First Embodiment The first embodiment of the present invention relates to a method for producing a plant with suppressed pathogen resistance, the method comprising suppressing or disrupting the expression of a gene involved in the resistance mechanism in a plant. The "resistance mechanism in a plant" refers to a plant's unique self-defense mechanism against various external stresses (Ethan et al., Disease Resistance Mechanisms in Plants, Genes 2018, 9(7), 339). For example, plants biosynthesize abscisic acid (ABA) when sensing environmental changes (e.g., dryness, low temperature, high salt concentration), salicylic acid (SA) when infected by pathogens, and jasmonic acid (JA) when damaged by insects. These low-molecular-weight compounds act as signaling substances, activating response systems against various stresses to defend themselves. "Pathogens" include filamentous fungi (molds and fungi), bacteria, viruses, viroids, phytoplasmas, rhizocera-like microorganisms, nematodes, protozoa, and the like. More than 80% of infectious diseases are caused by filamentous fungi. The term "gene involved in the resistance mechanism" is not particularly limited as long as it is a gene involved in the resistance mechanism, and includes, for example, genes involved in the SA biosynthetic pathway, genes involved in SA signal transduction, and genes involved in SA degradation as described in the second embodiment. As used herein, the term "SA biosynthetic pathway" refers to the pathway leading up to the biosynthesis of SA, and "SA biosynthesis" includes the metabolism of SA precursors. "SA precursors" include chorismic acid, isochorismic acid, L-phenylalanine, trans-cinnamic acid, cinnamoyl-CoA, benzoyl-CoA, ortho-coumaric acid, and benzoic acid (Ishihama, Nobuaki, Shirasu, Regulation of Plant Growth & Development, Vol. 53, No. 1, 53-59, 2018). Furthermore, "SA degradation" refers to the degradation or metabolism of SA that has already been biosynthesized.

[0016] The pathways for SA biosynthesis, degradation, and signal transduction are well known (e.g., Weijie Huang et al., Molecular Plant, 13, 31-41, January 2020; Muhammad Saad Shoaib Khan et al., Frontiers in Plant Science, January 2020, Volume 13, 1-12 | Article 82937; Pingtao Ding et al., Trends in Plant Science, June 2020, Vol. 25, No. 6, 549-565) and are summarized as follows: SA is biosynthesized via two pathways: the isochorismate synthase (ICS) pathway and the phenylalanine ammonia-lyase (PAL)-mediated pathway. Chorismate (CA) is converted to isochorismate (IC) in plastids by ICS, and IC is transported into the cytoplasm by the MATE (multidrug and toxin extrusion protein) transporter EDS5 (enhanced disease susceptibility 5), where it is converted to isochorismate-9-glutamate (IC-9-Glu) by PBS3 (avrPphB Susceptible 3). IC-9-Glu is then spontaneously cleaved to SA, and EPS1 (enhanced pseudomonas susceptibility 1) enhances this cleavage. In the PAL-mediated pathway, phenylalanine is converted to trans-CA by PAL, which is then converted to benzoic acid via beta-oxidation by abnormal inflorescence meristem 1 (AIM1), and benzoic acid is then converted to SA (Weijie Huang et al., Molecular Plant, 13, 31-41, January 2020).Downstream of SA is the important signaling factor NPR1 (nonexpressor of pathogenesis-related genes 1). Upon receiving the SA signal, NPR1 is reduced and dissociated into monomers, which then translocate to the nucleus and interact with coactivators such as enhanced disease susceptibility 1 (EDS1) and cyclin-dependent kinase 8 (CDK8) to induce the expression of PR (pathogenesis-related) genes (Muhammad Saad Shoaib Khan et al., Frontiers in Plant Science, January 2020, Volume 13, 1-12 | Article 82937; Pingtao Ding et al., Trends in Plant Science, June 2020, Vol. 25, No. 6, 549-565). SA regulates the transcriptional activity of NPR1 via NPR3 / 4. Additionally, downstream of NPR1, several plant-specific WRKY transcription factors are induced in an SA-dependent manner and are thought to be involved in the expression of defense response genes. Phytoalexin difficile 4 (PAD4) encodes a lipase-like gene and is thought to interact with EDS1 to regulate defense responses. SA is glycosylated by salicylic acid glycosyltransferase (SGT) and other enzymes. The glycoside is a storage compound that does not exhibit activity by itself, but is hydrolyzed to free SA when needed.

[0017] Examples of genes involved in the SA biosynthetic pathway include the phenylalanine ammonia-lyase (PAL) gene, the isochorismate synthase (ICS) gene, the EDS1 gene, the EDS5 gene, the phytoalexin deficient 4 (PAD4) gene, the salicylic acid decarboxylase (SDC) gene, the salicylic acid glucoside hydrolase gene, the abnormal inflorescence meristem 1 (AIM1) gene, the avrPphB susceptible 3 (PBS3) gene, the EPS1 gene, the SARD1 (SAR-deficient 1) gene, and the calmodulin-binding protein 60g (CBP60g) gene.

[0018] Examples of genes involved in SA signal transduction include NPR genes (nonexpressor of pathogenesis-related genes), and examples of NPR genes include the NPR1 gene and the NPR3 / 4 gene.

[0019] As used herein, "suppressing gene expression" refers to the non-production or reduced production of a protein encoded by a gene involved in a resistance mechanism (hereinafter referred to as "target gene" where appropriate) in a target plant, and expression suppression includes temporary suppression of expression. The suppression may involve inhibiting the transcription process of the target gene from DNA to mRNA, inhibiting the translation process of the gene from mRNA to protein, or degrading the mRNA. The degree of inhibition is not particularly limited, as long as the resistance to pathogens is suppressed in a plant that has had the expression of the gene suppressed. As used herein, "disrupting gene expression" refers to the non-functioning of the target gene in a target plant, resulting in the non-production of a protein with normal function encoded by the gene.

[0020] The genes involved in SA degradation will be explained in the second embodiment.

[0021] In a first embodiment of the present invention, the method of the present invention described above may include the steps of: (i) preparing a nucleic acid construct for suppressing or disrupting a gene involved in the resistance mechanism; (ii) introducing the nucleic acid construct into a plant cell or plant tissue; and (iii) culturing the plant cell or plant tissue into which the nucleic acid construct has been introduced to produce a plant in which the nucleic acid construct is expressed. This method will be referred to as "Embodiment 1-1" as appropriate.

[0022] [First nucleic acid construct] The nucleic acid construct in step (i) preferably comprises a nucleic acid sequence complementary to the mRNA of the target gene or a transcript thereof ("first nucleic acid construct" or "nucleic acid construct comprising a nucleic acid sequence complementary to the mRNA of the target gene, etc."). In the first nucleic acid construct, examples of the nucleic acid sequence complementary to the mRNA of the target gene or a transcript thereof include antisense RNA, RNA interference (RNAi) molecules, and virus-induced gene silencing (VIGS) molecules.

[0023] In step (i), the nucleic acid construct can be prepared as follows. First, the method for suppressing or disrupting gene expression is as follows. The method for suppressing or disrupting gene expression is not particularly limited and can be appropriately selected depending on the purpose. Examples of methods for suppressing gene expression include the RNA interference (RNAi) method, the antisense method, and virus-induced gene silencing (VIGS), which is a temporary gene suppression method. Other examples include the ribozyme method, which is characterized by cleaving the transcript of a target gene, and the co-suppression method, which is characterized by suppressing the expression of a gene encoding a protein through a co-suppression effect during protein expression. Examples of methods for disrupting gene expression include genome editing.

[0024] When the RNAi method is used, for example, an RNAi vector is used to introduce DNA encoding RNA that suppresses the expression of a target gene by the RNAi effect when the target gene is expressed. This method suppresses the expression of a target gene by RNA interference (RNAi) using double-stranded RNA having a sequence identical or similar to the base sequence of the gene.

[0025] As the RNAi vector, a vector that expresses dsRNA that induces RNAi as a hairpin dsRNA is preferred. The RNAi vector that expresses dsRNA can be a hairpin RNAi vector constructed by arranging DNA corresponding to the dsRNA-forming portion so that it forms an IR (inverted repeat) at both ends of a spacer sequence of several bases or more, such as an intron. Alternatively, the RNAi vector may be a tandem type in which sense RNA and antisense RNA are transcribed by separate promoters, and these hybridize in cells to produce dsRNA. Alternatively, multiple expression vectors that transcribe sense RNA and antisense RNA may be constructed to induce RNAi. In the present invention, the sequence of double-stranded RNA that induces RNAi is referred to as an "RNA interference (RNAi) molecule."

[0026] Another preferred method for suppressing gene expression is DNA methylation (transcriptional gene silencing). RNAi is also involved in regulating gene expression at the transcriptional level through DNA methylation and chromatin modification, and in plants, it is known to involve the addition of a methyl group to the 5-carbon atom of the pyrimidine ring of cytosine.

[0027] When using the antisense method, a method of introducing DNA encoding an antisense RNA complementary to at least a portion of the transcript of a target gene can be used. This method involves suppressing the expression of a target gene in a plant by introducing DNA encoding an antisense RNA complementary to at least a portion of the transcript of the gene. Antisense RNA is known to suppress target gene expression by inhibiting transcription initiation through triplex formation, thereby suppressing target gene expression by inhibiting various processes such as transcription, splicing, and translation. In the present invention, target gene expression may be suppressed by any of the above mechanisms.

[0028] The base sequence of the antisense RNA is preferably complementary to at least a portion of the transcript of the target gene, but does not need to be completely complementary as long as it can effectively suppress the expression of the target gene. For example, the sequence identity between the complementary DNA strand of the DNA encoding the antisense RNA and the target gene is preferably 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. Here, sequence identity refers to a value that can be calculated by appropriately aligning at least two sequences to be compared, determining the identical residues present in each sequence, determining the number of matching sites, and then dividing the number of matching sites by the total number of residues in the sequence region to be compared, and multiplying the obtained value by 100. Specifically, such sequence identity can be calculated using the BLAST algorithm, which is publicly available, for example, at http: / / www.ncbi.nlm.nih.gov / BLAST / . The length of the DNA encoding the antisense RNA is not particularly limited and may be determined appropriately as desired.

[0029] Virus-induced gene silencing (VIGS) is a technology for suppressing the expression of plant-encoded genes using the RNA silencing mechanism induced by plant virus infection. For example, a partial sequence of the target gene of a plant whose expression is to be suppressed is introduced into the cloning site of a vectorized plasmid containing viral genomic DNA. This plasmid is then used to infect a plant with a viral vector, which degrades plant mRNA homologous to the introduced plant gene sequence, thereby specifically knocking down its expression. When targeting multiple genes, the siRNA sequence is selected to maximize the shared sequence of 21nt siRNAs with perfect sequence matches within the coding region of the homologous genes. An advantage of the VIGS system is that it is not necessary to develop a plant transformation protocol tailored to the plant species in which the target gene is to be silenced. Herein, the partial sequence of the target gene of a plant whose expression is to be suppressed is referred to as the "VIGS molecule."

[0030] VIGS cannot completely suppress target gene expression (e.g., Purkayastha A. et al., Plant Physiology and Biochemistry vol. 47, 967-976, 2009). In other words, the phenotype induced by VIGS is affected by the type (function) of the target gene, the degree of suppression, and the extent to which VIGS is induced. Therefore, depending on the vector and plant species, only partial silencing may be induced, and with some viral vectors, the inserted gene may be unstable and be lost within a short period of time.

[0031] The method for expressing a nucleic acid sequence complementary to the mRNA of a target gene or its transcript in a plant is not particularly limited, and any method known to those skilled in the art can be used as appropriate. For example, an expression cassette can be constructed in which the complementary nucleic acid sequence is linked in the antisense direction downstream of a promoter, and the expression cassette can be introduced into a plant cell. The method for constructing the expression cassette can be selected appropriately depending on the purpose. For example, a first nucleic acid construct can be constructed by operatively linking, in this order, a promoter sequence capable of transcription in a plant, the complementary nucleic acid sequence, and, if necessary, an appropriate terminator sequence.

[0032] In step (ii), the first nucleic acid construct may be introduced into a plant using either a stable expression system or a transient expression system. In a transient expression system, when a gene encoding a target protein (hereinafter referred to as "foreign gene") introduced into a host cell is expressed, the foreign gene exists and is expressed separately from the chromosome of the host cell. Therefore, it is possible to express the foreign gene within about 3 days to 2 weeks, making this a promising method for producing a target protein using a plant. However, the expression of the foreign gene decays and disappears over time. On the other hand, in a stable expression system, the foreign gene is integrated into the chromosome, and therefore expression continues stably over a long period of time.

[0033] Methods for introducing foreign genes into plants using stable expression systems can be broadly divided into direct methods such as PEG, electroporation, and particle gun techniques, and the Agrobacterium method. In the Agrobacterium method, the T-DNA (transferred-DNA) region in the Ti plasmid carried by Agrobacterium is integrated into the plant chromosome through the action of genes involved in DNA transfer in the same Ti plasmid and other genes present in the Agrobacterium and plant chromosomes. Plant cells with integrated T-DNA begin to produce plant hormones, resulting in the formation of crown gall tumors. The Agrobacterium method utilizes the ability of Agrobacterium to integrate its own DNA into plant cells, enabling the introduction of foreign genes into plants by replacing the region between the left and right borders (LB and RB) of the T-DNA region with a foreign gene. In a typical Agrobacterium method, a binary vector incorporating a foreign gene into the T-DNA region is first constructed through genetic manipulation using Escherichia coli, and the vector is then introduced into Agrobacterium. The recombinant Agrobacterium harboring the binary vector is cultured in liquid, and the cultured cells are then brought into contact with plant sections to establish infection. Plant hormones are then added to the medium to regenerate the plant cells, and plant cells in which a T-DNA region containing a selectable marker such as antibiotic resistance has been integrated into the chromosome are selected in the callus stage using antibiotic resistance as an indicator, producing regenerated recombinant plants.

[0034] Transient expression systems include the agroinfiltration method, the plant virus vector method, and agroinfection, which is a combination of these. Transient expression systems do not include the regeneration step required for the stable expression system.

[0035] The plant virus vector method involves in vitro transcription of cDNA of a plant virus genome into which a foreign gene has been inserted, inoculating the resulting RNA into a plant as a vector to infect it, and then expressing the foreign gene in the plant by utilizing the virus's own proliferation ability and systemic movement ability. Examples of plant virus vectors include those selected from the group consisting of full virus vectors and deconstructed virus vectors, such as tobacco mosaic virus (TMV), plum pox virus (PPV), turnip vein clearing virus (TVCV), potato virus X (PVX), bean yellow dwarf virus (BEYDV), alfalfa mosaic virus (AIMV), cucumber mosaic virus (CMV), cowpea mosaic virus (CPMV), zucchini yellow mosaic virus (ZYMV), tobacco rattle virus (TRV), apple latent spherical virus (ACMV), brome mosaic virus (BMV), tomato mosaic virus (ToMV), tomato yellow leaf curl virus (TYLCV), and tomato golden mosaic virus (TGMV).

[0036] The agroinfection method involves inserting a replicon capable of self-replicating within a plant cell into a T-DNA region, and then allowing the foreign gene to self-replicate using its own replication ability after Agrobacterium infection. The agroinfection method can express foreign genes in tissues throughout the plant's body and can also increase the amount of foreign gene expressed per plant cell. In particular, the agroinfection method developed by the present inventors, which combines CMV and T-DNA sequences (Japanese Patent Application Publication No. 2016 / 0002654), can achieve systemic movement throughout the plant and high levels of foreign gene expression in most cells of the plant used.

[0037] When the first nucleic acid construct is expressed in a plant using, for example, the agroinfiltration method or a stable expression system using Agrobacterium, it has the following sequences (a) to (e) in this order, except that sequence (d) is optional: (a) a right border sequence (RB) derived from the T-DNA sequence of Agrobacterium; (b) an expression promoter sequence that functions in plants; (c) a nucleic acid sequence complementary to the mRNA of the target gene or a transcript thereof; (d) a terminator sequence that functions in plants; and (e) a left border sequence (LB) derived from the T-DNA sequence of Agrobacterium.

[0038] The above (a) and (e), that is, the right border sequence (RB) and left border sequence (LB) derived from the Agrobacterium T-DNA sequence, are as described above.

[0039] The expression promoter sequence (b) above is not limited to any particular type, as long as it functions in the plant genome and is capable of initiating transcription of the nucleic acid sequence (c) above. Examples of such promoters include the Agrobacterium-derived NOS promoter, the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al., (1985), Nature, 313:810-812), the cassava mosaic virus promoter, the figwort mosaic virus promoter, the Badnavirus promoter, the strawberry vein binding virus (SVBV) promoter, the Mirabilis mosaic virus promoter (MMV), the Rubisco promoter, the actin promoter, and the ubiquitin promoter. Among these, promoters derived from the 35S promoter of the cauliflower mosaic virus (CaMV) are preferred.

[0040] The terminator sequence (d) above is an optional element, but it is preferable to link a terminator sequence in order to reliably terminate transcription of the nucleic acid sequence (c) above and express a desired functional protein. The type of terminator sequence is not limited as long as it is a sequence that can terminate transcription of the coding sequence of the nucleic acid sequence (c) above. Examples include the NOS terminator derived from Agrobacterium, the heat shock protein (hsp) terminator, and the 35S terminator of cauliflower mosaic virus (CaMV).

[0041] The first nucleic acid construct may further contain other sequences as long as they do not substantially interfere with its function. Examples of other sequences include any other sequences derived from the Agrobacterium Ti plasmid (e.g., the vir region), a selection marker gene, etc. The selection marker gene is used to confirm the introduction of the nucleic acid construct. The type of selection marker gene is not limited, but typically includes various antibiotic resistance genes and drug resistance genes, such as genes that confer resistance to ampicillin, streptomycin, gentamicin, kanamycin, hygromycin, actinonin (PDF1 gene), bialaphos herbicide, glyphosate herbicide, sulfonamide, and mannose. Furthermore, the selection marker gene is typically operably linked to a regulatory sequence such as a native promoter and configured as an expression cassette that is autonomously expressed in the plant genome, and is positioned between the right border sequence (RB) and the left border sequence (LB). This allows the selection marker to be introduced into the plant genome and autonomously expressed by random integration of the right border sequence (RB) and the left border sequence (LB) into the genome.

[0042] As described above, the first nucleic acid construct can also be expressed by agroinfection, and in particular, the agroinfection method combining CMV and T-DNA sequences (Japanese Patent Application Publication No. 2016 / 0002654) is preferably used. In this case, the first nucleic acid construct has the following sequences (a) to (e) in this order, with the exception that sequence (d) is optional: (a) a right border sequence (RB) derived from the Agrobacterium T-DNA sequence; (b) an expression promoter sequence functional in plants; (c') a sequence corresponding to the CMV RNA2 genome, in which part or all of the gene encoding the 2b protein has been replaced with a nucleic acid sequence complementary to the mRNA of a target gene or its transcript; (d) a terminator sequence functional in plants; and (e) a left border sequence (LB) derived from the Agrobacterium T-DNA sequence.

[0043] In the above sequence (c'), the sequence corresponding to the CMV RNA2 genome is usually the cDNA sequence of the RNA2 genome. The CMV RNA2 genome includes a gene encoding the 2a protein and a gene encoding the 2b protein, and in the present invention, part or all of the sequence corresponding to the gene encoding the 2b protein in the cDNA sequence of the RNA2 genome is replaced with a nucleic acid sequence complementary to the mRNA of the target gene or its transcript.

[0044] The first nucleic acid construct may be in a linear or circular form, but is preferably in a circular form, such as a plasmid form, and particularly preferably in the form of a T-DNA vector capable of replicating in Agrobacterium.

[0045] A nucleic acid construct having the above-described configuration can be easily prepared by appropriately combining various gene recombination techniques well known to those skilled in the art.

[0046] When a stable expression system using Agrobacterium is used, in step (ii) of embodiment 1-1 or 1-2, the method for introducing the first nucleic acid construct into a plant is preferably, for example, to prepare a solution containing the first nucleic acid construct (cultured bacterial cells), and then introduce the solution into plant tissue by various physical methods, such as immersion or bacterial cell coating.

[0047] When a transient expression system is used, in step (ii) of embodiment 1-1, the method for introducing the first nucleic acid construct into a plant preferably involves, for example, preparing a solution containing the first nucleic acid construct and introducing the solution into plant tissue by, for example, injection or infiltration.

[0048] Specifically, a solution containing the first nucleic acid construct can be prepared by culturing transformed Agrobacterium and using the resulting culture (e.g., overnight culture). Typically, overnight cultures reach an optical density at 600 nm (OD600) of 3 to 3.5 units. This culture is diluted 3 to 5 times before agroinfiltration, typically yielding 5 to 9 x 10 colony-forming units (CFU) (Turpen et al., (1993), J. Virol. Methods, 42:227-240). Such a culture is suspended, for example, in MES buffer to an OD600 of 0.2 to 0.8. When using these bacterial cell solutions individually, they are prepared as suspensions with an OD600 of 0.2 to 0.6. When using a mixture of multiple bacterial cell solutions, equal amounts of each bacterial cell are mixed, and the final bacterial cell volume of the suspension is adjusted to an OD600 of 0.3 to 1.2.

[0049] When a solution containing the first nucleic acid construct is introduced into a plant by injection, the solution is forcibly injected into the plant using, for example, a syringe, etc. When a solution containing the nucleic acid construct is introduced into a plant by infiltration, the solution containing the nucleic acid construct is brought into contact with the plant, and then reduced pressure (approximately −0.09 MPa) is applied using, for example, a vacuum desiccator, and the solution is forcibly infiltrated into the plant.

[0050] The plants used in the method of the present invention are not particularly limited, and any species of plant can be used. Examples include grown plants, plant cells, plant tissues, calli, seeds, etc. Furthermore, the plant cells include plant cells of various forms. Examples of such plant cells include suspension culture cells, protoplasts, leaf slices, etc.

[0051] Examples of plants to which the present invention can be applied include alfalfa, barley, kidney beans, canola, cowpeas, cotton, corn, clover, lotus, lentils, lupine, millet, oats, peas, peanuts, rice, rye, sweet clover, sunflower, sweet pea, soybean, sorghum, triticale, jicama, velvet bean, broad bean, wheat, wisteria, nut plants, etc. Preferred plants include plants of the Poaceae, Asteraceae, Solanaceae, and Rosaceae families.

[0052] More preferred plants include plants from the following genera: Arabidopsis thaliana, bedweed, leek, snapdragon, honeywort, peanut, asparagus, rice bran, oat, capsicum, rapeseed, bromegrass, bluebell, camellia, hemp, chili pepper, chickpea, chrysanthemum, chrysanthemum, citrus, coffee tree, Job's tears, cucumber, pumpkin, corngrass, orchard grass, Datura stramonium, melon fly, digitalis, Japanese yam, oil palm, Zoysiagrass, fescue, strawberry, owl's lily, soybean, sunflower, day lily, rubber tree, barley, henbane, sweet potato, Lettuce, lentils, lilies, flax, ryegrass, lotus, tomatoes, marjoram, apples, mangoes, potato trees, alfalfa, African daisies, tobacco, sainfoin, rice, millet, pelargonium graveolens, Japanese laurel, morning glory, peas, kidney beans, timothy grass, strawberry, cherry blossoms, buttercups, radishes, currants, castor beans, brambleberries, sugarcane, salmenba, rye, senecio, setaria, white mustard, eggplant, sorghum, lawn grass, cocoa, jasmine, rye, wheat, broad beans, cowpeas, grapes, corn, etc.

[0053] In step (iii), the plant into which the first nucleic acid construct has been introduced is cultivated to express the nucleic acid sequence complementary to the mRNA of the target gene or its transcript, which is incorporated into the nucleic acid construct. The method for cultivating the plant may be appropriately selected depending on the type of plant, the purpose of expressing the complementary nucleic acid sequence, etc.

[0054] In a first embodiment of the present invention, the method of the present invention may include the steps of: (i) preparing a second nucleic acid construct including a nucleic acid sequence encoding a genome editing-related protein having a target site in a gene involved in the resistance mechanism; (ii) introducing the nucleic acid construct into a plant cell or plant tissue; and (iii) culturing the plant cell or plant tissue into which the nucleic acid construct has been introduced to produce a plant body having a mutation introduced into the gene sequence. This method will be referred to as "Embodiment 1-2" as appropriate.

[0055] The first and second embodiments may further include, after step (iii), a step (iv) of removing the second nucleic acid construct from the plant into which the mutation has been introduced. For example, seeds that inherit the nucleotide sequence altered by genome editing but lack the second nucleic acid construct may be selected from seeds collected from plants in which genome editing has been successfully performed (i.e., the next generation after genome editing).

[0056] [Second Nucleic Acid Construct] The nucleic acid construct of step (i) may include a nucleic acid sequence encoding a genome editing-associated protein having a target site within a target gene ("second nucleic acid construct" or "nucleic acid construct for expressing a genome editing-associated protein"). Examples of such genome editing-associated proteins include CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats CRISPR-Associated Proteins 9), TALEN (Transcription Activator Like Effector Nuclease), ZFN (Zinc Finger Nuclease), and PPR (Pentatricopeptide Repeat). To confer site specificity to the genome editing-associated protein, ZFN and TALEN utilize a sequence recognition domain (ZF domain, TALE domain) that binds to the target gene, while CRISPR / Cas9 utilizes a guide RNA with a sequence complementary to the target gene. In particular, the CRISPR-Cas9 system has a simpler structure, a high degree of freedom in sequence design, a good success rate for genome editing, and is low cost.

[0057] Cas9 proteins of various origins are known (e.g., U.S. Patent No. 8,697,359, U.S. Patent No. 8,865,406, WO 2013 / 176772, etc.), and these can be used. In known CRISPR / Cas systems, Cas9 derived from Streptococcus pyogenes is commonly used. Cas9 proteins can be obtained by expressing and recovering them from various known Cas9 expression vectors using appropriate host culture cells. Commercially available Cas9 proteins may also be used.

[0058] The Cas9 protein can further include a molecule or molecular complex involved in specific recognition of the target gene. Examples include a nucleic acid sequence recognition module and a guide RNA. The term "nucleic acid sequence recognition module" refers to a molecule or molecular complex capable of specifically recognizing and binding to a target gene, such as a protospacer adjacent motif (PAM) sequence, or a DNA-binding domain of a protein capable of specifically binding to DNA, such as a restriction enzyme, transcription factor, or RNA polymerase. The PAM sequence varies depending on the species and type of organism from which the Cas9 protein is derived.

[0059] The guide RNA guides the Cas9 protein to the target site. Methods for designing and producing guide RNAs are well known. The guide RNA may be a single-molecule guide RNA (sgRNA) containing a crRNA (CRISPR RNA) and a tracrRNA (trans-activating crRNA), or a two-molecule guide RNA consisting of a crRNA fragment and a tracrRNA fragment. The targeting sequence in the crRNA typically consists of 12 to 50 bases, preferably 17 to 30 bases, and more preferably 17 to 25 bases, and is selected so as to target the microinjection region adjacent to the PAM sequence.

[0060] Guide RNA may be in the form of RNA, DNA encoding the RNA, or a vector expressing the DNA. When using RNA, it can be prepared by chemical synthesis using a commercially available polynucleotide synthesizer based on the base sequence. It can also be prepared using an in vitro transcription system. In the present invention, when the purpose is to disrupt the NPR1 gene, for example, guide RNAs of SEQ ID NOS: 22 to 23 (in each guide RNA sequence, the three bases at the 3' end represent a PAM sequence) can be used. Furthermore, when the purpose is to disrupt the ICS gene, for example, guide RNAs of SEQ ID NOS: 25 to 27 (in each guide RNA sequence of SEQ ID NOS: 25 and 27, the three bases at the 5' end represent a PAM sequence, and in the guide RNA sequence of SEQ ID NOS: 26, the three bases at the 5' end represent a PAM sequence) can be used. When the purpose is to disrupt the EDS1 gene, for example, guide RNAs of SEQ ID NOS: 47 to 50 (in each guide RNA sequence of SEQ ID NOS: 47 to 50, the three bases at the 3' end represent a PAM sequence) can be used.

[0061] For details of TALEN, see, for example, Japanese Patent No. 8470973, U.S. Patent No. 8586363, Zhang, Feng et al. (2011) Nature Biotechnology 29(2), etc., and for details of ZFN, see, for example, U.S. Patent No. 6265196, U.S. Patent No. 8524500, U.S. Patent No. 7888121, European Patent No. 1720995, etc.

[0062] The method for expressing a nucleic acid sequence encoding a genome editing-related protein in a plant is not particularly limited, and any method known to those skilled in the art can be used as appropriate. For example, an expression cassette can be constructed by linking at least a portion of a target gene to a nucleic acid molecule having a nucleic acid sequence encoding a genome editing-related protein downstream of a promoter, and then introducing the expression cassette into a plant cell. The method for constructing the expression cassette can be appropriately selected depending on the purpose. For example, a second nucleic acid construct can be constructed by operatively linking, in this order, a promoter sequence capable of transcription in a plant, a nucleic acid molecule having a nucleic acid sequence encoding a genome editing-related protein, and, if necessary, an appropriate terminator sequence.

[0063] The second nucleic acid construct can be expressed in a plant using a stable expression system and has the following sequences (a) to (e) in this order, except that sequence (d) is optional: (a) a right border sequence (RB) derived from the T-DNA sequence of Agrobacterium; (b) an expression promoter sequence that functions in plants; (c) a nucleic acid sequence encoding a genome editing-related protein; (d) a terminator sequence that functions in plants; and (e) a left border sequence (LB) derived from the T-DNA sequence of Agrobacterium.

[0064] Steps (ii) and (iii) in the embodiment 1-2 are as described in the embodiment 1-1.

[0065] Second Embodiment The second embodiment of the present invention relates to a method for producing a plant with suppressed pathogen resistance, which comprises overexpressing a gene involved in SA degradation in a plant (hereinafter referred to as an "SA degradation-involving gene" or a "target gene" as appropriate). "Overexpressing a gene" means that the amount of production of a protein encoded by the target gene is increased in a target plant, and includes cases where the expression level of an endogenous target gene is increased as well as cases where the target gene is transduced from an external source. The degree of increase is also not particularly limited.

[0066] When introducing a target gene from outside, a known method can be used. Specific methods are not limited, but for example, a recombinant vector can be introduced into a plant to express the target gene. The target gene can be expressed using a stable expression system or a transient expression system. Furthermore, when increasing the expression level of an endogenous target gene, for example, a known mutagen can be used to obtain a mutant in which the expression level of the endogenous target gene is increased.

[0067] SA is normally converted into inactive glycosides such as O-glucose salicylic acid and salicylic acid glucose esters by genes involved in SA degradation, but overexpression of genes involved in SA degradation inhibits SA accumulation and increases the production of inactive glycosides. Examples of genes involved in SA degradation include the SA glycosyltransferase (SGT) gene, SA glycosyltransferase genes (UGT74F1, UGT74F2, UGT76B1, UGT75B1), salicylate-3-hydroxylase (S3H) gene, salicylate-5-hydroxylase (S5H) gene, and salicylate hydroxylase (nahG) gene.

[0068] In a second embodiment of the present invention, the method of the present invention may include the steps of: (i) preparing a nucleic acid construct for overexpressing the gene involved in SA degradation; (ii) introducing the nucleic acid construct into plant cells or plant tissue; and (iii) culturing the plant cells or plant tissue into which the nucleic acid construct has been introduced to produce a plant in which the nucleic acid construct is expressed. This method will be referred to as the "second embodiment" as appropriate.

[0069] [Third Nucleic Acid Construct] The nucleic acid construct in step (i) preferably comprises a partial or complete nucleic acid sequence of a gene involved in SA degradation ("third nucleic acid construct" or "nucleic acid construct for expressing a gene involved in SA degradation").

[0070] The method for expressing a gene involved in SA degradation in a plant is not particularly limited, and any method known to those skilled in the art can be used as appropriate. For example, an expression cassette can be constructed by linking a nucleic acid molecule containing part or all of a gene involved in SA degradation downstream of a promoter, and then introducing the expression cassette into plant cells. The method for constructing the expression cassette can be appropriately selected depending on the purpose. For example, a third nucleic acid construct can be constructed by operatively linking, in this order, a promoter sequence capable of transcription in a plant, a nucleic acid molecule containing part or all of a gene involved in SA degradation, and, if necessary, an appropriate terminator sequence.

[0071] The third nucleic acid construct may be expressed using either a transient expression system or a stable expression system, and has, for example, the following sequences (a) to (e) in this order, except that sequence (d) is optional: (a) a right border sequence (RB) derived from an Agrobacterium T-DNA sequence; (b) an expression promoter sequence that functions in plants; (c) a coding sequence for a gene involved in the degradation of SA; (d) a terminator sequence that functions in plants; and (e) a left border sequence (LB) derived from an Agrobacterium T-DNA sequence.

[0072] Steps (ii) and (iii) in the second embodiment are as described in the 1-1 embodiment.

[0073] <Third Embodiment> The third embodiment of the present invention relates to a method for producing a target protein using the plant produced in the first embodiment. The third embodiment includes producing a transformed plant or the like in which the expression of a gene involved in the resistance mechanism (i.e., a target gene) is suppressed or disrupted by the method of embodiment 1-1 or embodiment 1-2, and introducing a nucleic acid construct for expressing the target protein in a plant (a "fourth nucleic acid construct" or a "nucleic acid construct for expressing a target protein") into plant cells or plant tissue to produce a transformed plant or the like or a genome-edited plant in which the fourth nucleic acid construct is expressed. In other words, this is a method for expressing a target protein in a transformed plant or the like or a genome-edited plant using a transformed plant or the like or a genome-edited plant in which the expression of the target gene is suppressed or disrupted.

[0074] [Fourth Nucleic Acid Construct] For example, the fourth nucleic acid construct can be constructed by operatively linking a promoter sequence transcribable in a plant, a gene encoding a target protein (foreign gene), and, if necessary, an appropriate terminator sequence, etc., in this order. The fourth nucleic acid construct can be introduced into a plant before, simultaneously with, or after step (ii) of the method of embodiment 1-1 or embodiment 1-2. That is, the fourth nucleic acid construct can be introduced into a plant separately from the first nucleic acid construct or the second nucleic acid construct. The expression method for the first nucleic acid construct and the fourth nucleic acid construct may be either a transient expression system or a stable expression system. A transient expression system is preferred because it allows the target protein to be expressed in a short period of time, approximately 3 days to 2 weeks. On the other hand, since the expression method for the second nucleic acid construct is a stable expression system, the expression method for the fourth nucleic acid construct combined with this is also a stable expression system.

[0075] The fourth transient expression system for expressing a nucleic acid construct includes agroinfiltration, plant virus vectors, and agroinfection, which is a combination of these.

[0076] When the fourth nucleic acid construct is expressed in a plant by agroinfiltration, as described in the method of embodiment 1-1, the fourth nucleic acid construct can have a right border sequence (RB) and a left border sequence (LB) derived from the T-DNA sequence of Agrobacterium at both ends of the T-DNA sequence.

[0077] The plant viral vector for expressing the fourth nucleic acid construct is selected from the group consisting of full viral vectors and deconstructed viral vectors, such as tobacco mosaic virus (TMV), plum pox virus (PPV), turnip vein clearing virus (TVCV), potato virus X (PVX), bean yellow dwarf virus (BeYDV), alfalfa mosaic virus (AIMV), cucumber mosaic virus (CMV), cowpea mosaic virus (CPMV), and zucchini yellow mosaic virus (ZYMV).

[0078] Examples of agroinfection methods include those that combine the above-mentioned viruses with Agrobacterium T-DNA, such as those that combine CMV with Agrobacterium T-DNA sequences (see, for example, U.S. Patent Application Publication No. 2016 / 0002654).

[0079] When the fourth nucleic acid construct is introduced simultaneously with step (ii), an exogenous gene can be incorporated into the first nucleic acid construct and operably linked thereto, which can then be used for introduction. In such cases, the fourth nucleic acid construct can be expressed using either a transient expression system or a stable expression system, with the transient expression system being preferred. Alternatively, an exogenous gene can be incorporated into the second nucleic acid construct and operably linked thereto, which can then be used for introduction, with the stable expression system being used for expression of the fourth nucleic acid construct.

[0080] The foreign gene used in the method for producing a target protein is not particularly limited, and any gene can be used. Examples include various natural or synthetic genes, their fragments, mutants, and modified forms. Specific examples of foreign genes include various cytokines, immunogenic substances, antibodies, enzymes, blood-derived components, adjuvant substances, virus-derived components, and pathogenic microorganism-derived components.

[0081] Steps (ii) and (iii) in the third embodiment are as described in the 1-1 embodiment.

[0082] <Fourth Embodiment> The fourth embodiment of the present invention relates to a method for producing a target protein using the plant produced in the second embodiment. The fourth embodiment includes producing a transformed plant or the like in which a gene involved in SA degradation is overexpressed by the method of the second embodiment, and introducing a fourth nucleic acid construct into plant cells or plant tissue to produce a transformed plant or the like in which the fourth nucleic acid construct is expressed. In other words, this is a method for highly expressing a target protein in a plant using a transformed plant or the like in which a gene involved in SA metabolism is overexpressed.

[0083] In the fourth embodiment, the fourth nucleic acid construct may be introduced into a plant before, simultaneously with, or after step (ii) of the method of the second embodiment. That is, the fourth nucleic acid construct may be introduced into a plant separately from the third nucleic acid construct. When the fourth nucleic acid construct is introduced simultaneously with step (ii), an exogenous gene may be incorporated into the third nucleic acid construct and operatively linked thereto, which may then be prepared as the fourth nucleic acid construct and used for introduction. The expression method may be a transient expression system or a stable expression system.

[0084] The structure and production method of the fourth nucleic acid construct in the fourth embodiment are as described in the third embodiment. The transient expression system is as described in the third embodiment.

[0085] Fifth Embodiment The fifth embodiment of the present invention relates to a method for producing a target protein using a plant. The fifth embodiment includes producing a transformed plant or the like obtained by the method of the first or second embodiment, or a genome-edited plant obtained by the method of the first or second embodiment, and introducing a fourth nucleic acid construct into plant cells or plant tissue to produce a transformed plant or the like or a genome-edited plant in which the fourth nucleic acid construct is expressed. In this method, for example, the fourth nucleic acid construct can be introduced into Agrobacterium, which can then be introduced into a transformed plant or the like obtained by the method of the first or second embodiment. Furthermore, for example, the fourth nucleic acid construct can be introduced into Agrobacterium, which can then be introduced into a genome-edited plant obtained by the method of the first or second embodiment. The structure and production method of the fourth nucleic acid construct in the fifth embodiment are as described in the third embodiment. Furthermore, the expression method of the fourth nucleic acid construct in the fifth embodiment may be either a transient expression system or a stable expression system. For example, Figures 6 and 7 show examples of expressing a target protein (GFP) in a transient expression system using an NPR gene-suppressed plant and a PAL gene-suppressed plant, respectively, which were produced in a stable expression system. By using the expression method of the fourth nucleic acid construct in the fifth embodiment, good expression of various cytokines, immunogenic substances, antibodies, enzymes, and the like other than GFP can also be expected. The transient expression system is as described in the third embodiment.

[0086] <Sixth Embodiment> The sixth embodiment of the present invention relates to a transformed plant obtained by the method of the first embodiment, such as a genome-edited plant obtained by the method of the first embodiment. In particular, in a transformed plant in which expression of the NPR gene was suppressed and in a transformed plant in which expression of the PAL gene was suppressed, the amount of mRNA accumulated of the target gene was reduced compared to the wild-type of the target plant. Furthermore, it was confirmed that the amount of biosynthesized SA (salicylic acid) was reduced in a transformed plant in which expression of the PAL gene was suppressed. Meanwhile, it was confirmed that the expression of a PR (pathogenesis related) gene downstream of the NPR gene was suppressed in a transformed plant in which expression of the NPR gene was suppressed compared to the wild-type of the target plant.

[0087] <Seventh Embodiment> The seventh embodiment of the present invention relates to a transformed plant obtained by the method of the second embodiment. In particular, SGT was overexpressed in the SGT transformed plant compared to the wild-type plant of the target, and GFP was detected only in the leaf veins of the wild-type plant. Furthermore, in the SGT transformed plant, GFP was detected not only in the leaf veins but also in the mesophyll cells, confirming that the target protein (GFP) had accumulated compared to the wild-type plant of the target. This suggests that resistance is suppressed by SGT overexpression.

[0088] Eighth Embodiment Furthermore, an eighth embodiment of the present invention relates to a transformed plant or genome-edited plant obtained by the methods of any of the third to fifth embodiments. In particular, it has been confirmed that a target protein (GFP) is expressed at a higher level in a transformed plant in which expression of the NPR gene is suppressed and in a transformed plant in which expression of the PAL gene is suppressed, compared to the wild-type of the target plant.

[0089] It was confirmed that the amount of biosynthesized SA was reduced and the target protein (GFP) was highly expressed in transformed plants in which the expression of the EDS1 gene was suppressed and in transformed plants in which the expression of the PAD4 gene was suppressed, both of which were produced by the VIGS method, compared to the wild-type plants of the target plants.

[0090] Furthermore, since all of the other genes involved in the resistance mechanism are also genes involved in the plant resistance mechanism, it is possible to produce transformed plants or genome-edited plants in which the relevant genes are suppressed or destroyed, or transformed plants in which the relevant genes are overexpressed, and it can be assumed that this will enable high expression of the target protein.

[0091] Furthermore, it is also possible to produce a plant having traits of both transformed plants or genome-edited plants by crossbreeding any two of the transformed plants or genome-edited plants obtained by the method of embodiment 1-1, in which the expression of genes involved in the SA biosynthetic pathway is suppressed, the genome-edited plant obtained by the method of embodiment 1-2, in which the expression of genes involved in the SA biosynthetic pathway is disrupted, the transformed plant obtained by the method of embodiment 2, in which genes involved in SA degradation are highly expressed, the transformed plant obtained by the method of embodiment 1-1, in which the expression of genes involved in SA signaling is suppressed, and the genome-edited plant obtained by the method of embodiment 1-2, in which the expression of genes involved in SA signaling is disrupted.

[0092] According to the present invention, it is possible to produce a plant with suppressed pathogen resistance, and furthermore, by using such a plant, it is possible to highly express a target protein. This indicates that suppressing the plant's inherent resistance mechanism can significantly improve the productivity of a target useful substance.

[0093] The present invention will be described in more detail below with reference to examples. However, the present invention is not limited to the following examples and can be practiced with appropriate modifications.

[0094] Example 1: Construction of a plant expression vector containing an inverted repeat structure of the NPR gene. An inverted repeat (IR-NPR) of a partial sequence of the NPR gene encoded by Nicotiana benthamiana tobacco was inserted between the internal promoter sequence and terminator sequence derived from the SVBV virus that had already been inserted into a plant expression binary vector (pGPTV-HPT) (Becker et al., Plant Molecular Biology, 20: 1195-1197, 1992) containing a hygromycin resistance gene expression cassette. IR-NPR was synthesized by arranging the antisense and sense strands, in that order, against a 400-bp partial sequence (SEQ ID NO: 1) capable of simultaneously targeting the NPRa (Niben101Scf14780g01001) and NPRb (Niben101Scf11512g01004) genes. Gene numbers are assigned in the following database (N. benthamiana Genome v1.0.1.): https: / / solgenomics.net / organism / Nicotiana_benthamiana / genome. The structure of the plant expression vector for IR-NPR (pGPTV-IR-NPR) is shown schematically in Figure 1.

[0095] SEQ ID NO: 1: 400 bp partial sequence of NPR gene (below is the sense strand sequence) GAATGACATCAGCGGAAGCAGTAGTATATGCTGCATCGGCGGCGGCATGACAGAATCATTCTCGCCGGAAACTTCGCCGGCAGAGATTACTTCACTGAAACGCCTCTCTGAAACATTGGAATCTATCTTCGATGCGGCTTCTCCGGAGTTTGACTACTTCGCCGACGCTAAGCTTGTGATTCCCGGCGCCGGTAAGGAAATTCCGGTTCACCGGTGCATTTTGTCGGCGAGGAGTCCGTTCTTTAAGAATTTGTTCTGCGGGAAAAAGGAGAAGAATAGTAATAAGGTGGAATTAAAGGAAATAATGAAAGAGTATGAAGTGAGCTATGATGGTGTGGTGAGTGTGTTGGCCTATTTGTATAGTGGAAAAATTAGGCCTTCACCTAAAGATGTGTGTGTT

[0096] Example 2: Method for introducing a plant expression vector into Agrobacterium Agrobacterium tumefaciens LBA4404 (Clontech) was transformed with a plant expression vector using the liquid nitrogen freeze-thaw method (Holsters M. et al., (1978), Mol. Gen. Genet., 163(2): 181-7). The resulting transformed Agrobacterium cells (LBA4404) were osmotic cultured overnight at 28°C in LB medium supplemented with 100 mg / L rifampicin, 300 mg / L streptomycin, and 50 mg / L kanamycin to obtain a bacterial cell suspension.

[0097] Example 3: Generation of NPR-Suppressed Plants Transformation of Nicotiana benthamiana was carried out using Agrobacterium tumefaciens strain LBA4404 by the leaf disc method (Horsch R.B. et al. (1984), Science, 223:496-498). Leaf discs approximately 1 cm in diameter were excised from tobacco leaves, immersed in a bacterial solution of LBA4404 strain harboring pGPTV-IR-NPR, and co-cultured on MS (Murashige-Skoog) agar medium for two days. After three days, the co-cultured leaf discs were washed to remove attached Agrobacterium and subcultured on MS solid medium (containing 3% sucrose) supplemented with 1 mg / L BAP (6-benzylaminopurine), 0.1 mg / L NAA (naphthaleneacetic acid), 15 mg / L hygromycin, and 50 mg / L carbenicillin. After shoot induction, rooting was induced on MS solid medium (containing 3% sucrose) supplemented with 15 mg / L hygromycin and 500 mg / L carbenicillin to obtain multiple cultured plant lines. These plant lines were selected by the method described in Example 4 below, and the cultured plant lines of the selected lines were then acclimatized in a closed recombinant greenhouse and grown in soil to obtain next-generation seeds (T1 individuals).

[0098] [Example 4] Analysis of NPR expression suppression in candidate plants Fresh leaves of the rooted cultured plants produced in Example 3, or fresh leaves of the plants inoculated by agroinfiltration in Example 15 described below, were frozen in liquid nitrogen and then ground. Total RNA was extracted using the AGPC extraction method (Chomczynski, P. et al., (1987), Anal. Biochem. 162:156-159). Total RNA was treated with DNase, and cDNA was synthesized by reverse transcription using random primers. Real-time PCR was performed using a LightCycler 96 system (Roche Diagnostics). For NPR gene expression analysis, primers (SEQ ID NOS: 2 and 3) and a hydrolysis probe (Universal Probe Library Probe #108, Roche Diagnostics) capable of simultaneously detecting the NPRa (Niben101Scf14780g01001) and NPRb (Niben101Scf11512g01004) genes were used. Quantification was performed using Nicotiana benthamiana elongation factor 1α (Nb EF1α; GenBank accession number AY206004) as an internal standard. For detection of the EF1α (elongation factor 1α) gene, primers (SEQ ID NOS: 4 and 5) and a hydrolysis probe (Universal Probe Library Probe #56, Roche Diagnostics) were used.

[0099] Primers for detecting NPR genes (NPRa, NPRb) SEQ ID NO: 2: TGTGTGTGTTTGTGTGGACAAT (22mer) (forward) SEQ ID NO: 3: GAACGCTACAGCTGGCCTAC (20mer) (reverse)

[0100] Primers for detecting the EF1α gene: SEQ ID NO: 4: CTGGTACCTCCCAAGCTGAC (20mer) (forward) SEQ ID NO: 5: CCAGCTTCAAAACCACCAGT (20mer) (reverse)

[0101] Example 5 Construction of a Plant Expression Vector Having an Inverted Repeat Structure of the PAL Gene An inverted repeat sequence (iPAL) of a partial sequence of the PAL gene encoded by Nicotiana benthamiana was inserted between the internal sequence of a virus-derived promoter and the terminator that had already been inserted into a plant expression binary vector (pBI121) (Jefferson et al., The EMBO Journal, vol. 6, no. 13, pp. 3901-3907 (1987)) having a kanamycin resistance gene expression cassette. iPAL was synthesized by arranging the sense strand and antisense strand in this order relative to a 157 bp partial sequence of the PAL gene (SEQ ID NO: 6) that can simultaneously target multiple PAL genes (Niben101Scf12881g00009, Niben101Scf12881g00010, Niben101Scf05442g03015, Niben101Scf04652g00007, Niben101Scf04090g02003, Niben101Scf05617g00005, Niben101Scf04375g02015, Niben101Scf03712g01008, Niben101Scf02432g00011). The structure of the plant expression vector for iPAL (pBI-iPAL) is shown schematically in Figure 2. The vector was introduced into Agrobacterium by the method described in Example 2.

[0102] SEQ ID NO: 6: Partial sequence of PAL gene, 157 bp (the following is the sense strand sequence): accaaagcaagatcgttacgccctcagaacatcaccccagtggcttggccctcaaattgaggtcatccgttctgcaaccaagatgattgagagagagattaactcagtgaacgacaaccctttgatcgatgtttcaagaaacaaggcgttacacggt

[0103] Example 6: Production of PAL-Suppressed Plants Transformation of Nicotiana benthamiana was carried out using Agrobacterium tumefaciens strain LBA4404 by the leaf disc method (Horsch R.B. et al., (1984), Science, 223:496-498). Leaf discs approximately 1 cm in diameter were excised from tobacco leaves, immersed in a bacterial solution of LBA4404 strain harboring pBI-iPAL, and co-cultured on MS (Murashige-Skoog) agar medium for two days. After three days of co-culture, the co-cultured leaf discs were washed to remove attached Agrobacterium and subcultured on MS solid medium (containing 3% sucrose) supplemented with 1 mg / L BAP (6-benzylaminopurine), 0.1 mg / L NAA (naphthaleneacetic acid), 50 mg / L kanamycin, and 500 mg / L carbenicillin. After shoot induction, rooting was induced on MS solid medium (containing 3% sucrose) supplemented with 50 mg / L kanamycin and 500 mg / L carbenicillin to obtain multiple cultured plant lines. These plant lines were selected using the method described in Example 7 below, and the cultured plant lines of the selected lines were then acclimatized in a closed recombinant greenhouse and grown in soil to obtain next-generation seeds (T1 individuals).

[0104] Example 7 Analysis of PAL Expression Suppression in Candidate Plants Fresh leaves from the rooted cultured plants produced in Example 6 or fresh leaves from plants inoculated by agroinfiltration in Example 15 described below were frozen in liquid nitrogen and then ground. Total RNA was extracted using the AGPC extraction method (Chomczynski, P. et al., (1987), Anal. Biochem. 162:156-159). Total RNA was treated with DNase, and cDNA was synthesized by reverse transcription using random primers. Real-time PCR was performed using a LightCycler 96 system (Roche Diagnostics). Primers (SEQ ID NOs: 7 and 8) and a hydrolysis probe (Universal Probe Library Probe #142, Roche Diagnostics) were used to analyze the expression level of the PAL gene. Quantification was performed using Nb EF1α as an internal standard. For detection of the EF1α gene, the same primers (SEQ ID NOs: 4 and 5) as those described in Example 4 and a hydrolysis probe were used.

[0105] Primers for detecting the PAL gene: SEQ ID NO: 7: TGCCATGGCTTCATACTGTT (20mer) (forward) SEQ ID NO: 8: CGGCACTTTGTACGTGGTTA (20mer) (reverse)

[0106] Example 8: Construction of a plant expression vector with an inverted repeat structure of the ICS gene. An inverted repeat sequence (iICS) of a partial sequence of the ICS gene encoded by Nicotiana benthamiana was inserted between the internal sequence of a virus-derived promoter and the terminator already inserted into a plant expression binary vector (pBI121) containing a kanamycin resistance gene expression cassette. iICS was synthesized by arranging the sense and antisense strands in this order relative to a 153-bp partial sequence of the ICS gene (SEQ ID NO: 9) capable of simultaneously targeting the ICSa gene (Niben101Scf00593g04010) and the ICSb gene (Niben101Scf05166g06006). The structure of the iICS plant expression vector (pBI-iICS) is shown schematically in Figure 3. The vector was introduced into Agrobacterium using the method described in Example 2.

[0107] SEQ ID NO: 9: 153 bp partial sequence of ICS gene (sense strand sequence shown below) CCAGAGGTCAATAGAAGCACTTCAGGCCACAATATGGCAGGTTTCCTCCGTTCTTATGAGGGTGCAGAAAAAAATATCTCGTTCACATATACTCGCGAGTACTCATGTCCCGGGTAAAGCATCTTGGGACCAAGCTGTTAAGCGTGCTTTGCA

[0108] Example 9: Production of ICS-Suppressed Plants Transformation of Nicotiana benthamiana was carried out using Agrobacterium tumefaciens strain LBA4404 by the leaf disc method (Horsch R.B. et al., (1984), Science, 223:496-498). Leaf discs approximately 1 cm in diameter were excised from tobacco leaves, immersed in a bacterial solution of LBA4404 strain harboring pBI-iICS, and co-cultured on MS (Murashige-Skoog) agar medium for two days. After three days, the co-cultured leaf discs were washed to remove attached Agrobacterium and subcultured on MS solid medium (containing 3% sucrose) supplemented with 1 mg / L BAP (6-benzylaminopurine), 0.1 mg / L NAA (naphthalene acetic acid), 50 mg / L kanamycin, and 500 mg / L carbenicillin. After shoot induction, rooting was induced on MS solid medium (containing 3% sucrose) supplemented with 50 mg / L kanamycin and 500 mg / L carbenicillin to obtain multiple cultured plant lines. These plant lines were selected by the method described in Example 10, and the cultured plant lines of the selected lines were acclimatized in a closed recombinant greenhouse and grown in soil to obtain next-generation seeds (T1 individuals).

[0109] Example 10: Analysis of ICS expression suppression in candidate plants. Fresh leaves from the rooted cultured plants produced in Example 9 or fresh leaves from the agroinfiltrated plants in Examples 5 and 16 were frozen in liquid nitrogen and then ground. Total RNA was extracted using the AGPC extraction method (Chomczynski, P. et al., (1987), Anal. Biochem. 162:156-159). The total RNA was treated with DNase, and cDNA was synthesized by reverse transcription using random primers. Real-time PCR was performed using a LightCycler 96 system (Roche Diagnostics). Primers (SEQ ID NOs: 10 and 11) and a hydrolysis probe (Universal Probe Library Probe #63, Roche Diagnostics) were used to analyze the expression level of the ICS gene. Quantification was performed using Nb EF1α as an internal standard. The EF1α gene was detected using the primers (SEQ ID NOs: 4 and 5) and hydrolysis probe described in Example 4.

[0110] Primers for detecting ICS gene SEQ ID NO: 10: ATTCCGCCATCTCTGACTTG (20mer) (forward) SEQ ID NO: 11: GGCACCTCAAGACGAATGATA (21mer) (reverse)

[0111] By comparing the expression level of the Nicotiana benthamiana ICS gene in wild-type (WT) plants with that in the ICS-suppressed plants, four lines (Nos. 13, 43, 5, and 14) were obtained in which the expression level was reduced to 40% or less. Figure 8 shows the results of RT-PCR analysis of the expression level of the ICS gene.

[0112] Example 11: Construction of a plant expression vector for overexpressing the SGT gene. The 1,371 bp (SEQ ID NO: 12) SGT gene from Nicotiana benthamiana (Nb) was inserted downstream of the internal promoter sequence derived from strawberry vein binding virus (SVBV) that had already been inserted into a plant expression binary vector (pGPTV-HPT) containing a hygromycin resistance gene expression cassette. Specifically, PCR was performed using Nicotiana benthamiana cDNA as a template, using a primer (SEQ ID NO: 13) for adding restriction enzyme sites to both ends of the SGT gene (1,368 bp, 99.85% homologous to Niben101Scf00788g02014) and a primer (SEQ ID NO: 14) for adding a stop codon and a restriction enzyme site, to obtain an amplified product. TA cloning was performed, and the XbaI-SGT gene-SacI fragment with the added restriction enzyme sequence was ligated into the vector to construct pGPTV-HPT-SGT. This cDNA clone sequence was subjected to restriction enzyme site confirmation and sequencing using ABI PRISM Big Dye Terminator (Applied Biosystems, USA) to confirm the absence of errors. The structure of the constructed plant expression vector (pGPTV-HPT-SGT) is shown schematically in Figure 4. The vector was introduced into Agrobacterium by the method described in Example 2.

[0113] Similarly, pBI121-SGT was produced by inserting the NbSGT gene downstream of the 35S promoter of a plant expression binary vector (pBI121) having a kanamycin resistance gene expression cassette.

[0114]

[0115] Primers for amplifying the SGT gene: SEQ ID NO: 13: CCTCTAGAATGACTACTCACAAAGCTCATTG (31 mer) (forward) SEQ ID NO: 14: TGAGCTCCTATTAAGAAATAGTCATCAACTTG (32 mer) (reverse)

[0116] [Example 12] Production of SGT-overexpressing plants Transformation of Nicotiana benthamiana was carried out using Agrobacterium tumefaciens strain LBA4404 by the leaf disc method (Horsch RB. et al., (1984), Science, 223:496-498). Leaf discs approximately 1 cm in diameter were excised from tobacco leaves, immersed in a bacterial solution of LBA4404 strain carrying a plant expression vector, and co-cultured on MS (Murashige-Skoog) agar medium for 2 days. After 3 days, the leaf discs co-cultured with the fungus carrying pGPTV-HPT-SGT were washed to remove attached Agrobacterium and subcultured on MS solid medium (containing 3% sucrose) supplemented with 1 mg / L BAP (6-benzylaminopurine), 0.1 mg / L NAA (naphthaleneacetic acid), 15 mg / L hygromycin, and 50 mg / L carbenicillin. After shoot induction, rooting was induced on MS solid medium (containing 3% sucrose) supplemented with 15 mg / L hygromycin and 50 mg / L carbenicillin. The cultured individuals were then acclimatized in a closed recombinant greenhouse and grown in soil to obtain next-generation seeds (T1 individuals).

[0117] After 3 days, the leaf discs co-cultured with the pBI121-SGT-harboring bacteria were washed to remove attached Agrobacterium and subcultured on MS solid medium (containing 3% sucrose) supplemented with 1 mg / L BAP (6-benzylaminopurine), 0.1 mg / L NAA (naphthalene acetic acid), 50 mg / L kanamycin, and 500 mg / L carbenicillin. After shoot induction, rooting was induced on MS solid medium (containing 3% sucrose) supplemented with 50 mg / L kanamycin and 500 mg / L carbenicillin, and multiple cultured plant lines were obtained. These plant lines were selected using the method described in Example 13, and the cultured plants of the selected lines were then acclimatized in a closed recombinant greenhouse and grown in soil to obtain next-generation seeds (T1 individuals).

[0118] Example 13 Analysis of SGT Protein Expression in SGT Transformants Fresh leaves from cultured plants (T0 individuals) produced by the method described in Example 12 were collected and pulverized using liquid nitrogen, followed by grinding with PBS. The grinding solution was centrifuged (4°C, 15,000 rpm, 10 minutes), and the supernatant was mixed with SDS-PAGE electrophoresis buffer and subjected to SDS-PAGE. Western blot analysis was performed using an anti-SGT antibody using a PVDF membrane for transfer. Transgenic tobacco expressing SGT protein was selected from the regenerated cultured individuals. A photograph showing the results of the Western blot analysis is shown in Figure 5. In this example, several lines were obtained in which high SGT expression was confirmed compared to non-transformants (wild-type plants).

[0119] The recombinant plants produced in Examples 1 to 13 were analyzed by the methods described in Examples 14 to 21 below.

[0120] Example 14 Confirmation of Foreign Gene Introduction (Plant Expression Vector Introduction) in Candidate Plants Leaves of the rooted cultured plants produced in Examples 3, 6, 9, and 12 were sampled, and then a leaf lysate was prepared using the Extract-N-Amp Plant PCR Kit (Sigma, cat. XNA-P2). PCR was then performed using the Extract N-Amp PCR reaction mix from the same kit to amplify a portion of the plant expression vector construct introduced into the cultured plants. The primer sequences are shown below. Since PCR amplification was confirmed in individuals, it was predicted that the introduced plant expression vector construct had been inserted into the chromosome, and these cultured individuals were lineaged as transformed N. benthamiana.

[0121] Detection of transgene in NPR-suppressed plants SEQ ID NO: 15: TGGCCAGCTAGCTATCACTGAAAAG (25mer) (forward) SEQ ID NO: 16: CCTGGGGTCAGTCTTATCTTCAGC (24mer) (reverse)

[0122] Detection of transgene in PAL-suppressed plants SEQ ID NO: 17: CCTTCGCAAGACCCTTCCTC (20mer) (forward) SEQ ID NO: 18: TTGAAACATCGATCAAAGGG (20mer) (reverse)

[0123] Detection of introduced genes in ICS-suppressed plants SEQ ID NO: 17: Same as above SEQ ID NO: 19: TTGGTCCCAAGATGCTTTAC (20mer) (reverse)

[0124] Detection of transgene in SGT overexpressing plants In the case of transgene pGPTV-HPT-SGT: SEQ ID NO: 20: CATTTGAAGGCAGAGGCGAACAC (23mer) (forward) SEQ ID NO: 21: ACTGAGCTAGCTGGTTGATGG (21mer) (reverse) In the case of transgene pBI121-SGT: SEQ ID NO: 17: same as above SEQ ID NO: 21: same as above

[0125] Example 15 Agroinfiltration (vacuum infiltration) method Agroinfiltration was performed using a modified version of the method described in Grimsley N. et al. (1986), Proc. Natl. Acad. Sci. USA 83: 3282-3286. Agrobacterium carrying the GFP gene was transformed using the method described in Example 2 to obtain a recombinant Agrobacterium cell solution. The recombinant Agrobacterium cell solution was centrifuged (20°C, 6,000 rpm, 15 minutes), and the resulting cell pellet was soaked in MES buffer (final concentration 10 mM MES, 10 mM MgCl ２ The cells were suspended in a 500-mL PBS (pH 5.7) to an OD600 value of 0.6. When inoculating with a CMV-agroinfection vector, multiple types of cell solutions were mixed, and the individual cell solutions were mixed so that the final concentration reached an OD600 value of 0.6 (see Japanese Patent No. 6350995). These cell solutions were forcefully injected into wild-type plants, NPR-suppressed plants, PAL-suppressed plants, and SGT-highly expressing plants using a vacuum desiccator.

[0126] [Example 16] Cultivation of fungal cell-inoculated plants The plants of Examples 3, 6, and 12, in which the target protein (GFP) was transiently expressed by agroinfiltration (vacuum infiltration) using the method described in Example 15, were cultivated at 23°C in an artificial climate chamber or an illuminated plant cultivation incubator under a 16-hour light / 8-hour dark cycle.

[0127] Example 17: Western Blot Method for Detection of Target Protein (GFP) in Inoculated Plants. Leaves were collected from plants in which GFP was transiently expressed as described in Examples 15 and 16, pulverized using liquid nitrogen, and then ground with Tris buffer. The ground solution was centrifuged (15,000 rpm, 4°C, 10 minutes), and the crude juice supernatant was collected. Total protein (TSP) was quantified using the BCA method. For Western blot analysis, a fixed amount of TSP was prepared in each lane, and the gel was electrophoresed on a 12% SDS-PAGE gel and then transferred to a PVDF membrane. Immunostaining was performed using a specific antibody (anti-GFP antibody), and band intensity was quantified using ChemiDoc (Bio-Rad). Figure 6 shows the results of transient expression of a target protein (GFP) by agroinfiltration in NPR-suppressed plants, Figure 7 shows the results of transient expression of a target protein (GFP) by agroinfiltration in PAL-suppressed plants, Figure 19 shows the results of transient expression of a target protein (GFP) by agroinfiltration in SGT-overexpressing plants, and Figure 9 shows the results of transient expression of a target protein (GFP) by agroinfection in SGT-overexpressing plants. Increased GFP expression levels were confirmed in NPR-suppressed plants (Figure 6), PAL-suppressed plants (Figure 7), and SGT-overexpressing plants (Figure 19) compared to wild-type plants. Furthermore, in the wild-type plants in Figure 9, GFP was detected only in the veins, whereas in SGT-overexpressing plants, GFP was detected in the veins and mesophyll, expanding the range of expression. In other words, increased GFP expression levels were confirmed in SGT-overexpressing plants.

[0128] Example 18: Detection of GFP in Leaves of Inoculated Plants To confirm expression of the target gene in the inoculated plants, GFP-inoculated individuals were irradiated with blue light in a visible wavelength range, and GFP fluorescence in the plants was observed using a filter. GFP fluorescence photographs were taken using a GFP epifluorescence device SZX-RFL2 (SZX fluorescence illumination system, Olympus Corporation) or a digital camera. For example, Figure 10 shows a photograph (top) of GFP fluorescence in the leaves of SGT-transformed tobacco (SGT-overexpressing plant) obtained in Example 9, and a photograph (bottom) of GFP fluorescence in the leaves of wild-type tobacco (wild-type plant). Furthermore, Figure 16 shows photographs of GFP fluorescence in the leaves of the VIGS-induced EDS1-suppressed plant obtained in Example 28 and the VIGS-induced PAD4-suppressed plant obtained in Example 29.

[0129] [Example 19] Statistical analysis Data for each individual plant was subjected to a multiple comparison test using the Tukey-Kramer method. The test was performed at a significance level of 5%. The results are shown at the bottom of Figures 6, 7, 14, and 15. In the figures, * indicates groups in which a significant difference was observed compared to wild-type plants.

[0130] Example 20: Extraction of salicylic acid and salicylic acid glycosides from leaves. Salicylic acid and salicylic acid glycosides were extracted using the following method, a modification of the method by Tugizimana et al. (Metabolites 9:194 (2019)). First, powdered freeze-dried leaves were added to 80% methanol containing 0.1% formic acid, vortexed for 5 minutes, and then sonicated at ice temperature for 20 minutes to extract salicylic acids. The mixture was then centrifuged at 12,000 rpm for 5 minutes and the supernatant transferred to a new tube. This procedure was repeated twice, and the collected supernatant was left to stand at ice temperature for 1 hour, centrifuged at 6,000 rpm for 10 minutes, and then purified using an Oasis PRiME HLB column (Waters).

[0131] Example 21 LCMS Analysis Method for Salicylic Acid and Salicylic Acid Glycosides The salicylic acid and salicylic acid glycosides extracted in Example 20 were analyzed by LCMS using the following method, which was a modification of the method of Pastor et al. (Plant Physiology and Biochemistry 53:19 (2012)). Salicylic acid CAS 69-72-7 (SA), salicylic acid 2-O-β-D-glucoside CAS 10366-91-3 (SAG), and salicylic acid acylglucoside CAS 60517-74-0 (SGE) were separated and quantified in negative ion mode using an ultra-high-performance liquid chromatograph (ACQUITY UPLC H-Class: Waters), a tandem quadrupole mass spectrometer (Xevo TQD, Waters), and a reversed-phase column (ACQUITY UPLC BEH C18 1.7 μm, 2.1 mm x 50 mm: Waters). Standards used were SA manufactured by Fujifilm Wako Pure Chemical Industries, and SAG and SGE manufactured by Toronto Research Chemicals. Quantitation was performed using MRM with MassLynx™ ver. The analysis was performed using the IntelliStart program in Waters 4.1 software. The mobile phase consisted of 0.1% formic acid (A) and acetonitrile containing 0.1% formic acid (B). The gradient was as follows: 0 to 1 min: 95% A, 5% B (constant), 1 to 8 min: 0% A, 100% B (gradient), 8 to 10 min: 0% A, 100% B (constant), 10 to 11 min: 95% A, 5% B (gradient), 11 to 12 min: 95% A, 5% B (constant), flow rate: 0.4 ml / min, column temperature: 40°C, sample injection volume: 2 μl. The MRM transition for SA was m / z 136.872 > 93.0, and the MRM transition for SAG and SGE was 299.03 > 136.88, and SAG and SGE were distinguished by the difference in retention time.

[0132] The results of measuring the leaf content of salicylic acid (SA) and SA metabolites (SAG, SGE) in recombinant plants in which genes involved in the SA biosynthesis pathway and SA degradation were manipulated using the methods of Examples 20 and 21 are shown for PAL-suppressed plants in Figure 7, ICS genome-edited plants in Figure 15, and EDS1-suppressed plants and PAD4-suppressed plants in Figure 17. It was confirmed that the SA content was reduced in these plants compared to wild-type plants. This indicates that the suppression of genes involved in SA biosynthesis, genome editing, or VIGS suppression reduced the amount of SA accumulated in these plants. Furthermore, Figure 11 shows the results of measuring the salicylic acid (SA) and SA metabolites (SAG, SGE) content in the SGT-overexpressing plant shown in Figure 10 and the wild-type plant. While SA and SA metabolites were hardly detected in individuals not inoculated with Agrobacterium, SA and SA metabolites were detected in wild-type plants and SGT-overexpressing plants inoculated with Agrobacterium (CMV-agroinfection vector). Furthermore, the amounts of SAG and SGE accumulated in inoculated SGT-overexpressing plants increased compared to inoculated wild-type plants. In other words, it was inferred that highly expressed SGT increased the accumulation of SAG and SGE, which are degradation (metabolism) products of SA in the leaves.

[0133] Example 22: Construction of a Genome Editing Vector for the NPR Gene. Guide RNAs were designed to simultaneously knock out the NPRa and NPRb genes, and oligo DNAs containing the designed guide RNA target sequences (SEQ ID NOs: 22, 23, and 24) were synthesized. Each oligo DNA was obtained by annealing a sense guide RNA and an antisense guide RNA, followed by a Golden Gate cloning reaction and insertion downstream of the guide RNA expression promoter of the genome editing vector pEgP237-2A-GFP (Ueta et al., Scientific Reports, 7:1-8, 2017). E. coli was transformed, and the sequence of the resulting clone was confirmed. The structure of the plant expression vector for guide RNA expression (pEgP237-2A-GFP-NPRgRNA) is shown schematically in Figure 12. The vector was introduced into Agrobacterium using the method described in Example 2.

[0134] Guide RNA sequence (oligo DNA + PAM sequence) SEQ ID NO: 22: TGCAGATGTTGCTAAGAGAGGGG (23mer) SEQ ID NO: 23: ACTGCAGATGTTGCTAAGAGAGG (23mer) SEQ ID NO: 24: ACCGATTCACGAGCAGAACTTGG (23mer)

[0135] Example 23: Construction of a genome editing vector for the ICS gene. Guide RNAs were designed to simultaneously knock out the ICSa and ICSb genes, and oligo DNAs containing the designed guide RNA target sequences (SEQ ID NOs: 25, 26, and 27) were synthesized. Each oligo DNA was obtained by annealing a sense guide RNA and an antisense guide RNA, followed by a Golden Gate cloning reaction and insertion downstream of the guide RNA expression promoter of the genome editing vector pEgP237-2A-GFP (Ueta et al., Scientific Reports, 7:1-8, 2017). E. coli was transformed, and the sequence of the resulting clone was confirmed. The structure of the plant expression vector for guide RNA expression (pEgP237-2A-GFP-NPRgRNA) is shown schematically in Figure 13. The vector was introduced into Agrobacterium using the method described in Example 2.

[0136] Guide RNA sequence (oligo DNA + PAM sequence) SEQ ID NO: 25: GGAGGCAAGAATACTCCCACGTC (23mer) Antisense strand SEQ ID NO: 26: ACGATTGGCGTGCTATACGCAGG (23mer) SEQ ID NO: 27: GGAAACTGCTAACCGCACGATAT (23mer) Antisense strand

[0137] [Example 24] Production of genome-edited plants Transformation of Nicotiana benthamiana was carried out using Agrobacterium tumefaciens strain LBA4404 by the leaf disc method (Horsch RB. et al., (1984), Science, 223:496-498). Leaf discs approximately 1 cm in diameter were excised from tobacco leaves and immersed in a bacterial solution of LBA4404 strain harboring pEgP237-2A-GFP (Ueta et al., Scientific Reports, 7:1-8, 2017) containing an inserted guide RNA sequence. Co-culture was carried out on MS (Murashige-Skoog) agar medium for 2 days. After 3 days, the co-cultured leaf disks were washed to remove attached Agrobacterium and subcultured on MS solid medium (containing 3% sucrose) supplemented with 1 mg / L BAP (6-benzylaminopurine), 0.1 mg / L NAA (naphthalene acetic acid), 50 mg / L kanamycin, and 500 mg / L carbenicillin. After shoot induction, rooting was induced on MS solid medium (containing 3% sucrose) supplemented with 50 mg / L kanamycin and 500 mg / L carbenicillin to obtain multiple cultured plant lineages. These plant lineages were selected using the methods described in Examples 25 and 26, respectively. The cultured plant lineages of the selected lineages were then acclimatized in a closed recombinant greenhouse and grown in soil to obtain next-generation seeds (T1 to T4 individuals).

[0138] Example 25: Mutation analysis of NPR genome-edited plants Genomic DNA was extracted from leaves of the candidate genome-edited plants produced in Example 24. Genome extraction was performed using MagExtractor-PlantGenome (Toyobo, NPK-501) according to the manufacturer's instructions. Using the resulting genomic DNA as a template, the NPR gene region expected to undergo mutation introduction was amplified by PCR using primers (SEQ ID NOS: 28-36), and then NGS analysis and Sanger sequencing analysis were performed to confirm the introduction of mutations. The following mutations were presumed to have been introduced into genome-edited plants (NPRg526 Nos. 72-73) (Figure 14) obtained using the plant expression vector shown in Figure 12, into which the guide RNA of SEQ ID NOS: 22 had been inserted.

[0139] NPRa: Sequence analysis has revealed that the following mutant sequences are present in the homologous pair: Wild type: TGCAGATGTTGCTAAGAGAG (SEQ ID NO: 55) Mutant: TGCAGATGTTGCTAAG-GAG (A deleted) (SEQ ID NO: 56) NPRb: Sequence analysis has revealed that the following mutant sequences are present in the homologous pair: Wild type: TGCAGATGTTGCTAAGAGAG (SEQ ID NO: 57) Mutant: TGCAGATGTTGCTAAGATGAG (T inserted) (SEQ ID NO: 58)

[0140] These results demonstrate that plants with mutations introduced into the NPR gene (NPR genome-edited plants) were obtained. Using these plants, transient expression of the target protein (IgG) was performed. Transient expression was performed using the same method as described in Example 15, except that the IgG gene was used instead of the GFP gene. Inoculated plants were grown under the same conditions as described in Example 16. The expression level of the IgG gene was evaluated using the method described in Example 27 below. As a result, it was confirmed that IgG expression was significantly increased in multiple lines produced in NPR genome-edited plants compared to wild-type plants (Figures 14, 20, and 21). This effect was also observed in genetically fixed genome-edited plants (plants that do not contain the plant expression vector, which has been isolated by genetic techniques), confirming that expression of the target protein was significantly increased compared to wild-type plants (Figure 20).

[0141] PCR primers for amplifying the mutation-introduced region for NGS analysis Primer for detecting NPRa mutation SEQ ID NO: 28: acactctttccctacacgacgctcttccgatctCTAATGGTCCATTGCATATTTC (55mer) (forward) SEQ ID NO: 29: gtgactggagttcagacgtgtgctcttccgatctGTGCAAGATCTAGAAGTTCTG (55mer) (reverse) Primer for detecting NPRb mutation SEQ ID NO: 30: acactctttccctacacgacgctcttccgatctGTTCCACTTCACATTTCCTTC (54mer) (forward) SEQ ID NO: 29: same as above

[0142] PCR primers for amplifying the mutation-introduced region for Sanger sequencing Primer for detecting NPRa mutation SEQ ID NO: 31: CAGAGCAACCCCTCTTGTCTGTAC (24mer) (forward) SEQ ID NO: 32: CAAACTAAGTGGAAGATCATACAG (24mer) (reverse) Primer for detecting NPRb mutation SEQ ID NO: 33: GTCATTCAAGGTAAGTTTCTAGTG (24mer) (forward) SEQ ID NO: 34: CTTATGGAAGATCGTATACAGTG (23mer) (reverse)

[0143] Sanger sequencing primers: For NPRa sequence: SEQ ID NO: 35: CTAATGGTCCATTGCATATTTC (22mer); For NPRb sequence: SEQ ID NO: 36: GTTCCACTTCACATTTCCTTC (21mer)

[0144] Example 26: Mutation Analysis of ICS Genome-Edited Plants Genomic DNA was extracted from leaves of the candidate genome-edited plants produced in Example 24. Genome extraction was performed using MagExtractor-PlantGenome (Toyobo, NPK-501) according to the manufacturer's instructions. Using the resulting genomic DNA as a template, the ICS gene region expected to undergo mutation introduction was amplified by PCR using primers (SEQ ID NOS: 36-43). Next-generation sequencing (NGS) and Sanger sequencing were then performed to confirm the introduction of mutations. The following mutations were presumed to have been introduced into genome-edited plants (ICSg95 Nos. 45-46) (Figure 15) obtained using the plant expression vector shown in Figure 13, into which the guide RNA of SEQ ID NOS: 27 had been inserted.

[0145] ICSa: Sequence analysis revealed that it has the following mutant sequences in its homology. Wild type: CTTCTAAAGTGGTCAGTGTAGCTGGTGTCGGCTCTGCTGTCTTCTTTACTCATTTACGCCCTTTTTCCTTTGACGATTGGCGTGCTATA (SEQ ID NO: 59) (The underlined part indicates the sequence (complementary strand) of ICSg95.) Mutant: CTTCTAAAGTG-------------------------------------------------------------------------CTATA (SEQ ID NO: 60) ("-" indicates that the base at the corresponding position is deleted. A total of 73 bases are deleted.)

[0146] ICSb: Sequence analysis revealed the following heterologous wild-type and mutant sequences: Wild-type: TTGACGATTGGCGTGCTATA (SEQ ID NO: 61) Mutant: TTGA-----GGCGTGCTATA (SEQ ID NO: 62) ("-" indicates that the base at the corresponding position is deleted. A total of 5 bases are deleted.)

[0147] These results demonstrated that we were able to obtain plants with mutations (ICS genome-edited plants). Using these plants, transient expression of the target protein (IgG) was performed. Transient expression was performed using the same method as described in Example 15, except that the IgG gene was used instead of the GFP gene. Inoculated plants were grown under the same conditions as described in Example 16. The expression level of the IgG gene was evaluated using the method described in Example 27 below. As a result, it was confirmed that IgG expression was significantly increased in ICS genome-edited plants compared to wild-type plants ( Figure 15 ). Furthermore, when the amount of SA in the plants was measured using the method described in Example 21, SA accumulation was reduced in ICS genome-edited plants compared to wild-type plants ( Figure 15 ). This indicates that mutation of an enzyme gene involved in SA biosynthesis by genome editing reduced the amount of SA accumulated in these plants.

[0148] PCR primers for amplifying the mutation-introduced region for NGS analysis Primer for detecting ICSa mutation SEQ ID NO: 37: acactctttccctacacgacgctcttccgatctGTCGAAGGGCAGCTGCTGATTC (55mer) (forward) SEQ ID NO: 38: gtgactggagttcagacgtgtgctcttccgatctTTTAGTTGCCCAAATCTTCAG (55mer) (reverse) Primer for detecting ICSb mutation SEQ ID NO: 39: acactctttccctacacgacgctcttccgatctGGTCGAAGGCCAGCTGTTGAAC (55mer) (forward) SEQ ID NO: 40: gtgactggagttcagacgtgtgctcttccgatctCTACACTAATTTCATCATCTATG (57mer) (reverse)

[0149] PCR primers for amplifying the mutation-introduced region for Sanger sequencing Primers for detecting ICSa mutations SEQ ID NO: 41: GTCGAAGGGCAGCTGCTGATTC (22mer) (forward) SEQ ID NO: 42: TTTAGTTGCCCAAATCTTCAG (21mer) (reverse) Primers for detecting ICSb mutations SEQ ID NO: 43: GGTCGAAGGCCAGCTGTTGAAC (22mer) (forward) SEQ ID NO: 44: CTACACTAATTTCATCATCTATG (23mer) (reverse)

[0150] Primers for Sanger sequencing For ICSa sequencing, SEQ ID NO: 42: Same as above For ICSb sequencing, SEQ ID NO: 44: Same as above

[0151] Example 27: Western Blot Method for Detection of Target Protein (IgG) in Inoculated Plants Leaves were collected from plants inoculated with the IgG gene and pulverized using liquid nitrogen. PBS buffer was then added and the pulverized solution was then centrifuged (15,000 rpm, 4°C, 10 minutes), and the crude juice supernatant was collected. Total protein (TSP) was quantified using the BCA method. For Western blot analysis, a fixed amount of TSP was prepared for each lane, and the gel was then electrophoresed on a 12% SDS-PAGE gel and transferred to a PVDF membrane. Immunostaining was performed using a specific antibody (anti-IgG antibody), and band intensity was quantified using ChemiDoc (Bio-Rad) for chemiluminescence detection.

[0152] [Example 28] Transient gene suppression of the EDS1 gene The Nicotiana benthamiana EDS1a gene (Niben101Scf06720g01024) and EDS1b gene (Niben101Scf02237g01002) were cloned, and a 300 bp partial sequence (SEQ ID NO: 45) capable of simultaneously targeting these genes was introduced into a viral vector, and EDS1 gene expression suppression was induced using the VIGS method. To analyze the expression level of the EDS1 gene, the region in which the EDS1a gene and the EDS1b gene could be simultaneously detected was evaluated using quantitative RT-PCR. The target protein (GFP) was expressed in this plant by agroinfiltration (vacuum infiltration), and after growing the inoculated plant body using the method described in Example 16, GFP was detected using the method described in Example 17. Gene suppression by VIGS was examined in these plants using quantitative RT-PCR. The results confirmed that, when the EDS1 gene expression level in wild-type plants (without gene suppression) was taken as 1, the EDS1 gene expression level in tobacco plants inoculated with an empty vector not containing the EDS1 gene was 0.67, and the EDS1 gene expression level in the EDS1-suppressed tobacco plants produced in Example 28 was 0.18. Furthermore, Western blot analysis of GFP expression levels in these plants ( FIG. 17 ) confirmed increased GFP expression in EDS1-suppressed plants compared with wild-type plants and plants inoculated with the empty vector. Meanwhile, the contents of salicylic acid (SA) and SA metabolites (SAG, SGE) in leaves of EDS1-suppressed tobacco plants were measured using the methods described in Examples 20 and 21. The results are shown at the bottom of FIG. 17 . It was confirmed that SA levels were reduced in these plants compared with wild-type plants. This indicates that VIGS suppression of the EDS gene involved in SA biosynthesis reduced the amount of SA accumulated in these plants.

[0153] SEQ ID NO: 45: 300 bp partial sequence of EDS1 gene (introduced as an antisense strand, so the following is the antisense sequence) GTTTCTTAGTTCCTCCACTTCTGCCCAAAAACAAGACTCAGAGCGTTCACCTGTTTGCACCCTCTCTTCATGCTCTAACCATCGTTGTGTGAACCTATAACGCTTCGGCCTAGCCCTGATCATGTAAGGTCCTGTATCTTCATTCTTCAAATGCCTGTAATAGTTTGCAATATCCAAGGGCTCAACTTGCCTGCGGAACTGCGTCCCTAGTTTTATCCATTCCTTTCTTCCCTCAAAACTATCTGGGAGCTCATACCTTTTCAACATTTCAATGATTTCGTCCCATATTCCTGCTAGCTC

[0154] Example 29: Transient Gene Suppression of the PAD4 Gene The Nicotiana benthamiana PAD4 gene (Niben101Scf02544g01012) was cloned, and a portion of the sequence (300 bp) was introduced into a viral vector. PAD4 gene expression suppression was induced by the VIGS method. The effect of suppressing PAD4 gene expression was evaluated by quantitative RT-PCR (Figure 16). The target protein (GFP) was expressed in this plant by agroinfiltration (vacuum infiltration). After growing the inoculated plant as described in Example 16, GFP was detected as described in Example 17. Gene suppression by VIGS was examined in these plants using quantitative RT-PCR. The results confirmed that, when the PAD4 gene expression level in wild-type plants (without gene suppression) was taken as 1, the PAD4 gene expression level in tobacco plants inoculated with an empty vector not containing the PAD4 gene was 0.79, and the PAD4 gene expression level in PAD4-suppressed tobacco plants produced according to Example 29 was 0.2. Furthermore, the expression levels of GFP in these plants were evaluated by Western blot analysis ( FIG. 17 ). Compared with wild-type plants and plants inoculated with the empty vector, the PAD4-suppressed plants showed increased GFP expression levels. Meanwhile, the contents of salicylic acid (SA) and SA metabolites (SAG, SGE) in the leaves of PAD4-suppressed tobacco plants were measured using the methods described in Examples 20 and 21. The results are shown at the bottom of FIG. 17 . It was confirmed that the SA levels were reduced in these plants compared with wild-type plants. This indicates that VIGS suppression of the PAD4 gene involved in SA biosynthesis reduced the amount of SA accumulated in these plants.

[0155] SEQ ID NO: 46: 300 bp partial sequence of PAD4 gene (introduced as an antisense strand, so the following is the antisense sequence) TCATAGCTTGCCTCAGGTAGATTGCCTCCCATGAAGCTTCTAATCTCTATAAATTGCCAATGAACTTTCTGAATAAAATGCGTATAACCAAGATGATCCTCGAGGCTAGAACTTGGTGAACCATTCAGTAACGTCAAGTAAAGTAACTTAACGATAAGCATCCCATTATCGACACAAACTGCACCCATGTTGGTGCAGAACAAGTAGCTCCCAAAGGGCCAAAATGAACTCTTACATTCACCTTTTGATATAACTTCAAGAGAAGCCAACACAACGCGGAATAGCTGAGTCTTGTTTTCC

[0156] Example 30: Construction of a genome editing vector for the EDS gene. Guide RNAs were designed to simultaneously knock out the EDS1 gene (Niben101Scf06720g01024) and the EDS1b gene (Niben101Scf02237g01002), and oligo DNAs containing the designed guide RNA target sequences (SEQ ID NOs: 47, 48, 49, and 50) were synthesized. Each oligo DNA was obtained by annealing a sense guide RNA and an antisense guide RNA, followed by Golden Gate cloning and insertion downstream of the guide RNA expression promoter of the genome editing vector pEgP237-2A-GFP (Ueta et al., Scientific Reports, 7:1-8, 2017). Transformation of E. coli was performed, and the resulting clones were sequenced. The structure of the plant expression vector (pEgP237-2A-GFP-EDSgRNA) for guide RNA expression is shown schematically in Figure 18.

[0157] Guide RNA sequence (oligo DNA + PAM sequence) SEQ ID NO: 47: GCAATGGCATTTGAAGACAAGGG (23mer) SEQ ID NO: 48: CACTGGAAATGGGAAACTGGTGG (23mer) SEQ ID NO: 49: TATGCTGCATGTAATCTGAAAGG (23mer) SEQ ID NO: 50: ATCCCGGAATTATCAGCACGAGG (23mer)

[0158] [Example 31] Quantitative Analysis of PR1 Gene Expression Using the NPR-suppressed plants produced in Example 3, fresh leaves from the plants inoculated by agroinfiltration in Example 15 were frozen in liquid nitrogen and then ground. Total RNA was extracted using the AGPC extraction method (Chomczynski, P. et al., (1987), Anal. Biochem. 162:156-159). Total RNA was treated with DNase, and cDNA was synthesized by reverse transcription using random primers. Real-time PCR was performed using a LightCycler 96 system (Roche Diagnostics). Primers (SEQ ID NOs: 51 and 52) and SYBR Green I were used to detect the PR1 gene (Niben101Scf13926g01014). Quantification was performed using Nb EF1α as an internal standard. Primers (SEQ ID NOS: 53 and 54) and SYBR Green I were used to detect the EF1α gene. As a result, when the expression level of the PR1 gene in the wild type was set to 1, the expression level of this gene in the IR-NPR-transformed N. benthamiana No. 144 line was reduced to 0.33, and in the No. 168 line to 0.54 (not shown). These results suggest that suppression of NPR (SA receptor) expression inhibited SA signaling, resulting in the suppression of expression of genes involved in defense responses (PR genes) that are expressed after signal transduction via NPR.

[0159] Primers for detecting PR1 gene SEQ ID NO: 51: TCGTGCAGTTGTAGGCGTAG (20mer) (forward) SEQ ID NO: 52: TGTGCATAGGCTGCTACCTG (20mer) (reverse)

[0160] Primers for detecting EF1α gene SEQ ID NO: 53: TGGACACAGGGACTTCATCA (20mer) (forward) SEQ ID NO: 54: CGGGTCTGTCCATCCTTAGA (20mer) (reverse)

[0161] The present invention can be used as a method for increasing the production of useful substances using plants in which the plant's inherent resistance mechanism has been suppressed.

Claims

[Claim 1] A method for producing a host plant for the production of a target protein using plants, comprising suppressing the expression of NPR genes (nonexpressor of pathogenesis-related genes) involved in salicylic acid signaling in plants, or disrupting said NPR genes.