Method for treating ulcerative colitis or primary sclerosing cholangitis

Abstract

Provided are, inter alia, a system for treating ulcerative colitis or primary sclerosing cholangitis including a means for removing anti-integrin αvβ6 antibodies or anti-integrin αvβ6 antibody-producing B-cells that produce the anti-integrin αvβ6 antibodies, the anti-integrin αvβ6 antibodies having an activity of competing with fibronectin for binding to integrin αvβ6 and being specifically produced in patients having ulcerative colitis or primary sclerosing cholangitis.

Description

Method for treating ulcerative colitis or primary sclerosing cholangitis

[0001] The present invention relates to a method, a system, etc. for treating ulcerative colitis (hereinafter also referred to as "UC") or primary sclerosing cholangitis (hereinafter also referred to as "PSC").

[0002] Ulcerative colitis is an intractable disease of unknown cause in which erosions or inflammatory ulcers develop in the colonic mucosa, starting from the rectum, and are accompanied by symptoms such as diarrhea, bloody stools, and abdominal pain. Ulcerative colitis affects young people as well as the elderly, and since it undergoes repeated remissions and relapses, long-term treatment is required. The number of patients is very large, and has been increasing worldwide in recent years.

[0003] Primary sclerosing cholangitis (PSC) is a progressive chronic liver disease that causes multiple, diffuse fibrous strictures in the bile ducts both inside and outside the liver, with approximately half of patients progressing to cirrhosis within 10 years. In cases where primary sclerosing cholangitis progresses to cirrhosis, liver transplantation becomes necessary, but many patients die before a transplant can be performed. Primary sclerosing cholangitis is thought to be a multifactorial disease, including immunological abnormalities, but the cause remains unknown. Primary sclerosing cholangitis is often associated with inflammatory bowel disease (IBD), and among inflammatory bowel diseases, ulcerative colitis is also present in a certain percentage of patients with primary sclerosing cholangitis (in Japan, it is reported that approximately 40% of patients with primary sclerosing cholangitis also have ulcerative colitis, and that approximately 60% of young patients with primary sclerosing cholangitis in particular also have ulcerative colitis. In Europe and the United States, it is reported that approximately 70-80% of patients with primary sclerosing cholangitis also have ulcerative colitis).

[0004] In the medical treatment of ulcerative colitis, 5-aminosalicylic acid preparations are used in mild cases, immunosuppressants such as steroids in moderate cases, and cytapheresis, biological preparations such as anti-TNFα antibodies, and JAK inhibitors are used in moderate to severe cases depending on the severity of the symptoms (for example, for anti-TNFα antibodies, see Non-Patent Document 1, website: UpToDate, [searched November 28, 2022], Internet: https: / / www.uptodate.com / contents / search? However, ulcerative colitis cannot yet be completely cured by medical treatment, and various treatments are associated with various side effects. For example, using anti-TNFα antibodies, which are used to treat moderate to severe ulcerative colitis, to suppress the function of TNFα can lead to side effects such as infections and malignant tumors. Anti-TNFα antibodies are certainly effective in treating ulcerative colitis. However, because the target TNFα itself plays a central role in the immune system and supports a wide range of biological functions, including infection prevention and antitumor activity, impairing TNFα, which is required under normal conditions, can lead to the wide range of side effects described above.

[0005] Furthermore, while medical treatment for primary sclerosing cholangitis includes the administration of medications such as ursodeoxycholic acid, there is currently insufficient data to determine whether these treatments improve long-term prognosis, and new treatments are desperately needed.

[0006] Nature Reviews Immunology volume 15, pages362-374 (2015)

[0007] Therefore, an object of the present invention is to develop a novel method for treating ulcerative colitis or primary sclerosing cholangitis with reduced side effects compared to conventional methods.

[0008] As a result of intensive research to solve the above-mentioned problems, the inventors surprisingly discovered that anti-integrin αvβ6 autoantibodies, which are specifically produced in patients with ulcerative colitis and primary sclerosing cholangitis, are involved in the pathogenesis of these diseases, and that these diseases can be treated by targeting these autoantibodies, thereby completing the present invention.

[0009] The present invention provides the following aspects: (1) A system for treating ulcerative colitis or primary sclerosing cholangitis, comprising a means for removing an anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, which has activity that competes with fibronectin for binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis. (2) The system according to (1), wherein the means comprises a substance that specifically binds to the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody-producing B cells. (3) The system according to (2), wherein the substance is a fragment or the whole of the integrin αvβ6 protein. (4) The system according to (3), comprising a column carrying a fragment or the whole of the integrin αvβ6 protein. (5) A solid support for the treatment of ulcerative colitis or primary sclerosing cholangitis, which carries a fragment or the whole of an integrin αvβ6 protein that has activity competing with fibronectin for binding to integrin αvβ6 and is capable of specifically binding to an anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, the fragment or the whole of the integrin αvβ6 protein having activity competing with fibronectin for binding to integrin αvβ6 and that is specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis, thereby being capable of adsorbing the anti-integrin αvβ6 antibody or the anti-integrin αvβ6 antibody-producing B cells. (6) The solid support according to (5), wherein the fragment or the whole of the integrin αvβ6 protein has a binding dissociation constant (KD value) of 100 nM or less when used with the anti-integrin αvβ6 antibody that contains any one of the amino acid residue sequences RGD, RGRD, and / or RGSGD in CDR2 or CDR3 of the heavy chain. (7) The solid support according to (5) or (6), wherein the integrin αvβ6 protein is immobilized in an amount equal to or greater than twice the weight of the capturing antibody, or the αvβ6 protein fragment is immobilized in an amount equal to or greater than twice the weight of the capturing antibody multiplied by the ratio of the molecular weight of the fragment to the molecular weight of the entire integrin αvβ6. (8) A column comprising the solid support according to any one of (5) to (7).(9) The column according to (8), comprising the solid support, such that the amount of the integrin αvβ6 protein fragment or the whole protein per column is at least twice the weight of the capture antibody, or the weight of the αvβ6 protein fragment is at least twice the weight of the capture antibody multiplied by the ratio of the molecular weight of the fragment to the whole molecular weight of integrin αvβ6. (10) The column according to (8) or (9), which is used for apheresis. (11) A method for producing a primary sclerosing cholangitis animal model, comprising immunizing a non-human animal with an integrin αvβ6 protein fragment or the whole protein. (12) A method for producing a primary sclerosing cholangitis animal model, comprising knocking out the integrin β6 gene in a non-human animal. (13) A method for producing an ulcerative colitis or primary sclerosing cholangitis animal model, comprising administering an anti-integrin αvβ6 antibody derived from an ulcerative colitis or primary sclerosing cholangitis patient to a non-human animal. (14) The method for producing the antibody according to (13), wherein the antibody is a serum or a monoclonal antibody. (15) An ulcerative colitis model animal having symptoms of ulcerative colitis. (16) A primary sclerosing cholangitis model animal having symptoms of primary sclerosing cholangitis. (17) The primary sclerosing cholangitis model animal according to (16), which is a knockout mouse in which the function of integrin αvβ6 has been lost. (18) A method for screening for a therapeutic or preventive agent for ulcerative colitis or primary sclerosing cholangitis, comprising administering a candidate substance to the model animal of any of (15) to (17). (19) A method for treating ulcerative colitis or primary sclerosing cholangitis, comprising removing an anti-integrin αvβ6 antibody or an anti-integrin αvβ6 antibody-producing B cell that produces the anti-integrin αvβ6 antibody, which has activity that competes with fibronectin for binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.(20) A method for removing an anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody from a subject, the method comprising contacting a sample derived from the subject with a substance that specifically binds to the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, the anti-integrin αvβ6 antibody having activity that competes with fibronectin for binding to integrin αvβ6 and that is specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis.

[0010] The present invention surprisingly found that the presence of anti-integrin αvβ6 autoantibodies is involved in the pathogenesis of ulcerative colitis and primary sclerosing cholangitis. Therefore, according to the present invention, ulcerative colitis patients or primary sclerosing cholangitis patients can be treated by removing anti-integrin αvβ6 autoantibodies and B cells producing said antibodies in ulcerative colitis patients or primary sclerosing cholangitis patients. The present invention also provides a treatment system for ulcerative colitis patients or primary sclerosing cholangitis patients that can be used for the treatment.

[0011] The present invention is based on a concept that is completely different from conventional standard methods, and therefore provides a new therapeutic means for patients for whom conventional treatment methods are ineffective. Existing therapeutic agents for ulcerative colitis (e.g., anti-TNFα antibodies) target molecules that are also present in healthy individuals and therefore have significant side effects. However, the anti-integrin αvβ6 autoantibodies targeted by the present invention are not present or are barely present in healthy individuals, and therefore their elimination does not affect health, and is therefore thought to result in fewer side effects.

[0012] 1 shows the results of a fibronectin-integrin αvβ6 binding inhibition assay of autoantibodies derived from patients with primary sclerosing cholangitis. The vertical axis shows the binding inhibition rate (%). 1 shows the dose-dependent inhibition of fibronectin-integrin αvβ6 binding by autoantibodies derived from patients with primary sclerosing cholangitis. The vertical axis shows the binding inhibition rate (%). The horizontal axis shows the dilution rate of IgG derived from patients or controls used in the assay. 1 shows the correlation between the titer of autoantibodies derived from patients with primary sclerosing cholangitis and fibronectin-integrin αvβ6 binding inhibitory activity. 1 shows the results of a binding inhibition assay of autoantibodies derived from patients with primary sclerosing cholangitis with integrin αvβ6 by the addition of RGDS peptide. The vertical axis shows the titer of autoantibodies detected on the solid phase (A ４５０ The horizontal axis shows the amount of peptide added (μg / mL). The vertical axis shows the titer (A) of the autoantibody detected on the solid phase. ４５０) are shown. The horizontal axis shows the amount of peptide added (μg / mL). The figure shows the inhibitory effect of monoclonal anti-integrin αvβ6 antibodies derived from patients with ulcerative colitis or primary sclerosing cholangitis on integrin αvβ6-fibronectin binding. In the figure, "UC antibody 1," "UC antibody 2," "UC antibody 3," "UC antibody 4," "UC antibody 5," "UC antibody 6," "UC antibody 7," and "UC antibody 8" represent eight monoclonal anti-integrin αvβ6 antibodies established from the blood of UC patients. "PSC antibody 1" represents a monoclonal anti-integrin αvβ6 antibody established from the blood of a PSC patient. These are micrographs of bile ducts in integrin αvβ6-immunized mice and control-immunized mice. These are micrographs of bile ducts in integrin αvβ6-immunized mice administered various depleting antibodies. These are micrographs of bile ducts in mice lacking integrin αvβ6 function. 1 shows the concentration-dependent adsorption rate of a column carrying integrin αvβ6. 2 shows the adsorption rate of antibodies in the serum of ulcerative colitis patients on a column carrying integrin αvβ6. 3 shows the adsorption rate of antibodies in the serum of primary sclerosing cholangitis patients on a column carrying integrin αvβ6. 4 shows the results of a ligand protein specificity confirmation test of monoclonal anti-integrin αvβ6 autoantibodies derived from ulcerative colitis patients. 5 shows the adsorption rates of monoclonal autoantibodies derived from ulcerative colitis patients and autoantibodies derived from the serum of ulcerative colitis patients on a carrier carrying integrin αvβ6 immobilized by the NHS covalent bonding method. 6 shows the adsorption rate of monoclonal autoantibodies derived from ulcerative colitis patients on a carrier carrying integrin αvβ6 immobilized by the avidin-biotin bonding method. 1 shows a comparison of the adsorption amount of monoclonal anti-integrin αvββ autoantibodies derived from ulcerative colitis patients between integrin αvβ6 immobilized by avidin-biotin binding and integrin αvβ6 immobilized by covalent binding. 1 shows an overview of an example of a circulation column system. 1 shows the adsorption rate of anti-integrin αvβ6 antibodies in a circulation column packed with an integrin αvβ6-immobilized adsorbent. 1 shows the adsorption rate of anti-integrin αvβ6 antibodies in a circulation column packed with a BSA-immobilized adsorbent. 1 shows micrographs of the large intestine of mice administered with UC patient serum and PSC patient serum. 1 shows micrographs of the bile duct of mice administered with UC patient serum and PSC patient serum.1 shows micrographs of the large intestine of a DSS-administered mouse administered with UC patient serum and PSC patient serum. 2 shows micrographs of the bile duct of a DSS-administered mouse administered with UC patient serum and PSC patient serum. 3 shows micrographs of the large intestine of a mouse administered with an anti-integrin αvβ6 monoclonal antibody derived from a UC patient. 4 shows micrographs of the large intestine of a DSS-administered mouse administered with an anti-integrin αvβ6 monoclonal antibody derived from a UC patient.

[0013] In previous studies, the inventors demonstrated that anti-integrin αvβ6 antibodies are specifically produced in patients with ulcerative colitis or primary sclerosing cholangitis (International Publication No. WO 2020 / 141608). Integrin αvβ6 is known to bind to ligands such as fibronectin by recognizing the RGD tripeptide motif. Furthermore, in in vitro experiments using ELISA, the inventors' previous studies demonstrated that the addition of autoantibodies derived from ulcerative colitis patients inhibited the binding of integrin αvβ6 to fibronectin in a concentration-dependent manner, that the inhibitory activity correlated with the anti-integrin αvβ6 antibody titer derived from the patients, and that the binding of the patient-derived autoantibodies to integrin αvβ6 was inhibited by RGD peptide in a concentration-dependent manner (Gastroenterology Vol. 160, No. 7, June 2021, Pages 2383-2394).

[0014] Therefore, the inventors hypothesized that ulcerative colitis or primary sclerosing cholangitis is caused by inhibition of the binding of integrin αvβ6 expressed in the colonic or bile duct epithelial cell layer to fibronectin in the connective tissue layer via the RGD tripeptide motif by anti-integrin αvβ6 autoantibodies, and investigated the etiology of these diseases. In the present invention, it was revealed that anti-integrin αvβ6 autoantibodies derived from ulcerative colitis and primary sclerosing cholangitis patients contain the RGD tripeptide motif or a sequence similar thereto in the complementarity-determining region (CDR) that forms the antigen-binding site, i.e., the epitope of the antibody is located in the RGD-binding site of integrin αvβ6 (Example 2). Furthermore, we demonstrated that autoantibodies derived from patients with primary sclerosing cholangitis inhibit the binding of integrin αvβ6 to fibronectin in a concentration-dependent manner, that this inhibitory activity correlated with the patient's anti-integrin αvβ6 antibody titer, and that the binding of the patient's autoantibodies to integrin αvβ6 was inhibited by RGD peptide in a concentration-dependent manner (Example 1). Furthermore, we demonstrated that immunizing mice with integrin αvβ6 to induce the production of anti-integrin αvβ6 antibodies led to the development of primary sclerosing cholangitis, and that removal of the antibodies alleviated the pathology (Example 3). Furthermore, we generated integrin αvβ6 gene knockout mice and confirmed that they exhibited findings consistent with primary sclerosing cholangitis (Example 4). Thus, the present invention has demonstrated that anti-integrin αvβ6 antibodies are involved in the pathogenesis of ulcerative colitis and primary sclerosing cholangitis. Based on this finding, the present invention provides a technology characterized by removing anti-integrin αvβ6 antibodies that have the activity of competing with fibronectin for binding to integrin αvβ6 and are specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis, or anti-integrin αvβ6 antibody-producing B cells that produce such anti-integrin αvβ6 antibodies.

[0015] 1. Subject The subject to which the present invention is applied is an animal suffering from ulcerative colitis or primary sclerosing cholangitis and in need of treatment. Preferably, the subject is an animal that is positive for anti-integrin αvβ6 antibodies in its blood (an animal that produces anti-integrin αvβ6 antibodies in its body). More preferably, the subject is an animal that is positive for anti-integrin αvβ6 antibodies in its blood and does not improve with other therapies (e.g., conventional therapies). The type of animal is not particularly limited and may be a human or other non-human mammal, but is preferably a human.

[0016] <2. Anti-integrin αvβ6 antibody> Integrins are naturally occurring proteins consisting of heterodimeric molecules composed of two subunit chains, an α chain and a β chain. Known α chains include α1 to α11, αv, αX, αM, αL, αD, αE, and αIIb, and β chains include β1 to β8, with multiple isoforms consisting of different combinations of these. Integrins are present on the surface of epithelial cells and play an important role in cell adhesion by binding to extracellular matrix proteins such as laminin and fibronectin on the surface of connective tissue.

[0017] Integrin αvβ6 is a heterodimeric molecule containing αv as the α chain and β6 as the β chain. Integrin αvβ6 is rarely expressed in normal tissues, but is expressed on the surface of epithelial cells upon inflammatory stimulation.

[0018] As used herein, the term "anti-integrin αvβ6 antibody" refers to an antibody that specifically binds to integrin αvβ6 or a fragment thereof.

[0019] Therefore, the anti-integrin αvβ6 antibody to be removed in the present invention is an anti-integrin αvβ6 antibody that is specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis. The anti-integrin αvβ6 antibody is an autoantibody. Anti-integrin αvβ6 autoantibodies are absent or almost absent in healthy individuals.

[0020] Furthermore, the anti-integrin αvβ6 antibody has the activity of competing with fibronectin for binding to integrin αvβ6. That is, the anti-integrin αvβ6 antibody is an antibody that specifically binds to integrin αvβ6 and inhibits the binding of integrin αvβ6 to fibronectin. As used herein, "inhibition" also encompasses suppression, reduction, and loss.

[0021] The anti-integrin αvβ6 antibody preferably inhibits or suppresses the binding between integrin αvβ6 and fibronectin via the RGD tripeptide motif of fibronectin, and more preferably binds to an epitope containing the RGD-binding domain on integrin αvβ6.

[0022] Even more preferably, the anti-integrin αvβ6 antibody comprises an RGD peptide sequence or a sequence analogous thereto. Examples of sequences analogous to RGD peptides include, but are not limited to, RGRD (SEQ ID NO: 7), RGSGD (SEQ ID NO: 8), RED, KGD, and SGD. The RGD peptide sequence or a sequence analogous thereto is preferably contained in the complementarity-determining region (CDR) of the heavy chain and / or light chain of the anti-integrin αvβ6 antibody, more preferably in CDR2 or CDR3 of the heavy chain, particularly preferably in CDR2 or CDR3 of the heavy chain, and even more preferably in CDR3 of the heavy chain. For example, the anti-integrin αvβ6 antibody comprises a heavy chain CDR3 comprising the sequence set forth in AKVIPRIRGSGDKAGIKDYYYYGMDV (SEQ ID NO: 3), ATDRPLKLRGRDYNYYVMDV (SEQ ID NO: 4), AKDRGRRGDSGWYRHFDY (SEQ ID NO: 5), or ARDRGFRGDTAMIKGGMDV (SEQ ID NO: 6).

[0023] The binding dissociation constant (KD value) of the anti-integrin αvβ6 antibody to integrin αvβ6 or a fragment thereof is preferably 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. Preferably, an anti-integrin αvβ6 antibody comprising an RGD peptide sequence or a sequence analogous thereto, more preferably an RGD peptide sequence or a sequence analogous thereto in heavy or light chain CDR2 or CDR3, particularly preferably in heavy chain CDR2 or CDR3, and even more preferably in heavy chain CDR3, binds to integrin αvβ6 or a fragment thereof with a KD value of, for example, 100 nM or less, preferably 50 nM or less, more preferably 25 nM or less. Furthermore, the anti-integrin αvβ6 antibody preferably exhibits the property of capturing integrin αvβ6 at an adsorption rate of 50% or greater for a weight of integrin αvβ6 at least twice the weight of the capturing antibody, or for a weight of an integrin αvβ6 protein fragment at least twice the weight of the capturing antibody multiplied by the ratio of the integrin αvβ6 protein fragment to the molecular weight of the entire integrin αvβ6. As used herein, "adsorption rate" refers to the ratio of the amount of antigen-bound antibody to the amount of antibody added in an antigen-antibody reaction system. For example, the amount of free antibody (the amount of antibody not bound to the antigen) after adding the antibody to a reaction system containing the antigen can be measured to determine the ratio of the amount of antibody bound to the amount of antibody added to the reaction system. It has been found that the concentration of integrin αvβ6 antibody in the serum of UC and PSC patients is approximately 5-10 μg / mL. When used in clinical settings with patients with high antibody titers, this can be addressed by using a larger amount of adsorbent.

[0024] 3. Anti-integrin αvβ6 antibody-producing B cells As used herein, "anti-integrin αvβ6 antibody-producing B cells" refers to B cells that produce the anti-integrin αvβ6 antibody. Antibody-producing B cells express a B cell antigen receptor (membrane immunoglobulin) having a structure similar to that of the antibody on the cell surface. Therefore, anti-integrin αvβ6 antibody-producing B cells express the membrane-type anti-integrin αvβ6 antibody. Therefore, any substance that specifically binds to an anti-integrin αvβ6 antibody will specifically bind to anti-integrin αvβ6 antibody-producing B cells.

[0025] 4. Method for treating ulcerative colitis or primary sclerosing cholangitis The treatment method of the present invention comprises removing an anti-integrin αvβ6 antibody that has activity competing with fibronectin for binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis, or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody.

[0026] As used herein, "removal" of anti-integrin αvβ6 antibodies or anti-integrin αvβ6 antibody-producing B cells means that, if the antibodies or B cells are present in the subject's body, for example, in the blood, some or all of the antibodies or B cells present in the blood are removed from the blood.

[0027] Removal of anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells may be carried out by any method. For example, a substance that specifically binds to anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells (hereinafter collectively referred to as "substances that specifically bind to anti-integrin αvβ6 antibodies") may be used to remove anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells. The substance that specifically binds to anti-integrin αvβ6 antibody specifically binds to the antigen receptor of anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells, and inhibits binding between the antigen receptor of the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells and endogenous integrin αvβ6.

[0028] Examples of substances that specifically bind to the anti-integrin αvβ6 antibody include, but are not limited to, antigens of the antibody or B cells, i.e., integrin αvβ6 or fragments thereof, antigen-like proteins or fragments thereof, peptides that specifically bind to anti-integrin αvβ6 antibodies, and compounds that specifically bind to anti-integrin αvβ6 antibodies.

[0029] To remove anti-integrin αvβ6 antibodies or anti-integrin αvβ6 antibody-producing B cells, for example, a solid support on which a substance that specifically binds to the anti-integrin αvβ6 antibody is immobilized can be used. Examples of solid supports include, but are not limited to, carbohydrate materials such as agarose, dextran, cellulose, and activated carbon; synthetic polymers such as polymethacrylate, polystyrene, polyacrylamide, polyamide, polysulfone, polyethylene, polyvinyl alcohol, polypropylene, polyacrylonitrile, polyethylene phthalate, polyester, styrene-divinylbenzene copolymer, and ethylene-vinyl alcohol copolymer; inorganic materials such as silica gel, glass, and metal; and composite materials containing metals, such as beads, fibers, membranes, hollow fiber membranes, gels, and films, as well as composites of these. Commercially available solid supports may also be used. The substance can be immobilized on the solid support by methods known in the art, such as physical adsorption, covalent bonding, ionic bonding, chelating bonding, and avidin-biotin bonding. For example, covalent bonding methods include methods using active groups such as cyanate ester, NHS (N-hydroxysuccinimide) ester, aldehyde, formyl, azlactone, CDI (carbonyldiimidazole), sulfhydryl, carbonyl, carboxyl, active hydrogen, epoxy, EAH (epoxy-activated hexahydrophthalic anhydride), ECH (epoxy-activated cyclohexane), thiopropyl, and activated thiol. For example, in the avidin-biotin binding method, in addition to avidin, avidin-like substances or modified avidins such as streptavidin, deglycosylated avidin (NeutrAvidin (registered trademark)), reversible avidin (Switchavidin), monomeric avidin (SAvPhire (registered trademark) monomeric streptavidin), mushroom-derived avidin-like protein (Tamavidin (registered trademark) 2-REV), genetically modified streptavidin, or genetically modified avidin can also be used. Furthermore, the solid support on which the substance that specifically binds to the anti-integrin αvβ6 antibody is immobilized may be packed in a bag such as a column or a blood bag.

[0030] Removal of anti-integrin αvβ6 antibodies or anti-integrin αvβ6 antibody-producing B cells can be achieved by contacting a sample derived from a subject, such as the subject's blood (e.g., whole blood, serum, or plasma, preferably plasma), with a substance that specifically binds to the anti-integrin αvβ6 antibody. Preferably, removal can be achieved by contacting the sample derived from a subject with a solid support on which a substance that specifically binds to the anti-integrin αvβ6 antibody has been immobilized. For example, removal can be achieved by adsorbing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells from the subject's blood onto a column packed with a solid support on which a substance that specifically binds to the anti-integrin αvβ6 antibody has been immobilized. The blood from which anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells has been removed is preferably returned to the subject.

[0031] Therefore, an example of the treatment method of the present invention is apheresis therapy for the treatment of ulcerative colitis or primary sclerosing cholangitis, which comprises drawing blood from a subject, treating the blood with the column, and then returning the blood to the subject.

[0032] In addition, another aspect of the present invention provides a method for removing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells from a sample derived from a subject, the method comprising contacting the sample with a substance that specifically binds to the anti-integrin αvβ6 antibody.

[0033] 5. Fragment or Whole of Integrin αvβ6 The origin of the fragment or whole of integrin αvβ6 used in the present invention is not particularly limited, but is preferably the same species as the subject. Nucleotide sequence information of the genes encoding the integrin αv chain and β6 chain of mammalian species such as humans, and amino acid sequence information of each chain, can be obtained from publicly known databases (e.g., GenBank). In particular, the amino acid sequence of the preproprotein of human integrin αv chain isoform 1 is registered under GenBank Accession Number NP_002201.2 and is shown in SEQ ID NO: 1. The amino acid sequence of the precursor of the human integrin β6 chain is registered under GenBank Accession Number NP_000879.2 and is shown in SEQ ID NO: 2. Amino acid sequence information of the integrin αv chain and β6 chain of various mammals other than humans can also be obtained from publicly known databases (e.g., GenBank). Integrin αvβ6 may be composed of an αv chain and a β6 chain containing an amino acid sequence formed by further post-translational modification of one or both of the amino acid sequences of the αv chain and the β6 chain registered in the database. For example, the partial sequence from positions 1 to 30 in the amino acid sequence of SEQ ID NO: 1 is a signal peptide sequence, and the amino acid sequence of the mature polypeptide of the human integrin αv chain comprises the sequence from positions 31 to 1048 in the amino acid sequence of SEQ ID NO: 1. Similarly, the partial sequence from positions 1 to 21 in the amino acid sequence of SEQ ID NO: 2 is a signal peptide sequence, and the amino acid sequence of the mature polypeptide of the human integrin β6 chain comprises the sequence from positions 22 to 788 in the amino acid sequence of SEQ ID NO: 2. In the amino acid sequence of the human integrin αv chain shown in SEQ ID NO: 1, positions 31 to 992 correspond to the extracellular domain, positions 993 to 1016 correspond to the transmembrane domain, and positions 1017 to 1048 correspond to the intracellular domain, respectively. In addition, in the amino acid sequence of the human integrin β6 chain shown in SEQ ID NO: 2, positions 22 to 707 correspond to the extracellular domain, positions 708 to 730 correspond to the transmembrane domain, and positions 731 to 788 correspond to the intracellular domain.

[0034] In this specification, unless otherwise specified, both fragments and the whole of integrin αvβ6 are collectively referred to as "integrin αvβ6." Furthermore, in this specification, unless otherwise specified, integrin αvβ6 is not limited to a native form containing a mature or immature amino acid sequence, and may be a mutant form equivalent to the native integrin αvβ6.

[0035] Furthermore, integrin αvβ6 is not limited to a form in which both the natural or mutant α chain and β chain containing mature or immature amino acid sequences are in their full length (i.e., the entire integrin αvβ6), but may also be in the form of a fragment of integrin αvβ6.

[0036] The fragment or whole integrin αvβ6 may have another peptide attached to each chain of the fragment or whole integrin αvβ6 (e.g., attached to the C-terminus), or may have another peptide attached to each chain of the fragment, whole integrin αvβ6 (e.g., attached to the C-terminus) and biotin attached thereto. Examples of other peptides include, but are not limited to, coiled-coil sequences (e.g., acidic tail sequences or basic tail sequences), tag (or label) sequences, etc. These other peptides are used, for example, in the production of the fragment or whole integrin αvβ6, for the purpose of facilitating dimerization, purification, or immobilization to a support. The other peptide may be attached via a linker sequence. The linker sequence can be appropriately selected by those skilled in the art, and may be, for example, a peptide linker consisting of about 1 to 10 amino acids, such as GGGGSGGGGS, or about 2 to 5 amino acids, such as GGGGS, containing glycine or serine.

[0037] Fragments of integrin αvβ6 include fragments in which at least one of the αv chain and β6 chain constituting the integrin dimer is shorter than the mature or immature native form or a mutant thereof. Examples include integrin αvβ6 fragments containing the extracellular region of the αv chain or β6 chain. Specifically, examples of integrin αvβ6 fragments include dimers containing an αv chain comprising a partial sequence from Phe at position 31 to Val at position 992 of the amino acid sequence of the αv chain shown in SEQ ID NO: 1, and / or a β6 chain comprising a partial sequence from Gly at position 22 to Asn at position 707 of the amino acid sequence of the β6 chain shown in SEQ ID NO: 2. The αv chain or β6 chain fragment may contain a signal sequence. Therefore, another example of an integrin αvβ6 fragment is a dimer comprising an αv chain that includes a partial sequence from Met at position 1 to Val at position 992 of the amino acid sequence of the αv chain shown in SEQ ID NO: 1, and / or a β6 chain that includes a partial sequence from Met at position 1 to Asn at position 707 of the amino acid sequence of the β6 chain shown in SEQ ID NO: 2. The integrin αvβ6 fragment preferably forms a dimer, and more preferably has binding activity to extracellular matrix proteins such as laminin and fibronectin. Whether an integrin αvβ6 fragment has binding activity to extracellular matrix proteins can be confirmed, for example, by ELISA or the like.

[0038] The formation of a dimer by the entire integrin αvβ6 or a fragment thereof can be confirmed, for example, by the detection of a band corresponding to the molecular weight of the dimer when the entire integrin αvβ6 or a fragment thereof is subjected to SDS-PAGE in the absence of 2-mercaptoethanol, and the disappearance of the band corresponding to the molecular weight of the dimer when the entire integrin αvβ6 or a fragment thereof is subjected to SDS-PAGE in the presence of 2-mercaptoethanol.

[0039] An example of a commercially available integrin αvβ6 is recombinant human integrin αvβ6 (R&D Systems, Minnesota, USA, product number 3817-AV). This recombinant human integrin αvβ6 is a dimer of an αv chain consisting of a partial sequence from Phe at position 31 to Val at position 992 of the amino acid sequence of the αv chain shown in SEQ ID NO: 1, together with a linker sequence and an acidic tail sequence added to the C-terminus, and a β6 chain consisting of a partial sequence from Gly at position 22 to Asn at position 707 of the amino acid sequence of the β6 chain shown in SEQ ID NO: 2, together with a linker sequence and a basic tail sequence added to the C-terminus.

[0040] More specific embodiments of the αv chain constituting the entire or fragment of integrin αvβ6 include polypeptides selected from the group consisting of: (I) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 1 or a partial sequence of the amino acid sequence set forth in SEQ ID NO: 1 from Phe at position 31 to Thr at position 1048; (II) a polypeptide comprising a partial sequence of the amino acid sequence set forth in SEQ ID NO: 1 and functionally equivalent to the polypeptide of (I); (III) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or a partial sequence thereof and functionally equivalent to the polypeptide of (I); and (IV) a polypeptide comprising an amino acid sequence in which one or more amino acids have been substituted, deleted, and / or added in the amino acid sequence set forth in SEQ ID NO: 1 or a partial sequence thereof and functionally equivalent to the polypeptide of (I).

[0041] The polypeptides (I) to (IV) may be polypeptides comprising an amino acid sequence in which another amino acid sequence is further added to at least one of the N-terminus and C-terminus, preferably the C-terminus, of the amino acid sequence or partial sequence defined in (I) to (IV).

[0042] In the above (II), (III), and (IV), examples of polypeptides functionally equivalent to the polypeptide of (I) include polypeptides that can form dimers with an integrin β6 chain (particularly preferably, a polypeptide chain consisting of the amino acid sequence shown in SEQ ID NO: 2, a polypeptide chain consisting of a partial sequence from Gly at position 22 to Cys at position 788 of the amino acid sequence shown in SEQ ID NO: 2, or a polypeptide chain consisting of a partial sequence from Gly at position 22 to Asn at position 707 of the amino acid sequence shown in SEQ ID NO: 2), and that the formed dimer has the ability to bind to extracellular matrix proteins, such as laminin and fibronectin, to which native integrin αvβ6 or commercially available integrin αvβ6 can bind.

[0043] The partial sequence in (II) includes a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1. The partial sequences in (III) and (IV) include a partial sequence from Phe at position 31 to Thr at position 1048 in the amino acid sequence shown in SEQ ID NO: 1, or a partial sequence from Phe at position 31 to Val at position 992 in the amino acid sequence shown in SEQ ID NO: 1.

[0044] The sequence identity in (III) above is preferably 90% or more, more preferably 95% or more, even more preferably 96% or more, particularly preferably 97% or more, and most preferably 98% or more, or 99% or more.

[0045] In (IV) above, "one or more" means, for example, 1 to 100, preferably 1 to 50, preferably 1 to 30, preferably 1 to 20, preferably 1 to 15, preferably 1 to 10, preferably 1 to 5, preferably 1 to 4, preferably 1 to 3, preferably 1 to 2, or preferably 1.

[0046] More specific embodiments of the β6 chain constituting the entire or fragment of integrin αvβ6 include polypeptides selected from the group consisting of: (V) a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 or a partial sequence from Gly at position 22 to Cys at position 788 of the amino acid sequence set forth in SEQ ID NO: 2; (VI) a polypeptide comprising a partial sequence of the amino acid sequence set forth in SEQ ID NO: 2 and functionally equivalent to the polypeptide of (V); (VII) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 2 or a partial sequence thereof and functionally equivalent to the polypeptide of (V); and (VIII) a polypeptide comprising an amino acid sequence in which one or more amino acids have been substituted, deleted, and / or added in the amino acid sequence set forth in SEQ ID NO: 2 or a partial sequence thereof and functionally equivalent to the polypeptide of (V).

[0047] The polypeptides (V) to (VIII) may be polypeptides comprising an amino acid sequence in which another amino acid sequence is further added to at least one of the N-terminus and C-terminus, preferably the C-terminus, of the amino acid sequence or partial sequence defined in (V) to (VIII).

[0048] In the above (VI), (VII), and (VIII), examples of polypeptides functionally equivalent to the polypeptide of (V) include polypeptides that can form dimers with an integrin αv chain (particularly preferably, a polypeptide chain consisting of the amino acid sequence shown in SEQ ID NO: 1, a polypeptide chain consisting of a partial sequence from Phe at position 31 to Thr at position 1048 of the amino acid sequence shown in SEQ ID NO: 1, or a polypeptide chain consisting of a partial sequence from Phe at position 31 to Val at position 992 of the amino acid sequence shown in SEQ ID NO: 1), and that the formed dimer has the ability to bind to extracellular matrix proteins, such as laminin and fibronectin, to which native integrin αvβ6 or commercially available integrin αvβ6 can bind.

[0049] The partial sequence in (VI) may be a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2. The partial sequences in (VII) and (VIII) may be a partial sequence from Gly at position 22 to Cys at position 788 in the amino acid sequence shown in SEQ ID NO: 2, or a partial sequence from Gly at position 22 to Asn at position 707 in the amino acid sequence shown in SEQ ID NO: 2.

[0050] The sequence identity in (VII) above is preferably 90% or more, more preferably 95% or more, even more preferably 96% or more, particularly preferably 97% or more, and most preferably 98% or more, or 99% or more.

[0051] In (VIII) above, "one or more" means, for example, 1 to 100, preferably 1 to 50, preferably 1 to 30, preferably 1 to 20, preferably 1 to 15, preferably 1 to 10, preferably 1 to 5, preferably 1 to 4, preferably 1 to 3, preferably 1 to 2, or preferably 1.

[0052] In the above (III) and (VII), the sequence identity of the amino acid sequences can be determined using methods well known to those skilled in the art, sequence analysis software, etc. Examples of sequence analysis software include the blastp program of the BLAST algorithm and the fasta program of the FASTA algorithm.

[0053] 6. System for treating ulcerative colitis or primary sclerosing cholangitis The system of the present invention is a system for treating ulcerative colitis or primary sclerosing cholangitis, comprising a means for removing an anti-integrin αvβ6 antibody or an anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, which has activity competing with fibronectin for binding to integrin αvβ6 and is specifically produced in a subject suffering from ulcerative colitis or primary sclerosing cholangitis.

[0054] As used herein, a "system" includes a single device, a combination of devices, a treatment room, and the like.

[0055] The "means" for removing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells may be any means capable of removing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells, and is not particularly limited thereto. For example, but not limited thereto, the means may include a substance for removing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells.

[0056] Examples of the substance that removes anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells include the above-mentioned substances that specifically bind to anti-integrin αvβ6 antibody. For example, the means may be a device for adsorbing anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells.

[0057] The substance that specifically binds to the anti-integrin αvβ6 antibody may be immobilized on a solid support. The solid support to which the substance that specifically binds to the anti-integrin αvβ6 antibody is immobilized may further be packed into a column. The amount of solid support packed into the column, the amount of the substance that specifically binds to the anti-integrin αvβ6 antibody to be immobilized, and the size of the column are not particularly limited and can be appropriately selected by those skilled in the art. Examples of the substance that specifically binds to the anti-integrin αvβ6 antibody include, but are not limited to, a fragment or the whole of integrin αvβ6.

[0058] Therefore, as an example, the system of the present invention may include a column for treating ulcerative colitis or primary sclerosing cholangitis, which is supported with a substance that specifically binds to an anti-integrin αvβ6 antibody, thereby being capable of adsorbing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells. The column may also include a solid support to which a substance that specifically binds to the anti-integrin αvβ6 antibody is immobilized. The column may be regenerated after use by detaching the adsorbed anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells. The column may preferably be a column for apheresis. For example, the system of the present invention may be a system for apheresis.

[0059] An example of the therapeutic column is a column containing a carrier onto which integrin αvβ6 or a fragment thereof is immobilized. The carrier or column specifically adsorbs an anti-integrin αvβ6 antibody or B cells producing the antibody, preferably containing an RGD peptide sequence or an RGD peptide analogue sequence in its heavy or light chain CDR, more preferably in its heavy chain CDR2 or CDR3, and even more preferably in its heavy chain CDR3. Furthermore, the carrier or column preferably adsorbs an anti-integrin αvβ6 antibody or B cells producing the antibody with a binding dissociation constant (KD value) for integrin αvβ6 or a fragment thereof of 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. In other words, the carrier or column preferably adsorbs an anti-integrin αvβ6 antibody or B cells producing the antibody with a KD value of 100 nM or less, more preferably 50 nM or less, and particularly preferably 25 nM or less. Furthermore, the carrier or column may preferably have integrin αvβ6 immobilized in an amount equal to or greater than twice the weight of the capture antibody, or an integrin αvβ6 fragment immobilized in an amount equal to or greater than twice the weight of the capture antibody multiplied by the ratio of the integrin αvβ6 protein fragment to the molecular weight of the entire integrin αvβ6. More preferably, the carrier or column adsorbs anti-integrin αvβ6 antibodies or B cells producing said antibodies at an adsorption rate of 50% or greater to the integrin αvβ6 immobilized in an amount equal to or greater than twice the weight of the capture antibody, or to the integrin αvβ6 fragment immobilized in an amount equal to or greater than twice the weight of the capture antibody multiplied by the ratio of the integrin αvβ6 protein fragment to the molecular weight of the entire integrin αvβ6. Furthermore, the column preferably contains a carrier on which the entire integrin αvβ6 or a fragment thereof is immobilized, in an amount such that the integrin αvβ6 protein is at least twice the weight of the capturing antibody, or the αvβ6 protein fragment is at least twice the weight of the capturing antibody multiplied by the ratio of the fragment to the molecular weight of the entire integrin αvβ6.In this specification, the term "adsorption rate" refers to the ratio of the amount of antigen-bound antibody to the amount of antibody added in an antigen-antibody reaction system. For example, an antibody is added to a reaction system containing the carrier or column, and after the reaction is allowed to proceed, the amount of free antibody (the amount of antibody not captured by the carrier or column) is measured, and the ratio of the amount of captured antibody to the amount of antibody added to the reaction system can be determined.

[0060] Another example of the system of the present invention is a device for treating ulcerative colitis or primary sclerosing cholangitis, which may include one or more devices including the column. For example, the system may include, in addition to the column, one or more devices selected from the group consisting of a device for withdrawing blood from a subject, a device for returning blood to a subject, a pump for circulating blood, a plasma separator (e.g., a membrane plasma separator), a filter for removing foreign matter, fine particles, air bubbles, etc. from blood, a circuit for circulating blood (a blood supply line, a blood return line, etc.), a fluid replacement line, etc.

[0061] Yet another example of the system of the present invention is a treatment room for treating ulcerative colitis or primary sclerosing cholangitis, comprising a means for removing the anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells. As used herein, a "treatment room" refers to a compartment for accommodating a subject and treating them for the treatment of ulcerative colitis or primary sclerosing cholangitis, and is preferably an independent room. The treatment room preferably contains a substance that specifically binds to the anti-integrin αvβ6 antibody. More preferably, the treatment room contains the column or device. The treatment room may further include a treatment table, etc.

[0062] The devices and components included in the system of the present invention may be controlled by a computer.

[0063] The anti-integrin αvβ6 antibody and anti-integrin αvβ6 antibody-producing B cells, the substance that specifically binds to the anti-integrin αvβ6 antibody, and the solid carrier are as described in Section "4. Method for treating ulcerative colitis or primary sclerosing cholangitis."

[0064] 7. Kit for Treating Ulcerative Colitis or Primary Sclerosing CholangitisThe present invention further provides a kit for treating ulcerative colitis or primary sclerosing cholangitis, comprising a substance that specifically binds to the anti-integrin αvβ6 antibody, a solid support having immobilized thereon a substance that specifically binds to the anti-integrin αvβ6 antibody, or a column carrying a substance that specifically binds to the anti-integrin αvβ6 antibody. The substance that specifically binds to the anti-integrin αvβ6 antibody, the solid support, and the column are as described in Section 4, "Method for Treating Ulcerative Colitis or Primary Sclerosing Cholangitis."

[0065] 8. Animal Models of Ulcerative Colitis or Primary Sclerosing Cholangitis The present invention further provides animal models of ulcerative colitis or primary sclerosing cholangitis and methods for producing them. The animals may be any non-human animals, preferably non-human mammals. Examples of such animals include, but are not limited to, mice, rats, guinea pigs, rabbits, monkeys, goats, dogs, hamsters, ferrets, and pigs.

[0066] In one aspect, there is provided a method for producing a primary sclerosing cholangitis model animal, which comprises immunizing an animal with integrin αvβ6. It is believed that the immunized animal produces anti-integrin αvβ6 autoantibodies and develops the symptoms.

[0067] In the method for producing a primary sclerosing cholangitis animal model, integrin αvβ6 may be administered to the animal, preferably together with an adjuvant. Furthermore, in the method for producing a primary sclerosing cholangitis animal model, the number of immunizations is not particularly limited, but integrin αvβ6 may be administered preferably two or more times, for example, two to five times at appropriate intervals, for example, three times every two weeks or three times every four weeks. Integrin αvβ6 is administered, for example, by injection, for example, subcutaneous injection into the back. The administration route, dosage, frequency, and number of administrations of integrin αvβ6 can be appropriately determined by those skilled in the art. For example, integrin αvβ6 in a single dose of 50 μg / 200 μl PBS may be mixed with 200 μl of CFA and administered by subcutaneous injection into the back of the animal.

[0068] In another aspect, a method for producing a primary sclerosing cholangitis model animal is provided by knocking out the integrin αvβ6 gene in an animal. Gene knockout can be performed by known methods, such as genome editing or methods using ES cells with a disrupted target gene. According to the present invention, it has been revealed that the pathogenesis of primary sclerosing cholangitis involves the binding of anti-integrin αvβ6 autoantibodies to integrin αvβ6 present in the animal's body, i.e., functional inhibition or loss of integrin αvβ6 due to autoantibody binding. Therefore, in the present invention, knocking out the integrin αvβ6 gene resulted in the loss of integrin αvβ6 itself, thereby successfully inducing the onset of primary sclerosing cholangitis.

[0069] In another aspect, a method for producing an ulcerative colitis or primary sclerosing cholangitis model animal is provided, comprising administering to the animal an anti-integrin αvβ6 antibody derived from an ulcerative colitis or primary sclerosing cholangitis patient. The patient is an animal, preferably a mammal, and more preferably a human. Examples of the antibody include an antiserum (polyclonal antibody) or a monoclonal antibody. Serum derived from an ulcerative colitis or primary sclerosing cholangitis patient may be used as the antiserum. Preferably, a monoclonal antibody is administered. The monoclonal antibody may be prepared from serum derived from an ulcerative colitis or primary sclerosing cholangitis patient by a known method, such as a hybridoma method.

[0070] The administration method, administration route, dosage, number of administrations, administration frequency, and administration interval of the antibody can be appropriately determined by those skilled in the art. For example, patient-derived serum may be administered to animals by injection one or more times, e.g., 1 ml to 3 ml per animal, 1 to 3 times at appropriate intervals. For example, 2 ml of patient serum may be injected subcutaneously into the back of each animal once. In this case, symptoms of ulcerative colitis or primary sclerosing cholangitis appear at the latest approximately 24 hours after administration. For example, an anti-integrin αvβ6 monoclonal antibody may be administered to animals by injection, preferably two or more times, e.g., 1 mg to 20 mg per animal, 1 to 3 times per week, e.g., for 1 to 3 weeks. For example, 10 mg of anti-integrin αvβ6 antibody may be administered subcutaneously into the back of each animal twice a week for 3 weeks (6 times in total). In this case, symptoms of ulcerative colitis or primary sclerosing cholangitis appear at the latest about 48 hours after the last administration.

[0071] The antibody preferably comprises an RGD peptide sequence or an analogous sequence thereof in CDR2 or CDR3, more preferably in CDR2 or CDR3 of the heavy chain, and particularly preferably in CDR3 of the heavy chain. The analogous sequence of the RGD peptide is as described in Section <2. Anti-integrin αvβ6 antibody>.

[0072] The monoclonal antibody is, for example, (a) a polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, the polypeptide comprising three heavy chain CDRs having the sequences shown in SEQ ID NOs: 11 to 13, respectively, and three light chain CDRs having the sequences shown in SEQ ID NOs: 14 to 16, respectively, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 83, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 84; (b) a polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 17 to 19, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 20 to 22, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 85, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 86, which specifically binds to integrin αvβ6 or a fragment thereof; (c) a polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 23 to 25, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 26 to 28, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 87, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 88, which specifically binds to integrin αvβ6 or a fragment thereof;(d) a polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 29 to 31, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 32 to 34, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 89, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 90, which specifically binds to integrin αvβ6 or a fragment thereof; (e) a polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 35 to 37, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 38 to 40, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 91, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 92, which specifically binds to integrin αvβ6 or a fragment thereof; (f) a polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 41 to 43, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 50 to 52, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 93, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 94, which specifically binds to integrin αvβ6 or a fragment thereof;(g) a polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 47 to 49, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 44 to 46, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 95, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 96, which specifically binds to integrin αvβ6 or a fragment thereof; (h) a polypeptide comprising three heavy chain CDRs comprising the sequences shown in SEQ ID NOs: 53 to 55, respectively, and three light chain CDRs comprising the sequences shown in SEQ ID NOs: 56 to 58, respectively, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 97, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 98, which specifically binds to integrin αvβ6 or a fragment thereof; (i) A polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 59 to 61, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 62 to 64, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 99, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 100, which specifically binds to integrin αvβ6 or a fragment thereof;(j) A polypeptide comprising three heavy chain CDRs each comprising the sequences shown in SEQ ID NOs: 65 to 67, and three light chain CDRs each comprising the sequences shown in SEQ ID NOs: 68 to 70, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 101, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 102, which specifically binds to integrin αvβ6 or a fragment thereof; (k) a polypeptide comprising three heavy chain CDRs comprising the sequences set forth in SEQ ID NOs: 71 to 73, respectively, and three light chain CDRs comprising the sequences set forth in SEQ ID NOs: 74 to 76, respectively, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence set forth in SEQ ID NO: 103, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence set forth in SEQ ID NO: 104, wherein the polypeptide specifically binds to integrin αvβ6 or a fragment thereof; or (l) A polypeptide that specifically binds to integrin αvβ6 or a fragment thereof, the polypeptide comprising three heavy chain CDRs having the sequences shown in SEQ ID NOs: 77 to 79, respectively, and three light chain CDRs having the sequences shown in SEQ ID NOs: 80 to 82, respectively, and a heavy chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 105, and a light chain variable region having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence shown in SEQ ID NO: 106. Preferably, a polypeptide selected from (a) to (i), (k) or (l) is used, more preferably a polypeptide selected from (a) to (i) or (k), and even more preferably a polypeptide selected from (b) to (i) or (k).

[0073] Preferably, an anti-integrin αvβ6 antibody derived from an ulcerative colitis patient is used to generate an ulcerative colitis animal model, and an anti-integrin αvβ6 antibody derived from a primary sclerosing cholangitis patient is used to generate a primary sclerosing cholangitis animal model. For example, a polypeptide selected from (a) to (j), preferably a polypeptide selected from (a) to (i), more preferably a polypeptide selected from (b) to (i), and even more preferably a polypeptide selected from (c) or (d), is preferably used to generate an ulcerative colitis animal model. For example, a polypeptide selected from (k) or (l), preferably the polypeptide represented by (k), is preferably used to generate a primary sclerosing cholangitis animal model. However, because CDR3 is the most important site for antibody specificity (binding ability), if an antibody derived from an ulcerative colitis patient and an antibody derived from a primary sclerosing cholangitis patient share a common CDR3 sequence, it may be possible to generate animal models for both ulcerative colitis and primary sclerosing cholangitis using an antibody derived from either patient.

[0074] The animal may have been administered dextran sulfate sodium (DSS) in advance. DSS is a drug known to induce enteritis. Since integrin αvβ6 expression is known to increase during inflammation and healing, administering DSS can increase the amount of integrin αvβ6 in the animal's body, thereby increasing the reaction with anti-integrin αvβ6 autoantibodies and thereby increasing the incidence of disease. The dose of DSS can be determined appropriately by those skilled in the art and is not particularly limited. However, a preferred dose is one that induces mild inflammation, such as providing approximately 1% DSS via a waterer. DSS can be administered, for example, orally or by injection, preferably orally. The administration period of DSS is not particularly limited and can be determined appropriately by those skilled in the art. For example, it may be administered for approximately one day to three weeks. Preferably, a drug-free period is provided after DSS administration to allow the inflammation to completely resolve, after which the patient's serum or the monoclonal antibody is administered. The drug-free period is not particularly limited, but may be, for example, three weeks or more.

[0075] The ulcerative colitis model animal prepared by the above method exhibits symptoms of ulcerative colitis, particularly cellular infiltration (e.g., submucosal cellular infiltration) or disarray or twisting of crypts in the large intestine. The primary sclerosing cholangitis model animal prepared by the above method exhibits symptoms of primary sclerosing cholangitis, particularly partial loss of bile ducts, or cellular infiltration or fibrosis around the bile ducts. The model animal thus obtained is an ideal animal model for ulcerative colitis or primary sclerosing cholangitis, and various therapeutic agents can be developed using this model. Therefore, as a further aspect of the present invention, there is provided a method for screening therapeutic or preventive agents for ulcerative colitis or primary sclerosing cholangitis, which comprises administering a candidate therapeutic substance for ulcerative colitis or primary sclerosing cholangitis to the model animal.

[0076] As mentioned at the beginning, the inventors previously discovered that the presence of autoantibodies against integrin αvβ6 in patients is an indicator of ulcerative colitis and primary sclerosing cholangitis (International Publication No. WO 2020 / 141608, Gastroenterology Vol. 160, No. 7, June 2021, Pages 2383-2394). In addition to autoantibodies against integrin αvβ6, many other serological antibodies have been reported as indicators of ulcerative colitis. However, these serological antibodies are thought to be markers of abnormal immune responses rather than direct effectors involved in the pathogenesis of ulcerative colitis (World J Gastroenterol, 2016 January 21, 22(3): 1304-1310). Until the present invention, autoantibodies against integrin αvβ6 were also recognized in the medical community as a marker of an abnormal immune response, rather than a direct effector involved in the pathogenesis of ulcerative colitis.

[0077] The present invention will be described in more detail below using examples, but the present invention is not limited to these examples.

[0078] Example 1 Demonstration experiment on anti-integrin αvβ6 autoantibodies specifically produced in PSC patients 1. Inhibition of integrin αvβ6-fibronectin binding by antibodies derived from PSC patients Inhibition of the binding of integrin αvβ6 to fibronectin by antibodies (IgG: immunoglobulin G) derived from human PSC patients was investigated using a solid-phase binding assay.

[0079] [Methods] (1) Preparation of human IgG. IgG was purified from serum of PSC patients or controls (patients with biliary tract cancer, IgG4-associated sclerosing cholangitis, autoimmune hepatitis, primary cholestatic cholangitis, or other autoimmune diseases, or healthy individuals) using Ab-Rapid SPinN (P-013, ProteNova, Higashikagawa, Japan) according to the manufacturer's instructions. The purified IgG was dialyzed against phosphate-buffered saline (pH 7.2) and concentrated to the same volume as the original serum by ultrafiltration using an Amicon Ultra filter (UFC805024; Millipore). The purified IgG concentration was measured using a human IgG enzyme immunoassay kit (MK136; TaKaRa). The purity of the IgG fraction was confirmed by testing for IgA, IgA, IgE, and protein contaminants using a human IgA ELISA kit (E88-102; Bethyl Laboratories), a human IgM ELISA kit (E88-100; Bethyl Laboratories), a human IgE ELISA kit (E88-108; Bethyl Laboratories), and sodium dodecyl sulfate polyacrylamide gel electrophoresis with Coomassie brilliant blue staining, respectively.

[0080] (2) Solid-Phase Integrin αvβ6 Binding Assay. A 96-well microtiter plate was coated overnight at 4°C with 150 μL / well of 2 μg / mL human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1), blocked, and incubated with 120 μL of diluted patient or control IgG (1:10-1:80) at room temperature for 60 minutes. After washing, the plate was incubated with 100 μL of 2 μg / mL fibronectin (FC010; MilliporeSigma, Burlington, MA) for 60 minutes at room temperature. After washing, anti-fibronectin antibody (1:5000 dilution; ab2413; Abcam) was added and incubated for 60 minutes at room temperature. After washing, HRP-conjugated anti-rabbit antibody (1:10000 dilution; A27036; ThermoFisher Scientific) was added and incubated for 60 minutes at room temperature. After washing, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 10 minutes, and the absorbance at 450 nm was measured to detect fibronectin bound to integrin αvβ6 on the solid phase. ２ (1 mM) and CaCl ２ Human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) is a heterodimeric protein comprising an α chain comprising the extracellular domain of the human integrin αv chain, from Phe at position 31 to Val at position 992 in the amino acid sequence, and a linker sequence, an acidic tail sequence, and a polyhistidine tag at its C-terminus, and a β chain comprising the extracellular domain of the human integrin β6 chain, from Gly at position 22 to Asn at position 707 in the amino acid sequence, and a linker sequence and a basic tail sequence at its C-terminus.

[0081] To calculate the binding inhibition rate, blank wells were prepared by coating wells with integrin αvβ6 and incubating them with fibronectin in the absence of patient or control IgG, and the absorbance (OD) at 450 nm was measured in the same manner as above. The binding inhibition rate (%) was calculated according to the following formula: Binding inhibition rate (%) = {[(OD value of blank well) - (OD value of wells to which IgG was added)] / (OD value of blank well)} × 100

[0082] [Results] The results of the binding inhibition test using 1:10 diluted IgG are shown in Figure 1. In Figure 1, the cutoff OD level is indicated by a dashed line. The cutoff OD value is the mean value of the control IgG plus three times the standard deviation (SD). IgG from 15 of 37 PSC patients (40.5%) inhibited the binding of integrin αvβ6 to fibronectin (plotted as values ​​exceeding the cutoff OD value in Figure 1). On the other hand, control IgG from control disease patients (12 patients) did not inhibit the binding of integrin αvβ6 to fibronectin. IgG from healthy individuals (4 patients) also did not inhibit the binding of integrin αvβ6 to fibronectin.

[0083] Figure 2 shows the dose-dependent inhibition of fibronectin-integrin αvβ6 binding by autoantibodies derived from primary sclerosing cholangitis patients. The inhibitory activity of the PSC patient IgG on integrin αvβ6-fibronectin binding was shown to be dose-dependent (Figure 2). IgG from PSC patients (designated PSC21, PSC19, PSC17, PSC29, PSC32, PSC26, PSC1, PSC2, and PSC3 in Figure 2) containing anti-integrin αvβ6 antibodies dose-dependently inhibited the binding of integrin αvβ6 to fibronectin. In contrast, IgG from control IgG4-associated sclerosing cholangitis patients (designated IgG4-SC7 in Figure 2), cholangiocellular carcinoma patients (designated CCC21 in Figure 2), and healthy controls (designated HC3 in Figure 2) did not exhibit inhibitory activity.

[0084] Furthermore, Figure 3 shows the correlation between the titer of autoantibodies derived from primary sclerosing cholangitis patients and their inhibitory activity against fibronectin-integrin αvβ6 binding. The inhibitory activity of IgG from the PSC patients on integrin αvβ6-fibronectin binding was shown to correlate with the titer of anti-integrin αvβ6 antibodies (r=0.72, P<0.001) (Figure 3).

[0085] 2. Binding of PSC patient-derived antibodies to the fibronectin motif binding site Integrin αvβ6 is known to bind to ligands such as fibronectin by recognizing the RGD sequence motif. Here, we hypothesized that anti-integrin αvβ6 antibodies derived from PSC patients exert their inhibitory activity by targeting the RGD binding site of integrin αvβ6, and examined the binding site of these antibodies.

[0086] [Method] Microtiter plates were coated with 2 μg / mL integrin αvβ6 at 4°C overnight, then blocked. 100 μL of a patient-derived IgG dilution (1:100) was added along with the peptides RGDS (SEQ ID NO: 9: Arg-Gly-Asp-Ser) or RGES (SEQ ID NO: 10: Arg-Gly-Glu-Ser) containing an RGD motif or an RGE motif (control), respectively, and incubated at room temperature for 60 minutes. After washing, 100 μL / well of HRP-labeled anti-human IgG antibody (50,000-fold diluted; ab6759; Abcam) was added and incubated at room temperature for 60 minutes. After washing, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 7 minutes, and the absorbance density (OD) at 450 nm was measured to detect human IgG bound to the solid phase integrin αvβ6.

[0087] [Results] Figure 4 shows the results of an assay for inhibition of binding between autoantibodies derived from primary sclerosing cholangitis patients and integrin αvβ6 by the addition of RGDS peptide (note that the symbols for identifying each patient in Figure 4 are the same as those in Figure 2). The RGDS peptide dose-dependently reduced the binding of PSC patient IgG to integrin αvβ6. On the other hand, Figure 5 shows the results of an assay for inhibition of binding between autoantibodies derived from primary sclerosing cholangitis patients and integrin αvβ6 by the addition of RGES peptide (note that the symbols for identifying each patient in Figure 5 are the same as those in Figure 2). The RGES peptide did not inhibit the binding of PSC patient IgG to integrin αvβ6. Therefore, it was demonstrated that the RGD peptide and the anti-integrin αvβ6 antibody compete for binding to the RGD motif-binding site on integrin αvβ6.

[0088] Example 2: Establishment of Monoclonal Anti-Integrin αvβ6 Antibody 1. Establishment of Monoclonal Antibody Monoclonal anti-integrin αvβ6 antibodies were established using standard methods from peripheral blood collected from human patients with ulcerative colitis or primary sclerosing cholangitis. Briefly, peripheral blood was obtained from patients with ulcerative colitis and primary sclerosing cholangitis, and the blood was immortalized by infection with EB virus. A clone producing an anti-integrin αvβ6 antibody was selected. The IgG DNA sequence of the clone was sequenced, and the DNA sequence was introduced into a plasmid, which was then transfected into CHO cells to establish a monoclonal anti-integrin αvβ6 antibody. As a result, four monoclonal anti-integrin αvβ6 antibodies (referred to as UC antibody 1, UC antibody 2, UC antibody 3, and UC antibody 4, respectively) were established from one ulcerative colitis patient, one monoclonal anti-integrin αvβ6 antibody (referred to as PSC antibody 1 and PSC antibody 2, respectively) was established from each of two primary sclerosing cholangitis patients, and four, one, and one monoclonal anti-integrin αvβ6 antibodies (referred to as UC antibodies 5-8, UC antibody 9, and UC antibody 10, respectively) were established from three other ulcerative colitis patients, respectively.

[0089] Sequence analysis of the obtained monoclonal antibodies revealed that the heavy chain CDR3 and CDR2 sequences contained an RGD motif or an RGD-like sequence, respectively. Another group also reported that the heavy chain CDR3 of monoclonal antibodies derived from UC patients contained, in addition to the RGD motif, sequences similar to RGD, such as RED, KGD, or SGD, and that antibodies containing these sequences had high binding ability to integrin αvβ6 (Nature Medicine volume 28, 766-779 (2022), J Exp Med (2023) 220 (4): e20220538.).

[0090] The CDR sequences of the heavy and light chains of the obtained monoclonal antibody are shown below. The amino acid and nucleotide sequences of the variable region sequences are also shown. In the amino acid sequences of the variable regions, the CDR sequences are underlined and in bold.

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] UC antibody 1: Heavy chain variable region CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 107) Light chain variable region GATATTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAACCTCCTGCATAGTAATGGATACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCCGGGGTCCCTGACAGGTTCAGTGGCAGTGGATCAGGCACAGATTTTACACTGAAAATCAGCAGAGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGCTCTACAAACTTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAA (SEQ ID NO: 108)

[0098] UC antibody 2: Heavy chain variable region GAGGTGCAGTTGGTGGAGTCTGGGGGAGGCTTGGTAAAGCCTGGGGGGTCCCTTAGAGTCTCCTGTGTAGTCTCTGGATTCACAATCACTAACGCCTGGATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTTGGCCGTAGTAAAAGCAAAACTGATGGTGGGACAACAGACTACATTGCACCCGTGAAAGGCAGATTCACCATCTCAAGAGATGATTCAAAAAACACACTTTATCTGGAAATGAACAGCCTGAAAACCGAGGACACAGCCGTGTATTACTGTGCCACAGATCGGCCTCTGAAACTAAGGGGTAGAGACTACAACTACTACGTTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 109) Light chain variable region GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCTTCTGTTGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTGCCAGATCTTTAAATTGGTATCAGCAAAAACCAGGGAAAGCCCCTAATCTCCTGATCTATGCTGCATCCACTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCGGCAGTCTGCAACCTGAAGATTTCGCAACTTACTCCTGTCAACAGAGTTCCAGTTCCCCTCTCACTTTCGGCGGAGGGACCAGGGTGGAGATCAAG (SEQ ID NO: 110)

[0099] UC antibody 3: Heavy chain variable region CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGAGTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTATTTATGGGATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATTTCATCTGATGGAACTAATCAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAACAACACGGTGTATCTGCAAATGAACAGCCTGGGAGGTGAGGACACGGCTGTGTATTACTGTGCGAAAGATCGGGGCCGCCGGGGGGACAGTGGCTGGTACCGACACTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA (SEQ ID NO: 111) Light chain variable region CAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACAATGGGAATAATTATGTATCCTGGTACCAGCAGGTCCCAGGAACAGCCCCCAAACTCCTCATTTATGACAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGTAGTCTTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 112)

[0100] UC antibody 4: Heavy chain variable region CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTTACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 113) Light chain variable region TCCTATGAGCTGACACAGCCACCCTCGGTGTCAGTGTCCCCAGGACAGACGGCCAGGATCACCTGCTCTGGAGATGCATTGCCAAAGCAATATGCTTATTGGTACCAGCAGAAGCCAGGCCAGGCCCCTGTGCTGGTGATATATAAAGACAGTGAGAGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAGCTCAGGGACAATGGCCACCTTGACTATCAGTGGGGCCCAGGTGGAGGATGAAGGTGACTACTACTGTTCCTCAACAGACAGCAATTCTCAGCGCGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 114)

[0101] UC antibody 5: Heavy chain variable region CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 115) Light chain variable region GTGCTGACGCAGCCGCCCTCAGTGTCCGTGTCCCCAGGACAGACAGCCAGCATCACCTGCTCTGGAGATAAATTGGGGGATAAATATGCTTGCTGGTACCAGCAGAAGTCAGGCCAGGCCCCTGTATTGGTCATCTATCAAGATAGCAAGCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCTGGGAACACAGCCACTCTGACCATCAGCGGGACCCAGGCTATGGATGAGGCTGACTATTACTGTCAGGCGTGGGACAGCAGCACTGCGCTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 116)

[0102] UC antibody 6: Heavy chain variable region CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 117) Light chain variable region CAGTCTGTGCTGACGCAGCCGCCCTCAGTGTCTGGGGCCCCAGGGCAGAGGGTCACCATCTCCTGCACTGGGAGCAGTTCCACCATCGGGGCAAATAATGATGTACACTGGTACCAGCAACTTCCAGGAACAGCCCCCAAACTCCTCATCTATGGTAACAAGAATCGCCCCTCAGGGGTCTCTGACCGATTCTCTGGCTCCAAGTCTGGCACCTCAGCCTCCCTGGCCATCACTGGGCTCCAGGCTGAGGATGAGGCTGATTATTACTGCCAGTCCTATGACAGCAGTCTGAGTGATCTTTATGTCTTCGGAACGGGGACCAAGGTCACCGTCCTA (SEQ ID NO: 118)

[0103] UC antibody 7: Heavy chain variable region GTGCAGCTGGTGGAGTCTGGAGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 119) Light chain variable region GAAATTGTGTTGACACAGTCTCCAGCCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCTACTTAGCCTGGTACCAACAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGATGCATCCAACAGGGCCACTGGCATCCCAGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGCCTAGAGCCTGAAGATTTTGCAGTTTATTACTGTCAGCAGCGTAGCAACTGGCTCACTTTCGGCGGAGGGACCAAGGTGGAGATCAAA (SEQ ID NO: 120)

[0104] UC antibody 8: Heavy chain variable region CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAACCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGCTATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATCCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCGAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 121) Light chain variable region GAAATTGTGTTGACACAGTCTCCAGGCACCCTGTCTTTGTCTCCAGGGGAAAGAGCCACCCTCTCCTGCAGGGCCAGTCAGAGTGTTAGCAGCAGCTACTTAGCCTGGTACCAGCAGAAACCTGGCCAGGCTCCCAGGCTCCTCATCTATGGTGCATCCAGCAGGGCCACTGGCATCCCAGACAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACTCTCACCATCAGCAGACTGGAGCCTGAAGATTTTGCAGTGTATTACTGTCAGCAGTATGGTAGCTCAGTGTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAA (SEQ ID NO: 122)

[0105] UC antibody 9: Heavy chain variable region CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCATTTATATCATATGATGGAATTAATAAATACTATGCAGACTCCGTGAAGGGCCGCTTCACCATCTCCAGAGACAATTCCAAGGACACGCTGTATCTGCAAATGAACAGCCTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGAAAGTCATCCCCAGGATAAGGGGTTCGGGAGACAAAGCGGGGATAAAAGACTACTACTACTACGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 123) Light chain variable region CAGTCTGTGTTGACGCAGCCGCCCTCAGTGTCTGCGGCCCCAGGACAGAAGGTCACCATCTCCTGCTCTGGAAGCAGCTCCAACATTGGGAATAATTATGTATCCTGGTACCAGCAGCTCCCAGGAACAGCCCCCAAACTCCTCATTTATGACAATAATAAGCGACCCTCAGGGATTCCTGACCGATTCTCTGGCTCCAAGTCTGGCACGTCAGCCACCCTGGGCATCACCGGACTCCAGACTGGGGACGAGGCCGATTATTACTGCGGAACATGGGATAGCAGCCTGAGTGCTGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTA (SEQ ID NO: 124)

[0106] UC antibody 10: Heavy chain variable region CAGGTCCAGCTGGTACAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAAGTCTCCTGCAAGGTTTCCGGATACACCCTCACTGAATTACGCATACACTGGGTGCGACAGGTTCCTGGAAAAGGGCTTGAGTGGATGGGAGGTTTTGATCCTGAAGATGGTGAAACAATCTACACACAGAAGTTCCAGGGCAGAGTCACGATGACCGAGGACACATCTACAGACACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAGGACACGGCCGTCTATTACTGTACAACAGATCTTTTCGCTTTCGTTCGGGGAGTTAGGGGTGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCTTCA (SEQ ID NO: 125) Light chain variable region GACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGACCATTACTACTTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATAGAGCATCCAGTTTGCACAGTGGGGTCCCATCTAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACCGTACCCTCTGGACGTTCGGCCAAGGGACCAAGGTGGAAATCAAC (SEQ ID NO: 126)

[0107] PSC Antibody 1: Heavy chain variable region CAGGTTCAGCTGGTGCAGTCTGGAGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTCTCCTGCAAGGCTTCTGGTCACACCTTTTCCAGCTTTGGTATCAGCTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAGTGGATGGGATGGATCAGCGCTTACAATGGTAACACAAACTCTGCACAGAAGTTCCAGGGCAGAGTCACCATGACCACAGACACATCCACGAGCACAGCCTACATGGAGCTGAGGAGCCTGAGATCTGACGACACGGCCGTGTATTACTGTGCGAGAGATAGGGGTTTTCGCGGGGACACAGCTATGATTAAAGGGGGTATGGACGTCTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA (SEQ ID NO: 127) Light chain variable region CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCCAACTCATAATTTATGATGTCAGTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAGGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGCAGCACTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTA (SEQ ID NO: 128)

[0108] PSC antibody 2: Heavy chain variable region GAGGCGCATCTGTTGGAGTCTGGGGGAGGCCTGGTACAGCCTGGGGGGTCCCTGAGACTCTCATGTGAAGGCTCTGGGTTCGACTTTAGCAATTATGTCATGAACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCCGCAATTACTGACAGAGGTGATAGTCGATACTATATAAATTCAGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTTTCTGGAGATGTACGGCCTGACACCCGAAGACACGGCCGTCTATTACTGTGCCAAGGATCAGACATTTGCGGGCGACGACCCCACCGTCTTCGACTCCTGGGGCCTGGGAACCCTGGTCACCGTCTCCTCA (SEQ ID NO: 129) Light chain variable region CAGTCTGCCCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACATTGGTGGTTATAACTATGTCTCCTGGTACCAACAACACCCAGGCAAAGCCCCCAAACTCATGATTTATGATGTCAATAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAACTCATATACAACCAGCAGCACTTCTGTCTTCGGAACTGGGACCAAGGTCACCGTCCTA (SEQ ID NO: 130)

[0109] 2. Integrin αvβ6 Binding Inhibition Assay: The functionality of the obtained monoclonal antibodies was further confirmed by a competitive assay with fibronectin for binding to integrin αvβ6. Briefly, 96-well microtiter plates were coated overnight at 4°C with 150 μL / well of 2 μg / mL human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1), blocked, and incubated with 120 μL of monoclonal antibody (0.0001-10 μg / mL) at room temperature for 60 minutes. After washing, the plates were incubated with 100 μL of 2 μg / mL fibronectin (FC010; MilliporeSigma, Burlington, MA) for 60 minutes at room temperature. After washing, anti-fibronectin antibody (1:5000 dilution; ab2413; Abcam) was added and incubated for 60 minutes at room temperature. After washing, HRP-labeled anti-rabbit IgG antibody (1:10,000 dilution; A27036; ThermoFisher Scientific) was added and incubated at room temperature for 60 minutes. After washing, fibronectin bound to integrin αvβ6 on the solid phase was detected by incubating with 3,3',5,5'-tetramethylbenzidine for 10 minutes and measuring the absorbance at 450 nm. The assay was performed using MgCl ２ (1 mM) and CaCl ２ The assay was carried out in the presence of 1 mM integrin (αvβ6). To calculate the binding inhibition rate, blank wells coated with integrin αvβ6 were incubated with fibronectin in the absence of antibody, and the optical density (OD) at 450 nm was measured in the same manner as above. The binding inhibition rate (%) was calculated according to the following formula. The results are shown in Figure 6. Binding inhibition rate (%) = {[(OD value of blank well) - (OD value of well to which antibody was added)] / (OD value of blank well)} x 100

[0110] All of the monoclonal antibodies tested (UC antibodies 1 to 8, PSC antibody 1) inhibited the binding of fibronectin to integrin αvβ6 (FIG. 6).

[0111] CDR3 is the most important region for antibody specificity (binding ability). Therefore, it was found that the epitope of anti-integrin αvβ6 autoantibodies derived from ulcerative colitis and primary sclerosing cholangitis patients is a region containing the RGD binding site on integrin αvβ6. It was also found that in ulcerative colitis or primary sclerosing cholangitis, anti-integrin αvβ6 autoantibodies compete with the RGD of fibronectin, thereby inhibiting the binding of fibronectin to integrin αvβ6.

[0112] 3. Binding Affinity Analysis Next, the binding affinity of the obtained anti-integrin αvβ6 monoclonal antibodies derived from UC or PSC patients was determined. KD values ​​were measured by biolayer interferometry using Octet RED96 (Sartorius). 20 mM Tris, 150 mM NaCl, 1 mM CaCl ２ , 1 mM MgCl ２ A 100 nM antibody solution and a biotinylated integrin αvβ6 protein solution serially diluted over the range of 200 to 6.25 nM were prepared using 0.1% human serum albumin (014-27604; Fujifilm Wako Pure Chemical Industries, Ltd.) and 0.02% Tween 20 (1610781; Bio-Rad) buffer. 200 μL / well of these solutions were added to a 96-well plate (Greiner; 655209). Biotinylated integrin αvβ6 was allowed to bind to a biosensor (18-5136; Sartorius) immersed in the buffer for 5 minutes. After washing, the biosensor was immersed in each antibody solution for 5 minutes (binding reaction). The sensor was then immersed in the buffer solution for 1 minute (dissociation reaction). The binding dissociation constant (KD value) between "integrin αvβ6 and each monoclonal antibody" was determined using the analytical software (Octet BLI Analysis) attached to the instrument. The results are shown in Table 3.

[0113]

[0114] The KD values ​​of UC antibodies 1, 2, 4, 5, 7, and 9 and PSC antibody 1 are 1 x 10 -９ The KD values ​​of UC antibodies 3, 6, and 8 are on the order of 1 x 10 -８The KD values ​​of UC antibody 10 and PSC antibody 2 were unmeasurable, suggesting that these antibodies have low binding affinity for integrin αvβ6.

[0115] Example 3: Preparation of Primary Sclerosing Cholangitis Animal Model Eight-week-old mice (10 C57BL / 6J mice, 5 BALB / c mice) were immunized with 100 μg / mouse of human integrin αvβ6 (ACROBiosystems, product number IT6-H52E1) subcutaneously in the back together with an adjuvant [CFA (Freund's Complete Adjuvant, manufacturer: BD, product number: 263810) or IFA (Freund's Incomplete Adjuvant, manufacturer: BD, product number: 263910)] (day 0). Subsequent immunizations with the same amount of antigen as the first immunization were performed on days 14 and 28 to induce anti-integrin αvβ6 antibody production. As a control, mice were similarly immunized with OVA (ovalbumin).

[0116] The mice were sacrificed 56 days after immunization, and the bile ducts of the mice were examined. The integrin αvβ6-immunized mice showed partial bile duct loss and peri-bile duct cellular infiltration (Figure 7). These findings are similar to the pathological findings of PSC. The bile ducts of all integrin αvβ6-immunized mice showed cellular infiltration consistent with PSC pathology. In contrast, neither peri-bile duct cellular infiltration nor bile duct loss was observed in the control OVA-immunized mice.

[0117] Example 4. Investigation of the mechanism in a primary sclerosing cholangitis animal model To investigate which element of immunity—cellular immunity (immunity primarily driven by T cells) or humoral immunity (immunity primarily driven by B cells that fights against foreign substances by producing antibodies)—has a stronger effect in the PSC model mice prepared in Example 3, the mice were administered anti-CD8 antibody (InVivoMab anti-mouse CD8a Clone: ​​2.43, BioXcell), anti-CD20 antibody (InVivoMAb anti-mouse CD20 Clone: ​​AISB12, BioXcell), or anti-CD4 antibody (InVivoMab anti-mouse CD4 Clone: ​​GK1.5, BioXcell) as ablative antibodies. Anti-CD8 antibody suppresses cellular immunity, anti-CD20 antibody suppresses humoral immunity, and anti-CD4 antibody suppresses both cellular and humoral immunity.

[0118] As a result, administration of anti-CD20 antibody or anti-CD4 antibody suppressed cell infiltration ("+CDa4dep. or +CD20dep." in Figure 8). On the other hand, administration of anti-CD8 antibody did not change the pathology ("+CD8dep." in Figure 8). Therefore, it is thought that antibody production by humoral immunity (here, production of anti-integrin αvβ6 antibody) causes the pathology of PSC.

[0119] Example 5. Creation of integrin αvβ6 knockout animals In C57BL / 6J mice, gene editing was performed using CRISPR / Cas9 to delete Exon 3 and Exon 4 of the integrin β6 gene and insert a stop codon into Exon 5, thereby creating integrin αvβ6 gene knockout mice (n=5). Although several types of β bind to αv, only αv binds to β6, so knocking out the integrin αvβ6 protein results in a loss of function of only the integrin αvβ6 protein among the integrin family proteins.

[0120] Figure 9 shows a micrograph of the bile duct in a mouse lacking the function of integrin αvβ6 protein. In integrin β6 gene knockout mice (mice lacking the function of integrin αvβ6 protein), partial loss of the bile duct and inflammatory cell infiltration (lymphocyte infiltration) around the bile duct were observed ( Figure 9 ). This supports the finding in Example 4 that inhibition of integrin αvβ6 function by anti-integrin αvβ6 antibodies is involved in the pathogenesis of PSC.

[0121] Example 6: Antibody Removal Experiment 1 Using an Anti-Integrin αvβ6 Antibody Adsorption Column Using a commercially available histidine-tagged purification kit (His-tagged Protein Purification Kit, MBL, #3310), a column packed with anti-histidine-tagged beads (agarose beads bound to anti-histidine-tagged antibodies) was loaded with histidine-tagged integrin αvβ6 extracellular domain protein (10 μg / mL; ACROBiosystems, #IT6-H52E1) and serum samples (50 μL) collected from ulcerative colitis patients (n=3) and reacted. The sample was then centrifuged and collected. A microtiter plate was coated with 100 μL / well of 2 μg / mL integrin αvβ6 overnight at 4°C, followed by washing and blocking. After washing, the column-passed sample was diluted 10-fold and added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-human IgG antibody (50,000-fold diluted; ab6759; Abcam) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 7 minutes, and the absorbance density (OD value) at 450 nm was measured to detect human IgG bound to integrin αvβ6 on the solid phase.

[0122] Furthermore, for concentration-dependent experiments, 1, 2, 5, or 10 μg / mL of histidine-tagged integrin αvβ6 and 25 μL of serum samples from ulcerative colitis patients were used in the same manner as above, except that the absorbance density (OD value) at 450 nm was measured by diluting the column-passed sample 5-fold.

[0123] As a control, only patient serum was applied to the column, and the absorbance density (OD value) at 450 nm of the serum that passed through the column was measured in the same manner as above. The column adsorption rate of the anti-integrin αvβ6 antibody was calculated according to the following formula: Adsorption rate (%) = [{(OD value of control) - (OD value of sample)} / (OD value of control)] × 100. In this formula (and in Tables 2 and 3 described below), "sample" refers to the sample that passed through the column when histidine-tagged integrin αvβ6 and a patient serum sample were applied to the column.

[0124] The results are shown in Tables 4 and 5 and Figure 10. As expected, anti-integrin αvβ6 antibodies in patient serum were adsorbed to the column by using integrin αvβ6. Furthermore, the antibody adsorption reaction depended on the concentration of integrin αvβ6 to be reacted (Figure 10).

[0125]

[0126]

[0127] Example 7 Antibody Removal Experiment 2 Using an Anti-Integrin αvβ6 Antibody Adsorption Column An adsorption test of anti-integrin αvβ6 antibodies contained in the sera derived from patients with ulcerative colitis and primary sclerosing cholangitis was conducted using an adsorbent in which histidine-tagged integrin αvβ6 protein was immobilized on anti-histidine tag antibody-labeled magnetic agarose.

[0128] Antibody adsorption test: 5 μg / mL or 25 μg / mL histidine-tagged integrin αvβ6 (ACRO Biosystems, IT6-H52E1) was mixed with 10 μL (5 μg of anti-his tag antibody) of anti-histidine tag antibody-conjugated magnetic agarose (MBL, D291-10) and 25 μL of serum from patients with ulcerative colitis (n=8, UC patients 4-11) or primary sclerosing cholangitis (n=9, PSC patients 1-9). The mixture was then incubated at 4°C for 12 hours in a total of 500 μL by end-over-end mixing. After the incubation, the tubes were placed on a magnetic rack and the reaction solution was collected. As a control, a similar reaction was performed using a mixture without histidine-tagged integrin αvβ6 (agarose and patient serum alone).

[0129] Measurement of anti-integrin αvβ6 antibody concentration: The anti-integrin αvβ6 antibody concentration in the recovered solution was measured by ELISA. A microtiter plate was coated with 100 μL / well of 2 μg / mL integrin αvβ6 overnight at 4°C, followed by washing and blocking. After washing, the recovered reaction solution was diluted 10-fold and added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, HRP-labeled anti-human IgG antibody (50,000-fold diluted; ab6759; Abcam) was added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 7 minutes, and the absorbance density (OD value) at 450 nm was measured to detect human IgG bound to integrin αvβ6 on the solid phase.

[0130] Conversion of anti-integrin αvβ6 antibody concentration: To a microtiter plate on which 2 μg / mL of integrin αvβ6 had been solid-phased, 1 to 0.001 μg / mL of UC antibody 1 (see Table 1) prepared in Example 2, diluted at a 3-fold common ratio, was added and incubated at room temperature for 60 minutes. After washing the plate, 100 μL / well of HRP-labeled anti-human IgG antibody (50,000-fold dilution; ab6759; Abcam) was added as a secondary antibody. After incubation at room temperature for 60 minutes, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 7 minutes, and the absorbance density (OD value) at 450 nm was measured. A calibration curve was then created to calculate the anti-integrin αvβ6 antibody concentration from the obtained OD values. Using this calibration curve, the anti-integrin αvβ6 antibody concentration contained in the solution subjected to the antibody adsorption reaction was determined. The adsorption rate of the anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated using the following formula. The adsorption sample refers to a solution recovered after the binding reaction to integrin αvβ6 on the solid phase. Adsorption rate (%) = [{(antibody concentration of control) - (antibody concentration of adsorbed sample)} / (antibody concentration of control)] x 100

[0131] Results: The results are shown in Figures 11 and 12. As is clear from Figures 11 and 12, the amount of adsorbed anti-integrin αvβ6 antibody contained in the serum from UC and PSC patients increased with increasing amounts of integrin αvβ6 added in the antibody adsorption reaction. When the amount of added integrin was 25 μg / mL, the adsorption rate of autoantibodies was 50% or higher in all samples from UC or PSC patients.

[0132] Example 8. Test to confirm the specificity of ligand proteins Five types of integrin β subunits are known to form heterodimers with integrin αv: β1, β3, β5, β6, and β8. An adsorption test of monoclonal autoantibodies derived from ulcerative colitis patients was performed using an adsorbent in which the five histidine-tagged integrin proteins were immobilized on anti-histidine tag antibody-labeled agarose, to confirm whether the autoantibody adsorption was specific to integrin αvβ6.

[0133] Ten μL (5 μg of anti-histidine tag antibody) of anti-histidine tag antibody-labeled magnetic agarose (MBL, D291-10), 150 ng of the monoclonal autoantibody (UC antibody 1 shown in Table 1) derived from an ulcerative colitis patient prepared in Example 2, and 5 μg / mL or 25 μg / mL of one of the following integrins were mixed and reacted by end-over-end mixing in a total of 500 μL at 4°C for 12 hours. The solution was then recovered. As a control, a similar reaction was performed using a mixture without integrin (a mixture of the above agarose and autoantibody only). Integrin αvβ1 (ACRO Biosystems, IT1-H82W6) Integrin αvβ3 (ACRO Biosystems, IT3-H52E3) Integrin αvβ5 (ACRO Biosystems, IT5-H52W5) Integrin αvβ6 (ACRO Biosystems, IT6-H52E1) Integrin αvβ8 (ACRO Biosystems, IT8-H52W4)

[0134] The concentration of anti-integrin αvβ6 antibody contained in the recovered solution was determined, and the adsorption rate of anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated in the same manner as described in Example 7. The results are shown in Figure 13.

[0135] As is clear from Figure 13, the anti-integrin αvβ6 antibody was adsorbed only when integrin αvβ6 was used as the ligand, indicating that autoantibodies in UC patients specifically recognize integrin αvβ6.

[0136] Example 9: Test of antibody removal performance of immobilized integrin αvβ6 by NHS covalent bonding method An adsorption test of monoclonal autoantibodies derived from ulcerative colitis patients and anti-integrin αvβ6 antibodies contained in the serum of ulcerative colitis patients was conducted using an adsorbent in which integrin αvβ6 protein was immobilized to magnetic agarose by N-hydroxysuccinimide (NHS) covalent bonding.

[0137] 3-30 μg of integrin αvβ6 (ACRO Biosystems, IT6-H52E1) was mixed with 25 μL (including 5 μL of carrier) of NHS mag Sepharose (Cytiva, 28-9440-09) and 500 ng of monoclonal autoantibody derived from an ulcerative colitis patient (UC antibody 1 prepared in Example 2) or 25 μL of serum derived from an ulcerative colitis patient (UC patient 11 in Example 7). The mixture was then mixed by end-over-end mixing in a total of 500 μL of solution at 4°C for 12 hours. After the reaction, the tube was placed on a magnetic rack and the reaction solution was collected. As a control, a similar reaction was performed using a mixture without integrin αvβ6.

[0138] The concentration of anti-integrin αvβ6 antibody contained in the recovered solution was determined, and the adsorption rate of anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated in the same manner as described in Example 7. The results are shown in Figure 14.

[0139] As is clear from FIG. 14, the adsorbed amounts of UC antibody 1 and anti-integrin αvβ6 antibody contained in the serum derived from UC patient 11 increased with an increase in the amount of integrin αvβ6 added for antibody adsorption.

[0140] Example 10: Antibody removal performance test of integrin αvβ6 immobilized on various carriers by NHS covalent bonding Integrin αvβ6 was immobilized on a cellulose carrier or a polymethyl methacrylate (PMMA) carrier by NHS covalent bonding, and an antibody adsorption test was performed. The cellulose carrier and PMMA carrier were prepared as follows.

[0141] Preparation of cellulose carrier: Cellupher C P-305 (Asahi Kasei) was used as the cellulose carrier. 1 g of the cellulose carrier was placed in a flask reactor and suspended in 0.05 M sodium phosphate buffer (90 mL, pH 6.8). TEMPO (2,2,6,6-tetramethylpiperidine 1-oxyl, 0.016 g, 0.1 mmol) and sodium chlorite (80%, 1.13 g, 10 mmol) were added and gently stirred. Subsequently, 2 M aqueous sodium hypochlorite solution (0.5 mL, 1.0 mmol) and 0.05 M sodium phosphate buffer (0.5 mL, pH 6.8) were mixed, and this was added to the reaction suspension. The mixture was then heated at 60°C for 2, 6, 24, 48, and 72 hours. After each reaction time, the suspension was returned to room temperature and then filtered. The filtered material was washed three times with distilled water and then subjected to a 30-minute pull-and-cut procedure to obtain crystalline cellulose beads with COOH groups attached to their surfaces. 1 g of the carrier was filtered and washed twice with 10 mL of 0.05 M, pH 5.0 2-(N-morpholino)ethanesulfonic acid monohydrate (MES) buffer to prepare 20 mL of a 50 mg / mL suspension of the carrier in MES buffer. 640 μL of a solution prepared by dissolving 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) in MES buffer to a concentration of 150 mM was prepared. 320 μL of a solution prepared by dissolving Sulfo NHS (N-hydroxysulfosuccinimide sodium) in MES buffer to a concentration of 300 mM was prepared. To the carrier suspension, EDC solution and sulfo-NHS solution were added in this order, and the mixture was shaken and stirred at room temperature for 1 hour, filtered, and washed with 0.1 M phosphate buffer solution at pH 7.4 to obtain an NHS-activated carrier.

[0142] Preparation of PMMA Support: Polymethyl methacrylate (PMMA) particles containing COOH groups were obtained by copolymerizing methyl methacrylate (MMA) and methacrylic acid (MAA) using a dispersion polymerization method. 50 g of MMA (M0087; Tokyo Chemical Industry Co., Ltd.) and 50 g of MAA (M0079; Tokyo Chemical Industry Co., Ltd.) were mixed with 116 g of purified water (161-08247; Fujifilm Wako Co., Ltd.) and 464 g of methanol (131-01826; Fujifilm Wako Co., Ltd.). Additionally, 10 g of polyvinylpyrrolidone (P0691; Tokyo Chemical Industry Co., Ltd.) as a dispersion stabilizer and 2 g of 2,2'-azodiisobutyronitrile (A0566; Tokyo Chemical Industry Co., Ltd.) as a polymerization initiator were added to the polymerization flask and reacted at 60°C for 6 hours while stirring at 120 rpm. After the reaction, the particles were washed and subjected to testing. Thereafter, an NHS-activated carrier was obtained in the same manner as the cellulose carrier.

[0143] Immobilization of integrin αvβ6 protein onto NHS-activated carrier: The required amount of carrier was weighed and washed with 1 mM hydrochloric acid. The carrier was mixed with integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) at a volume ratio of 2:1 and mixed by end-over-end mixing at room temperature for 2 hours. After the reaction, the mixture was replaced with 0.5 M ethanolamine solution (pH 8.3, containing 500 mM NaCl) for blocking, and mixed by end-over-end mixing at room temperature for 2 hours. Thereafter, to remove excess reagents and reaction by-products, the mixture was alternately washed with 0.1 M Tris-HCl buffer (pH 8.3, containing 500 mM NaCl) and 0.1 M acetate buffer (pH 4.0, containing 500 mM NaCl), and finally the solution was replaced with 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution, and the mixture was stored at 4°C as a 50% slurry.

[0144] Using the two types of adsorbents thus obtained, an adsorption test of a monoclonal autoantibody derived from an ulcerative colitis patient (UC antibody 1 prepared in Example 2) was performed in the same manner as described in Example 9, and the adsorption rate was calculated. The results are shown in Table 6. For comparison, Table 6 also shows the adsorption rate of an agarose carrier (NHS mag Sepharose; Cytiva, 28-9440-09) onto which the same amount of integrin αvβ6 (10 μg per 5 μL of carrier) as shown in Example 9 was immobilized.

[0145]

[0146] Example 11. Antibody removal test of integrin αvβ6 immobilized by a covalent bonding method other than the NHS method. An adsorption test of a monoclonal autoantibody derived from an ulcerative colitis patient (UC antibody 1 produced in Example 2) was carried out using an adsorbent in which integrin αvβ6 was immobilized on a carrier activated by the formyl method, the epoxy method, or the EAH method. Each carrier was prepared as follows.

[0147] Preparation of formyl group-immobilized carrier: Integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) was mixed with formyl group-activated cellulose (19853: JNC) in a 1:1 volume ratio, and the mixture was mixed by inversion at room temperature for 1 hour. 2 mg of trimethylamine borane (CH ３ ) ３ NBH ３ The mixture was added to the integrin αvβ6 protein solution and mixed by end-over-end mixing at room temperature for 2 hours. This reaction resulted in the formation of a covalent bond between the exposed amino group of the integrin αvβ6 protein and the formyl group of the cellulose carrier, immobilizing the protein on the carrier surface. Furthermore, to block any unreacted formyl groups on the carrier surface, the immobilized carrier was immersed in 200 mM Tris-HCl buffer (pH 7.0) containing 1 M ethanolamine, and mixed by end-over-end mixing at room temperature for 2 hours. After the reaction, the carrier solvent was replaced with a 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution, and the resulting 50% slurry was stored at 4°C.

[0148] Epoxy-activated Sepharose 6B (Cytiva, 17048001) was used as the epoxy-activated support. The required amount of support was weighed, swelled with distilled water, and washed with neutral buffer on a glass filter. The support and integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) were mixed at a 1:1 volume ratio and incubated with shaking at room temperature for 16 hours. After the reaction, the solution was replaced with a 1 M ethanolamine solution at pH 8.0 for blocking and allowed to stand at 40°C for 4 hours. Thereafter, to remove excess reagents and reaction by-products, the mixture was alternately washed with 0.1 M Tris-HCl buffer (pH 8.0, containing 500 mM NaCl) and 0.1 M acetate buffer (pH 4.0, containing 500 mM NaCl), and finally the solution was replaced with 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution, and the mixture was stored at 4°C as a 50% slurry.

[0149] Preparation of EAH-group-immobilized carrier: EAH Sepharose® 4B (Cytiva, 17056901) was used as the EAH-group carrier. The required amount of carrier was placed on a glass filter and washed with distilled water adjusted to pH 4.5 with hydrochloric acid, followed by washing with 500 mM NaCl. The carrier was mixed with integrin αvβ6 solution (500 μg / mL; ACRO Biosystems, IT6-H52E1) at a volume ratio of 2:1 and incubated overnight at 4°C. After the reaction, to remove excess reagents and reaction by-products, the mixture was washed alternately with 0.1 M Tris-HCl buffer (pH 8.0, containing 500 mM NaCl) and 0.1 M acetate buffer (pH 4.0, containing 500 mM NaCl), and finally the solution was replaced with 50 mM Tris-HCl, 150 mM NaCl (pH 7.5) solution, and the mixture was stored at 4°C as a 50% slurry.

[0150] The carrier on which 13 μg of integrin αvβ6 was immobilized or the albumin-immobilized carrier (control) was mixed with 500 ng of a monoclonal autoantibody derived from an ulcerative colitis patient (UC antibody 1), and a reaction was carried out by end-over-end mixing in a total of 500 μL of solution at 4°C for 12 hours, after which the reaction solution was recovered.

[0151] The concentration of anti-integrin αvβ6 antibody in the recovered solution was determined in the same manner as described in Example 7, except that an HRP-labeled anti-human IgG antibody (ab98535, diluted 40,000 times) was used as the labeled antibody, and the adsorption rate of anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated. The results are shown in Table 7.

[0152]

[0153] Example 12. Antibody removal test of immobilized integrin αvβ6 using the avidin-biotin binding method. Integrins with biotin attached to the C-terminus of either subunit (α chain or β chain) can be bound to avidin-immobilized carriers with binding affinity equivalent to that of covalent bonds. In this binding mode, the integrin is immobilized upright on the carrier, which is expected to open the head region, which is thought to be the recognition site for many autoantibodies, and increase the efficiency of interaction with the autoantibody. An adsorption test of a monoclonal autoantibody derived from an ulcerative colitis patient (UC antibody 1 prepared in Example 2) was performed using an avidin-attached carrier on which biotinylated integrin αvβ6 was immobilized.

[0154] (1) Antibody Removal Test of NeutrAvidin Agarose-Immobilized Integrin αvβ6: 400 μL (200 μL as carrier) of NeutrAvidin Agarose (Thermo Fisher Scientific, 29200) was washed with binding buffer (25 mM Tris, 0.15 M sodium chloride, pH 7.2), and then 200 μL (80 μg) of biotinylated integrin αvβ6 (ACRO Biosystems, IT6-H82E4) was added and allowed to stand at room temperature for 15 minutes. The supernatant was then removed, and the immobilized gel was washed with buffer (20 mM Tris, 150 mM NaCl, pH 7.4) and stored at 4°C as a 50% slurry. As a control, biotinylated bovine serum albumin (SIGMA, A8549) was similarly immobilized on NeutrAvidin to prepare an agarose support (BSA). Biotinylated human integrin αvβ6 (ACROBiosystems, product number IT6-H82E4) is a heterodimeric protein comprising an α chain containing the extracellular domain of the human integrin αv chain from Phe at position 31 to Val at position 992 in the amino acid sequence, an acidic tail sequence at its C-terminus, a polyhistidine tag, and an Avi tag (registered trademark), and a β chain containing the extracellular domain of the human integrin β6 chain from Gly at position 22 to Asn at position 707 in the amino acid sequence, and a basic tail sequence at its C-terminus.

[0155] 500 ng of anti-integrin αvβ6 antibody (UC antibody 1) was mixed with 10 μL or 30 μL of the above-mentioned carrier-immobilized integrin αvβ6 or BSA (immobilized amount: 2 μg or 7 μg, respectively) to a total volume of 500 μL, and the mixture was mixed by end-over-end mixing for 12 hours at 4° C. After the reaction, the mixture was allowed to stand and then the solution was recovered.

[0156] The concentration of anti-integrin αvβ6 antibody contained in the recovered solution was determined in the same manner as described in Example 7, except that an HRP-labeled anti-human IgG antibody (40,000-fold diluted; ab98535; Abcam) was used as the labeled antibody, and the adsorption rate of anti-integrin αvβ6 antibody in the antibody adsorption reaction was calculated using the following formula. In this example, the antibody concentration before the adsorption reaction (pre-antibody concentration) was 1 μg / mL (= 500 ng / 500 μL). The results are shown in Figure 15. Adsorption rate (%) = [{(pre-antibody concentration before adsorption reaction) - (antibody concentration of adsorbed sample)} / (pre-antibody concentration before adsorption reaction)] x 100

[0157] As a result, the antibody adsorption rates of the adsorbents onto which 2 μg and 7 μg of integrin αvβ6 were immobilized were 48% and 88%, respectively (Figure 15). The adsorption rate of the support onto which BSA was immobilized (control) was a maximum of 14%. This indicates that the anti-integrin αvβ6 antibody was specifically adsorbed onto the integrin αvβ6-immobilized support.

[0158] (2) Antibody Removal Test of Immobilized Integrin αvβ6 Using Various Carriers or Various Avidins Cellulose and PMMA carriers were prepared as carriers other than agarose in the same manner as described in Example 10, and 1 mg of NeutrAvidin (Thermo Fisher) was immobilized per 100 μL of carrier. Furthermore, StreptAvidin agarose (Thermo Fisher), which is StreptAvidin-immobilized agarose, and Avidin agarose (Thermo Fisher), which is Avidin-immobilized agarose, were used as immobilization carriers using various avidins other than NeutrAvidin.

[0159] Using these carriers thus obtained, biotinylated integrin αvβ6 (ACRO Biosystems, IT6-H82E4) was immobilized and an antibody adsorption test was performed as described in Example 12(1) above. The results are shown in Table 8. For comparison, Table 6 also shows the adsorption rate of integrin αvβ6 immobilized on NeutrAvidin agarose as shown in Example 12(1) above.

[0160]

[0161] (3) Comparison of the avidin-biotin method and the covalent binding method A monoclonal antibody adsorption test was carried out under the conditions described in Example 12(1) above using the adsorbent in which biotinylated integrin αvβ6 was immobilized on NeutrAvidin-immobilized agarose prepared in Example 12(1) above and the adsorbent in which integrin αvβ6 was immobilized on NHS mag Sepharose (Cytiva) prepared in Example 9, and their performances were compared. The results are shown in Figure 16.

[0162] As is clear from FIG. 16, the adsorbent in which biotinylated integrin αvβ6 was immobilized on NeutrAvidin-immobilized agarose had superior antibody adsorption performance to the adsorbent in which the integrin was immobilized by covalent bonding.

[0163] Example 13 Antibody Removal Test Using a Circulation Column Using a column packed with the NeutrAvidin-biotinylated integrin αvβ6-immobilized agarose adsorbent prepared in Example 12, a circulation adsorption test was carried out on a monoclonal autoantibody solution derived from an ulcerative colitis patient.

[0164] Circulation column: Figure 16 shows an example of a circulation column. A 10 mL solution (antibody concentration: 1 μg / mL) containing 10 μg of a monoclonal autoantibody derived from an ulcerative colitis patient (UC antibody 1 prepared in Example 2) and 0.1 g of human serum albumin (SIGMA, A8549) was prepared. The antibody solution was circulated using a peristaltic pump and passed through a column containing agarose adsorbent immobilized with biotinylated integrin αvβ6 (10 μg), prepared in the same manner as in Example 12. The antibody solution was collected every 30 minutes during circulation. As a control, a similar test was performed using an adsorbent immobilized with 10 μg of biotinylated bovine serum albumin (SIGMA, A8549).

[0165] Measurement of anti-integrin αvβ6 antibody concentration: The anti-integrin αvβ6 antibody concentration in the solution sampled during the circulation test and in the solution after the inversion reaction was measured by ELISA. A microtiter plate was coated with 100 μL / well of 2 μg / mL integrin αvβ6 overnight at 4°C, followed by washing and blocking. After washing, the column-passed sample was diluted 10-fold and added at 100 μL / well and incubated at room temperature for 60 minutes. After washing, 100 μL / well of HRP-labeled anti-human IgG antibody (40,000-fold dilution; ab98535; Abcam) was added and incubated at room temperature for 60 minutes. After washing, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 7 minutes, and the absorbance density (OD value) at 450 nm was measured to detect human IgG bound to integrin αvβ6 on the solid phase.

[0166] Conversion of anti-integrin αvβ6 antibody concentration: UC antibody 1 (see Table 1) prepared in Example 2, diluted 1 to 0.001 μg / mL at a 3-fold common ratio, was added to a microtiter plate on which 2 μg / mL integrin αvβ6 had been solidified, and the plate was incubated at room temperature for 60 minutes. After washing the plate, 100 μL / well of HRP-labeled anti-human IgG antibody (40,000-fold dilution; ab98535; Abcam) was added as a secondary antibody. After incubation at room temperature for 60 minutes, the plate was incubated with 3,3',5,5'-tetramethylbenzidine for 7 minutes, and the absorbance density (OD value) at 450 nm was measured. A calibration curve was then created to calculate the anti-integrin αvβ6 antibody concentration from the OD value. This calibration curve was used to determine the anti-integrin αvβ6 antibody concentration in the solution subjected to the antibody adsorption reaction. The adsorption rate of autoantibodies was calculated by dividing the amount of autoantibodies reduced after passing through each column by the amount of autoantibodies after passing through a dummy column (not filled with adsorbent) (referred to as "pass-through") based on the following formula: Adsorption rate (%) = [(antibody concentration in pass-through) - (antibody concentration in adsorbed sample)} / (antibody concentration in pass-through)] x 100

[0167] Results: The results are shown in Figures 18-1 and 18-2. As shown in Figures 18-1 and 18-2, the antibody solution sample circulated through the integrin αvβ6-immobilized adsorbent was adsorbed over time, with the adsorption rate reaching 50% after 3 hours. Approximately 5 μg of anti-integrin αvβ6 antibody in the antibody solution was adsorbed to 10 μg of integrin αvβ6 immobilized on the carrier. In the control (BSA), almost no adsorption of anti-integrin αvβ6 antibody was observed during 3 hours of circulation. This demonstrates that the anti-integrin αvβ6 antibody was specifically removed by the integrin αvβ6-immobilized adsorbent in the column.

[0168] Example 14: Measurement of anti-integrin αvβ6 antibody levels in patient serum Based on the anti-integrin αvβ6 antibody concentration measurement and conversion method described in Example 7, the anti-integrin αvβ6 antibody concentrations in the serum of UC (n = 8) and PSC (n = 13) patients were quantified. As a result, the average anti-integrin αvβ6 antibody levels in the serum of UC and PSC patients were approximately 5.8 μg / mL and 8.0 μg / mL, respectively (Table 9). Of the 21 patient serum samples measured, 17 patients had levels of 10 μg / mL or less.

[0169]

[0170] Example 15: Verification of the direct pathological effects of anti-integrin αvβ6 antibodies (1) Using serum derived from human UC patients or PSC patients, we investigated whether disease characteristics could be reproduced by passively transferring anti-integrin αvβ6 antibodies to animals. The amounts of anti-integrin αvβ6 antibodies contained in the serum derived from UC patients, PSC patients, and control (healthy) serum used in this example are shown in the table below.

[0171]

[0172] One-week-old mice (Balb / c, C57BL / 6) were subcutaneously injected with UC patient serum, PSC patient serum, or healthy control serum (2 ml / animal). After 24 hours, the mice were sacrificed, and the colon and bile duct were examined by hematoxylin-eosin (HE) staining. Administration of UC patient serum resulted in crypt disorganization and cellular infiltration in the colon (Figure 19). Administration of PSC patient serum also resulted in cellular infiltration around the bile duct (Figure 20).

[0173] Eight-week-old mice (Balb / c, C57BL / 6) were administered 1% DSS for three weeks, followed by a three-week treatment break. The above dose of DSS was sufficient to induce mild intestinal inflammation, and a three-week treatment break was considered sufficient to completely resolve the inflammation. Then, 1 ml of serum from UC patients, PSC patients, or healthy control serum was administered subcutaneously into the back of the mice three times every 24 hours. 24 hours after the final administration, mice were sacrificed, and their colons and bile ducts were examined by HE staining. Both UC and PSC serum treatments demonstrated significant cellular infiltration in the submucosa of the colon, as well as disrupted crypts, compared with controls (Figure 21). Furthermore, PSC serum treatment induced significant fibrosis around the bile duct (Figure 22).

[0174] These results suggest that the presence of anti-integrin αvβ6 antibodies in UC and PSC patient sera contributes to the pathogenesis of UC and PSC. Furthermore, we found that administration of UC or PSC patient sera can produce animal models that exhibit the symptoms of UC or PSC.

[0175] Example 16: Verification of direct pathological effects of anti-integrin αvβ6 antibody 2 We verified whether the characteristics of UC could be reproduced by passive transfer of anti-integrin αvβ6 monoclonal antibody derived from a human UC patient to an animal.

[0176] Mice (B6 wild-type) were administered 10 mg / mouse of UC antibody 3 or UC antibody 4 (see Table 1) prepared in Example 2 or a control healthy donor IgG (Fujifilm Wako Pure Chemical Industries, Ltd., 149-09503) by subcutaneous injection twice weekly into the back for three weeks. Twenty-four hours after the final administration, the mice were sacrificed, and their colons were examined by HE staining. Cell infiltration was observed in the colons of mice administered the anti-integrin αvβ6 monoclonal antibody. The results for administration of UC antibody 4 are shown in Figure 23. On the other hand, no abnormalities were observed in the colons of mice administered the control antibody (Figure 23).

[0177] Mice (B6 wild-type) were administered 1% DSS for three weeks, followed by a six-week treatment break. Then, both UC antibody 3 and UC antibody 4 prepared in Example 2, or UC antibody 3 or UC antibody 4 (see Table 1), or control healthy donor IgG (Fujifilm Wako Pure Chemical Industries, Ltd., 149-09503) were administered subcutaneously twice weekly in the back for three weeks. Mice were sacrificed 24 hours after the final administration, and their colons were examined by HE staining. Significant cell infiltration and crypt twisting were observed in the colons of mice administered anti-integrin αvβ6 monoclonal antibodies (both UC antibody 3 and UC antibody 4, or either one). The results for the administration of both UC antibody 3 and UC antibody 4 are shown in Figure 24. In contrast, no abnormalities were observed in the colons of mice administered the control antibody (Figure 24).

[0178] Thus, administration of anti-integrin αvβ6 monoclonal antibodies derived from UC patients to mice was shown to result in pathology similar to UC. Thus, the pathogenicity of anti-integrin αvβ6 monoclonal antibodies derived from UC patients was demonstrated, and it was shown that the presence of these antibodies leads to the onset of UC pathology. Furthermore, it was found that administration of anti-integrin αvβ6 monoclonal antibodies derived from UC patients can produce model animals exhibiting UC symptoms. Furthermore, based on the results of this example and Example 14, it was found that anti-integrin αvβ6 antibodies derived from PSC patients also lead to the onset of PSC pathology, and that administration of these antibodies can produce PSC model animals.

Claims

1. A therapeutic system for ulcerative colitis or primary sclerosing cholangitis, comprising means for removing an anti-integrin αvβ6 antibody or anti-integrin αvβ6 antibody-producing B cells that produce the anti-integrin αvβ6 antibody, which has competitive activity with fibronectin for binding to integrin αvβ6 and is specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis.

2. The system according to claim 1, wherein the means includes an anti-integrin αvβ6 antibody or a substance that specifically binds to anti-integrin αvβ6 antibody-producing B cells.

3. The system according to claim 2, wherein the substance is a fragment or the whole of the integrin αvβ6 protein.

4. The system according to claim 3, comprising a column supporting a fragment or the whole of the integrin αvβ6 protein.

5. A solid carrier for the treatment of ulcerative colitis or primary sclerosing cholangitis, which carries a fragment or the whole of an integrin αvβ6 protein that has competitive activity with fibronectin for binding to integrin αvβ6 and is specifically produced in subjects suffering from ulcerative colitis or primary sclerosing cholangitis, or an anti-integrin αvβ6 antibody-producing B cells that produce said anti-integrin αvβ6 antibody, thereby enabling adsorption of said anti-integrin αvβ6 antibody or said anti-integrin αvβ6 antibody B cells.

6. The solid carrier according to claim 5, wherein the fragment or whole of the integrin αvβ6 protein has a binding-dissociation constant (KD value) of 100 nM or less when used with the anti-integrin αvβ6 antibody, which contains one amino acid sequence of RGD, RGRD, or RGSGD in the CDR2 or CDR3 of the heavy chain.

7. The solid carrier according to claim 5 or 6, wherein the integrin αvβ6 protein is immobilized in an amount equal to or greater than twice the weight of the captured antibody, or the fragment of the αvβ6 protein is immobilized in an amount equal to or greater than twice the weight of the captured antibody multiplied by the ratio of the fragment to the total molecular weight of the integrin αvβ6.

8. A column comprising a solid carrier as described in claim 5.

9. The column according to claim 8, comprising the solid carrier such that the amount of fragments or the whole of the integrin αvβ6 protein per column is such that the integrin αvβ6 protein is at least twice the weight of the captured antibody, or the fragments of the αvβ6 protein are at least twice the weight of the captured antibody multiplied by the ratio of the fragments to the total molecular weight of the integrin αvβ6.

10. The column according to claim 8 or 9, which is for apheresis.

11. A method for producing an animal model of primary sclerosing cholangitis, comprising immunizing a non-human animal with a fragment or the whole of the integrin αvβ6 protein.

12. A method for creating an animal model of primary sclerosing cholangitis, which involves knocking out the integrin β6 gene in a non-human animal.

13. A method for producing an animal model of ulcerative colitis or primary sclerosing cholangitis, comprising administering an anti-integrin αvβ6 antibody derived from a patient with ulcerative colitis or primary sclerosing cholangitis to a non-human animal.

14. The method for producing according to claim 13, wherein the antibody is serum or a monoclonal antibody.

15. An animal model of ulcerative colitis exhibiting symptoms of the disease.

16. An animal model of primary sclerosing cholangitis exhibiting symptoms of primary sclerosing cholangitis.

17. The primary sclerosing cholangitis model animal according to claim 16, which is a knockout mouse lacking the function of integrin αvβ6.