Method for producing plant having controlled stomatal density and use thereof

JPWO2025075174A1Undetermined Publication Date: 2025-04-10

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Filing Date
2024-10-04
Publication Date
2025-04-10

AI Technical Summary

Technical Problem

The effect of environmental conditions during the grain-filling period on the stomatal density of the next generation of plants remains unclear, and existing methods for increasing stomatal density often require genetic manipulation or breeding.

Method used

A method for producing plants with controlled stomatal density by exposing the parent generation to environmental stress, specifically controlling temperature during the ripening stage, and regulating the methylation of gene promoters involved in stomatal density, such as the YODA1 gene, to influence the transcription of these genes in the next generation.

Benefits of technology

This approach allows for the production of plants with increased stomatal density without genetic manipulation, enhancing carbon dioxide fixation and stress resistance, leading to improved agricultural productivity and reduced environmental impact.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention addresses the problem of clarifying the relationship between heat stress in grain-filling stage and the control of stomatal density and producing a useful plant by a novel method different from the conventional genetic engineering techniques. Provided is a method for producing a progeny of a plant which has a controlled stomatal density, the method including a step for controlling the temperature of the grain-filling stage of the plant. The control of the stomatal density is preferably achieved by the control of the methylation of a promoter region of a gene involved in the stomatal density.
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing plants with controlled stomatal density and use thereof

[0001] The present invention relates to a method for producing plants with controlled stomatal density and uses thereof. The present invention is useful in the fields of plant improvement, crop production, industrial crop production, etc.

[0002] Plant stomata are structures that contain a pair of guard cells and the cells around them, and the size of the pores that form between the guard cells is adjusted by changes in the shape of the guard cells. Open stomata allow carbon dioxide necessary for photosynthesis to be taken in and oxygen produced by photosynthesis to be released, as well as releasing water vapor into the air through transpiration. Transpiration also plays a role in lowering the temperature of leaves that has risen due to strong sunlight.

[0003] Regarding increasing the number of stomata in plants, Patent Document 1 describes a method for producing plants having an increased number of stomata compared to a control plant of the same species, the method comprising the following steps: (i) inhibiting the function of an endogenous gene comprising the polynucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or otherwise disrupting the activity of the gene; (ii) selecting material inhibited as described above; and (iii) regenerating the selected material into plants and selecting, from the population of regenerants, regenerated plants having an increased number of stomata compared to the control plant of the same species. The sequences of SEQ ID NOs: 1 and 2 used in this method relate to a fatty acid elongase gene called FAE-1. Patent Document 2 also describes a stomatal-increasing agent containing a compound that increases the number and / or density of stomata in plants. The compound contained in this stomatal enhancer is (I) the amino acid sequence shown in SEQ ID NO: 6, (II) an amino acid sequence which has one or more amino acid residues substituted, deleted, added, or inserted in SEQ ID NO: 6 and constitutes a polypeptide which has at least the property of positively regulating stomatal formation in plants, and (III) an amino acid sequence which matches the amino acid sequence shown in SEQ ID NO: 6 using the BLAST algorithm under the conditions of Costtoopengap11, Costtoextendgap1, expectvalue10, and wordsize3. (IV) amino acid sequences that have a calculated sequence identity of 95% or more after alignment and that encode a polypeptide that has at least the property of positively regulating stoma formation in plants, and that are encoded by a nucleic acid that hybridizes under stringent conditions with a complementary strand of a nucleic acid that encodes the amino acid sequence shown in SEQ ID NO: 6, and that encode a polypeptide that has at least the property of positively regulating stoma formation in plants. SEQ ID NO: 6 shows the sequence of the EPFL9 gene (At4g12970), a gene (stomagen gene) of unknown function that belongs to the EPF family.

[0004] On the other hand, environmental stresses such as high temperatures, drought, and salinity can cause losses in crop production, and various studies have been conducted on the effects of environmental stress on crops and methods for improving environmental stress resistance in crops. For example, Patent Document 3 proposes a method for enhancing stress resistance in the next generation of plants, which includes a step of subjecting the current generation of plants to stress treatment during the vegetative growth stage. The Examples section of this document describes how rice varieties Hitomebore and Sasanishiki were subjected to salt stress or low light stress during the vegetative growth stage to obtain seeds, and the next generation of rice plants grown from these seeds had enhanced cold tolerance at the booting stage.

[0005] Recent advances have revealed that plants memorize past environmental events and utilize this memory to respond to recurring environmental events. Elucidation of the epigenetic mechanisms used by plants under various environmental stresses has been ongoing, and it is known that they play an important role in regulating gene expression through small RNAs, histone modifications, DNA methylation, and other mechanisms (Non-Patent Document 1). The mechanism by which high temperatures during the ripening period delay seed germination in rice (Oryza sativa L.) has been studied, and it has been reported that high temperatures during ripening cause DNA methylation in the promoters of abscisic acid (ABA) catabolism-related genes and the α-amylase gene (Non-Patent Document 2). Furthermore, the effect of heat priming on the first generation of wheat on post-flowering heat stress tolerance in the next generation has been reported. This report showed that the progeny of heat-primed plants (PH) had higher grain yield, leaf photosynthesis, antioxidant enzyme activity, and less cell membrane damage under high temperature stress compared with the progeny of non-heat-primed plants (NH). Furthermore, the gene encoding lysine-specific histone demethylase 1 (LSD1), which is involved in epigenetic modification, was more highly expressed in PH than in NH. It was concluded that heat priming in the first generation induces transgenerational high-temperature tolerance and may be an effective means of dealing with high-temperature stress in wheat production (Non-Patent Document 3).

[0006] International Publication WO99 / 54471 (Patent Publication No. 2002-512035) International Publication WO2011 / 071050 (Patent No. 5825574) JP 2015-181370 Publication International Publication WO2023 / 191038

[0007] Kinoshita, T. et al., Epigenetic Memory for Stress Response and Adaptation in Plants. Plant Cell Physiol., 55(11): 1859-1863 (2014)Suriyasak, C. et al., Mechanism of delayed seedgermination caused by high temperature during grain filling in rice (Oryza sativa L.). Scientific Reports, 10: 17378 (2020)Heat Priming Induces Trans-generational Tolerance to High Temperature Stress in Wheat. Front. Plant Sci., 7: Article501 (2016)

[0008] The present inventors have found that cultivating seeds obtained from rice plants grown under high temperature stress during the ripening stage results in delayed germination, increased biomass, accelerated flowering, increased grain yield, and high temperature ripening tolerance. They have also found that such environmental stress is memorized in the seeds, allowing the production of seeds for agricultural production with enhanced environmental stress tolerance (Patent Document 4).

[0009] On the other hand, the effect of the environment during the grain filling period on the stomatal density of the next generation is unclear.

[0010] The present inventors discovered that when seeds obtained from plants cultivated under high temperature stress during the ripening stage are cultivated, the stomatal density of the grown next generation plants is controlled, and this discovery led to the completion of the present invention.

[0011] The present application provides the following: [1] A method for producing next-generation plants with controlled stomatal density, comprising the step of cultivating a plant under environmental stress. [2] The production method according to 1, wherein the step of cultivating a plant under environmental stress comprises controlling the temperature during the ripening stage of the plant. [3] The production method according to 1 or 2, wherein the control of stomatal density is by regulating methylation of the promoter region of a gene involved in stomatal density. [4] The method of any one of [1] to [3], wherein the stomatal density is controlled by methylation of a promoter region of a gene encoding any one of the following proteins: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; (B) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1 with one or more amino acids substituted, deleted, added, or inserted, with the exception that the portion corresponding to amino acids 236 to 330 is identical, and the protein has the property of controlling stomatal formation in plants; or (C) a protein consisting of an amino acid sequence with 60% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to amino acids 236 to 330 is identical, and the protein has the property of controlling stomatal formation in plants. [5] The method of [4], wherein methylation of the promoter region of the gene is controlled to reduce gene expression, thereby producing next-generation plants with increased stomatal density. [6] A plant with increased stomatal density, its seed or seedling, or a processed product thereof, obtained by the method of any one of [1] to [5]. [7] A method for fixing atmospheric carbon dioxide using the plant according to 6. [8] A method for cultivating the plant according to 6, comprising a step of foliar spraying a material. [9] A method for controlling the stomatal density of a next generation plant, comprising a step of cultivating the plant under environmental stress.

[10] The method according to 9, wherein the step of cultivating the plant under environmental stress comprises a step of controlling the temperature during the ripening period of the plant.

[0012] It is possible to produce next-generation plants with controlled stomatal density by utilizing existing superior varieties, without genetic manipulation or breeding through crossbreeding and fixation.

[0013] Plants with increased stomatal density can absorb more materials from the leaves.

[0014] Plants with increased stomatal density can fix more carbon dioxide from the atmosphere.

[0015] Increase in stomatal density during rice growth (field experiment). CS, control (22-32°C) developed seeds; HDS, heat (28-38°C) developed seeds. n=4. Student's t-test indicates significant differences with P<0.01** and P<0.001***. Increase in stomatal density (n=5) and stomatal conductance (n=3) during rice growth (pot experiment). CS, control (22-32°C) developed seeds; HDS, heat (28-38°C) developed seeds. n=3. Student's t-test indicates significant differences with P<0.01** and P<0.001***. Increase in biomass under elevated CO2 conditions. CS, control (22-32°C) developed seeds; HDS, heat (28-38°C) developed seeds. n=13. Student's t-test indicates significant differences (P<0.01**, P<0.001***). Identification of the gene responsible for increased stomatal density (OsYODA1). CS, control (22-32°C) developed seeds; HDS, heat (28-38°C) developed seeds. n=3. Student's t-test indicates significant differences (P<0.05*, P<0.01**). Methylation level of the OsYODA1 promoter region, which controls OsYODA1 gene expression. CS, control (22-32°C) developed seeds; HDS, heat (28-38°C) developed seeds. n=4. Student's t-test indicates significant differences (P<0.05*, P<0.01**, P<0.001***). Increased stomatal density in lettuce (Lactuca sativa). n=4. Student's t-test indicates significant differences (P<0.05*). Changes in photosynthetic rate, stomatal aperture, and transpiration rate due to increased stomatal density in lettuce (Lactuca sativa). YODA1 gene expression and seed methylation level in lettuce (Lactuca sativa). n=3. P<0.05*, P<0.01** indicate significant differences in Student's t-test.Stomatal density (n=10), biomass reduction (n=25), and AtYODA1 gene expression (n=3) in Arabidopsis thaliana. For biomass reduction (top center, bottom left, bottom center, bottom right), n=10. Student's t-test indicates significant differences of P<0.01** and P<0.001***. For AtYODA1 gene expression (top right), n=3. Student's t-test indicates significant differences of P<0.05* and P<0.01**. Increased stomatal density and high temperature tolerance in soybean (Glycine max (L.) Merr). n=4. Student's t-test indicates significant differences of P<0.01**. Increased photosynthetic rate in soybean (Glycine max (L.) Merr). n=3. *P<0.05*, *P<0.01** indicates a significant difference in Student's t-test. Reduction in stomatal density and heat tolerance in barley (Hordeum vulgare L.). n=4. *P<0.05* indicates a significant difference in Student's t-test. Reduction in stomatal density in wheat (Triticum aestivum L.). n=4. *P<0.01** indicates a significant difference in Student's t-test. Increase in stomatal density in maize (Zea mays). n=3. *P<0.05*, *P<0.01** indicates a significant difference in Student's t-test. Increase in stomatal density in strawberry (Fx ananassa). n=3. *P<0.05*, *P<0.01** indicates a significant difference in Student's t-test. Amino acid sequence of OsYODA1 (OsMPKKK10) (SEQ ID NO:1). The conserved N-terminal regulatory domain is underlined.

[0016] [Control of stomatal density] The present invention relates to a method for controlling the stomatal density of a next-generation plant, which comprises a step of exposing the plant to environmental stress. By controlling the stomatal density of the next-generation plant, it is possible to produce a next-generation plant with a controlled stomatal density. Therefore, in one embodiment, the present invention provides a method for producing a next-generation plant with a controlled stomatal density, which comprises a step of exposing the plant to environmental stress.

[0017] In a preferred aspect, the step of exposing the plant to environmental stress includes a step of controlling the temperature during the ripening period of the plant. By controlling the stomatal density of the next generation plant, it is possible to produce a next generation plant with a controlled stomatal density. Therefore, one embodiment of the present invention is a method for producing a next generation plant with a controlled stomatal density, which includes a step of controlling the temperature during the ripening period of the plant.

[0018] Pore ​​density is the number of pores per area (number / mm 2 ) Stomata are found in various parts of plants, such as leaves, sepals, and petals, but when referring to stomatal density in the present invention, it refers to the stomatal density of leaves, unless otherwise specified. Leaves usually have stomata on both the adaxial and abaxial surfaces, but the method of the present invention can control the stomatal density on both surfaces. Stomatal density of plants can be determined by methods well known to those skilled in the art, such as the Sump method. Control includes upward control (when stomatal density increases) and downward control (when stomatal density decreases).

[0019] In this embodiment, the stomatal density of a plant is controlled by controlling the temperature during the ripening period of the parental generation of the plant. More specifically, by controlling the methylation of the promoter region of a gene involved in stomatal density, it is possible to produce a next-generation plant with controlled stomatal density. Methylation of the promoter region of a gene is known to be associated with its transcriptional regulation (Zhang et al. 2006).

[0020] The gene involved in stomatal density encodes one selected from the group consisting of FAMA, MUTE, SPCH1, SPCH2, YODA1, YODA2, ICE1, ICE2, SHR1, SHR2, SCR1, SCR2, SDD1, RSD1, EPF1, EPFL9, FLP, and PAN2. In a preferred embodiment, next-generation plants with controlled stomatal density are produced by regulating the transcription or expression of the YODA1 gene, one of the genes involved in stomatal density. YODA1 is known to suppress stomatal formation by suppressing the expression of SPCH (Samakovli et al. 2020, Molecular Plants).

[0021] The YODA1 gene may be a gene encoding any one of the following proteins: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence in which one or more amino acids have been substituted, deleted, added, or inserted in the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to the portion consisting of amino acids at positions 236 to 330 is identical, and which has the property of regulating stoma formation in plants; (C) a protein consisting of an amino acid sequence having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to the portion consisting of amino acids at positions 236 to 330 is identical, and which has the property of regulating stoma formation in plants.

[0022] The YODA1 gene may be a gene encoding any one of the following proteins: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence in which one or more amino acids have been substituted, deleted, added, or inserted in the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to the portion consisting of amino acids at positions 236 to 330 is identical, and which has the property of regulating stoma formation in plants; (C) a protein consisting of an amino acid sequence having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to the portion consisting of amino acids at positions 236 to 330 is identical, and which has the property of regulating stoma formation in plants.

[0023] The amino acid sequence of OsYODA1 (OsMPKKK10) derived from rice (Oryza sativa L. cv. Nipponbare) is shown in SEQ ID NO:1 in the sequence listing.

[0024] In the present invention, unless otherwise specified, the term "sequence identity" for amino acid sequences or nucleotide sequences (sometimes referred to as "base sequences") refers to the percentage of identical positions shared between the two sequences when the two sequences are optimally aligned. That is, identity can be calculated as follows: identity = (number of identical positions / total number of positions) × 100. This can be calculated using commercially available algorithms. Furthermore, such algorithms are incorporated into the NBLAST and XBLAST programs described in Altschul et al., J. Mol. Biol. 215 (1990) 403-410. Nucleotide sequence identity can be calculated using programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, those skilled in the art can appropriately set parameters, or the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art.

[0025] In the present invention, unless otherwise specified, high sequence identity refers to sequence identity of 60% or more, 64% or more, 65% or more, 69% or more, 70% or more, 72% or more, 75% or more, 76% or more, 77% or more, 78% or more, 79% or more, preferably 80% or more, 81% or more, 83% or more, 84% or more, more preferably 85% or more, 86% or more, 89% or more, even more preferably 90% or more, even more preferably 95% or more, even more preferably 97.5% or more, and even more preferably 99% or more.

[0026] In the present invention, when it is said that one or several amino acids or nucleotides (sometimes referred to as bases) have been substituted, deleted, added or inserted into a sequence, the number means, in each case, 1 to 400, 1 to 350, 1 to 300, 1 to 250, 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 18, 1 to 16, 1 to 14, 1 to 12, 1 to 10 or 1 to 9, unless otherwise specified.

[0027] The sequence identities between rice-derived OsYODA1 and its counterparts from other plants (analysis by https: / / phytozome-next.jgi.doe.gov) are shown in the table below.

[0028]

[0029]

[0030]

[0031] In a preferred embodiment, the stomatal density of the next generation of plants is controlled by controlling the methylation level of the promoter region of the YODA1 gene, one of the genes involved in stomatal density. In the case of rice, the promoters whose methylation levels are controlled are the P1, P2, and P3 promoters of OsYODA1. The relevant sequences are shown below.

[0032] OsYODA1 - P1 (SEQ ID NO:2) CAAAAGATGGTGGCTAGATGATCTGGGTTAAAAACCTCATCCCTTCTAATTTGATATTATATCATTCTCTAATATTCGCGTCTTTTTAATCGATGATGAATGAATGACATCCCTTTTCTTTTGTAGCGAGTGAAAGTGTAGTTATTTT

[0033] OsYODA1 - P2 (SEQ ID NO:3) TCGGTTTAATTGTACACCGAATCACCAATTAATCAACTCTTTTTTTTTTTTAGATTTTATAGATCCAACAAAAATTTATAGAGTCCATCATAATGCTCTTTGACATTTTGTTAAAAA GTTAATCTAAAATGTTTGCCGTCGTACAATTGTGAAAGGTCTATTTAGAACAAAGGTTAAAACACAAAAATTAGAAACATTTCTCATACACAAATAATAGTAACGATAGGCATGCTGATGGCA

[0034] OsYODA1 - P3 (SEQ ID NO:4) AACGGACCGTCTCGATGAAGCTACCGTAGTCCGTAGCAACGGCGCCTTATATATCCCCTCCATATCGAGGCTCGAAGCGTACTCGGTACTGCGGTAGCACGCCTGGGAACACAGACAGGGGGAAAAAAAAAGAACCGTTGCTACCGATGTCCCGTATCCCCTCCATATCGAGGCTCGAAGCGTACTCGTACTGCGGTAGCACGCCTGGGAACACAGACAGGGGGAAAAAAAAAGAACCGTTGCTACCGATGTCCCG

[0035] LsYODA1:promote (Lettuce) (SEQ ID NO:5) THE TACATIONSINGGENCE INFORMATION OF THE TACATIONAL TAACATIONAL TAACATIONAL AND TACATIONALCTIONALCTATCTALCT CONSCTALCT CONSCTALCT CONSCTALCT CONSCTALCT CONSCTALCT CONSCTCTCTCTCTED

[0036] AtYODA1:promoter (Arabidopsis) (SEQ ID NO:6) GTGGTCAAAACACCAATGGGATAATAATAAAATGGTGTTTATATTGGGACTTTTCTTCGTTTGTTGACCTATGTTGGGTCAACCAAGTATGATCTCTGAAGTGGTCAAAAGGAGAGTTACTTTGTAATGTTGAACAAGAGCTTTTAAAAGAGTGATAGTGTGAGTGAGTGTGCCTCTTGGTTTGTGGGAAGAAG

[0037] HvYODA1:promoter (Barley) (SEQ ID NO:7) AATCCCAAAGCCACGGGTCAACCAGACCCCAACCCGGTCCAGCACCGAGTTCCCTCGAGCCTTGCAGTTTGCGGTTGGAAGGCAGAGGGGATCGATCCCGGCAGGCGAGCCGCGGCGATCGTGTGGCGGTTGCCGCTTTGCCTCAGTTTCCACTGCTGTGTCTGTGTGTGTGG

[0038] Promoters corresponding to the above promoters are also commonly found in plants other than rice, lettuce, Arabidopsis, and barley. Those skilled in the art can appropriately obtain corresponding sequences from databases such as Phytozome (https: / / phytozome-next.jgi.doe.gov / ) based on the accession numbers in the above table.

[0039] The promoter whose methylation level is controlled may be any of the following polynucleotides: (a) a protein consisting of the nucleotide sequence set forth in any one of SEQ ID NOs: 2 to 7; (b) a polynucleotide consisting of an amino acid sequence in which one or more nucleotides have been substituted, deleted, added or inserted in the nucleotide sequence set forth in any one of SEQ ID NOs: 2 to 7, and having the property of controlling the expression of a gene operably linked downstream thereof; (c) a polynucleotide consisting of a sequence having a high sequence identity with the nucleotide sequence set forth in any one of SEQ ID NOs: 2 to 7, and having the property of controlling the expression of a gene operably linked downstream thereof.

[0040] [Environmental Stress, Temperature Control During Ripening] Examples of environmental stress include temperature stress (high temperature stress or low temperature stress), salt stress, low light stress, high light stress, drought stress, excessive humidity stress, high temperature stress, low temperature stress, nutritional stress (e.g., low nitrogen stress), heavy metal stress, disease stress, oxygen deficiency stress, ozone stress, CO2 stress, and strong wind stress. The environmental stress is preferably temperature stress (high temperature stress or low temperature stress) during seed development, or nutritional stress, such as low nitrogen stress. The step of exposing a plant to temperature stress can be carried out, for example, by controlling the environmental temperature of the plant to a low or high temperature. Furthermore, the step of exposing a plant to nutritional stress, more specifically low nitrogen stress, can be carried out, for example, by controlling the amount of nitrogen provided to the plant to a low level.

[0041] In the present invention, the term "ripening period" refers to the period during which seeds develop, unless otherwise specified.

[0042] When the step of exposing a plant to environmental stress is carried out by controlling the temperature during the ripening period, the temperature during the ripening period can be controlled by exposing the plant during the ripening period to a temperature higher or lower than the temperature normally experienced during the ripening period for that plant. With regard to temperature control during the ripening period, a high temperature refers to a temperature that is higher than the reference temperature by, for example, 2 to 8°C or more, 3 to 7°C, or 4 to 6°C, and a low temperature refers to a temperature that is lower than the reference temperature by, for example, 2 to 8°C, 3 to 7°C, or 4 to 6°C.

[0043] In one preferred embodiment, when the plant is a grass, the temperature during the ripening period is controlled by cultivating the plant at an environmental temperature that is at least 5°C higher than the average temperature during that period, for example, for at least 6 weeks after heading.

[0044] A preferred example of temperature control during the grain filling period is as follows: In the case of wheat, the environmental temperature during the grain filling period is set to a temperature higher than 15°C, for example, 20 to 33°C, 22 to 32°C, or 25 to 31°C. In the case of barley, the environmental temperature during the grain filling period is set to a temperature higher than 15°C, for example, 20 to 33°C, 22 to 32°C, or 25 to 31°C. In the case of lettuce, the environmental temperature during the grain filling period is set to a temperature higher than 20°C, for example, 21 to 33°C, 22 to 32°C, 25 to 31°C, or 27 to 40°C, 28 to 38°C, or 29 to 36°C. In the case of soybean, the environmental temperature during the grain filling period is set to a temperature higher than 20°C, for example, 21 to 33°C, 22 to 32°C, 25 to 31°C, or 27 to 40°C, 28 to 38°C, or 29 to 36°C. For corn, the ambient temperature during the grain filling period is set to a temperature higher than 20°C, for example, 21-40°C, 23-40°C, 25-40°C, 27-40°C, 28-38°C, or 29-36°C. For strawberries, the ambient temperature during the grain filling period is set to a temperature higher than 10°C, for example, 11-33°C, 13-33°C, 15-33°C, 17-33°C, 18-28°C, 19-23°C, or 21-34°C, 22-32°C, or 23-30°C. In either case, the target plants are grown under controlled temperatures for one or more days, three or more days, one or more weeks, three or more weeks, or six or more weeks.

[0045] [Methylation Level] In the present invention, the term "effectively controlled methylation level" refers to the level of methylation that can control the expression of downstream genes, unless otherwise specified. The level of methylation may be higher or lower than the methylation level of a standard individual by a certain percentage or more.

[0046] The methylation level can be determined by measuring the degree of methylation of DNA extracted from the target seeds by an appropriate method. The measurement method is not particularly limited, and any of the following may be used: (A) a method of fragmenting and concentrating methylated DNA and then analyzing the methylated DNA, (B) an analysis method of bisulfite treatment followed by sequencing, (C) an analysis method using a methylation-sensitive restriction enzyme, or (D) an analysis method using a methylation-specific PCR method.

[0047] One suitable example is a method in which single-stranded DNA is fragmented by sonication or enzymes, and then 5-methylcytosine (5-mC) on the single-stranded DNA (ssDNA) fragments is immunoprecipitated and enriched using an antibody against 5-mC. Commercially available kits, such as the MeDIP Kit, can be used for this measurement.

[0048] Methylation levels can be expressed as % input, which is the percentage of methylated DNA relative to the DNA used for analysis (input) (https: / / www.diagenode.com / files / products / kits / magmedip-qpcr-kit-manual.pdf).

[0049] Examples of promoters and preferred methylation levels are listed below.

[0050] Relative methylation level of the P1 promoter of the rice OsYODA1 gene: 0.050% input or more, preferably 0.060% input or more, more preferably 0.065% input or more, and even more preferably 0.069% input or more.

[0051] Relative methylation level of the P2 promoter of the rice OsYODA1 gene: 0.020% input or more, preferably 0.023% input or more, more preferably 0.026% input or more, and even more preferably 0.029% input or more.

[0052] Relative methylation level of the P3 promoter of the rice OsYODA1 gene: 0.012% input or more, preferably 0.014% input or more, more preferably 0.016% input or more, and even more preferably 0.018% input or more.

[0053] Relative methylation level of the P1 promoter of the LsYODA1 gene of lettuce: 0.70% input or more, preferably 1.00% input or more, more preferably 1.40% input or more, and even more preferably 1.80% input or more.

[0054] Relative methylation level of the barley YODA1 gene promoter: 0.055% input or more, preferably 0.060% input or more, more preferably 0.070% input or more, and even more preferably 0.075% input or more.

[0055] [Plants] The plants to which the present invention is applicable are not particularly limited. They can be herbaceous or woody. They can also be monocotyledonous or dicotyledonous. Examples of plants include Amborellales, Nymphales, Austrobaileales, Craniales, Caneales, Piperales, Laurales, Magnoliales, Calamales, Salviales, Dioscoreales, Pandanales, Liliales, Asparagales, Dasypogonaceae, Palmales, Poales, Commelales, Zingiberales, Brussels Alderales, Ranunculales, Aquifoliaceae, Proteales, Buxales, Tritrichales, Celastraceae, and Aquilegiales. Examples of plants include plants belonging to any order selected from the Oxalidales, Fabaceae, Rosales, Cucurbitales, Fagales, Geraliales, Myrtales, Crossosomatales, Sapindales, Fuerteales, Brassicales, Malvales, Vitales, Saxifragales, Lobiaceae, Berberidopsisales, Santalaceales, Caryophyllales, Cornales, Ericales, Galliales, Gentianales, Lamiales, Solanales, Ilexales, Umbelliales, Asterales, and Dipsacales. Preferably, the plant belongs to any one of the following orders: Poales, Brassicles, Malvales, Sapindales, Myrtales, Scutellariales, Fabaceae, Cucurbitales, Rosales, Vitales, Asterales, Lamiales, Solanales, Caryophyllales, Ranunculales, Zingiberales, and Coniferales (also known as Pinales).

[0056] Examples of suitable plants include rice (O. sativa), watercress (A. thaliana), turnip mustard (B. rapa), papaya (C. papaya), cacao (T. cacao), orange (C. sinesis), eucalyptus (E. grandis), poplar (P. trichocarpa), soybean (G. max), cowpea (V. unguiculata), cucumber (C. sativus), strawberry (F. ananassa), grape (V. vinifera), lettuce (L. sativa), sunflower (H. annuus), olive (O. europaea), tomato (S. lycopersicum), amaranth (A. hypochondriacus), sugar beet (B. vulgaris), spinach (S. oleracea), Colorado blue columbine (A. coerulea), and corn (Z. mays), wheat (T. aestivum), barley (H. vulgare), banana (M. acuminata), Douglas-fir (P. menziesii), and red pine (P. sylvestris).

[0057] In the present invention, unless otherwise specified, the term "plant" refers to an individual plant or a part thereof. Furthermore, the term "part" refers to seeds (including germinated seeds and immature seeds), organs or parts thereof (including leaves, roots, stems, flowers, stamens, pistils, and their fragments), plant cultured cells, callus, and protoplasts. Plants include genetically engineered plants and transformed plants. Plants include harvested material and propagation material. In the present invention, propagation material refers to all or part of a plant used for propagation (sometimes called seedlings), unless otherwise specified, and includes, for example, seeds, seedlings (saplings, plants), scions, bulbs, cells, callus, and shoots. In the present invention, harvested material is used in its ordinary sense, unless otherwise specified, and includes all or part of a plant not used for propagation, such as harvested rice and unhulled rice when the plant is rice. Harvested material is also sometimes referred to as crop or agricultural product. Unless otherwise specified, the term "processed products" used in this invention refers to processed products produced directly or indirectly from harvested products. The scope of this invention includes at least processed products that reflect the characteristics of the harvested products of this invention. For example, if the plant is rice, processed products include polished rice, cooked rice, rice flour, breads made with rice flour, confectioneries, buns, pizza, and alcohol.

[0058] In the present invention, when referring to a plant, the term "progeny" refers to a plant that has the plant as at least one genetic parent and / or ancestor, unless otherwise specified. Progeny includes the progeny (e.g., T1) obtained from the parent transformed plant or its progeny, as well as the hybrid progeny (e.g., F1) with T0 or T1 as one parent and its progeny, as long as the desired trait is inherited. The progeny of the first generation is sometimes referred to as the next generation. Progeny includes the next generation, the generation after that, etc.

[0059] [Plants with increased stomatal density and uses thereof] The present invention also provides plants with increased stomatal density, seeds and seedlings thereof, or processed products thereof, obtained by the above-mentioned production method. The plants with increased stomatal density provided by the present invention have useful characteristics. Examples of useful characteristics for the present invention include increased biomass, improved carbon dioxide fixation capacity, and high-temperature tolerance.

[0060] Plants with increased stomatal density have an improved ability to absorb carbon dioxide, making them more efficient at fixing carbon dioxide in the atmosphere and capable of fixing more carbon dioxide. Furthermore, plants with increased stomatal density can be expected to achieve higher yields because they have increased carbon dioxide absorption and therefore increased carbon fixation. Furthermore, plants with increased stomatal density can absorb more materials (fertilizers, such as the three elements nitrogen, phosphorus, and potassium, as well as middle and trace elements; pesticides and other chemicals) from their leaves, reducing the amount of materials sprayed, which is thought to contribute to the production of agricultural crops with less impact on the environment.

[0061] As a plant used for such a purpose, a vascular plant is preferred because of the significant effect of increasing stomatal density. Vascular plants are not particularly limited, but examples thereof include legumes such as soybean, grasses such as rice, crucifers such as Arabidopsis, Salicaceae such as black cottonwood, and Selaginellaceae such as Selaginella serrata.

[0062] <Rice> [Materials and Methods] 1. Plant Materials, Growth Conditions, and Growth Measurements. Rice (Oryza sativa L. cv. Nipponbare) was grown under natural conditions at the Hakozaki Campus of Kyushu University (Fukuoka Prefecture, Japan, 33°67'N, 130°42'E) from 2015 to 2018, and at the Ito Campus of Kyushu University (Fukuoka Prefecture, Japan, 33°37'N, 130°25'E) from 2019 to 2020. Rice plants were grown under control conditions and then subjected to high temperature stress during the grain filling stage as previously reported (Suriyasak et al. 2020). For growth measurements, one 3-week-old rice seedling from each of the control and high-temperature-ripened seeds was transplanted into a 1 / 5000 Wagner pot with basal fertilizer. The basal fertilizer was as described in a previous study (Suriyasak et al. 2020).

[0063] 2. Analysis of stomatal density, stomatal conductance, and transpiration rate, biomass under elevated CO2 conditions, and photosynthetic rate analysis. Rice (Oryza sativa L. cv. Nipponbare) was sown in 400 ppm or 800 ppm CO2 (also at 25°C) and sampled three weeks after sowing. Photosynthetic rate analysis was performed according to the method described in the literature (Egashira et al. 2020).

[0064] 3. Comprehensive DNA Methylation Analysis by Whole-Genome Bisulfite Sequencing (WGBS). Genomic DNA for each sample was extracted from 20 dried seeds using the IsoSpin Plant DNA Extraction Kit (Nippon Gene). Pooled gDNA from 10 samples from each treatment was subjected to bisulfite treatment before sequencing. Reference genome sequences, gene and TE (transposable element) annotations were obtained from the RAP-DB. Methylation levels greater than 1.25-fold (±25% difference between control and treatment) (P value less than 0.05) were identified as differentially methylated sites (DMPs) and differentially methylated regions (DMRs). The extracted DMRs were screened in 100-bp increments using a sliding window. DMRs within 3000 bp upstream and downstream of the coding region were considered to be the promoter TSS (transcription start site). Gene Ontology (GO) analysis was performed using the PANTHER software with the analysis sets "GO biological process complete," "GO molecular function complete," and "GO cellular component complete" and the 'Fisher's Exact' test with 'No correlation'. Genes involved in each GO were tabulated in descending order of number.

[0065] 4. RNA Sequencing and Quantitative Real-Time PCR. RNA sequencing was performed using seedlings 18 days after sowing. All differentially expressed genes (DEGs, P < 0.05) were analyzed, and a heat map of RNA reads was generated using OriginPro. GO analysis of DEGs was performed using the same method as described above for DMRs. For quantitative real-time PCR (qRT-PCR), cDNA was synthesized from the extracted RNA using ReverTra Ace reverse transcriptase (Toyobo) according to the manufacturer's instructions. Quantitative real-time PCR was performed using a CFX Connect Optical Module Real-Time PCR Detection System (Bio-Rad) with SYBR Green (Toyobo) according to the manufacturer's instructions. The primers used for qRT-PCR are listed in Supplementary Table S5. PCR conditions were as follows: After initial denaturation at 94°C for 2 minutes, 40 cycles of denaturation at 94°C for 20 seconds, annealing at a temperature selected for each primer for 20 seconds, and extension at 72°C for 20 seconds were repeated. The plates were then melted and read. Results were normalized based on the expression levels of OsUBQ (leaf samples) or OsActin (root and maturing grain samples).

[0066] 5. DNA Methylation Analysis by MeDIP-qPCR. Genomic DNA was extracted from dried seeds and seedlings using the DNeasy Plant Mini Kit (Qiagen) and sheared to approximately 500 bp fragments by sonication. For MeDIP-qPCR, immunoprecipitation was performed using 1000 ng of sheared DNA using an immunoprecipitation kit (Active Motif) as described in the manufacturer's protocol. The immunoprecipitated DNA was subjected to qRT-PCR to detect sites with altered DNA methylation levels. % input was calculated as described in the manufacturer's protocol (https: / / www.diagenode.com / files / products / kits / magmedip-qpcr-kit-manual.pdf). Specifically, % input is the ratio of DNA precipitated by the methylation antibody to the DNA used for analysis (input).

[0067] [Results] 1. High temperature stress during ripening alters phenotypes and increases stomatal density in progeny plants. To clarify how high temperature stress during ripening affects phenotypic changes in progeny, seeds from control and high temperature-stressed plants (the former matured at 22-32°C, and the latter matured at 28-38°C) were sown and grown under natural conditions. In field experiments, plants grown from seeds ripened at high temperatures exhibited significantly increased stomatal density on both the adaxial and abaxial surfaces compared with the control (Fig. 1). In pot experiments, plants grown from seeds ripened at high temperatures also exhibited significantly increased stomatal density, stomatal conductance, and transpiration rate compared with the control (Fig. 2). Furthermore, when grown under elevated CO2 conditions, plants grown from seeds ripened at high temperatures exhibited significantly increased biomass six weeks after sowing compared with the control. In particular, when seeds ripened at high temperatures were grown under 400 ppm CO2, the biomass yield was significantly higher in the latter than in the latter under 800 ppm CO2 (Fig. 3). It was found that plants grown from seeds ripened at high temperatures can fix large amounts of CO2 under elevated CO2 conditions.

[0068] 2. High temperature stress during ripening induces global methylome changes in dry seeds. We hypothesized that epigenetic regulation, particularly DNA methylation, may play an important role in this transgenerational memory. We generated methylomes by comparing methylated cytosines at a single base level between control and heat-stressed seeds. Global methylation analysis by whole-genome bisulfite sequencing (WGBS) revealed that 56.6%, 27.0%, and 14.1% of cytosine residues were methylated in CG, CHG, and CHH contexts, respectively, in control seeds. In heat-stressed seeds, a total of 3,991,072,994 cytosines were sequenced, and 57.8%, 28.5%, and 15.5% were methylated in CG, CHG, and CHH contexts, respectively (Table 1).

[0069]

[0070] In summary, high temperature stress during grain filling induced approximately 1% hypermethylation of methylated cytosines across all chromosomal contexts. The average methylation levels across all chromosomal contexts were plotted in 1-Mbp windows as a chromosomal map, revealing genome-wide changes in methylation levels in high-temperature stressed seeds compared with controls. Next, we identified differentially methylated regions (DMRs) in high-temperature ripening seeds compared with controls. We identified 268 hypermethylated DMRs and 189 hypomethylated DMRs, for a total of 457 DMRs. The distribution of DMRs revealed that the majority of DMRs in CG contexts overlapped with gene promoters, followed by TE regions with both hypermethylated and hypomethylated DMRs.

[0071] On the other hand, in non-CG contexts, the majority of DMRs were located in TE regions, followed by promoter regions. Furthermore, retrotransposons were found to have the highest number of DMRs overlapping with TEs. GO analysis of DMRs overlapping with protein-coding genes revealed that DMRs associated with stress response, metal ion transport, response to oxidative stress, and various other biological processes were enriched.

[0072] This suggests that exposure to high temperature stress during the grain filling stage induces global methylome changes, particularly in the promoter regions of coding genes.

[0073] 3. High temperature stress during the ripening period leads to transcriptional changes during the vegetative growth of progeny. To gain a deeper understanding of how global DNA methylation changes during plant development affect transcriptional regulation, we performed RNA sequencing analysis using RNA from progeny leaves during the vegetative growth period.

[0074] As a result, the expression of OsYODA1 (SEQ ID NO:1), a gene involved in stomatal development, was reduced in the progeny (Fig. 4). YODA1 is known to suppress SPCH expression and inhibit stomatal formation (Samakovli et al. 2020, Molecular Plants).

[0075] These findings suggest that the decreased expression of OsYODA1 may play an important role in the stomatal density phenotype in progeny plants exposed to high temperature stress during the grain filling stage.

[0076] 4. Changes in DNA methylation in dry seeds are maintained in developing progeny and are involved in transcriptional regulation. These results indicate that changes in OsYODA1 expression during plant development are involved in stomatal density in high-temperature-stressed plants, suggesting that changes in DNA methylation levels in the promoters of these genes may play an important role in transcriptional regulation. Therefore, we analyzed the DNA methylation levels of the OsYODA1 gene promoter in both dry seeds and developing progeny by MeDIP-qPCR (methylated DNA immunoprecipitation-qPCR) using locus-specific amplicons.

[0077] The results showed that the promoter regions of OsYODA1 (P1 (SEQ ID NO:2), P2 (SEQ ID NO:3), and P3 (SEQ ID NO:4)) were significantly hypermethylated in dry seeds and seedlings exposed to high temperature stress (Fig. 5).

[0078] Taken together, these data suggest that high temperature stress during grain filling induces promoter hypermethylation of OsYODA1, resulting in the stomatal density phenotype, and that the DNA methylation state is partially maintained from dry seeds to developing organs in progeny.

[0079] [Discussion] The results of this study showed that progeny plants of rice whose parent plants were subjected to high temperature stress during the grain filling stage had an increased stomatal density compared to the control.

[0080] The results of this study showed that high temperature stress during the ripening stage caused significant hypomethylation of the OsYODA1 promoter in dry seeds and progeny leaves, resulting in reduced OsYODA1 gene expression.

[0081] Methylation in gene promoter regions is known to be associated with transcriptional regulation (Zhang et al. 2006). In this study, DMRs were most frequently found in gene regions, particularly promoters, suggesting their potential contribution to various transcriptional changes during development. DMRs were also found in TE regions, particularly retrotransposons, which are known to affect gene expression in response to various stimuli (Galindo-Gonzalez et al. 2017). While this study suggests a role for DNA methylation in transgenerational memory in rice, further elucidation of other epigenetic markers, such as TE regulation and histone modifications, is required.

[0082] In conclusion, this study suggests that high temperature stress during ripening significantly affects the phenotypic changes in progeny plants through global DNA methylation in seeds, some of which is maintained at specific loci in developing organs and is involved in transcriptional regulation. Among the observed phenotypic changes, increased stomatal density and the resulting improved CO2 fixation are traits advantageous for rice production and are likely to bring great benefits to humanity.

[0083] Lettuce, Arabidopsis, barley, wheat, soybean, corn, and strawberry. Materials and methods: Monocotyledonous barley (Hordeum vulgare L. cv. Ichibanboshi), wheat (Triticum aestivum L. cv. Shiroganekomugi), dicotyledonous Arabidopsis (Arabidopsis thaliana accession Col-0), lettuce (Lactuca sativa cv. Chimasanthu), and soybean (Glycine Max (L.) Merr. cv. Fukuyutaka) were cultivated in the same manner as rice. Corn (Zea mays L. cv. P2088) and strawberry (Fragaria x ananassa cv. Toyonoka) were also cultivated.

[0084] [Results] The results obtained, along with the cultivation and experimental conditions, are shown in Figures 6 to 15. It was demonstrated that stomatal density can be controlled by controlling the temperature during ripening in both monocotyledonous and dicotyledonous plants.

[0085] For barley, wheat, and soybean, the effects were analyzed using a FLIR C2 (FLIR System AB, Sweden) thermography camera 3, 2, and 1 days after treatment, respectively. It was found that the temperatures around the progeny plants with increased stomatal density were lower (Fig. 10, bottom right; Fig. 12, bottom right; Fig. 13, bottom right), indicating that they had increased transpiration and were more heat-resistant.

[0086] In lettuce and barley, the relative methylation level of the YODA1 gene promoter (SEQ ID NOs: 5 and 7) increased, confirming decreased YODA1 gene expression (Figures 8 and 12). In Arabidopsis, the relative methylation level of the YODA1 gene promoter (SEQ ID NOs: 6) decreased, confirming increased YODA1 gene expression (Figure 9).

[0087] <References cited in the Examples section> 1) Suriyasak, C. et al. Mechanism of delayed seed germination caused by high temperature during grain filling in rice (Oryza sativa L.). Sci. Rep. 10, 17378 (2020). (Non-Patent Document 2 cited above) 2) Zhang, X. et al. Genome-wide high-resolution mapping and functional analysis of DNA methylation in Arabidopsis. Cell 126, 1189-1201 (2006). 3) Galindo-Gonzalez, L. et al. LTR retrotransposons in plants: Engines of evolution. Gene 626, 14-25 (2017). 4) Egashira et al. A rapid translocation of photoassimilates from source organs maintains grain yield in cowpea subjected to drought stress during grain filling. Biologia plantarum 64:529-534 (2020). 5) Samakovli et al. Molecular Plants YODA-HSP90 Module Regulates Phosphorylation-Dependent Inactivation of SPEECHLESS to Control Stomatal Development under Acute Heat Stress in Arabidopsis. Molecular Plant 13, 612-633 (2020).

[0088] <Sequences listed in the sequence listing> SEQ ID NO:1 OsYODA1 amino acid sequence SEQ ID NO:2 OsYODA1 P1 nucleotide sequence SEQ ID NO:3 OsYODA1 P2 nucleotide sequence SEQ ID NO:4 OsYODA1 P3 nucleotide sequence SEQ ID NO:5 LsYODA1:promoter (Lettuce) nucleotide sequence SEQ ID NO:6 AtYODA1:promoter (Arabidopsis) nucleotide sequence SEQ ID NO:7 HvYODA1:promoter (Barley) nucleotide sequence

[0089] The present invention enables the production of plants with controlled stomatal density, which is useful in fields such as agriculture and industrial crop production. Plants with increased stomatal density can absorb more materials through their leaves, allowing for a reduction in the amount of materials sprayed, which is thought to contribute to the production of agricultural crops with less environmental impact. Furthermore, because plants with increased stomatal density can fix more carbon dioxide from the atmosphere, the present invention is expected to be useful in applications such as increasing the amount of carbon dioxide absorbed by forests.

Claims

1. A method for producing a progeny plant having controlled stomatal density, comprising cultivating a plant under environmental stress.

2. The method according to claim 1, wherein the step of cultivating under environmental stress includes a step of controlling the temperature during the ripening stage of the plant.

3. The production method according to claim 1, wherein the control of stomatal density is by controlling methylation of the promoter region of a gene involved in stomatal density.

4. The method of claim 1, wherein the control of stomatal density is by controlling methylation of a promoter region of a gene encoding any one of the following proteins: (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence in which one or more amino acids have been substituted, deleted, added or inserted in the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to the portion consisting of amino acids at positions 236 to 330 is identical, and the protein has the property of controlling stomatal formation in plants; (C) a protein consisting of an amino acid sequence having 60% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 1, with the exception that the portion corresponding to the portion consisting of amino acids at positions 236 to 330 is identical, and the protein has the property of controlling stomatal formation in plants.

5. The method of claim 4, wherein the expression of the gene is reduced by controlling the methylation of the promoter region of the gene, thereby producing a progeny plant having increased stomatal density.

6. A plant, its seedling, or a processed product thereof having an increased stomatal density obtained by the method according to claim 5.

7. A method for fixing atmospheric carbon dioxide using the plant according to claim 6.

8. A method for cultivating the plant according to claim 6, comprising a step of spraying the material on the leaves.

9. A method for controlling stomatal density in a progeny of a plant, comprising the step of cultivating the plant under environmental stress.

10. The method according to claim 9, wherein the step of cultivating under environmental stress comprises controlling the temperature during the ripening stage of the plant.