Oligonucleotide production method

Abstract

The present invention provides: an oligonucleotide production method comprising a step for reacting an n-polymerized oligonucleotide (n represents an arbitrarily defined integer of two or more) and water or an aqueous solution having a pH of 1-8 to degrade branch bodies; and an oligonucleotide in which the content proportion of branch bodies in the oligonucleotide is at a certain amount or less.

Description

Methods for producing oligonucleotides

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2022-208672 (filed December 26, 2022), the entire contents of which are incorporated herein by reference.

[0002] The present invention relates to a method for producing oligonucleotides, which comprises selectively degrading branched bodies, which are impurities in synthetic oligonucleotides, under mild conditions.

[0003] In recent years, there has been growing interest in the application of nucleic acid molecules in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are called nucleic acid drugs.

[0004] Oligonucleotides can be synthesized using the phosphoramidite method (hereinafter referred to as the "amidite method"). For oligonucleotides containing ribose, the protecting group of the hydroxyl group at the 2'-position of the ribose is removed by deprotection to produce the desired oligonucleotide.

[0005] Branched oligonucleotides are known to be a major impurity in the production of synthetic oligonucleotides (see Non-Patent Document 1). Branched oligonucleotides are formed by linking oligonucleotides to the base moiety of a nucleotide via a phosphoramidate bond. The formation of branched oligonucleotides presents a problem of reduced yield and purity of the desired synthetic oligonucleotide.

[0006] Known methods for decomposing branched bodies include, for example, mixing triethylamine trihydrofluoride with the branched body to decompose the branched body (see Non-Patent Document 2). Another known method for decomposing phosphoramidate bonds is using 80% aqueous acetic acid (see Non-Patent Document 3). However, these methods require harsh reaction conditions, and the target oligonucleotide is also decomposed. Therefore, there is a need for a method for selectively decomposing branched bodies under milder conditions.

[0007] Mass Spectrometry, Reviews 2021, 40, 75-109Oligonucleotides 2006, 16, 181-185J. Org. Chem., 1970, 35, 3800-3803

[0008] The present invention aims to provide a method for producing oligonucleotides with a reduced content of branch bodies, which comprises treating the oligonucleotides under mild conditions to decompose branch bodies as by-products.

[0009] As a result of extensive research to achieve the above object, the present inventors have found that selective degradation of branched bodies proceeds, improving the yield and purity of the resulting oligonucleotide, by reacting an oligonucleotide with water or an aqueous solution having a pH of 1 to 8. As a result, the present invention provides a method for producing an oligonucleotide, which comprises the step of reacting an n-mer oligonucleotide (n is any integer of 2 or greater) with water or an aqueous solution having a pH of 1 to 8 to degrade the branched bodies, and an oligonucleotide in which the content of branched bodies in the oligonucleotide is a certain amount or less.

[0010] The present invention encompasses, but is not limited to, the following aspects. [1] A method for producing an oligonucleotide, comprising the step of reacting an n-mer oligonucleotide (n is any integer of 2 or greater) with water or an aqueous solution having a pH of 1 to 8 to degrade branched bodies. [2] The method for producing the oligonucleotide according to [1], wherein the step of degrading the branched bodies comprises a reaction of selectively cleaving the phosphoramidate bond of the branched bodies. [3] The method for producing the oligonucleotide according to either [1] or [2], wherein crude oligonucleotide obtained after solid-phase synthesis is used as a starting material. [4] The method for producing the oligonucleotide according to any one of [1] to [3], wherein the step of degrading the branched bodies comprises mixing an n-mer oligonucleotide (n is any integer of 2 or greater) with water or an aqueous solution having a pH of 1 to 8 and reacting for 10 minutes or more. [5] The method according to any one of [1] to [4], wherein the reaction temperature is 0 to 60°C. [6] The method according to any one of [1] to [5], wherein the water or aqueous solution having a pH of 1 to 8 contains acetic acid or an acetate salt. [7] The manufacturing method according to any one of [1] to [5], wherein the water or aqueous solution having a pH of 1 to 8 is a Tris-HCl buffer having a pH of 7 to 8. [8] The manufacturing method according to any one of [1] to [5], wherein the water or aqueous solution having a pH of 1 to 8 is water. [9] The manufacturing method according to any one of [1] to [8], wherein the n-mer oligonucleotide is an n-mer oligonucleotide containing a nucleotide having a 2'-OMe.

[10] The manufacturing method according to any one of [1] to [9], wherein the n-mer oligonucleotide is an n-mer oligonucleotide containing a nucleotide having a 2'-OH.

[11] The manufacturing method according to any one of [1] to

[10] , wherein the pH of the aqueous solution is 1 to 2 and the reaction temperature is 0 to 30°C.

[12] The manufacturing method according to any one of [1] to

[10] , wherein the pH of the aqueous solution is 3 to 4 and the reaction temperature is 0 to 50°C.

[13] The method according to any one of [1] to

[10] , wherein the pH of the aqueous solution is 5 to 8 and the reaction temperature is 20 to 60°C.

[14] An oligonucleotide having a branched form content ratio of 15% or less relative to the full-length oligonucleotide (FLP).

[15] An oligonucleotide having a branched form content ratio of 5% or less relative to the FLP.

[16] An oligonucleotide having a chain length of 50 or more, having a branched form content ratio of 5% or less relative to the FLP.

[17] An oligonucleotide having a chain length of 100 or more, having a branched form content ratio of 5% or less relative to the FLP.

[18] The production method according to any one of [1] to

[13] , wherein the oligonucleotide is RNA.

[19] The oligonucleotide according to any one of

[14] to

[17] , wherein the oligonucleotide is RNA.

[0011] The present invention provides a method for producing an oligonucleotide, characterized in that selective decomposition of branched bodies, which are reaction by-products, proceeds efficiently by reacting the oligonucleotide with water or an aqueous solution having a pH of 1 to 8. The production method of the present invention is expected to improve the yield and purity of the produced oligonucleotide.

[0012] FIG. 1 is a scheme A showing a typical example of producing a nucleic acid oligomer represented by formula (5) from a nucleic acid oligomer represented by formula (1) by the phosphoramidite method.

[0013] According to one embodiment of the present invention, the present invention relates to a method for producing an oligonucleotide, comprising the step of reacting an n-mer oligonucleotide (n is any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 to decompose branched oligonucleotides.

[0014] According to one embodiment of the present invention, a representative reaction scheme for the decomposition reaction of the branched body of the present invention is shown below. In the formula, each "Base" is independently the same or different and represents a nucleic acid base; each Y is independently the same or different and represents an oxygen atom or a sulfur atom; each R is independently the same or different and represents a hydrogen atom, a fluorine atom, or an OQ group; each Q is independently the same or different and represents a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, or an ethylidene group bonded to the carbon atom at the 4' position of ribose; and R １ are each independently the same or different and represent a hydrogen atom or an alkyl group, but are not limited thereto.

[0015] As used herein, the term "branched body" refers to a by-product in the production of synthetic oligonucleotides, a compound in which an oligonucleotide is linked via a phosphoramidate bond at the base moiety of the nucleotide reactant, and also includes compounds in which one or more nucleotides are further polymerized to the nucleotide of the compound. Branched bodies are contained in the crude reaction product containing the oligonucleotide produced after the synthetic oligonucleotide production reaction. As used herein, the terms "crude oligonucleotide" or "crude oligonucleotide oligomer" also refer to a mixture containing the oligonucleotide and branched body after the synthesis reaction.

[0016] As used herein, the term "degrading a branch body" means cleaving the phosphoramidate bond at the base portion of the branch body. As used herein, the term "selectively degrading a branch body" means selectively cleaving the phosphoramidate bond at the base portion of the branch body without cleaving the phosphorodiester bond or phosphorothioate bond in the desired target oligonucleotide.

[0017] As used herein, the term "water or aqueous solution having a pH of 1 to 8" specifically includes water or an aqueous solution of an acid or a salt thereof having a pH of 1 to 8. Examples of aqueous solutions include an aqueous solution containing an organic acid or a salt thereof, and an aqueous solution containing an inorganic acid or a salt thereof. Specific examples include, but are not limited to, an aqueous solution containing acetic acid or an acetate salt (e.g., sodium acetate, ammonium acetate, potassium acetate, calcium acetate), and Tris-HCl buffer. Examples of water include, but are not limited to, UF water (ultrafiltered water). Examples of aqueous solutions having a pH of 1 to less than 6.8 include an aqueous solution of acetic acid or an acetate salt. Examples of UF water having a pH of 6.8 include. Examples of aqueous solutions having a pH of more than 6.8 but not more than 8 include Tris-HCl buffer.

[0018] In the present invention, the reaction conditions for the "step of reacting an n-mer oligonucleotide (n is any integer of 2 or greater) with water or an aqueous solution having a pH of 1 to 8 to degrade the branched oligonucleotide" require mixing the n-mer oligonucleotide (n is any integer of 2 or greater) with water or an aqueous solution having a pH of 1 to 8 and allowing the reaction to proceed for a certain period of time or longer. The reaction time may vary depending on the oligonucleotide reactant used, the water or aqueous solution having a pH of 1 to 8, the reaction temperature, and the like, and is not particularly limited as long as the conditions allow sufficient decomposition of the branched oligonucleotide; however, a reaction time of 10 minutes or longer is preferred, for example. Specific examples of the reaction time include several tens of minutes to several weeks, such as 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours (2 days), 72 hours (3 days), 1 week, several weeks, 1 month, and several months. Considering the stability of the resulting oligonucleotide in water or an aqueous solution having a pH of 1 to 8, a shorter reaction time is preferable, for example, at least 10 minutes or more, 30 minutes or more, or 60 minutes or more, while at least 1 week or less, 72 hours or less, 24 hours or less, and 12 hours or less are examples. Specific reaction times include, for example, 30 minutes to 1 week, 2 hours to 72 hours, and 6 hours to 24 hours, and a more preferred embodiment is 30 minutes to 24 hours.

[0019] The reaction temperature may vary depending on the oligonucleotide reactant used, the water or aqueous solution having a pH of 1 to 8, the reaction time, etc., and is not particularly limited as long as the conditions allow sufficient decomposition of the branched body. However, taking into consideration the stability of the resulting oligonucleotide, a lower reaction temperature is preferable. Specific examples include 0°C or higher, room temperature or higher (e.g., 25°C or higher), 40°C or higher, and 50°C or higher, as well as 60°C or lower, 50°C or lower, and 40°C or lower. Specific reaction temperatures include, for example, 0°C to 60°C, 10 to 60°C, 20 to 60°C, 20 to 50°C, and 20 to 40°C.

[0020] The reaction conditions for the decomposition reaction of the branch body, with respect to the relationship between pH and reaction temperature, include, but are not limited to, conditions in which the pH of the aqueous solution is 1 to 2 and the reaction temperature is 0 to 30°C, conditions in which the pH of the aqueous solution is 3 to 4 and the reaction temperature is 0 to 50°C, and conditions in which the pH of the aqueous solution is 5 to 8 and the reaction temperature is 20 to 60°C.

[0021] Examples of reaction conditions for the decomposition reaction of the branched bodies include, but are not limited to, conditions in which the pH of the aqueous solution is 1 to 2, the reaction temperature is 0 to 30°C, and the reaction time is 10 minutes to 12 hours (e.g., 30 minutes to 2 hours); conditions in which the pH of the aqueous solution is 3 to 4, the reaction temperature is 0 to 50°C, and the reaction time is 6 to 48 hours (e.g., 12 to 24 hours); and conditions in which the pH of the aqueous solution is 5 to 8, the reaction temperature is 20 to 60°C, and the reaction time is 48 hours to several weeks (e.g., 24 hours to 1 week).

[0022] As for the reaction conditions for the decomposition reaction of branch bodies, generally, under more acidic pH conditions, the decomposition reaction proceeds faster, the reaction temperature is lower, and the reaction time is shorter, while under closer to neutral pH conditions, the decomposition reaction proceeds slower, the reaction temperature is higher, and the reaction time is longer.

[0023] The term "branch body" used herein refers to a compound represented by the formula (A) above, R １is a hydrogen atom, an alkyl group (for example, a methyl group, an ethyl group), etc., but is not limited to these.

[0024] As used herein, the term "n-mer oligonucleotide (n is any integer of 2 or more)" refers to a polymerized oligonucleotide in which n nucleotides (n is any integer of 2 or more) are polymerized via a phosphorodiester bond or a phosphorothioate bond at the 5'-end and 3'-end of a general nucleotide. The specific structure of the n-mer oligonucleotide is not particularly limited, and examples include oligonucleotides containing nucleotides having 2'-OMe and oligonucleotides containing nucleotides having 2'-OH.

[0025] In this specification, an "oligonucleotide" may also be referred to as a "nucleic acid oligomer," and a "nucleotide" may also be referred to as a "nucleic acid molecule."

[0026] In this specification, the crude oligonucleotide to be subjected to the branched body degradation reaction may be a commonly known crude oligonucleotide after liquid phase synthesis before purification, for example, a crude oligonucleotide with protected nucleic acid bases, or a crude oligonucleotide with deprotected nucleic acid bases before purification. Alternatively, it may be a crude oligonucleotide after solid phase synthesis before purification, for example, a crude oligonucleotide with protected nucleic acid bases, or a crude oligonucleotide with deprotected nucleic acid bases before purification. A crude oligonucleotide after solid phase synthesis is preferred.

[0027] In this specification, the nucleosides (ribose and deoxyribose) contained in the nucleic acid molecules of the oligonucleotides may include both synthetic DNA and RNA, but preferably RNA.

[0028] The chain length (N) of the oligonucleotide is not particularly limited, and may be, for example, 2 or more chain lengths (mers), 3 or more chain lengths, 5 or more chain lengths, 10 or more chain lengths, 20 or more chain lengths, 30 or more chain lengths, 40 or more chain lengths, 50 or more chain lengths, 60 or more chain lengths, 80 or more chain lengths, 100 or more chain lengths, 150 or more chain lengths, 200 or more chain lengths, 250 or more chain lengths, 300 or more chain lengths, 2 or more to 300 or less chain lengths, 2 or more to 200 or less chain lengths, 10 or more to 300 or less chain lengths, 10 or more to 200 or less chain lengths, 10 or more to 100 or less chain lengths, Examples include, but are not limited to, from 100 to 150 chain lengths, from 20 to 300 chain lengths, from 20 to 200 chain lengths, from 20 to 100 chain lengths, from 50 to 300 chain lengths, from 50 to 200 chain lengths, from 50 to 100 chain lengths, from 80 to 300 chain lengths, from 80 to 250 chain lengths, from 80 to 200 chain lengths, from 100 to 300 chain lengths, from 100 to 250 chain lengths, and from 100 to 200 chain lengths.

[0029] The content ratio of branched bodies in the oligonucleotide obtained by the branched body selective degradation step of the present invention is 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less, relative to the full-length polymer (FLP), and is preferably 5.0% or less, less than 5.0%, 4.5% or less, 4.1% or less, 4.0% or less, 3.5% or less, 3.4% or less, 3.0% or less, 2.5% or less, 2.2% or less, 2.0% or less, 1.5% or less, or 1.0% or less, but is not limited to these. The content ratio of branched bodies is determined by analyzing a predetermined amount of a sample of crude oligonucleotide or crude oligonucleotide oligomer by high-performance liquid chromatography (HPLC). Here, the content of branched oligonucleotides relative to the full length product (FLP) in the oligonucleotide, i.e., the content (%) of branched oligonucleotides when the content of full length product (FLP) in the oligonucleotide is taken as 100%, is defined as the "branched oligonucleotide content ratio."

[0030] Analysis of branched bodies by HPLC is typically performed using an oligonucleotide HPLC column (e.g., DNAPac™ from Thermo Fisher). ＴＭ The mobile phase is, for example, a Tris-HCl buffer, a CH 3 buffer containing urea, etc. ３ CN solution was used, and NaClO was used as mobile phase B. ４ , Tris-HCl buffer, CH containing urea ３ The gradient is carried out using a CN solution. The UV detection wavelength is typically 260 nm.

[0031] Next, a method for producing a nucleic acid molecule by the phosphoramidite method (amidite method) will be described.

[0032] An example of a precursor having a phosphite triester bond is a nucleic acid compound represented by formula (4). In the formula, G １ represents a protecting group for a hydroxyl group, ２ are each independently the same or different and represent a hydroxyl-protecting group; a are each independently the same or different and represent a nucleobase which may be protected by a protecting group; R are each independently the same or different and represent a protected hydroxyl group, hydrogen atom, fluorine atom, methoxy group, 2-methoxyethyl group, OQ' group, or NQ' group; and Q' are each independently the same or different and represent an alkylene group or a carbonyl group bonded to the carbon atom at the 4'-position of ribose.

[0033] In formula (4), when R represents an OQ′ group or an NQ′ group, and Q′ represents an alkylene group or a carbonyl group bonded to the carbon atom at the 4′-position of ribose, specific examples of the structure include LNA-1 to LNA-7 of formula (10) below. (In the formula, B a represents an optionally protected nucleic acid base, and R' represents a hydrogen atom or a methyl group.

[0034] Examples of nucleotide units contained in the nucleic acid molecules used in the present invention include, but are not limited to, DNA, RNA, 2'-O-Me, 2'-F, 2'-O-MOE (2'-O-methoxyethyl), UNA, morpholino nucleic acid, and LNA.

[0035] More specifically, the group represented by Z, which is composed of a solid phase carrier and a linking moiety connecting the solid phase carrier and the oxygen atom of the hydroxyl group at the 2'- or 3'-position of ribose at the 3'-end of a nucleic acid oligomer (also referred to as an "oligonucleotide"), includes a structure represented by the following formula (11): In formula (11), Sp represents a spacer. Examples of the spacer (Sp) include those having the structural formula shown in formula (12) below.

[0036]

[0037] The linker may have, for example, a structure shown in the following formula (13), or a structure in which the structure of formula (13) does not have a hexamethyleneamino group portion and an aminopropyl group is bonded to Si. Alternatively, the linker may have a structure shown in the following formula (14). (In the formula, A may be any of a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include a methoxy group and an ethoxy group. Examples of alkyl groups include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.) Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene.

[0038] The various steps in the synthesis of nucleic acid molecules by solid phase synthesis can be carried out under air atmosphere, but are preferably carried out under an inert gas (for example, nitrogen or argon) atmosphere.

[0039] A method for synthesizing a nucleic acid molecule by solid-phase synthesis typically includes the following steps: (1) deprotecting the 5'-hydroxyl group of a hydroxyl-protected nucleoside bound to a solid-phase support via a linker, (2) coupling the 5'-hydroxyl group produced in the previous step with an amidite to obtain a phosphite triester compound, (3) oxidizing the phosphite triester produced in the previous step to convert it into a phosphate triester to produce an elongated nucleic acid molecule, (4) repeating a series of reaction cycles consisting of steps (1) to (3), i.e., the deprotection of the 5'-hydroxyl group of the produced nucleic acid molecule, the coupling of the 5'-hydroxyl group with an amidite compound, and the oxidation of the produced phosphite triester, any number of times to synthesize a nucleic acid molecule on a solid-phase support, (5) subjecting the nucleic acid molecule on the solid-phase support produced in step (4) to excision and deprotection steps to release it from the solid-phase support to produce a nucleic acid molecule from which the protecting groups have been removed, and (6) A step of deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the 3'-end of the ribose constituting the nucleic acid molecule, provided that the method for synthesizing a nucleic acid molecule may include, following step (2) or (3), a step of capping the hydroxyl group at the 5'-position that has not undergone the coupling reaction with the amidite, or a capping step may be added between any of the steps in the series of reaction cycles constituting step (4).

[0040] More specifically, the step (5) involves subjecting the nucleic acid molecule on the solid support produced in step (4) to the following steps (5-1) and (5-2) in this order. The step (5-1) reaction may be performed arbitrarily, and the step (5-2) reaction may be performed using the method described in Japanese Patent No. 4705716. As a result, a nucleic acid molecule from which a protecting group has been removed from the nucleic acid molecule released from the solid support, or a nucleic acid molecule in which the hydroxyl group at the 5'-end is protected, can be produced. (5-1) A reaction to deprotect the protecting group of the hydroxyl group at the 5'-end of the nucleic acid molecule; (5-2) A reaction to cleave and release the nucleic acid molecule from the solid support, and a reaction to deprotect the protecting groups of the nucleic acid bases.

[0041] More specifically, the step (6) is carried out by subjecting the nucleic acid molecule obtained in step (5), which has been released from the solid phase support and from which the protecting groups have been removed, to the deprotection reaction in the following step (6): (6) A reaction for deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the 3'-end of the ribose constituting the nucleic acid molecule.

[0042] The scheme of the steps (1) to (6) is shown in Scheme A of Figure 1. The synthesis of a nucleic acid compound by the amidite method in the steps (1) to (5) can be carried out by repeating each of the deprotection step and the condensation step according to a generally known method (for example, the method described in the above-mentioned Japanese Patent No. 5,157,168 or Japanese Patent No. 5,554,881), thereby carrying out a nucleic acid extension reaction.

[0043] Each step will be described below. Among the substituents in the chemical formula in Scheme A, G １ , G ２ , B ａ The definitions of R and G are as defined above. ３ , G ４ , G ５ , B ｃ The definitions of R and R' are as described below. In addition, in the chemical formula of Scheme A, Y's are each independently the same or different and represent an oxygen atom or a sulfur atom, X represents an R group or an OZ group, wherein Z is as defined above, W represents an OZ group when X represents an R group, wherein Z is as defined above, or W represents an OV group when X represents an OZ group, wherein V represents a protecting group for a hydroxyl group, W may also contain a group derived from a W group (e.g., a residue cleaved from a solid phase support, a deprotected group, etc.), X may also contain a group derived from an X group (e.g., a residue cleaved from a solid phase support, a deprotected group, etc.), n represents an integer of 1 or more and 300 or less, and m represents an integer of 1 or more and 300 or less.

[0044] G １ There are no particular limitations on the protecting group, so long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used.

[0045] G １ is preferably the following group: (In the formula, R １ , R ２ and R ３ are each independently the same or different and represent hydrogen or an alkoxy group.

[0046] R １ , R ２ and R ３ Preferably, one of the groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0047] G ２ There are no particular limitations on the protecting group G as long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used. ２ Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0048] G ２ is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0049] G ２ Particularly preferred as the alkyl group is a 2-cyanoethyl group (a group represented by the following formula).

[0050] G ３is two G 3 may be bonded to each other to form a cyclic structure. ３ Preferably, both of the groups are isopropyl groups.

[0051] The R １ , R ２ , R ３ , G ２ , and G ３ The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and n-hexyl. The alkyl group moiety constituting the alkoxy group in the definition of the substituent has the same definition as the alkyl group herein.

[0052] As used herein, the term "nucleobase" refers to a group having a natural or non-natural nucleobase backbone, and also encompasses modified forms of the natural or non-natural nucleobase backbone.

[0053] B ａ The nucleobase that may be protected with a protecting group represented by the formula (I) is not particularly limited. Examples of the nucleobase include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleobase may also be substituted with a substituent. Examples of such substituents include halogen atoms such as fluoro, chloro, bromo, and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0054] When a nucleic acid base has an amino group at the exocyclic position, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene, as well as combinations of two or more of these protecting groups.

[0055] B ａ More specifically, examples of the nucleic acid base represented by the formula (I) include the following structures:

[0056] (In the above formula, R ４ represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group; R ５ represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group; R ６ represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R ７ represents a 2-cyanoethyl group, R ８ represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, and R ９ represents a dimethylaminomethylene group.

[0057] In the method of the present invention, the amidite can be used in its free state or in its salt state. Examples of amidite salts include, but are not limited to, base addition salts and acid addition salts. Specific examples of base addition salts include salts with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, and aluminum salts; salts with organic bases such as methylamine, ethylamine, and ethanolamine; salts with basic amino acids such as lysine, ornithine, and arginine; and ammonium salts. Specific examples of acid addition salts include salts with mineral acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, and phosphoric acid; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, and ethanesulfonic acid; and acidic amino acids such as aspartic acid and glutamic acid. The amidite compounds also include salts, hydrates, solvates, crystalline polymorphs, and other forms.

[0058] When R represents a protected hydroxyl group, the protecting group may be any that can be used in the amidite method, such as a 2'-tert-butyldimethylsilyl (TBDMS) group, a 2'-bis(2-acetoxyethoxy)methyl (ACE) group, a 2'-(triisopropylsilyloxy)methyl (TOM) group, a 2'-(2-cyanoethoxy)ethyl (CEE) group, a 2'-(2-cyanoethoxy)methyl (CEM) group, a 2'-para-tolylsulfonylethoxymethyl (TEM) group, or a 2'-EMM group (WO 2006 / 022323). In addition, those described in WO 2013 / 027843 and WO 2019 / 208571 can be used. Among these ribonucleoside (RNA) 2'-protecting groups, the protecting group represented by formula (15) is exemplified as a preferred protecting group. More preferably, E Ｗ An example of such a protecting group is a protecting group represented by formula (16) having a cyano group as the electron-withdrawing group. (wherein q represents an integer of 1 to 5; R ａ and R ｂare the same or different and each represent a methyl group, an ethyl group, or a hydrogen atom, the bond marked with an asterisk (**) is attached to the oxygen of a protected hydroxyl group, and E Ｗ represents an electron-withdrawing group.)

[0059] The protecting group represented by formula (16) can be synthesized, for example, as described in International Publication Nos. 2013 / 027843 and 2019 / 208571, and an amidite having such a protecting group can be used to produce a nucleic acid molecule. For the nucleic acid elongation reaction, an amidite represented by formula (3) shown in Scheme A in Figure 1 is used.

[0060] (Nucleic acid extension reaction) In this specification, "nucleic acid extension reaction" means a reaction in which a nucleic acid molecule is extended by sequentially linking nucleotides via a phosphorodiester bond or a phosphorothioate bond. The nucleic acid extension reaction can be carried out according to the procedure of the general amidite method (phosphoramidite method). The nucleic acid extension reaction may be carried out using an automatic nucleic acid synthesizer that employs the amidite method.

[0061] The chain length of the nucleic acid oligomer may be, for example, 2 to 300 mer, 10 to 200 mer, or 15 to 150 mer.

[0062] The 5'-deprotection step of step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the RNA strand supported on the solid phase support. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0063] The condensation step of step (2) is a reaction in which a nucleoside amidite represented by the following formula (3) shown in Scheme A of Figure 1 is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. The amidite compound represented by formula (3) is used as the amidite used in nucleic acid elongation. Other usable amidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, and the like. The nucleoside amidite used has its 5' hydroxyl group protected with a protecting group (e.g., a DMTr group). The condensation step can be carried out using an activator that activates the nucleoside amidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0064] The nucleoside amidite (hereinafter referred to as amidite) represented by formula (3) in Scheme A of Figure 1 is as follows: (In the formula, G １ , G ２ , G ３ , B ａ and R is as defined above.

[0065] After the condensation step, any unreacted 5' hydroxyl group may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0066] The oxidation step (3) is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by reacting the oxidizing agent with an oligonucleic acid derivative supported on a solid phase support. When converting a phosphite group into a phosphate group, for example, iodine can be used as the "oxidizing agent." The oxidizing agent can be prepared to a concentration of 0.005 to 2 M. Water can be used as the oxygen source for oxidation, and pyridine, N-methylimidazole (NMI), N-methylmorpholine, or triethylamine can be used as the base to promote the reaction. Furthermore, the solvent is not particularly limited as long as it does not participate in the reaction, and acetonitrile, tetrahydrofuran (THF), or a mixture of these in any ratio can also be used. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, per mol of the compound supported on the solid phase carrier.

[0067] When converting a phosphite triester group into a thiophosphate group, examples of oxidizing agents that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.001 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and mixed solvents of these in any ratio. The oxidation step may be carried out after the capping step, or conversely, the oxidation step may be carried out before the capping step, and this order is not limited.

[0068] In step (5), after the synthesis of a nucleic acid having a desired sequence is completed, the phosphate protecting group is deprotected by the action of an amine compound to deprotect the protecting group of the phosphate moiety. Examples of the amine compound include diethylamine, which is described in Japanese Patent No. 4705716.

[0069] The protecting group for the 5' hydroxyl group of the nucleoside introduced at the end of elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, and the protecting group for the 5' hydroxyl group may be deprotected after column purification.

[0070] In step (5), the nucleic acid oligomer elongated to a desired chain length on the solid phase support is cleaved from the solid phase support usually using concentrated aqueous ammonia as a cleavage agent.

[0071] Furthermore, the oligonucleotide chain is cleaved from the solid support and recovered using ammonia or an amine compound, etc. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0072] In step (6), the protecting group on the 2- or 3-hydroxyl group of the ribose of the nucleic acid compound (6) cleaved from the solid support can be removed according to the method described in WO 2006 / 022323, WO 2013 / 027843, or WO 2019 / 208571 to obtain a deprotected nucleic acid oligomer (7).

[0073] Nucleotides and amidites in which the R group in formula (4) is a substituent other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, JP 2014-221817 A, and known methods cited therein. Furthermore, they can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0074] Nucleic acid molecules that can be produced using the production method of the present invention include, but are not limited to, nucleic acid molecules in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, or 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558. Preferably, the nucleic acid molecule produced by the method of the present invention is RNA.

[0075] In one embodiment, the production method of the present invention can be used to produce oligonucleotides with a reduced content of branched oligonucleotides. Specific examples of oligonucleotides include, but are not limited to, the following: an oligonucleotide in which the branched oligonucleotide content is 15% or less relative to the full-length form (FLP); an oligonucleotide in which the branched oligonucleotide content is 5.0% or less relative to the full-length form (FLP); an oligonucleotide in which the branched oligonucleotide content is 4.5% or less relative to the full-length form (FLP); an oligonucleotide in which the branched oligonucleotide content is 4.1% or less relative to the full-length form (FLP); an oligonucleotide in which the branched oligonucleotide content is 3.4% or less relative to the full-length form (FLP); an oligonucleotide in which the branched oligonucleotide content is 3.0% or less relative to the full-length form (FLP); an oligonucleotide in which the branched oligonucleotide content is 2.5% or less relative to the full-length form (FLP). An oligonucleotide in which the content ratio of branched bodies in the oligonucleotide is 2.2% or less relative to the full length form (FLP). An oligonucleotide in which the content ratio of branched bodies in the oligonucleotide is 2.0% or less relative to the full length form (FLP). An oligonucleotide in which the content ratio of branched bodies in the oligonucleotide is 1.5% or less relative to the full length form (FLP). An oligonucleotide in which the content ratio of branched bodies in the oligonucleotide is 1.0% or less relative to the full length form (FLP).

[0076] An oligonucleotide having a chain length of 100 mer or more and a branched content ratio in the oligonucleotide of 15% or less relative to the full length (FLP). An oligonucleotide having a chain length of 100 mer or more and a branched content ratio in the oligonucleotide of 5.0% or less relative to the full length (FLP). An oligonucleotide having a chain length of 100 mer or more and a branched content ratio in the oligonucleotide of 4.5% or less relative to the full length (FLP). An oligonucleotide having a chain length of 100 mer or more and a branched content ratio in the oligonucleotide of 4.1% or less relative to the full length (FLP). An oligonucleotide having a chain length of 100 mer or more and a branched content ratio in the oligonucleotide of 3.4% or less relative to the full length (FLP). An oligonucleotide having a chain length of 100 mer or more and a branched content ratio in the oligonucleotide of 3.0% or less relative to the full length (FLP). An oligonucleotide having a chain length of 100 mer or more, wherein the branched content ratio in the oligonucleotide is 2.5% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 100 mer or more, wherein the branched content ratio in the oligonucleotide is 2.2% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched content ratio in the oligonucleotide is 15% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched content ratio in the oligonucleotide is 5.0% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched content ratio in the oligonucleotide is 4.5% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched content ratio in the oligonucleotide is 4.1% or less relative to the full-length form (FLP).An oligonucleotide having a chain length of 50 mer or more, wherein the branched form content ratio in the oligonucleotide is 3.4% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched form content ratio in the oligonucleotide is 3.0% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched form content ratio in the oligonucleotide is 2.5% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more, wherein the branched form content ratio in the oligonucleotide is 2.2% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 15% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 5.0% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 4.5% or less relative to the full length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 4.1% or less relative to the full length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 3.4% or less relative to the full length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 3.0% or less relative to the full length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched form content ratio in the oligonucleotide is 2.5% or less relative to the full length form (FLP).An oligonucleotide having a chain length of 50 mer or more and 200 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 2.2% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 15% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 5.0% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 4.5% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 4.1% or less. An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched body content ratio in the oligonucleotide is 3.4% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched body content ratio in the oligonucleotide is 3.0% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched body content ratio in the oligonucleotide is 2.5% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 50 mer or more and 300 mer or less, wherein the branched body content ratio in the oligonucleotide is 2.2% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the branched body content ratio in the oligonucleotide is 15% or less relative to the full-length form (FLP). An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the content ratio of branched forms in the oligonucleotide relative to full length forms (FLP) is 5.0% or less.An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 4.5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 4.1% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 3.4% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 3.0% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the branched oligonucleotide content ratio relative to the full length (FLP) is 2.5% or less. An oligonucleotide having a chain length of 100 mer or more and 300 mer or less, wherein the content ratio of branched oligonucleotides in the oligonucleotide relative to full length oligonucleotides (FLP) is 2.2% or less.

[0077] Typical examples of nucleic acid molecules that can be used in the production method of the present invention include, but are not limited to, the following examples in addition to those described in the Examples. In the following explanations of sequences, U represents uridine (ST.25 format), C represents cytidine, A represents adenosine, and G represents guanosine.

[0078] Examples of nucleic acid molecules include those having the following sequences (A) and (B) described in WO 2019 / 060442: Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on the ST.25 format) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on the ST.26 format)) (Antisense) (SEQ ID NO: 1) 21 mer Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on the ST.25 format) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on the ST.26 format)) (Sense) (SEQ ID NO: 2) 21 mer In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Cm represents 2'-O-methylcytidine, and dT represents thymidine. Unless otherwise specified, the abbreviations in the sequences herein apply to both the ST.25 format and the ST.26 format.

[0079] An example is the nucleic acid molecule described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid molecule having the following sequence (C): Sequence (C): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (based on the ST.25 format) (5'-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3' (based on the ST.26 format)) (SEQ ID NO: 3) 36mer

[0080] An example is a nucleic acid molecule having the following sequence (D) described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (D): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (based on the ST.25 format) (5'-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3' (based on the ST.26 format)) (SEQ ID NO: 4) 67mer

[0081] An example is a nucleic acid molecule having the following sequence (E) described in JP-A No. 2015-523856, page 173: Sequence (E): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (based on the ST.25 format) (5'-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3' (based on the ST.26 format)) (SEQ ID NO: 5) 94mer

[0082] Examples include the nucleic acid molecules described in JP-A-2017-537626. Typical examples include nucleic acid molecules having the following sequences (F), (G), (H), and (I).Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (based on ST.25 format) (5'-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3' (based on ST.26 format)) (SEQ ID NO: 6) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 7) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (based on ST.25 format) (5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3' (based on ST.26 format)) (SEQ ID NO: 8) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine.Sequence (I): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (based on ST.25 format) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 9) 113mer In sequence (I), Um represents 2'-O-methyluridine (ST.25 format), Tm represents 2'-O-methyluridine (ST.26 format), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification.

[0083] The present invention will be described in more detail below with reference to examples, but is not limited to these examples. In this specification, Me represents a methyl group. UF water means ultrafiltered water.

[0084] Measurement Methods First, the various measurement methods used in the following tests are shown below.

[0085] (Measurement Method 1: Measurement of FLP and Branched Product Proportions in Oligonucleotides) The FLP and branched product proportions in oligonucleotides were measured using HPLC. FLP stands for Full Length Product. The HPLC measurement conditions are shown in Table 1 below.

[0086] Solid-phase synthesis of oligonucleotides Sequence (J): 5'-AmsUmsAmsACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsUmsUmsU-3' (based on ST.25 format) (5'-AmsCmsTmsCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 format)) (SEQ ID NO: 10) 100mer In sequence (J), "A" is represented by the partial structure separated by a wavy line in the following formula (A1). "C" is represented by the partial structure separated by a wavy line in the following formula (A2). "G" is represented by the partial structure separated by a wavy line in the following formula (A3). U is represented by the partial structure separated by a wavy line in the following formula (A4). "Ums" is represented by the partial structure separated by a wavy line in the following formula (A5). "Ams" is represented by the partial structure separated by a wavy line in the following formula (A6). Note that "Ams" at the 5'-end is represented by the upper partial structure separated by a wavy line in the following formula (A7). Furthermore, "U" at the 3'-end is represented by the lower partial structure separated by a wavy line in the following formula (A8). However, the phosphate group in the structural formula may be a salt.

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095] Using controlled pore glass (CPG) as the solid phase support and an AKTA oligopilot plus 100 (GE Healthcare) as the nucleic acid synthesizer, the oligonucleotide consisting of the above sequence (J) was synthesized from the 3' to 5' end by phosphoramidite solid phase synthesis. The synthesis was carried out on a 9.79 μmol scale. Further, for the synthesis, adenosine PMM amidite (compound (A9)), cytidine PMM amidite (compound (A10)), guanosine PMM amidite (compound (A11)), and uridine PMM amidite (compound (A12)), as described in WO 2019 / 208571, as well as adenosine 2'-OMe amidite (compound (A13)), and uridine 2'-OMe amidite (compound (A14)) were used, a dichloroacetic acid toluene solution was used as the deblocking solution, 5-benzylmercapto-1H-tetrazole was used as the condensing agent, an iodine solution was used as the oxidizing agent, and a phenoxyacetic anhydride solution and an N-methylimidazole solution were used as the capping solution. After completion of nucleic acid elongation, the cyanoethyl protecting group of the phosphate moiety was selectively deprotected by reacting the nucleic acid on the support with diethylamine solution. Here, PMM is an abbreviation for (((1-cyanopropan-2-yl)oxy)methoxy)methyl group.

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102] Next, specific examples of oligonucleotides (nucleic acid oligomers) produced by the method of the present invention will be described. In the following examples, the oligonucleotides produced by the method of the present invention are oligonucleotides having the sequence (J) shown in SEQ ID NO:10.

[0103] Furthermore, the uridine derivatives described in the following examples and comparative examples refer to compounds represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG.

[0104]

[0105] Reference Example 1 Using CPG carrying 9.79 μmol of a uridine derivative and the amidite shown in Formula (A9), Formula (A10), Formula (A11), Formula (A12), Formula (A13), or Formula (A14), solid-phase synthesis of sequence (J) was carried out using an AKTA Oligopilot Plus 100. Thereafter, the CPG carrier carrying 5.01 μmol of oligonucleotide was collected, and 2.85 mL of 28% aqueous ammonia and 0.95 mL of ethanol were added, and the mixture was incubated at 40° C. for 6 hours to liberate the oligonucleotide from the solid-phase carrier. Next, the solvent was removed by concentration, and the free oligonucleotide was dissolved in 3.78 mL of dimethyl sulfoxide. Then, 1.06 mL of acetonitrile, 67 μL of nitromethane, and a stir bar were added. Then, 7.02 mL of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) that had been dehydrated using molecular sieves 4A was added dropwise over 1 hour at room temperature while stirring with a stirrer. The mixture was then kept at 33°C for 4 hours to deprotect the PMM protecting group at the 2'-position. A crude oligonucleotide oligomer was then obtained by precipitation.

[0106] Example 1 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 50% aqueous acetic acid. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 25°C and allowed to stand for 30 minutes. After standing, the vial was removed from the incubator, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0107] Example 2 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 10% aqueous acetic acid. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 25°C and allowed to stand for 2 hours. After standing, the vial was removed from the incubator, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0108] Example 3 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 0.5% aqueous acetic acid solution. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 25°C and allowed to stand for 24 hours. After standing, the vial was removed from the incubator, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0109] Example 4 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 0.1 M sodium acetate buffer (pH = 5.2). The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 25°C and allowed to stand for 48 hours. After standing, the vial was removed from the incubator, and the ratio of branch body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0110] Example 5: 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of UF water. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 25°C and allowed to stand for one week. After standing, the vial was removed from the incubator, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0111] Example 6 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of UF water. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 40°C and allowed to stand for 72 hours. After standing, the vial was removed from the incubator and cooled to room temperature, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0112] Example 7 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of UF water. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 50°C and allowed to stand for 24 hours. After standing, the vial was removed from the incubator and cooled to room temperature, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0113] Example 8 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of UF water. The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 60°C and allowed to stand for 6 hours. After standing, the vial was removed from the incubator and cooled to room temperature, and the ratio of branched body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0114] Example 9 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 0.1 M Tris-HCl buffer (pH = 7.5). The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 60°C and allowed to stand for 24 hours. After standing, the vial was removed from the incubator and cooled to room temperature, and the ratio of branch body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0115] Comparative Example 1 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 0.1 M Tris-HCl buffer (pH = 9.0). The vial containing the mixed solution was placed in an incubator (Kennis) temperature-controlled at 60°C and allowed to stand for 6 hours. After standing, the vial was removed from the incubator and cooled to room temperature, and the ratio of branch body to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0116] Comparative Example 2 (initial value: before reaction) 3 mg of the crude product obtained in Reference Example 1 was dissolved in 1 mL of UF water, and the ratio of branched form to FLP was calculated by the method described in the above-mentioned Measurement Method 1. The results are shown in Table 2.

[0117] Comparative Example 3 (Reaction Conditions Described in Non-Patent Document 2) Following the method described in Non-Patent Document 2 (Oligonucleotides 2006, 16, 181-185), crude oligonucleotides after synthesis were treated with triethylamine trihydrofluoride. Specifically, 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent), and triethylamine trihydrofluoride was added. The vial containing the mixture was placed in an incubator (Kennis) thermostated at 65°C and allowed to stand for 1.5 hours. After standing, the vial was removed from the incubator and cooled to room temperature, and the ratio of branched form to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0118] Comparative Example 4 (Reaction Conditions Described in Non-Patent Document 3) Following the method described in Non-Patent Document 3 (J. Org. Chem., 1970, 35, 3800-3803), the synthesized crude oligonucleotide was treated with 80% aqueous acetic acid at 100°C. Specifically, 3 mg of the crude product obtained in Reference Example 1 was placed in a 2 mL glass vial (Agilent) and dissolved in 1 mL of 80% aqueous acetic acid. The vial containing the mixed solution was placed in an oil bath controlled at 100°C and allowed to stand for 20 minutes. After standing, the vial was removed from the oil bath and cooled to room temperature, and the ratio of branched form to FLP was calculated using the method described in Measurement Method 1 above. The results are shown in Table 2.

[0119] The results of Examples 1 to 9 and Comparative Examples 1 to 4 are shown in Table 2. In Table 2, ND means not detected.

[0120] In Table 2, the branch body ratio means the ratio (area percentage) of branch bodies in the oligonucleotide, determined by analyzing the oligonucleotide using the above-mentioned Measurement Method 1. Furthermore, the FLP ratio means the ratio (area percentage) of FLP in the oligonucleotide, determined by analyzing the oligonucleotide using the above-mentioned Measurement Method 1. "Branch body / FLP" means the content ratio of branch bodies when the ratio of FLP in the oligonucleotide is taken as 100%, and is calculated by the following formula: "Branch body / FLP" (%) = branch body ratio / FLP ratio × 100

[0121] The production method of the present invention makes it possible to selectively decompose branched bodies produced during the production of oligonucleotides, which is expected to improve the yield and purity of oligonucleotides.

[0122] SEQ ID NOs: 1 to 10 in the sequence listing represent the base sequences of oligonucleotides produced according to the method for producing oligonucleotides of the present invention.

Claims

1. A method for producing oligonucleotides, A method for producing an oligonucleotide, comprising the step of reacting an n-polymerized oligonucleotide (where n is any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 to decompose the branched oligonucleotide.

2. A method for producing an oligonucleotide according to claim 1, wherein the step of degrading the branched product includes a reaction that selectively cleaves the phosphoramidate bond of the branched product.

3. A method for producing oligonucleotides according to claim 1, wherein crude oligonucleotides obtained after solid-phase synthesis are used as starting materials.

4. A method for producing an oligonucleotide according to claim 1, wherein the step of decomposing the branched oligonucleotide includes a step of mixing an n-polymerized oligonucleotide (where n is any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 and reacting them for 10 minutes or more.

5. The manufacturing method according to claim 1, wherein the reaction temperature is 0 to 60°C.

6. The manufacturing method according to claim 1, wherein the water or aqueous solution with a pH of 1 to 8 is an aqueous solution containing acetic acid or an acetate salt.

7. The manufacturing method according to claim 1, wherein the water or aqueous solution having a pH of 1 to 8 is a Tris-HCl buffer having a pH of 7 to 8.

8. The manufacturing method according to claim 1, wherein the water or aqueous solution with a pH of 1 to 8 is water.

9. The method for producing an n-polymerized oligonucleotide according to any one of claims 1 to 8, wherein the n-polymerized oligonucleotide is an n-polymerized oligonucleotide containing a nucleotide having 2'-OMe.

10. The method for producing an n-polymerized oligonucleotide according to any one of claims 1 to 8, wherein the n-polymerized oligonucleotide is an n-polymerized oligonucleotide containing a nucleotide having a 2'-OH group.

11. The manufacturing method according to any one of claims 1 to 8, wherein the pH of the aqueous solution is 1 to 2 and the reaction temperature is 0 to 30°C.

12. The manufacturing method according to any one of claims 1 to 8, wherein the pH of the aqueous solution is 3 to 4 and the reaction temperature is 0 to 50°C.

13. The manufacturing method according to any one of claims 1 to 8, wherein the pH of the aqueous solution is 5 to 8 and the reaction temperature is 20 to 60°C.

14. Oligonucleotides in which the branched form content ratio is 15% or less relative to the full-chain extended form (FLP).

15. Oligonucleotides in which the branched form content ratio is 5% or less relative to FLP.

16. Oligonucleotides with a chain length of 50 or more, in which the branched form content ratio is 5% or less relative to FLP.

17. Oligonucleotides with a chain length of 100 or more, in which the branched form content ratio is 5% or less relative to FLP.

18. The manufacturing method according to any one of claims 1 to 8, wherein the oligonucleotide is RNA.

19. The oligonucleotide according to any one of claims 14 to 17, wherein the oligonucleotide is RNA.