Reaction solution for nucleic acid amplification

Abstract

Provided is a reaction solution for nucleic acid amplification which provides a easily visible color before reaction and does not have a color interfering with fluorescence derived from amplified nucleic acid after the reaction.　A reaction solution for nucleic acid amplification, the reaction solution having a pH of 7.5-10.5 and containing a colorant, wherein the colorant is a water-soluble dye that is colorless in a reaction solution having a pH of 7.5-10.5 at 40°C or higher. A reaction solution for nucleic acid amplification, the reaction solution containing a discoloring agent and a colorant, wherein the discoloring agent is an oxidizing agent, a reducing agent or an acidifying agent, and the colorant is a water-soluble dye that discolors or is colorless in a reaction solution at 40°C or higher in the presence of the discoloring agent.

Description

Nucleic acid amplification reaction solution

[0001] The present invention relates to a reaction solution for nucleic acid amplification, a coloring composition to be added to the reaction solution, and a nucleic acid amplification method using the reaction solution.

[0002] In the field of molecular biology research and clinical application fields such as genetic testing, techniques for amplifying and analyzing target nucleic acid molecules have become common technical knowledge. Numerous nucleic acid amplification methods are known, such as the polymerase chain reaction (PCR) method, the loop-mediated isothermal amplification (LAMP) method, and the strand displacement amplification (SDA) method, and most of these methods are characterized by treating nucleic acids at high temperatures above 60°C.

[0003] Known methods for detecting amplified amplification products include subjecting the post-amplification solution to agarose gel electrophoresis, binding the double-stranded nucleic acid to a fluorescent intercalator (ethidium bromide, SYBR® Green, etc.), and observing specific fluorescence (see, for example, Non-Patent Document 1). Alternatively, a real-time nucleic acid detection and quantification method is also widely known, in which a fluorescent intercalator, fluorescently labeled primer, fluorescently labeled probe, etc. is bound to the amplification product during the nucleic acid amplification reaction, and specific fluorescence is detected over time (see, for example, Patent Document 1). In particular, the latter method is the mainstream of nucleic acid amplification methods because it does not require complicated procedures such as electrophoresis and allows detection and quantification results to be obtained quickly.

[0004] Nucleic acid amplification is typically performed by mixing a reaction solution with a sample containing nucleic acid. However, the reaction solution and sample used are very small, making it difficult to visually determine whether the solution is present or not, which makes pipetting errors prone to occur. Even if a trace amount of sample is mixed into another nucleic acid amplification system, nucleic acid amplification poses a high risk of false positives due to amplification. Therefore, careful handling of the reaction solution and sample is required, and it is desirable to create a more error-resistant environment. To address this issue, for example, a colorant that does not affect the nucleic acid amplification reaction has been added to the reaction solution to make the reaction solution more visible. However, in real-time nucleic acid amplification using fluorescently labeled probes, etc., as described in Patent Document 1 and elsewhere, depending on the fluorescent dye used, the absorption wavelength of the colorant may interfere with the fluorescence wavelength, potentially preventing accurate nucleic acid quantification.

[0005] Patent Document 2 discloses a method of adding a thermolabile water-soluble substance that absorbs light and / or fluoresces at a tolerable temperature to a nucleic acid amplification system. In this method, the water-soluble substance absorbs light and / or fluoresces at temperatures before the nucleic acid amplification reaction, making it easy to visualize the reaction solution. However, after the nucleic acid amplification reaction, the water-soluble substance loses its ability to absorb light and / or fluoresce, preventing the water-soluble substance from interfering with the detection of fluorescently labeled probes, etc. Fluorescent proteins are cited as examples of such water-soluble substances.

[0006] JP 2009-232871 A JP 2018-537991 A

[0007] Molecular Cloning second edition, vol. 1, 6. 15 (1989)

[0008] However, the water-soluble substance described in Patent Document 2 is a protein, and there remain issues regarding its stable production and long-term storage stability.

[0009] An object of the present invention is to provide a reaction solution for nucleic acid amplification, which has an easily visible color before the reaction and does not have a color that interferes with the fluorescence derived from the amplified nucleic acid after the reaction, a coloring composition for preparing the reaction solution, and a nucleic acid amplification method using the reaction solution.

[0010] The present inventors have discovered a relatively stable low-molecular-weight dye that does not affect nucleic acid amplification and that becomes colorless upon heating, thereby completing the present invention. The present inventors have also discovered a relatively stable low-molecular-weight dye that does not affect nucleic acid amplification and that changes color or becomes colorless upon heating under certain conditions, thereby completing the present invention. Specifically, the present invention provides the following: [1] A reaction solution for nucleic acid amplification, having a pH of 7.5 to 10.5 and containing a colorant, wherein the colorant is a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and at 40°C or higher. [2] The reaction solution according to [1], wherein the molecular weight of the colorant is less than 1,000. [3] The reaction solution according to [1] or [2], wherein the absorbance at the maximum absorption wavelength in the visible range decreases to 10% or less upon heating at 80°C for 10 minutes. [4] The reaction solution according to any of [1] to [3], wherein the colorant is a non-fluorescent dye. [5] The reaction solution according to any one of [1] to [4], wherein the colorant is a triphenylmethane dye. [6] The reaction solution according to [5], wherein the triphenylmethane dye is at least one compound selected from the group consisting of compounds represented by the following formulas (I) to (V): [7] A coloring composition containing a colorant to be added to a reaction solution for nucleic acid amplification, wherein the colorant is a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and at 40°C or higher. [8] A method for amplifying nucleic acid in a specimen, using the reaction solution according to any one of [1] to [6]. [9] A method for amplifying nucleic acid in a specimen, comprising the step of reacting the nucleic acid in the specimen in a reaction solution containing: a DNA polymerase or an RNA polymerase; at least one pair of primers for amplifying a desired region on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a pH buffer; and a colorant, wherein the pH of the reaction solution is 7.5 to 10.5, and the colorant is a water-soluble dye that becomes colorless in a reaction solution at 40°C or higher.

[10] The method according to [9], wherein the colorant is a non-fluorescent dye.

[11] The method according to [9] or

[10] , wherein the reaction solution further contains an intercalative fluorescent dye.

[12] The method according to any one of [9] to

[11] , wherein the reaction solution further contains a probe bound to a fluorescent dye.

[13] A method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing multiple reaction solutions containing: a DNA polymerase or an RNA polymerase; at least one pair of corresponding primers per region for amplifying desired regions on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; and a pH buffer; and simultaneously reacting the nucleic acid in the sample in each reaction solution, wherein the pH of the reaction solutions is 7.5 to 10.5, and the multiple reaction solutions further contain different coloring agents, each of which is a water-soluble dye that becomes colorless in the reaction solution at 40°C or higher.

[14] A method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing a reaction solution containing: DNA polymerase or RNA polymerase; at least one pair of corresponding primers per region for amplifying a desired region on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a pH buffer; and a colorant; and simultaneously reacting multiple nucleic acids in the sample, wherein the pH of the reaction solution is 7.5 to 10.5, and the colorant is a water-soluble dye that becomes colorless in the reaction solution at 40° C. or higher.

[15] A reaction solution for nucleic acid amplification, comprising a colorant and a colorant, wherein the colorant is an oxidizing agent, a reducing agent, or an acidifying agent, and the colorant is a water-soluble dye that changes color or becomes colorless in the presence of the colorant in the reaction solution at 40° C. or higher.

[16] The reaction solution according to

[15] , wherein the molecular weight of the colorant is less than 1,000.

[17] The reaction solution according to

[15] or

[16] , wherein the absorbance at the maximum absorption wavelength in the visible range decreases to 10% or less by heating at 80° C. for 10 minutes.

[18] The reaction solution according to any one of

[15] to

[17] , wherein the colorant is a non-fluorescent dye.

[19] The reaction solution according to any one of

[15] to

[18] , wherein the water-soluble dye contains at least one compound selected from the group consisting of compounds represented by the following formulas (VI) to (X):

[20] A coloring composition containing a colorant to be added to a reaction solution for nucleic acid amplification, wherein the colorant is a water-soluble dye that becomes colorless in a reaction solution at 40°C or higher in the presence of a color change agent, and the color change agent is an oxidizing agent, a reducing agent, or an acidifying agent.

[21] A method for amplifying nucleic acid in a specimen, using the reaction solution according to any one of

[15] to

[19] .

[22] A method for amplifying nucleic acid in a specimen, comprising a step of reacting the nucleic acid in the specimen in a reaction solution containing: a DNA polymerase or an RNA polymerase; at least one set of primers for amplifying a desired region on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a color change agent; and a colorant, wherein the color change agent is an oxidizing agent, a reducing agent, or an acidifying agent, and the colorant is a water-soluble dye that becomes colorless or becomes colorless in a reaction solution at 40°C or higher in the presence of the color change agent.

[23] The method according to

[22] , wherein the colorant is a non-fluorescent dye.

[24] The method according to

[22] or

[23] , wherein the reaction solution further comprises an intercalating fluorescent dye.

[25] The method according to

[22] or

[23] , wherein the reaction solution further comprises a probe bound to a fluorescent dye.

[26] A method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing multiple reaction solutions containing: a DNA polymerase or an RNA polymerase; at least one pair of corresponding primers per region for amplifying desired regions on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; and a color change agent; and simultaneously reacting the nucleic acid in the sample in each reaction solution, wherein the color change agent is an oxidizing agent, a reducing agent, or an acidifying agent, and the multiple reaction solutions further contain different colorants, and the colorants are water-soluble dyes that change color or become colorless in the reaction solutions at 40°C or higher.

[27] A method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing a reaction solution containing: a DNA polymerase or an RNA polymerase; at least one pair of corresponding primers per region for amplifying desired regions on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a colorant; and a colorant; and simultaneously reacting the regions of nucleic acid in the sample in the reaction solution, wherein the colorant is a water-soluble dye that changes color or becomes colorless in the reaction solution at 40°C or higher. This specification incorporates the disclosures of Japanese Patent Application Nos. 2023-049524 and 2023-049530, from which the present application claims priority.

[0011] According to the present invention, in a nucleic acid amplification reaction, the reaction solution is easy to visualize and handle before the reaction, and after the reaction, the color of the reaction solution does not interfere with the fluorescence derived from the amplified nucleic acid, allowing for more accurate nucleic acid detection and quantification.

[0012] Photographs showing the appearance of the reaction solutions under non-heating and heated conditions in Test Examples 1 and 3 of Example 1. The numbers below each well indicate the absorbance of the solution at 625 nm (Test Example 1) and 617 nm (Test Example 3). Absorption spectra of the reaction solutions under non-heating and heated conditions in Test Example 1 of Example 1. Absorption spectra of the reaction solutions under non-heating and heated conditions in Test Example 2 of Example 1. Absorption spectra of the reaction solutions under non-heating and heated conditions in Test Example 3 of Example 1. Absorption spectra of the reaction solutions under non-heating and heated conditions in Test Example 4 of Example 1. Absorption spectra of the reaction solutions under non-heating and heated conditions in Test Example 5 of Example 1. Photographs showing the appearance of the reaction solutions under non-heating and heated conditions in Test Examples 6 to 9 of Example 2. The results of visual color judgment are shown below each well. Photographs showing the appearance of the reaction solutions under non-heating and heated conditions in Test Example 10 of Example 3 after 27 hours of refrigerated storage. The results of visual color judgment are shown below each well. This is a graph showing the change in fluorescence intensity over time for the reaction solutions of Test Examples 11 to 13 in Example 4. A shows the change in fluorescence intensity of FAM over time, and B shows the change in fluorescence intensity of ROX over time. This is a graph showing the change in fluorescence intensity over time for the reaction solutions of Test Examples 11 and 13 to 16 in Example 4. A shows the change in fluorescence intensity of FAM over time, and B shows the change in fluorescence intensity of ROX over time. This is a graph showing the change in fluorescence intensity over time for Test Examples 17 to 19 in Example 5. This is an absorption spectrum for the reaction solution under non-heating and heated conditions for Test Example 20 in Example 6. This is an absorption spectrum for the reaction solution under non-heating and heated conditions for Test Example 21 in Example 6. This is an absorption spectrum for the reaction solution under non-heating and heated conditions for Test Example 22 in Example 6. This is an absorption spectrum for the reaction solution under non-heating and heated conditions for Test Example 23 in Example 6. 1 shows the absorption spectra of the reaction solution under non-heating and heated conditions in Test Example 24 in Example 6. 2 shows a graph showing the change over time in the ROX fluorescence intensity of the reaction solutions in Test Examples 25 to 30 in Example 7. 3 shows a graph showing the change over time in the ROX fluorescence intensity of the reaction solutions in Test Examples 25 and 30 to 34 in Example 8. 4 shows a graph showing the change over time in the FAM fluorescence intensity of the reaction solutions in Test Examples 25 and 35 to 39 in Example 9.

[0013] In this specification, "%" indicating the concentration of an aqueous solution refers to % by weight unless otherwise specified. In this specification, the expression "A to B" (A and B are both numerical values) means "A or more and B or less" unless otherwise specified. Unless otherwise specified, the compounds described in this specification encompass any geometric isomers, optical isomers, solvates, and salts that may exist.

[0014] 1. Nucleic Acid Amplification Reaction Solution I A first embodiment of the present invention is a nucleic acid amplification reaction solution having a pH of 7.5 to 10.5 and containing a colorant, wherein the colorant is a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and at 40°C or higher.

[0015] As used herein, "nucleic acid amplification" is not particularly limited as long as it amplifies a nucleic acid sequence, and includes all known nucleic acid amplification methods. Known nucleic acid amplification methods include, for example, the polymerase chain reaction (PCR) method, the ligase chain reaction (LCR) method, the strand displacement amplification (SDA) method, the rolling circle amplification (RCA) method, the cycling probe technology (CPT) method, the Q-Beta replication technology method, and the isothermal and chimeric primer-initiated amplification of nucleic acids (ICAN). Examples of such methods include, but are not limited to, well-known methods such as the Loop-Mediated Isothermal Amplification of DNA (LAMP) method, the Nucleic Acid Sequence-based Amplification method (NASBA) method, and the Transcription-mediated amplification method (TMA). Q-Beta Replicase Amplification Technology, RCA, NASBA, SDA, TMA, LAMP, ICAN, and other methods perform amplification reactions at a constant temperature, while other methods such as PCR and LCR perform amplification reactions by temperature cycling.

[0016] As used herein, "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The nucleic acid amplification described above may be DNA amplification or RNA amplification, but is preferably DNA amplification, which has high structural stability. When the nucleic acid to be detected or measured contained in a sample is RNA, the RNA may be amplified as is, but it is preferable to use a reverse transcriptase such as Tth DNA polymerase to construct DNA (cDNA) having a complementary sequence from the RNA, and then use the cDNA as a template to perform the amplification reaction.

[0017] As used herein, the term "reaction solution" refers to a reagent solution for causing a reaction in the solution. In this embodiment, the reaction solution is a reagent solution for causing nucleic acid amplification in the solution. As the components contained in the reaction solution of this embodiment, other than the colorant described below, any known composition can be used depending on the nucleic acid amplification method to be used.

[0018] As used herein, the term "colorant" refers to a substance that has a maximum absorption wavelength in the visible range in an aqueous solution at 20 to 25°C and pH 6.0 to 7.0. The "visible range" here refers to the region of 380 to 800 nm. In this embodiment, the colorant is a water-soluble dye. The term "water-soluble" as used herein refers to a substance that has a higher solubility in water when compared to its solubility in water and in a solvent with an HLB value of 10 or less.

[0019] In this embodiment, the colorant is required to be decolorized in an aqueous solution having a pH of 7.5 to 10.5 and a temperature of 40°C or higher. That is, the colorant is required to be decolorized by warming or heating under weakly basic conditions. In this specification, "decolorization" of an aqueous solution refers to a decrease in the maximum absorption peak in the visible range to 10% or less of the value at the start of observation.

[0020] The colorant of this embodiment preferably has an absorbance at the maximum absorption wavelength in the visible range that is reduced to 20% or less, particularly 10% or less, and further preferably 5% or less, by heating for 10 minutes under conditions of pH 7.5 to 10.5 and 80°C.

[0021] On the other hand, it is preferable that the colorant does not become colorless under conditions of room temperature (e.g., 20 to 25°C) and in a weakly acidic to neutral aqueous solution (e.g., pH 6.0 to 7.0). Furthermore, it is preferable that the colorant does not become colorless even when heated or warmed under weakly acidic to neutral conditions. It is also preferable that the colorant can be stored under weakly acidic to neutral conditions at room temperature or in a refrigerator for a long period of time (e.g., several days to several months) while maintaining its color. Furthermore, it is preferable that the colorant does not become colorless by heating or warming under weakly basic conditions (e.g., pH 7.5 to 10.5) and then return to a low temperature, even if it is returned to a low temperature. This makes it possible to analyze the reaction solution after nucleic acid amplification even after storing it in a refrigerator.

[0022] In the present embodiment, the colorant is not particularly limited as long as it is a water-soluble dye that becomes colorless in an aqueous solution at a pH of 7.5 to 10.5 and a temperature of 40°C or higher. However, it is preferable that the colorant be a low-molecular-weight substance, specifically, a substance with a molecular weight of less than 1,000. Examples of water-soluble dyes include triphenylmethane dyes, thiazine dyes, oxazine dyes, azine dyes, phenazine dyes, xanthene dyes, phenanthridium dyes, azo dyes, lactone dyes, sultone dyes, indigoid dyes, cyanine dyes, oxonol dyes, styryl dyes, porphyrin dyes, thioxanthene dyes, squalyl dyes, croconium dyes, azulenium dyes, dithiol metal salt dyes, naphthoquinone dyes, anthraquinone dyes, indophenol dyes, coumarin dyes, ketocoumarin dyes, pyrylium salt dyes, thiopyrylium salt dyes, thiazole dyes, quinoline dyes, benzophenone dyes, thiobenzophenone dyes, and mixtures thereof. Non-fluorescent dyes are particularly preferred, and triphenylmethane dyes are even more preferred. As used herein, the term "non-fluorescent dye" refers to any dye that does not have the property of emitting excitation light with a longer wavelength than absorbed light. For example, it refers to a dye for which the difference between the wavelength of irradiated light and the wavelength of transmitted light in an aqueous solution is less than 10 nm. As used herein, the term "triphenylmethane dye" refers to a dye having a structure represented by the following formula (XI) or (XII): In formulas (VI) and (VII), R, R, R′, and R″ are independently selected from substituted and unsubstituted aryl groups such as phenyl, naphthyl, anthracenyl, etc. The aryl groups can be substituted with functional groups such as, for example, amino, hydroxyl, carbonyl, carboxyl, sulfonic acid, alkyl, and / or other functional groups.

[0023] In this embodiment, at least one compound selected from the group consisting of compounds represented by the following formulas (I) to (V) can be suitably used as the triphenylmethane dye. The compound represented by formula (I) is a blue-green water-soluble dye known as methyl green (CI42585), and has a maximum absorption wavelength of 632 nm. The compound represented by formula (II) is a blue-green water-soluble dye known as methyl green (CI42590), and has maximum absorption wavelengths of 629 nm and 423 nm. The compound represented by formula (III) is a green water-soluble dye known as malachite green, and has a maximum absorption wavelength of 617 nm. The compound represented by formula (IV) is a green water-soluble dye called Light Green SF Yellow, and has a maximum absorption wavelength of 632 nm. The compound represented by formula (V) is a reddish-purple water-soluble pigment called acid fuchsin, and has a maximum absorption wavelength of 546 nm.

[0024] The concentration of the colorant in the reaction solution is not particularly limited as long as the color of the solution can be visually confirmed, but is preferably 0.005% by weight or less, more preferably 0.001% by weight or less.

[0025] The reaction solution of this embodiment contains, in addition to the colorant, other components necessary for amplifying the sequence of a desired region from a nucleic acid template. The other components referred to here vary depending on the nucleic acid amplification technique, but the following provides examples of components necessary for nucleic acid amplification by real-time PCR.

[0026] A reaction solution for nucleic acid amplification in real-time PCR usually contains at least the following components: DNA polymerase or RNA polymerase, preferably DNA polymerase; at least one pair of forward and reverse primers for amplifying a desired region on a nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), preferably dNTPs; divalent metal ions, preferably magnesium ions (Mg ２＋ ); - pH buffer. The nucleic acid amplification reaction solution is usually weakly basic, with a pH of about 7.5 to 10.5, particularly about 8.0 to 9.0. In one aspect of this embodiment, the reaction solution contains a primer set for amplifying a single region and the colorant. In another aspect of this embodiment, the nucleic acid amplification reaction solution contains at least one primer set for each region, and the colorant, in order to amplify multiple regions.

[0027] The DNA polymerase is not particularly limited, and examples thereof include Taq DNA polymerase, Tth DNA polymerase, KOD DNA polymerase, Bst DNA polymerase, and Bsu DNA polymerase. The pH buffer may be an existing pH buffer commonly used for real-time PCR, such as Tris, phosphate buffer, or Good's buffer solution such as HEPES. The divalent metal ion may be Mg ２＋ In this case, the concentration can be, for example, about 2 mM.

[0028] In real-time PCR, the nucleic acid amplification reaction solution further contains an intercalating fluorescent dye or a fluorescently labeled probe. The intercalating fluorescent dye is a dye that emits fluorescence upon binding to double-stranded nucleic acid, and the double-stranded nucleic acid purified in the reaction solution can be quantified by measuring a specific fluorescence from the reaction solution. Examples of such intercalating fluorescent dyes include SYBR (registered trademark) Green, TB Green, and Eva Green. On the other hand, the fluorescently labeled probe has a sequence complementary to a portion of the desired region and emits fluorescence upon binding to that region in the amplification product. Examples of such fluorescently labeled probes include, but are not limited to, TaqMan (registered trademark) probes. Fluorescent dyes that can be used in fluorescently labeled probes include fluorescein (FAM), HEX, X-rhodamine (ROX), Cy3 (registered trademark), Cy5 (registered trademark), Cy5.5 (registered trademark), fluorescein isothiocyanate (FITC), Yakima Yellow (registered trademark), VIC, Tex615, Texas Red, JOE, MAX, etc. When amplifying multiple regions of a nucleic acid, fluorescently labeled probes having sequences complementary to each region and different fluorescent labels can be used, enabling real-time detection and quantification of multiple nucleic acid regions (multiplex PCR) using a single nucleic acid amplification system.

[0029] In addition to the above components, the reaction solution of this embodiment may further contain stabilizers, preservatives, enzymes such as recombinase and nuclease, SSB, and the like.

[0030] The reaction solution of this embodiment preferably contains a DNA polymerase and dNTPs and is used to amplify DNA. When the desired nucleic acid contained in the sample is RNA, the reaction solution of this embodiment preferably contains a reverse transcriptase or a DNA polymerase having reverse transcription activity. In this way, nucleic acid amplification from RNA is not performed, but cDNA is first produced and the cDNA is amplified by the DNA polymerase.

[0031] The reaction solution of this embodiment may be stored in a state containing the colorant, or may be stored separately, for example, as a test solution containing a colorant at a concentration of approximately 10 to 1000 times the original concentration, and a test solution containing other components. In this case, the test solution containing the colorant is diluted and added to the test solution containing other components immediately before mixing with the sample. Typically, reaction solutions for nucleic acid amplification, particularly real-time PCR, are weakly alkaline. However, long-term storage of colorants under weakly alkaline conditions may cause the colorant to become colorless even without the nucleic acid amplification reaction. Therefore, it is preferable to store only the colorant in aqueous solution under weakly acidic to neutral conditions. The "test solution containing other components" does not necessarily have to be a single test solution; the components may be stored separately in multiple test solutions.

[0032] The reaction solution of this embodiment may be prepared by mixing two or more reagent solutions prepared and stored as separate reagent solutions immediately prior to the nucleic acid amplification reaction. For example, in the case of PCR, a kit may be prepared comprising a reagent solution (enzyme solution) containing an enzyme (polymerase) and a reagent solution (primer solution) containing a primer mix. In this case, the colorant may be added to either the enzyme solution or the primer solution, or both, immediately prior to mixing, or may be added after mixing. Alternatively, the colorant may be added to either the enzyme solution or the primer solution, or both, in advance before storage. When the colorant is added in advance and stored, it is preferable to add it only to the primer solution, which is less susceptible to pH and other factors. Alternatively, if the kit also includes an extraction solution used in a step of extracting DNA or the like from a sample prior to the PCR reaction, the colorant may be added to this extraction solution in advance or immediately prior to use. The extraction solution referred to here refers to a reagent solution that is not separated from the nucleic acids in the sample and is mixed directly with the enzyme solution and primer solution.

[0033] 2. Coloring Composition I A second embodiment of the present invention is a coloring composition. The coloring composition of this embodiment is a coloring composition containing a colorant to be added to a reaction solution for nucleic acid amplification, and is characterized in that the colorant is a water-soluble dye that becomes colorless in a reaction solution having a pH of 7.5 to 10.5 and a temperature of 40°C or higher.

[0034] The composition of this embodiment may be added to an aqueous solution together with DNA polymerase, dNTPs, divalent metal ions, etc., and used to prepare the reaction solution described in Section "1. Nucleic Acid Amplification Reaction Solution I." The composition of this embodiment may also be added to an existing commercially available nucleic acid amplification reaction solution. In this embodiment, the definitions of terms such as "colorant," "decolorizing agent," and "water-soluble dye" are the same as those in Section "1. Nucleic Acid Amplification Reaction Solution I," unless otherwise specified or unless otherwise contradicted.

[0035] The composition of this embodiment contains at least a colorant and a carrier. The carrier here is preferably a solvent, more preferably water. The composition of this embodiment may further contain a pH buffer, a primer, a fluorescently labeled probe, etc. The composition of this embodiment preferably has a pH of 5.8 to 7.2, more preferably a pH of 6.0 to 7.0, and most preferably a pH of 7.0.

[0036] The composition of this embodiment preferably contains the colorant at a concentration of 0.01 to 0.001 wt %, particularly 0.005 to 0.0025 wt %. More specifically, the colorant is preferably contained at a concentration 2 to 100 times, preferably 5 to 10 times, the concentration in the nucleic acid amplification buffer solution.

[0037] 3. Method I for Amplifying Nucleic Acid in a Sample A third embodiment of the present invention is a method for amplifying nucleic acid in a sample. The method of this embodiment is characterized by using the colorant described in Section "1. Reaction Solution I for Nucleic Acid Amplification," i.e., a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and 40°C or higher. More specifically, the method of this embodiment is characterized by using the reaction solution described in Section "1. Reaction Solution I for Nucleic Acid Amplification." Note that, unless otherwise specified or unless otherwise contradictory, the definitions of terms in this embodiment are the same as those described in Section "1. Reaction Solution I for Nucleic Acid Amplification."

[0038] As used herein, the term "specimen" refers to a "sample" that contains or is suspected to contain a nucleic acid of interest and has been made suitable for nucleic acid amplification by pretreatment or the like. The term "sample" is not particularly limited as long as it contains or is suspected to contain a nucleic acid of interest, and includes any derived from an animal, plant, microorganism, virus, etc. This also includes samples extracted from living subjects, i.e., biological samples. The term "subject" as used herein refers to, for example, mammals and birds. Birds refer to animals belonging to the phylum Chordata, subphylum Vertebrates, class Aves, and include, for example, chickens, ducks, quails, geese, wild ducks, turkeys, budgerigars, parrots, mandarin ducks, and swans. Mammals refer to animals belonging to the phylum Chordata, subphylum Vertebrates, class Mammalia, including both humans and non-humans. Examples include primates, including humans and chimpanzees, pet animals such as dogs and cats, livestock animals such as cows, pigs, horses, sheep, and goats, rodents such as mice and rats, and mammals kept in zoos. The subject herein is preferably a human. Biological samples are not particularly limited, but may include, for example, nasal swabs, pharyngeal swabs, nasal discharge, saliva, sputum, gargle, blood (e.g., whole blood, serum, plasma), urine, feces, milk, tissue or cell extracts, or mixtures thereof. Furthermore, samples are not limited to biological samples and may also include those obtained from food, sewage, etc. Samples may be pretreated, such as by nucleic acid extraction, depending on their properties and the structure of the target nucleic acid. In particular, in the nucleic acid amplification method of this embodiment, it is preferable that the specimen does not contain substances that inhibit enzymatic reactions or fluorescent detection. Examples of such pretreatments include protein denaturation / decomposition using surfactants, solvent extraction, solvent precipitation, column purification, and the like.

[0039] One aspect of the method of this embodiment includes a step of reacting nucleic acid in a sample in a reaction solution containing DNA polymerase or RNA polymerase; at least one set of primers for amplifying a desired region of the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a pH buffer; and a colorant, wherein the pH of the reaction solution is 7.5 to 10.5, and the colorant is a water-soluble dye that becomes colorless in the reaction solution at 40°C or higher. This aspect is characterized in that, in the nucleic acid amplification reaction, the sample and the reaction solution can be mixed in a colored state, i.e., in a state in which the reaction solution is easily visible. Furthermore, subsequent amplification of the desired region of the nucleic acid and colorlessness of the colorant can be achieved simultaneously, and the colorant has no or only a minimal effect on detection of the amplification product.

[0040] Another aspect of the method of the present embodiment is a method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing multiple reaction solutions containing DNA polymerase or RNA polymerase, at least one pair of corresponding primers per region for amplifying desired regions on the nucleic acid, deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), a divalent metal ion, and a pH buffer, and simultaneously reacting the nucleic acid in the sample in each reaction solution, wherein the pH of the reaction solutions is 7.5 to 10.5, and the multiple reaction solutions contain different colorants, each of which is a water-soluble dye that becomes colorless in the reaction solution at 40° C. or higher. This aspect is an aspect in which one type of sample is dispensed into multiple reaction solutions, and the multiple reaction solutions are reacted simultaneously.

[0041] Preferably, the multiple reaction solutions amplify different regions. It is not necessary to amplify one region with one reaction solution; multiple reaction solutions that amplify multiple regions may be used. Alternatively, a reaction solution that amplifies only one region and a reaction solution that amplifies multiple regions may be used in combination.

[0042] The multiple reaction solutions contain different colorants. It is particularly preferable to use multiple colorants with different maximum absorption wavelengths (different color tones). When dispensing one type of nucleic acid into multiple reaction solutions in a procedure prior to nucleic acid amplification, color-coding the reaction solutions, i.e., according to the type of nucleic acid to be amplified, makes it easier to visually check the different types and reduces the risk of dispensing errors by the operator. Among the multiple reaction solutions, only one may contain a colorless reaction solution that does not contain a colorant.

[0043] Another aspect of the method of the present embodiment is a method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing a reaction solution containing: DNA polymerase or RNA polymerase; at least one set of corresponding primers per region for amplifying desired regions on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a pH buffer; and a colorant; and simultaneously reacting the multiple nucleic acids in the sample, wherein the pH of the reaction solution is 7.5 to 10.5, and the colorant is a water-soluble dye that becomes colorless in the reaction solution at 40°C or higher.

[0044] This embodiment is a method for simultaneously amplifying multiple nucleic acid regions in a single reaction solution. This embodiment includes, for example, a multiplex PCR method. When simultaneously amplifying multiple nucleic acid regions in a single reaction solution, it is necessary to use multiple types of fluorescently labeled probes, as described below. To amplify and detect multiple types of nucleic acids, it is preferable to be able to select a fluorescent dye from a larger number of fluorescent dyes with different fluorescence properties. However, if a colorant contained in the reaction solution interferes with fluorescence within a certain range of wavelengths, the fluorescent dyes that can be selected are accordingly limited. In this embodiment, because the colorant becomes colorless during the nucleic acid amplification reaction, there is no need to consider the effect of interference with fluorescence, and a suitable fluorescent dye can be selected from a larger number of candidates.

[0045] In the method of this embodiment, the colorant is not particularly limited as long as it is a water-soluble dye that becomes colorless in a reaction solution at a pH of 7.5 to 10.5 and a temperature of 40°C or higher, but a non-fluorescent dye is particularly preferred. In the method of this embodiment, the reaction solution preferably further contains a fluorescent intercalator or a fluorescently labeled probe. The use of a fluorescent intercalator or a fluorescently labeled probe enables simultaneous nucleic acid amplification and detection. Because of their ease of use, fluorescent intercalators are particularly useful when amplifying only one region in a single reaction solution. On the other hand, fluorescently labeled probes can be used by binding different fluorescent dyes to multiple types of probes, making them useful when amplifying multiple regions in a single reaction solution (e.g., multiplex PCR).

[0046] 4. Reaction Solution II for Nucleic Acid Amplification A fourth embodiment of the present invention is a reaction solution for nucleic acid amplification, comprising a colorant and a colorant, wherein the colorant is an oxidizing agent, a reducing agent, or an acidifying agent, and the colorant is a water-soluble dye that changes color or becomes colorless in the reaction solution at 40°C or higher in the presence of the colorant.

[0047] As used herein, the term "color change agent" refers to an agent that changes the maximum absorption wavelength of a colorant solution, as described below, or reduces the absorbance. In particular, an agent that reduces the absorbance of a colorant solution is preferred, and in this case, the color change agent is also referred to as a "decolorizing agent." Specifically, the color change agent is an oxidizing agent, a reducing agent, or an acidifying agent. The oxidizing agent referred to here is not particularly limited, but may be, for example, one or more oxidizing agents selected from the group consisting of hydrogen peroxide, potassium permanganate, potassium chlorate, potassium dichromate, sodium bromate, potassium bromate, halogen, concentrated sulfuric acid, nitric acid, sodium hypochlorite, chlorine dioxide, chloramine, osmium tetroxide, dimethyl sulfoxide, and metachloroperbenzoic acid. The reducing agent is not particularly limited, and may be, for example, one or more reducing agents selected from the group consisting of sodium borohydride, sodium cyanogen borohydride, sodium bisulfite, sodium sulfite, sodium hyposulfite, potassium pyrosulfite, sodium thiosulfate, glutathione, ascorbic acid, 2-mercaptoethanol, DL-dithiothreitol, 1-thioglycerol, cysteine, tributylphosphine, aminoethanethiol, and tris-2-carboxyethylphosphine. The acidifying agent is not particularly limited, and may be, for example, one or more acidifying agents selected from the group consisting of hydrochloric acid, sulfuric acid, nitric acid, acetic acid, formic acid, oxalic acid, citric acid, and lactic acid.

[0048] The concentration of the color change agent in the reaction solution is preferably a concentration that changes the absorption maximum wavelength of the colorant described below or reduces the absorbance, but does not inhibit nucleic acid amplification. Furthermore, the concentration of the color change agent is preferably adjusted to a concentration that does not cause the reaction solution to discolor or become colorless before heating. The concentration of the color change agent can be adjusted appropriately depending on the types of color change agent and colorant used, but can be, for example, 0.1 to 1000 mM, particularly 0.5 to 500 mM, and even more preferably 1 to 100 mM.

[0049] In this embodiment, the colorant is required to change color or become colorless in an aqueous solution at 40° C. or higher in the presence of a color change agent. In this specification, the term "discoloration" of an aqueous solution refers to a change in the maximum absorption wavelength in the visible range of 20 nm or more.

[0050] In this embodiment, the colorant is preferably decolorized in an aqueous solution at 40°C or higher in the presence of a color change agent. Decolorization, i.e., a state in which the intensity of the absorption peak in the visible range is suppressed, enables detection and measurement of various types of fluorescence that may be generated in a nucleic acid amplification reaction without interference from the colorant. In particular, it is preferable that the absorbance at the maximum absorption wavelength in the visible range be reduced to 20% or less, particularly 10% or less, and even 5% or less, by heating in the presence of a color change agent at 80°C for 10 minutes.

[0051] On the other hand, it is preferable that the colorant does not discolor or become colorless at room temperature (e.g., 20 to 25°C) in the absence of a color change agent.Furthermore, it is preferable that the colorant does not discolor or become colorless even when heated in the absence of a color change agent.

[0052] In this embodiment, the colorant is not particularly limited as long as it is a water-soluble pigment that changes color or becomes colorless in an aqueous solution at 40°C or higher in the presence of a color change agent; however, it is preferable that the colorant be a low-molecular-weight substance, specifically, a substance with a molecular weight of less than 1,000. Examples of water-soluble dyes include thiazine dyes, oxazine dyes, azo dyes, azine dyes, triphenylmethane dyes, phenazine dyes, xanthene dyes, phenanthridium dyes, lactone dyes, sultone dyes, indigoid dyes, cyanine dyes, oxonol dyes, styryl dyes, porphyrin dyes, thioxanthene dyes, squarylium dyes, croconium dyes, azulenium dyes, dithiol metal salt dyes, naphthoquinone dyes, anthraquinone dyes, indophenol dyes, coumarin dyes, ketocoumarin dyes, pyrylium salt dyes, thiopyrylium salt dyes, thiazole dyes, quinoline dyes, benzophenone dyes, thiobenzophenone dyes, and mixtures thereof. Non-fluorescent dyes are particularly preferred, with thiazine dyes, oxazine dyes, and azo dyes being more preferred.

[0053] In this embodiment, at least one compound selected from the group consisting of compounds represented by the following formulas (VI) to (X) can be suitably used as the colorant. The compound represented by formula (VI) is a thiazine dye, a blue water-soluble dye known as methylene blue, and has a maximum absorption wavelength of 664 nm. The compound represented by formula (VII) is a thiazine dye, a blue water-soluble dye called thionine acetate, and has a maximum absorption wavelength of 598 nm. The compound represented by formula (VIII) is a thiazine dye, a blue water-soluble dye known as toluidine blue, and has a maximum absorption wavelength of 628 nm. The compound represented by formula (IX) is an oxazine dye, a blue water-soluble dye known as brilliant cresyl blue, and has a maximum absorption wavelength of 624 nm. The compound represented by formula (X) is an azo dye, a red water-soluble dye also known as Basic Red 29, and has a maximum absorption wavelength of 509 nm.

[0054] The concentration of the colorant in the reaction solution is not particularly limited as long as the color of the solution can be visually confirmed, but is preferably 0.002% by weight or less, more preferably 0.001% by weight or less.

[0055] The reaction solution of this embodiment contains, in addition to the colorant, other components necessary for amplifying the sequence of a desired region from a nucleic acid template. The other components referred to here vary depending on the nucleic acid amplification technique, but the following provides examples of components necessary for nucleic acid amplification by real-time PCR.

[0056] A reaction solution for nucleic acid amplification in real-time PCR usually contains at least the following components: DNA polymerase or RNA polymerase, preferably DNA polymerase; at least one pair of forward and reverse primers for amplifying a desired region on a nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs), preferably dNTPs; divalent metal ions, preferably magnesium ions (Mg ２＋); and - a pH buffer. The reaction solution for nucleic acid amplification is usually weakly basic, with a pH of 7.5 to 10.5, particularly 8.0 to 9.0. In one aspect of this embodiment, the reaction solution comprises a primer set for amplifying a single region, and the color change agent and colorant. In another aspect of this embodiment, the reaction solution for nucleic acid amplification comprises at least one primer set for each region, and the color change agent and colorant, in order to amplify multiple regions.

[0057] The DNA polymerase is not particularly limited, and examples thereof include Taq DNA polymerase, Tth DNA polymerase, KOD DNA polymerase, Bst DNA polymerase, and Bsu DNA polymerase. The pH buffer may be an existing pH buffer commonly used for real-time PCR, such as Tris, phosphate buffer, or Good's buffer solution such as HEPES. The divalent metal ion may be Mg ２＋ In this case, the concentration can be, for example, about 2 mM.

[0058] In real-time PCR, the nucleic acid amplification reaction solution further contains an intercalating fluorescent dye or a fluorescently labeled probe. The intercalating fluorescent dye is a dye that emits fluorescence upon binding to double-stranded nucleic acid, and the double-stranded nucleic acid purified in the reaction solution can be quantified by measuring a specific fluorescence from the reaction solution. Examples of such intercalating fluorescent dyes include SYBR (registered trademark) Green, TB Green, and Eva Green. On the other hand, the fluorescently labeled probe has a sequence complementary to a portion of the desired region and emits fluorescence upon binding to that region in the amplification product. Examples of such fluorescently labeled probes include, but are not limited to, TaqMan (registered trademark) probes. Fluorescent dyes that can be used in fluorescently labeled probes include fluorescein (FAM), HEX, X-rhodamine (ROX), Cy3 (registered trademark), Cy5 (registered trademark), Cy5.5 (registered trademark), fluorescein isothiocyanate (FITC), Yakima Yellow (registered trademark), VIC, Tex615, Texas Red, JOE, MAX, etc. When amplifying multiple regions of a nucleic acid, fluorescently labeled probes having sequences complementary to each region and different fluorescent labels can be used, enabling real-time detection and quantification of multiple nucleic acid regions (multiplex PCR) using a single nucleic acid amplification system.

[0059] In addition to the above components, the reaction solution of this embodiment may further contain stabilizers, preservatives, enzymes such as recombinase and nuclease, SSB, and the like.

[0060] The reaction solution of this embodiment preferably contains a DNA polymerase and dNTPs and is used to amplify DNA. When the desired nucleic acid contained in the sample is RNA, the reaction solution of this embodiment preferably contains a reverse transcriptase or a DNA polymerase having reverse transcription activity. In this way, nucleic acid amplification from RNA is not performed, but cDNA is first produced and the cDNA is amplified by the DNA polymerase.

[0061] The reaction solution of this embodiment may be stored in a state containing the colorant, or may be stored separately as a test solution containing the colorant at a concentration of about 10 to 1000 times and a test solution containing other components. In this case, the test solution containing the colorant is diluted and added to the test solution containing other components immediately before mixing with the sample. Alternatively, the reaction solution may be stored as a test solution containing the colorant at a concentration of about 10 to 1000 times and a test solution containing other components. In this case, the test solution containing the colorant is diluted and added to the test solution containing other components immediately before mixing with the sample. Alternatively, the reaction solution may be stored as a test solution containing the colorant at a concentration of about 10 to 1000 times, a test solution containing the colorant at a concentration of about 10 to 1000 times, and a test solution containing the colorant at a concentration of about 10 to 1000 times. In this case, the test solution containing the colorant and the test solution containing the colorant are diluted and added to the test solution containing other components immediately before mixing with the sample. When stored for a long period of time in the presence of a colorant, the colorant may discolor or become colorless without undergoing a nucleic acid amplification reaction. Therefore, it is preferable that the colorant and the color change agent are stored as separate test solutions. Note that the "test solution containing other components" does not necessarily have to be a single test solution, and the components may be stored separately in multiple test solutions.

[0062] The reaction solution of this embodiment may be prepared by mixing two or more reagent solutions prepared and stored as separate reagent solutions immediately before the nucleic acid amplification reaction. For example, in the case of PCR, a kit can be prepared comprising a reagent solution (enzyme solution) containing an enzyme (polymerase) and a reagent solution (primer solution) containing a primer mix. In this case, the colorant can be added to either the enzyme solution or the primer solution, or both, immediately before mixing. The colorant can also be added to either the enzyme solution or the primer solution, or both, before storage. In this case, it is preferable to add the colorant only to the enzyme solution or the primer solution that does not already contain a colorant component. Alternatively, if the kit also includes an extraction solution used in a step of extracting DNA or the like from a sample prior to the PCR reaction, the colorant may be added to this extraction solution in advance or immediately before use. The extraction solution referred to here refers to a reagent solution that is not separated from the nucleic acids in the sample and is mixed directly with the enzyme solution and the primer solution.

[0063] The color change agent can be added to the primer solution in advance and stored, but it is preferable to add it to the enzyme solution, primer solution, colorant solution, or a mixture of any of these immediately before the PCR reaction. The color change agent may be added to the extraction solution in advance as long as it does not interfere with nucleic acid extraction. In either case, it is necessary to avoid adding and storing the color change agent and colorant in the same reagent solution.

[0064] 5. Coloring Composition II The fifth embodiment of the present invention is a coloring composition. The composition of this embodiment is characterized in that the colorant is a water-soluble dye that changes color or becomes colorless in a reaction solution at 40°C or higher in the presence of a color changer, and the color changer is an oxidizing agent, a reducing agent, or an acidifying agent.

[0065] The composition of this embodiment may be added to an aqueous solution together with a DNA polymerase, dNTPs, divalent metal ions, etc., and a color change agent, and used to prepare the reaction solution described in Section "4. Nucleic Acid Amplification Reaction Solution." The composition of this embodiment may also be added to a commercially available existing nucleic acid amplification reaction solution together with a color change agent. In this embodiment, the definitions of terms such as "colorant," "color change agent," "color change," "color removal," "water-soluble dye," and the like are the same as those described in any of Sections "1. Nucleic Acid Amplification Reaction Solution I," "2. Coloring Composition I," and "4. Nucleic Acid Amplification Reaction Solution II," unless otherwise specified or unless otherwise contradicted.

[0066] The composition of this embodiment contains at least a colorant and a carrier. The carrier here is preferably a solvent, more preferably water. The composition of this embodiment may further contain a pH buffer, a primer, a fluorescently labeled probe, etc. The composition of this embodiment preferably has a pH of 5.0 to 9.0, more preferably a pH of 6.0 to 8.0, and most preferably a pH of 7.0.

[0067] The composition of this embodiment preferably contains the colorant at a concentration of 0.01 to 0.001 wt %, particularly 0.005 to 0.0025 wt %. More specifically, the colorant is preferably contained at a concentration 2 to 100 times, preferably 5 to 10 times, the concentration in the nucleic acid amplification buffer solution.

[0068] 6. Method II for Amplifying Nucleic Acid in a Sample The sixth embodiment of the present invention is a method for amplifying nucleic acid in a sample. The method of this embodiment is characterized by using a colorant described in Sections "1. Reaction Solution I for Nucleic Acid Amplification" or "4. Reaction Solution II for Nucleic Acid Amplification," i.e., a water-soluble dye that changes color or becomes colorless in a reaction solution at 40°C or higher in the presence of a color changer. More specifically, the method of this embodiment is characterized by using a reaction solution described in Section "4. Reaction Solution II for Nucleic Acid Amplification." Note that, unless otherwise specified or unless otherwise contradictory, the definitions of terms in this embodiment are the same as those described in any of Sections "1. Reaction Solution I for Nucleic Acid Amplification," "3. Method I for Amplifying Nucleic Acid in a Sample," and "4. Reaction Solution II for Nucleic Acid Amplification."

[0069] One aspect of the method of this embodiment includes a step of reacting nucleic acid in a sample in a reaction solution containing DNA polymerase or RNA polymerase; at least one set of primers for amplifying a desired region of the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); divalent metal ions; a pH buffer; a colorant; and a colorant, wherein the colorant is a water-soluble dye that changes color or becomes colorless in the reaction solution at 40°C or higher in the presence of the colorant. In this aspect, the sample and the reaction solution can be mixed in a colored state during the nucleic acid amplification reaction, i.e., in a state where the reaction solution is easily visible. Furthermore, subsequent amplification of the desired region of the nucleic acid and coloring or decoloring of the colorant can be achieved simultaneously, and the colorant has no or only minimal effect on the detection of the amplification product.

[0070] Another aspect of the method of this embodiment is a method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing multiple reaction solutions containing DNA polymerase or RNA polymerase; at least one pair of corresponding primers per region for amplifying desired regions on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; and a color change agent, and simultaneously reacting the nucleic acid in the sample in each reaction solution, wherein the multiple reaction solutions contain different colorants, and each of the colorants is a water-soluble dye that changes color or becomes colorless in the presence of the color change agent in a reaction solution at 40° C. or higher. This aspect is an aspect in which one type of sample is dispensed into multiple reaction solutions, and the multiple reaction solutions are reacted simultaneously.

[0071] Preferably, the multiple reaction solutions amplify different regions. It is not necessary to amplify one region with one reaction solution; multiple reaction solutions that amplify multiple regions may be used. Alternatively, a reaction solution that amplifies only one region and a reaction solution that amplifies multiple regions may be used in combination.

[0072] The multiple reaction solutions contain different colorants. It is particularly preferable to use multiple colorants with different absorption wavelengths (different color tones). When dispensing one type of nucleic acid into multiple reaction solutions in a pre-nucleic acid amplification procedure, color-coding the reaction solutions, i.e., the type of nucleic acid to be amplified, makes it easier to visually check each type and reduces the risk of dispensing errors by the operator. The multiple reaction solutions may include only one colorless reaction solution that does not contain a colorant.

[0073] Another aspect of the method of the present embodiment is a method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising the steps of preparing a reaction solution containing: DNA polymerase or RNA polymerase; at least one set of corresponding primers per region for amplifying desired regions on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); a divalent metal ion; a colorant; and a colorant; and simultaneously reacting the regions of nucleic acid in the sample in the reaction solution, wherein the colorant is a water-soluble dye that changes color or becomes colorless in the presence of the colorant in the reaction solution at 40°C or higher.

[0074] This embodiment is a method for simultaneously amplifying multiple nucleic acid regions in a single reaction solution. This embodiment includes, for example, a multiplex PCR method. When simultaneously amplifying multiple nucleic acid regions in a single reaction solution, it is necessary to use multiple types of fluorescently labeled probes, as described below. To amplify and detect multiple types of nucleic acids, it is preferable to be able to select a fluorescent dye from a larger number of fluorescent dyes with different fluorescence properties. However, if a colorant contained in the reaction solution interferes with fluorescence within a certain range of wavelengths, the number of fluorescent dyes that can be selected is accordingly limited. In this embodiment, the colorant changes color or becomes colorless during the nucleic acid amplification reaction, thereby avoiding the influence of interference with fluorescence and allowing a suitable fluorescent dye to be selected from a larger number of candidates.

[0075] In the method of this embodiment, the reaction solution may contain a pH buffer. Examples of pH buffers that can be used include existing pH buffers commonly used in real-time PCR, such as Tris, phosphate buffer, and Good's buffers such as HEPES. The pH of the reaction solution can be adjusted to 7.5 to 10.5, particularly 8.0 to 9.0. The colorant is not particularly limited as long as it is a water-soluble dye that changes color or becomes colorless in the presence of a color changer in a reaction solution at 40°C or higher. A non-fluorescent dye is particularly preferred. In the method of this embodiment, the reaction solution preferably further contains a fluorescent intercalator or a fluorescently labeled probe. The use of a fluorescent intercalator or a fluorescently labeled probe enables simultaneous nucleic acid amplification and detection. Because of their ease of use, fluorescent intercalators are particularly useful when amplifying only one region in a single reaction solution. On the other hand, fluorescently labeled probes can be used by binding different fluorescent dyes to multiple probes, making them useful when amplifying multiple regions in a single reaction solution (e.g., multiplex PCR).

[0076] The present invention will be described in more detail below by showing examples, but the following description is not intended to limit the scope of the present invention to the examples.

[0077] Example 1: Decolorization of Colorant by Heating (1) Test Example 1 A colorant solution was prepared by adding methyl green (CI42585) (formula (I) below) to a PCR reaction solution (TaqPath™ 1-Step Multiplex Master Mix (No ROX), pH 8.3-8.9) containing no primers or probes to a concentration of 0.0025% (w / v). The colorant solution was dispensed into a 96-well V-bottom white microplate at 50 μL / well and either left at room temperature for 5 minutes (unheated) or heated in a heat block at 95°C for 5 minutes (heated). The coloration of the colorant solution under unheated and heated conditions was visually confirmed. Furthermore, the absorption spectra of the unheated and heated colorant solutions were obtained using a spectrophotometer.

[0078] (2) Test Example 2 A test similar to Test Example 1 was carried out, except that methyl green (CI 42590) (formula (II) below) was used instead of methyl green (CI 42585).

[0079] (3) Test Example 3 A test similar to Test Example 1 was carried out, except that malachite green (formula (III) below) was used instead of methyl green (CI42585).

[0080] (4) Test Example 4 A test similar to Test Example 1 was carried out, except that Light Green SF Yellow (formula (IV) below) was used instead of Methyl Green (CI42585).

[0081] (5) Test Example 5 A test similar to Test Example 1 was carried out, except that Light Green SF Yellow (formula (V) below) was used instead of Methyl Green (CI42585).

[0082] (6) Results Figure 1 shows photographs of the colorant solutions of Test Examples 1 and 3 under unheated and heated conditions. The numbers below each well indicate the absorbance of the solution at 625 nm (Test Example 1) and 617 nm (Test Example 3). In both Test Examples 1 and 3, a blue coloration was observed under unheated conditions, but it was confirmed that this became colorless upon heating. Figures 2 to 6 show the absorption spectra of each of the colorant solutions of Examples 1 to 5 before and after heating. It was confirmed that in all of the colorant solutions, the absorbance at the maximum absorption wavelength under unheated conditions significantly decreased after heating.

[0083] [Example 2] pH Effect Test (1) Test Example 6 A 50 mM Tris solution at pH 7.0 was prepared, and methyl green (CI42585) was added to prepare a colorant solution at 0.0025% (w / v). The colorant solution was dispensed into a 96-well V-bottom white microplate at 50 μL / well, and either left at room temperature for 5 minutes (unheated) or heated in a heat block at 95°C for 2 minutes (heated). The color of the colorant solution under unheated and heated conditions was visually confirmed.

[0084] (2) Test Example 7 A test similar to Test Example 6 was carried out, except that a 50 mM Tris solution at pH 8.0 was used instead of the 50 mM Tris solution at pH 7.0.

[0085] (3) Test Example 8 A test similar to Test Example 6 was carried out, except that a 50 mM Tris solution at pH 9.0 was used instead of the 50 mM Tris solution at pH 7.0.

[0086] (4) Test Example 9 A test similar to Test Example 6 was conducted, except that 50 mM phosphate buffer at pH 8.0 was used instead of 50 mM Tris solution at pH 7.0. (5) Results Figure 7 shows photographs of the colorant solutions of Test Examples 6 to 9 under unheated and heated conditions. The results of visual color assessment are shown below each well. In Test Example 6, there was almost no difference in coloration between unheated and heated conditions, whereas in Test Examples 7 and 8, significant decolorization was observed. Test Example 8, which had a particularly high pH, ​​showed particularly significant decolorization. Test Example 9, which used phosphate buffer, showed a higher degree of decolorization than Test Example 7, which had the same pH. These results demonstrate that methyl green decolorizes when heated under weakly alkaline conditions, but does not decolorize when heated under neutral conditions.

[0087] Example 3: Coloring and Decolorization Stability of Colorants (1) Test Example 10: Methyl green (CI42585) was added to TaqPath™ 1-Step Multiplex Master Mix (No ROX) to prepare a colorant solution at 0.0025% (w / v). The colorant solution was dispensed into a 96-well V-bottom white microplate at 50 μL / well and either left at room temperature for 2 minutes (unheated) or heated in a 95°C heat block for 2 minutes (heated). The plate was then left refrigerated (1-4°C) for 27 hours, and the coloration of the colorant solution under unheated and heated conditions was visually confirmed. Furthermore, the absorption spectra of the unheated and heated colorant solutions were measured using a spectrophotometer.

[0088] (2) Results Figure 8 shows the appearance of the unheated and heated colorant solutions after refrigerated storage for 27 hours. The results of visual color assessment are shown below each well. It was confirmed that the unheated colorant solution did not become colorless after refrigerated storage for 27 hours, even under weakly alkaline conditions. On the other hand, the colorant that had become colorless by heating did not recolor even after refrigerated storage for 27 hours under refrigerated conditions, confirming that the colorless amplification product solution can be stored in the refrigerator for at least 27 hours.

[0089] [Example 4] Effect of colorants on real-time PCR (1) Test Example 11 A reagent for detecting DOCK2 SNP (G / A) was prepared under the following conditions. Primer sets (SEQ ID NOs: 1 and 2) and fluorescently labeled probes (SEQ ID NOs: 3 and 4) corresponding to the G allele and A allele of DOCK2 were prepared, respectively. The base sequences of each primer and probe are shown in Table 1. Fluorescent labels used were FAM for the probe for the G allele and ROX for the probe for the A allele. The primer set and fluorescently labeled probe corresponding to the G / A allele were added to TaqPath™ 1-Step Multiplex Master Mix (No ROX) to prepare a reaction solution for nucleic acid amplification.

[0090]

[0091] To the nucleic acid amplification reaction solution, synthetic DNAs corresponding to the DOCK2 G allele and A allele were added as template DNA at 500, 5,000, 50,000, and 500,000 copies / test, respectively. Each reaction solution was dispensed into a microwell plate for real-time PCR, sealed, and then reacted under the temperature conditions shown in Table 2.

[0092]

[0093] (2) Test Example 12 A test similar to Test Example 11 was carried out, except that methyl green (CI42585) was further added to the nucleic acid amplification reaction solution so as to give a concentration of 0.0025% (w / v).

[0094] (3) Test Example 13 A test similar to Test Example 11 was carried out, except that PrecisionBlue™ (BioRad) was further added to the nucleic acid amplification reaction solution so as to give a concentration of 0.005% (v / v).

[0095] (4) Test Example 14 A test similar to Test Example 11 was carried out, except that malachite green was further added to the nucleic acid amplification reaction solution so that the concentration was 0.0005% (w / v).

[0096] (5) Test Example 15 A test similar to Test Example 11 was carried out, except that Light Green SF Yellow was further added to the nucleic acid amplification reaction solution so as to give a concentration of 0.00125% (w / v).

[0097] (6) Test Example 16 A test similar to Test Example 11 was carried out, except that acid fuchsin was further added to the reaction solution for nucleic acid amplification so as to give a concentration of 0.001% (w / v).

[0098] (7) Results Figure 9 shows the change in fluorescence intensity over time in real-time PCR for Test Examples 11 to 13. Figure 9A shows the change in FAM fluorescence intensity over time, and Figure 9B shows the change in ROX fluorescence intensity over time. Table 3 also shows the Cq values ​​for each template DNA copy number in Test Examples 11 to 13. Regarding FAM fluorescence intensity, Test Example 12, in which methyl green was added, showed an overall tendency to decrease compared to Test Example 11, but no significant decrease in brightness was observed. Furthermore, similar Cq values ​​were obtained in all Test Examples. Regarding ROX fluorescence intensity, Test Example 12 showed no significant differences from Test Example 11 in both fluorescence intensity and Cq value, but Test Example 13 showed a significant decrease in fluorescence intensity and a difference in Cq value. This confirmed that methyl green does not affect nucleic acid amplification in real-time PCR or interfere with the fluorescent signal.

[0099]

[0100] Figure 10 shows the change in fluorescence intensity over time in real-time PCR for Test Examples 11 and 13-16. Figure 10A shows the change in FAM fluorescence intensity over time in real-time PCR using 50,000 copies / test of template DNA, and Figure 10B shows the change in ROX fluorescence intensity over time in real-time PCR using 500 copies / test of template DNA. It was confirmed that all FAM fluorescence intensities were comparable. Meanwhile, only Test Example 13 showed a significant decrease in ROX fluorescence intensity, while the other Test Examples all showed comparable fluorescence intensities. This confirmed that malachite green, light green SF yellow, and acid fuchsin did not affect nucleic acid amplification in real-time PCR or interfere with the fluorescent signal.

[0101] [Example 5] Effect of colorants on isothermal nucleic acid amplification As isothermal nucleic acid amplification, nucleic acid amplification was performed using TRIAmp. The primers used in the TRIAmp reaction were prepared with the same sequences as the forward primer DRa21 (SEQ ID NO: 5) and reverse primer DRb19 (SEQ ID NO: 6), which target the repetitive sequence of Mycobacterium tuberculosis described in International Publication No. 2021 / 124681. Forward primer: cggggttttgggtctgacgac (SEQ ID NO: 5) Reverse primer: cccgagaggggacggaaac (SEQ ID NO: 6)

[0102] A primer mix containing 20 μM of each primer was prepared. Next, a 2x TRIAmp buffer mix was prepared consisting of 40 mM Tris buffer (pH 8.8), 20 mM potassium chloride, 20 mM ammonium sulfate, 0.2% Tween® 20, 1.8 M betaine, 1.6 mM deoxynucleotide triphosphate, and 12 mM magnesium sulfate. 2 μL of DNA sample was added to 12.5 μL of TRIAmp buffer mix, 2 μL of primer mix, 8 units of Bst DNA polymerase, and 5 μL of 1:10,000 diluted SYBR Green I solution to prepare a total volume of 25 μL of TRIAmp reaction solution. The DNA sample used was a DNA solution (100 pg / μL) extracted and purified from Mycobacterium bovis BCG strain. As a control, a control reaction solution was also prepared in which PBS containing no DNA was used instead of the DNA sample.

[0103] (1) Test Example 17 The TRIAmp reaction solution and the control reaction solution were reacted at 68°C for 1 hour using a real-time PCR device (LightCycler 96) manufactured by Roche, and fluorescence was measured over time.

[0104] (2) Test Example 18 A test was conducted in the same manner as in Test Example 17, except that 0.00125% (w / v) of Light Green SF Yellow was added to the nucleic acid amplification reaction solution.

[0105] (3) Test Example 19 A test was conducted in the same manner as in Test Example 17, except that 0.001% (w / v) acid fuchsin was added to the reaction solution for nucleic acid amplification.

[0106] (4) Results Figure 11 shows the change in fluorescence intensity over time for the negative and positive controls of each test example. Table 4 shows the Tt value (minutes) and color tone before and after the reaction for each test example. It was confirmed that Light Green SF Yellow and acid fuchsin became colorless even in isothermal nucleic acid amplification at 68°C. It was also confirmed that the nucleic acid amplification reaction yielded results similar to those obtained under conditions without the addition of a colorant.

[0107]

[0108] Example 6: Decolorization of a colorant by heating in the presence of a reducing agent (1) Test Examples 20 to 24 In a 0.5 mL PCR polypropylene tube, 50 μL of a colorant solution containing a dye and sodium sulfite at the concentrations shown in Table 5 was prepared. Each colorant solution was heated in a 95°C heat block for 5 minutes. The absorption spectra of each of the unheated and heated aqueous solutions were obtained using a spectrophotometer.

[0109]

[0110] (2) Results Figures 12 to 16 show the absorption spectra of the unheated and heated colorant solutions of Test Examples 20 to 24. In Test Examples 20 to 23, the absorption peaks observed in the unheated state almost disappeared. In Test Example 24, the maximum absorption wavelength shifted to the lower wavelength side, confirming the occurrence of discoloration. The peak area (AUC) also decreased significantly.

[0111] Example 7 Effect of Methylene Blue on Real-Time PCR (1) Test Example 25 A reagent for detecting DOCK2 SNP (G / A) was prepared under the following conditions. Primer sets (SEQ ID NOS: 1 and 2 in Table 1) and fluorescently labeled probes (SEQ ID NOS: 3 and 4 in Table 1) corresponding to the G allele and A allele of DOCK2 were prepared, respectively. FAM was used as the fluorescent label for the G allele probe, and ROX was used for the A allele probe. The primer set and fluorescently labeled probe corresponding to the G / A allele were added to TaqPath™ 1-Step Multiplex Master Mix (No ROX) to prepare a reaction solution for nucleic acid amplification.

[0112] To the nucleic acid amplification reaction solution, synthetic DNAs corresponding to the DOCKS2 G allele and A allele were added as template DNA at 500, 5,000, 50,000, and 500,000 copies / test, respectively. Each reaction solution was dispensed into a microwell plate for real-time PCR, sealed, and then reacted under the temperature conditions shown in Table 2.

[0113] (2) Test Examples 26 to 29 The same test as in Test Example 25 was carried out, except that methylene blue and sodium nitrite were added to the reaction solution for nucleic acid amplification in the amounts shown in Table 6.

[0114]

[0115] (3) Test Example 30 A test similar to Test Example 25 was carried out, except that PrecisionBlue™ (BioRad) was further added to the nucleic acid amplification reaction solution so as to give a concentration of 0.005% (v / v).

[0116] (4) Results Figure 17 shows the time course of ROX fluorescence intensity in real-time PCR in Test Examples 25 to 30. It was confirmed that the addition of methylene blue and sodium sulfite did not inhibit the PCR reaction. Test Examples 26 and 30, which did not contain sodium nitrite, interfered with ROX fluorescence. On the other hand, Test Examples 27 to 29, in which methylene blue and sodium sulfite were added simultaneously, did not interfere with ROX fluorescence, and it was confirmed that real-time PCR similar to that in Test Example 6 could be achieved.

[0117] [Example 8] Effect of toluidine blue on real-time PCR method (1) Test Examples 31 to 34 Tests similar to Test Example 25 were carried out, except that toluidine blue and sodium nitrite were added to the nucleic acid amplification reaction solution in the amounts shown in Table 7.

[0118]

[0119] (2) Results Figure 18 shows the time course of ROX fluorescence intensity in real-time PCR for Test Examples 25 and 30 to 34. It was confirmed that the addition of toluidine blue and sodium sulfite did not inhibit the PCR reaction. In Test Example 31, which did not contain sodium nitrite, ROX fluorescence was interfered with, but it was confirmed that the fluorescence intensity could be restored by adding sodium sulfite.

[0120] [Example 9] Effect of Basic Red 29 on real-time PCR method (1) Test Examples 35 to 39 Tests were carried out in the same manner as in Test Example 25, except that Basic Red 29 and sodium nitrite were added to the nucleic acid amplification reaction solution in the amounts shown in Table 8.

[0121]

[0122] (2) Results Figure 19 shows the change in FAM fluorescence intensity over time in real-time PCR for Test Examples 25, 35 to 39. It was confirmed that the addition of Basic Red 29 and sodium sulfite did not inhibit the PCR reaction. In Test Example 35, which did not contain sodium nitrite, FAM fluorescence was interfered with, but it was confirmed that the fluorescence intensity could be restored by adding sodium sulfite. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety.

Claims

1. A reaction solution for nucleic acid amplification, Contains color change agents and colorants, the color changing agent is an oxidizing agent, a reducing agent, or an acidifying agent; The reaction solution, wherein the colorant is a water-soluble dye that changes color or becomes colorless in the presence of a color-changing agent at 40°C or higher.

2. The reaction liquid according to claim 1 , wherein the colorant has a molecular weight of less than 1,000.

3. 2. The reaction solution according to claim 1, wherein the absorbance at the maximum absorption wavelength in the visible region decreases to 10% or less when heated at 80°C for 10 minutes.

4. The reaction solution according to claim 1 , wherein the colorant is a non-fluorescent dye.

5. The reaction solution according to claim 1, wherein the water-soluble dye comprises at least one compound selected from the group consisting of compounds represented by the following formulas (VI) to (X): 【Chemistry 1】 【Chemistry 2】 【Transformation 3】 【Chemistry 4】 【Transformation 5】

6. A coloring composition containing a colorant to be added to a reaction solution for nucleic acid amplification, the colorant is a water-soluble dye that becomes colorless in a reaction solution at 40°C or higher in the presence of a color changing agent, The composition, wherein the color changing agent is an oxidizing agent, a reducing agent, or an acidifying agent.

7. A method for amplifying nucleic acid in a sample, which comprises using the reaction solution according to any one of claims 1 to 5.

8. 1. A method for amplifying nucleic acid in a sample, comprising: Nucleic acids in the sample DNA polymerase or RNA polymerase; at least one set of primers for amplifying a desired region on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); divalent metal ions; a color changing agent; and reacting the compound in a reaction solution containing a colorant; the color changing agent is an oxidizing agent, a reducing agent, or an acidifying agent; The method, wherein the colorant is a water-soluble dye that changes color or becomes colorless in a reaction solution at 40°C or higher in the presence of a color changing agent.

9. The method of claim 8 , wherein the colorant is a non-fluorescent dye.

10. The method according to claim 8 , wherein the reaction solution further comprises an intercalative fluorescent dye.

11. The method according to claim 8 , wherein the reaction solution further comprises a probe bound to a fluorescent dye.

12. 1. A method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising: DNA polymerase or RNA polymerase; at least one pair of corresponding primers per region for amplifying a desired region on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); divalent metal ions; and preparing a plurality of reaction solutions containing a color change agent; a step of simultaneously reacting nucleic acids in a sample in each reaction solution, the color changing agent is an oxidizing agent, a reducing agent, or an acidifying agent; the plurality of reaction solutions further contain different colorants; The colorant is a water-soluble dye that changes color or becomes colorless in a reaction solution at 40°C or higher.

13. 1. A method for simultaneously amplifying multiple regions of nucleic acid in a sample, comprising: DNA polymerase or RNA polymerase; at least one pair of corresponding primers per region for amplifying a desired region on the nucleic acid; deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs); divalent metal ions; a color changing agent; and preparing one reaction solution containing a colorant; The method comprises the step of simultaneously reacting regions of nucleic acid in a sample in a single reaction solution, The method, wherein the colorant is a water-soluble dye that changes color or becomes colorless in a reaction solution at 40°C or higher.

Images