Modified cordyceps containing high content of cordycepin and method for preparing the same
The Cordyceps militaris SS2.0 strain addresses low cordycepin content by producing 10,000 to 30,000 ppm, enhancing immune benefits and alleviating atopic dermatitis and inflammation through specific cultivation and extraction methods.
Patent Information
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- 박수율
- Filing Date
- 2025-01-22
- Publication Date
- 2026-07-29
AI Technical Summary
Existing methods for producing Cordyceps militaris result in low content of cordycepin, an active ingredient with immune-boosting and disease-alleviating properties, necessitating a strain with enhanced cordycepin production.
Development of a Cordyceps militaris SS2.0 strain (accession number KFCC11997P) capable of producing 10,000 to 30,000 ppm of cordycepin, involving sterilization and cultivation in specific media conditions, followed by extraction processes to enhance cordycepin content.
The Cordyceps militaris SS2.0 strain produces high levels of cordycepin, effectively suppressing immune hypersensitivity, improving atopic dermatitis, inflammation, and immune hypersensitivity reactions.
Smart Images

Figure PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a mutant Cordyceps mycelium and a method for producing the same, specifically to a mutant Cordyceps that does not have a fruiting body and a method for producing the same. Background Technology
[0002] Cordyceps Cordyceps militaris ) is a general term for fungi of the Ascomycetes that grow inside an insect using the insect as a host and then break through the insect to form a fruiting body under certain conditions, or the fruiting body itself.
[0003] Fungi that produce Cordyceps have host specificity depending on the type, for example, Cordyceps sinucider ( Cordyceps sicadae ) uses cicadas as a host, and Ophiocordyceps sinensis( Ophiocordyceps sinensis ), Silomyces happyili( Paesilomyces hepiallid ) and Lecanisirium( Lecanicillium ...etc. use bat moth larvae as hosts. On the other hand, Cordyceps militaris ( Cordyceps militaris It uses various insects as hosts and extends fruiting bodies outward to spread spores by spreading within the host's body. The most significant characteristic of the fruiting body of the militaris fungus is that it appears mainly during the pupal stage and is club-shaped or cylindrical, displaying orange and brown colors.
[0004] Cordyceps has long been known as an elixir of longevity and is widely used as a medicinal herb for the treatment of respiratory diseases, including asthma, and liver diseases, including jaundice. Recently, extensive research has been conducted on the immune-boosting effects of Cordyceps. However, research results to date have shown a problem in that the content of cordycepin, an active ingredient that exhibits effects such as alleviating respiratory and liver diseases and boosting immunity, is low. Therefore, there is an urgent need to develop a method for producing Cordyceps containing a high content of cordycepin. Prior art literature
[0005] Registered Patent Publication No. 10-2713678 The problem to be solved
[0006] The present invention aims to solve the above problems, and the present invention aims to provide a Cordyceps militaris SS2.0 (accession number KFCC11997P) strain having the ability to produce a high amount of cordycepin.
[0007] In addition, the present invention aims to provide a composition containing a high amount of cordycepin produced from the above-mentioned Cordyceps militaris SS2.0 (accession number KFCC11997P) strain. Specifically, the present invention aims to provide a composition for improving atopic dermatitis, itching, inflammation, and immune hypersensitivity reactions containing a high amount of cordycepin produced from the Cordyceps militaris SS2.0 (accession number KFCC11997P) strain. means of solving the problem
[0008] To achieve the above objective, the present invention may provide a strain of Cordyceps militaris SS2.0 (accession number KFCC11997P).
[0009] In one embodiment of the present invention, the Cordyceps militaris SS2.0 (accession number KFCC11997P) strain may have the ability to produce 10,000 to 30,000 ppm of cordycepin.
[0010] Another aspect of the present invention may provide a method for producing a variant Cordyceps, comprising the steps of: sterilizing a culture medium at high temperature and pressure; and inoculating the sterilized culture medium with a Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0011] Another aspect of the present invention may provide a method for preparing a culture comprising the step of culturing the Cordyceps militaris SS2.0 strain (accession number KFCC11997P) in a culture medium.
[0012] Another aspect of the present invention may provide a composition containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0013] In one embodiment of the present invention, the composition may contain 10,000 ppm or more of cordycepin.
[0014] Another aspect of the present invention may provide a composition for improving atopic dermatitis containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0015] In one embodiment of the present invention, the composition for improving atopic dermatitis may contain 10,000 ppm or more of cordycepin.
[0016] Another aspect of the present invention may provide a composition for improving inflammation containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0017] In one embodiment of the present invention, the composition for improving inflammation may contain 10,000 ppm or more of cordycepin.
[0018] Another aspect of the present invention may provide a cosmetic composition containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0019] In one embodiment of the present invention, the cosmetic composition may contain 10,000 ppm or more of cordycepin.
[0020] Another aspect of the present invention may provide a composition for improving immune hypersensitivity reactions containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0021] In one embodiment of the present invention, the composition for improving immune hypersensitivity reactions may contain 10,000 ppm or more of cordycepin.
[0022] Another aspect of the present invention may provide a composition for a health functional food containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0023] In one embodiment of the present invention, the composition for health functional food may contain 10,000 ppm or more of cordycepin. Effects of the invention
[0024] The variant Cordyceps strain of the present invention can produce a high amount of cordycepin, and the composition of the present invention containing a high amount of cordycepin can suppress immune hypersensitivity and improve and prevent atopic dermatitis, inflammation, and immune hypersensitivity reactions. Brief explanation of the drawing
[0025] FIG. 1(a) is a photograph of a variant cordyceps militaria produced according to the manufacturing method of the present invention, and FIG. 1(b) is a photograph of a conventional cordyceps militaris having a fruiting body. Figure 2 is a photograph of the variant Cordyceps of the present invention. Figure 3 shows the inhibitory effect of the composition according to the present invention on MAPK / NF-χB expression. Figure 4 shows the effect of the composition according to the present invention on inhibiting iflammasome formation. Figure 5 shows the iNOS and COX-2 expression inhibitory effect of the composition according to the present invention. Figure 6 shows the efficacy of the composition according to the present invention in improving immune hypersensitivity reactions and atopic dermatitis. Figure 7 shows changes in the skin of an animal model with atopic dermatitis caused by treatment with the composition according to the present invention. Figure 8 shows the change in body weight of an animal model with atopic dermatitis treated with the composition according to the present invention. Figure 9 shows the efficacy of the composition according to the present invention in inhibiting inflammation. Figure 10 shows the efficacy of the composition according to the present invention in inhibiting inflammation. Specific details for implementing the invention
[0026] The present invention will be described in detail below. However, the attached drawings are merely examples to easily explain the content and scope of the technical concept of the present invention, and the technical scope of the present invention is not limited or altered by them. Furthermore, it will be obvious to those skilled in the art that various modifications and changes are possible within the scope of the technical concept of the present invention based on these examples.
[0027] Furthermore, terms and words used in this specification and claims should not be interpreted as being limited to their ordinary or dictionary meanings, but should be interpreted in a meaning and concept consistent with the technical spirit of the invention, based on the principle that the inventor may appropriately define the concept of the terms to best describe his invention. Accordingly, since the embodiments described in this specification are merely the most preferred embodiments of the invention and do not represent all of the technical spirit of the invention, it should be understood that various equivalents and modifications that can replace them may exist at the time of filing this application.
[0028] In the present invention, “Cordyceps militaris” refers to a variant Cordyceps without fruiting bodies that is white, pale yellow, or pale orange, as shown in FIG. 1(a). Although the variant Cordyceps of the present invention cannot be identified visually because it lacks fruiting bodies, it can be identified through its color and fluffy appearance, which resembles mold spreading over a culture medium.
[0029] The present invention may provide a novel strain of Cordyceps militaris SS2.0 belonging to the genus Cordyceps militaris, and the accession number of said strain is KFCC11997P.
[0030] The above Cordyceps militaris SS2.0 strain (accession number KFCC11997P) is a strain obtained by selecting a strain with excellent cordycepin production ability from the ascocarps of a Cordyceps militaris fruiting body (hereinafter referred to as “Cordyceps militaris strain”) and then crossing it, and may be a strain in which cordycepin production ability is increased compared to the parent strain.
[0031] The novel strain of the present invention, Cordyceps militaris SS2.0 (accession number KFCC11997P), may be capable of producing cordycepin of 10,000 ppm or more, cordycepin of 30,000 ppm or less, or cordycepin of 10,000 ppm or more and 30,000 ppm or less.
[0032] The Cordyceps militaris SS2.0 strain (accession number KFCC11997P) may have been obtained by culturing in a liquid medium.
[0033] The above liquid medium may be a mixture comprising distilled water, potatoes, and sugar, and the potatoes may be sliced into pieces smaller than 1 cm or may be potato powder. The above liquid medium may contain 200 to 800 mL of distilled water, or 300 to 700 mL, or 400 to 600 mL, or 500 mL. In addition, 60 to 150 g, or 70 to 130 g, or 80 to 120 g, or 90 to 110 g, or 100 g of potatoes may be included in the liquid medium. The above liquid medium may contain 6 to 15 g, or 7 to 13 g, or 8 to 12 g, or 9 to 11 g, or 10 g of sugar.
[0034] The above liquid medium may be sterilized at high temperature and high pressure at 100 to 140°C, or 110 to 130°C, or 120°C. The sterilization treatment may be performed for 40 minutes or more, or 90 minutes or less, or 60 minutes or less, or 40 to 60 minutes at high temperature and high pressure.
[0035] After inoculating the above-mentioned sterilized liquid medium with Cordyceps militaris spawn, the strain was cultured for 14 to 45 days to obtain Cordyceps militaris SS2.0 (accession number KFCC11997P).
[0036] The novel strain Cordyceps militaris SS2.0 (accession number KFCC11997P) obtained as described above can produce cordycepin of 10,000 ppm or more, cordycepin of 30,000 ppm or less, or cordycepin of 10,000 ppm or more and 30,000 ppm or less.
[0037] The present invention may provide a method for manufacturing a variant Cordyceps, wherein the method may include the steps of: preparing a culture medium; sterilizing the prepared culture medium at high temperature and high pressure; and inoculating the sterilized medium with a Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0038] The method for producing a variant Cordyceps according to the present invention may include a step of preparing a culture medium, and said culture medium may be a mixture containing soybeans. Various medicinal materials may be further mixed into said culture medium, but are not limited thereto.
[0039] The above beans may be one or more selected from the group consisting of soybeans, black beans, white beans, mung bean sprout beans, chestnut beans, green soybeans, peas, kidney beans, speckled beans, and black soybeans, and the above medium may contain 200 to 300 g of beans, or 220 to 280 g, or 230 to 250 g, or 240 g, or 250 g. The above beans may be soaked for 24 hours after washing, but are not limited thereto. The above beans may be in powder form or in the form of particles of the beans themselves. The above beans may be fermented, but are not limited thereto.
[0040] The method for producing a variant Cordyceps according to the present invention may include the step of sterilizing the prepared culture medium at high temperature and high pressure.
[0041] The above sterilization treatment may be performed by high-temperature and high-pressure sterilization of a culture medium containing soybeans at 100 to 140°C, or 110 to 130°C, or 121°C. The above high-temperature and high-pressure sterilization treatment may be performed for 40 minutes or more, or 90 minutes or less, or 60 minutes or less, or 40 to 60 minutes. The sterilized soybeans may be in a fluffy state.
[0042] The method for producing a variant Cordyceps according to the present invention may include the step of inoculating a Cordyceps militaris SS2.0 (accession number KFCC11997P) strain into the sterilized culture medium.
[0043] The above Cordyceps militaris SS2.0 (accession number KFCC11997P) strain can be inoculated into the above sterilized culture medium.
[0044] The method for producing a variant Cordyceps according to the present invention allows the inoculated culture medium to be cultivated for 14 to 45 days in a low-temperature, low-humidity (RH 20% or less) environment. The cordycepin content can be controlled by adjusting the cultivation time, and if the cultivation period is satisfied, it can contain cordycepin ranging from a maximum of 30,000 ppm to a minimum of 10,000 ppm.
[0045] The method may include a step of harvesting the mutant Cordyceps mycelium after cultivation, and the mutant Cordyceps mycelium can be obtained therefrom.
[0046] The method for producing a mutant Cordyceps according to the present invention may further include, if necessary, a step of drying or processing the harvested mutant Cordyceps mycelium at 50 to 100°C, or at 60 to 80°C, or at 70°C for 5 to 20 hours, or at 7 to 15 hours, or at 10 to 13 hours, or at 50 to 100°C for 7 to 15 hours, or at 60 to 80°C for 10 to 13 hours, or at 70°C for 12 hours. The mutant Cordyceps mycelium that has undergone the drying and processing step may be a dried product or powder of the mutant Cordyceps mycelium.
[0047] The composition of the present invention can be prepared from a method comprising: a process of preparing an extract by adding a variant Cordyceps mycelium obtained at the harvesting step to an extraction solvent; a process of filtering the prepared extract; and a process of preparing an extract by concentrating the filtered extract under reduced pressure.
[0048] Alternatively, the composition of the present invention may be prepared from a method comprising: a process of preparing a primary extract by adding a mutant Cordyceps mycelium obtained at the harvesting step to an extraction solvent; a process of filtering the prepared primary extract; a process of preparing a secondary extract by adding the filtered primary extract to a 95% ethanol extraction solvent; and a process of preparing an extract by concentrating under reduced pressure.
[0049] The mutant Cordyceps mycelium obtained in the above harvesting step can be used after shaking extraction, Soxhlet extraction, or reflux extraction.
[0050] The above extraction solvent may be water, alcohol, or a mixture thereof, and the alcohol may be methanol or ethanol, or an extraction solvent consisting of water may be used.
[0051] The process for preparing the above extract may use an amount of extraction solvent equal to 1 to 6 times or 2 to 4 times the weight of the mutant Cordyceps mycelium, and the mass ratio of the mutant Cordyceps mycelium to the extraction solvent (mycelium:extraction solvent) may be 1:1 to 1:6, or 1:1 to 1:5, or 1:2 to 1:4, or 1:3, but is not limited thereto.
[0052] The first extraction temperature may be 70 to 130°C, or 80 to 120°C, or 90 to 110°C, or 100°C, but is not limited thereto. In addition, the extraction time may be 1 to 5 hours, or 1 to 3 hours, or 1 to 2 hours, or 2 hours. The number of extractions may be 1 to 5 times, or 1 to 3 times, or 1 time.
[0053] The above first extraction process may be a hot water extraction process using a high-temperature, high-pressure device.
[0054] The process of filtering the above extract can be carried out using a conventional filtration method, or a 100 mesh stainless steel filter can be used.
[0055] The vacuum concentration of the process for preparing the extract by vacuum concentrating the filtered extract above can be performed using a vacuum vacuum concentrator or a vacuum rotary evaporator, and can be concentrated at a temperature of 60°C for 1 to 2 hours under vacuum vacuum conditions (76 Torr).
[0056] The extract after the above reduced pressure concentration may contain 10,000 to 30,000 ppm of cordycepin.
[0057] A drying step after reduced pressure concentration may be further included, and the drying step may be reduced pressure drying, vacuum drying, boiling drying, spray drying, or freeze-drying.
[0058] Alternatively, the composition of the present invention may be prepared from a method comprising: a process of preparing a primary extract by adding the mutant Cordyceps mycelium obtained at the harvesting stage to an extraction solvent; a process of filtering the primary extract prepared above; a process of preparing a secondary extract by adding the filtered primary extract to an alcohol extraction solvent; and a process of preparing an extract by concentrating under reduced pressure. The process of preparing a primary extract by adding the mutant Cordyceps mycelium obtained at the harvesting stage to an extraction solvent and the process of filtering the primary extract prepared above may be carried out in the same manner as described above, and then the process of preparing a secondary extract by adding the filtered primary extract to an alcohol extraction solvent may be included.
[0059] The process for preparing the above secondary extract may be performed by introducing the primary extract, which has been filtered from distilled ore, into a vacuum extraction device and heating it to a temperature of 60 to 80°C under vacuum reduced pressure. At this time, the extraction time may be 1 to 2 hours.
[0060] A process for preparing an extract by concentrating the above secondary extract under reduced pressure can be performed, and this process can be carried out in the same way as the process for preparing an extract by concentrating the filtered primary extract under reduced pressure.
[0061] The extract obtained by concentrating the above secondary extract under reduced pressure may contain 40,000 to 120,000 ppm of cordycepin.
[0062] The composition of the present invention may include the extract as an active ingredient. The extract may be an extract obtained by concentrating a primary extract under reduced pressure, or an extract obtained by concentrating a secondary extract under reduced pressure, or an extract obtained by freeze-drying the extracts after concentrating them under reduced pressure.
[0063] A method for preparing a culture can be provided, comprising the step of culturing the Cordyceps militaris SS2.0 strain (accession number KFCC11997P) in a culture medium.
[0064] In the present invention, the term “culture” refers to growing the strain of the present invention under appropriately controlled environmental conditions. Culture may be batch, continuous, and / or fed-batch, but is not limited thereto. Furthermore, “medium” refers to a substance mixed with nutrients as the main component required to culture the strain of the present invention, and may supply nutrients and growth factors, including water, which is indispensable for survival and growth.
[0065] The present invention can provide a composition containing cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P).
[0066] The cordycepin content contained in the above composition may be 10,000 ppm or more. Or it may be 16,000 ppm or more, 20,000 ppm or more, or 25,000 ppm or more. The cordycepin content may be 30,000 ppm or less, or 28,000 ppm. Or it may be 10,000 ppm or more and 30,000 ppm or less, or 16,000 ppm or more and 30,000 ppm or less, or 20,000 ppm or more and 30,000 ppm or less, or 25,000 to 30,000 ppm.
[0067] The composition of the present invention containing 10,000 ppm or more of cordycepin may be a composition for improving atopic dermatitis, a composition for improving inflammation, a composition for cosmetics, a composition for improving immune hypersensitivity reactions, a composition for health functional foods, a composition for food, or a feed composition, or a pharmaceutical composition for the treatment or prevention of atopic dermatitis, itching, and inflammation, but is not limited thereto.
[0068] The composition of the present invention containing 10,000 ppm or more of cordycepin has excellent effects in improving atopic dermatitis, inflammation, itching, and immune hypersensitivity reactions, so it can be used as a composition for improving atopic dermatitis, inflammation, itching, and immune hypersensitivity reactions.
[0069] The above composition for improving atopic dermatitis may specifically be a cosmetic composition for improving atopic dermatitis and itching. The above composition for improving atopic dermatitis may contain 10,000 ppm or more of cordycepin. Or it may contain 16,000 ppm or more, or 30,000 ppm or less, or 16,000 to 30,000 ppm, or 20,000 to 30,000 ppm, or 16,000 to 24,000 ppm, or 25,000 ppm to 30,000 ppm of cordycepin. When cordycepin of the above content is contained, the affected area of atopic dermatitis can heal in a short period of time, and specifically, the composition containing cordycepin of the above content has the effect of taking about 20 to 90 days for the affected area of atopic dermatitis to heal. In addition, the composition containing the above cordycepin can achieve the effects of relieving itching and inflammation.
[0070] The composition of the present invention may contain 10,000 ppm or more of cordycepin or 10,000 ppm to 30,000 ppm, and since the content of cordycepin that exhibits maximum effect may vary depending on the use of the composition, the content of cordycepin contained in the composition can be adjusted according to the use of the composition.
[0071] In the present invention, the term “atopic dermatitis” refers to a chronic and recurrent inflammatory skin disease accompanied by itching, dry skin, and characteristic erythema or eczema. Acute lesions of atopic dermatitis exhibit a significant increase in serum immunoglobulin (IgE), and in addition to this, the diagnosis and severity of atopic dermatitis are determined by evaluating histopathological changes in the lesions and dermatitis lesions. Although the exact cause of atopic dermatitis has not been fully understood to date, it is reported that immunological and non-immunological mechanisms are involved along with genetic predisposition.
[0072] In addition, the term “skin itching” refers to an unpleasant sensation that causes a desire to scratch or rub the skin, and examples include itching caused by dry skin; itching caused by urticaria; itching caused by insect bites; itching caused by heat rash, acne, chafing, frostbite, contact dermatitis, seborrheic dermatitis, or psoriasis; itching caused by various skin diseases; and scalp itching. However, it goes without saying that the present invention does not exclude skin itching of various causes other than those listed above. The present invention includes all types of itching known in the art, such as dermatological itching, systemic itching, neuropathic itching, and psychogenic itching.
[0073] Furthermore, the term “inflammation” is used to collectively refer to defensive reactions that occur within the body when biological tissue is damaged; specifically, it refers to symptoms that cause congestion, swelling, fever, and pain in a part of the body in response to trauma, burns, or bacterial invasion. Additionally, in the present invention, “inflammatory disease” is used to collectively refer to diseases in which inflammation is the primary lesion, and the inflammatory disease in the present invention is characterized as being a NO-mediated inflammatory disease.
[0074] The composition of the present invention for improving atopic dermatitis, inflammation, itching, and immune hypersensitivity may be prepared in a formulation selected from the group consisting of a solution, topical ointment, cream, foam, nourishing lotion, softening lotion, mask pack, softening water, emulsion, makeup base, essence, soap, liquid cleanser, bath additive, sunscreen cream, sun oil, suspension, emulsion, paste, gel, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, patch, and spray, but is not limited thereto.
[0075] The composition of the present invention containing 10,000 ppm or more of cordycepin may be a cosmetic composition, but is not limited thereto.
[0076] The cosmetic composition of the present invention may additionally include one or more cosmetically acceptable carriers that are incorporated into general skin cosmetics, and may incorporate one or more of the following conventional ingredients selected from the group consisting of, for example, oils, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, colorants, preservatives, and fragrances, but is not limited thereto.
[0077] Cosmetically acceptable carriers included in the cosmetic composition of the present invention may vary depending on the formulation.
[0078] When the cosmetic composition of the present invention is in the form of an ointment, paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, or a mixture thereof may be used as a carrier component.
[0079] In the case where the cosmetic composition of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, or a mixture thereof may be used as a carrier component, and in particular, in the case of a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.
[0080] When the cosmetic composition of the present invention is in the form of a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan may be used.
[0081] When the cosmetic composition of the present invention is a suspension, a liquid diluent such as water, ethanol, or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracanthenic acid may be used as a carrier component.
[0082] In the case where the cosmetic composition of the present invention is a soap, an alkali metal salt of a fatty acid, a fatty acid hemiester salt, a fatty acid protein hydrolyzate, acethionate, a lanolin derivative, an aliphatic alcohol, a vegetable oil, glycerol, or a sugar may be used as a carrier component.
[0083] The composition of the present invention containing 10,000 ppm or more of cordycepin may be a composition for health functional foods, but is not limited thereto.
[0084] Health functional foods are a term synonymous with specific health foods and refer to foods with high medical or therapeutic effects that are processed to efficiently exhibit biological regulatory functions in addition to providing nutrition. These foods can be manufactured in various forms, such as tablets, capsules, powders, granules, liquids, and pills, to obtain useful effects for the prevention or improvement of cardiovascular diseases. Unlike general medicines, they have the advantage of being made from food ingredients and thus avoiding side effects that may occur with long-term use. Furthermore, due to their excellent portability, they can be consumed as supplements to enhance the effects of improving atopic dermatitis.
[0085] The above-mentioned health functional food can be manufactured by methods commonly used in the industry, and can be manufactured by adding raw materials and ingredients commonly added in the industry. In addition, unlike general pharmaceuticals, it has the advantage of being made from food ingredients, thus avoiding side effects that may occur during long-term use of pharmaceuticals, and can be highly portable.
[0086] A composition containing 10,000 ppm or more of cordycepin produced from the strain of the present invention may be a food composition, but is not limited thereto.
[0087] The types of food according to the present invention are not particularly limited and may include all foods in the conventional sense. Non-limiting examples of foods to which the above substance may be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes. When the above composition is used as a food additive, the composition may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods.
[0088] The above food composition may include a food-grade acceptable carrier. Additionally, the above food composition may include additional ingredients that are commonly used in food compositions to improve odor, taste, visual appearance, etc. For example, it may include vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, pantothenic acid, etc. It may also include minerals such as zinc, iron, calcium, magnesium, manganese, and copper; and amino acids such as lysine, tryptophan, cysteine, and valine.
[0089] In addition, the above food composition may include food additives such as preservatives (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate, etc.), disinfectants (bleaching powder and high-grade bleaching powder, sodium hypochlorite, etc.), antioxidants (butylhydroxyanisole (BHA)), butylhydroxytoluene (BHT), etc.), coloring agents (tar dyes, etc.), colorants (sodium nitrite, sodium nitrite, etc.), bleaching agents (sodium sulfite), seasonings (MSG, monosodium glutamate, etc.), sweeteners (dulcin, cyclamate, saccharin, sodium, etc.), flavorings (vanillin, lactones, etc.), leavening agents (alum, potassium hydrogen tartrate, etc.), reinforcing agents, emulsifiers, thickeners (sizing agents), coating agents, gum bases, antifoaming agents, solvents, and improvers. The above additives can be selected according to the type of food and used in appropriate amounts.
[0090] A composition containing 10,000 ppm or more of cordycepin produced from the strain of the present invention may be a feed composition, but is not limited thereto.
[0091] In the present invention, the term “feed” refers to any natural or artificial prescribed food, single meal, etc., or the components of said single meal, intended for or suitable for animals to eat, consume, and digest.
[0092] The types of the above feed are not particularly limited, and feeds commonly used in the relevant technical field may be used. Non-limiting examples of the above feed include plant-based feeds such as grains, root vegetables, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain dispersions; and animal-based feeds such as proteins, minerals, oils and fats, single-cell proteins, zooplankton, or food waste. These may be used individually or in a mixture of two or more types.
[0093] In the present invention, the food composition or feed composition may include a salt, in particular in the form of a food-grade acceptable salt or a feed-grade acceptable salt. As for the salt, any salt commonly used in the art, such as an acid addition salt formed by a food-grade or feed-grade acceptable free acid, may be used without limitation. In the present invention, the terms “food-grade acceptable salt” or “feed-grade acceptable salt” refer to any organic or inorganic addition salt of said composition that has an effective action that is relatively non-toxic and harmless to the individual, and for which side effects caused by said salt do not impair the beneficial efficacy of the composition of the present invention.
[0094] Acid addition salts are prepared by conventional methods, for example, by dissolving a compound in an excess amount of an aqueous acid solution and precipitating the salt using a water-miscible organic solvent, for example, methanol, ethanol, acetone, or acetonitrile. An equal molar amount of acid or alcohol (e.g., glycol monomethyl ether) in the compound and water may be solubilized, and then the mixture may be dried by evaporation or the precipitated salt may be filtered by suction.
[0095] At this time, organic acids and inorganic acids may be used as free acids. Inorganic acids may include hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc., and organic acids may include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carboxylic acid, vanillic acid, hydroiodide, etc., but are not limited thereto.
[0096] In addition, metal salts that are acceptable for food or feed use can be produced using a base. Alkali metal salts or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess amount of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, sodium, potassium, or calcium salts are particularly suitable for food or feed use, but are not limited to these. In addition, the corresponding silver salt can be obtained by reacting an alkali metal or alkaline earth metal salt with a suitable silver salt (e.g., silver nitrate).
[0097] The food or feed-acceptable salts of the present invention comprise salts of acidic or basic groups that may be present in the composition of the present invention, unless otherwise indicated. For example, food or feed-acceptable salts may include sodium, calcium, and potassium salts of hydroxyl groups, and other food or feed-acceptable salts of amino groups include hydrobromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate) and p-toluenesulfonate (tosyllate) salts, and may be prepared through methods for preparing salts known in the art.
[0098] A suitable dosage of the feed composition of the present invention may be 1 to 5 g / kg. When the above amount is consumed, the immunity of the animal consuming it may be enhanced.
[0099] The composition of the present invention containing 10,000 ppm or more of cordycepin can be usefully used as a pharmaceutical composition for the treatment or prevention of atopic dermatitis, inflammation, and itching.
[0100] The term “treatment” in the present invention refers to any act in which the symptoms of atopic dermatitis, itching, and inflammation-related diseases are improved or beneficially altered by the administration of a composition according to the present invention, and the term “prevention” refers to any act in which the onset of atopic dermatitis, itching, and inflammation-related diseases is inhibited or delayed by the administration of a composition according to the present invention.
[0101] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is one that is commonly used in formulations and may include, but is not limited to, one or more from the group consisting of lactose, dextrose, sucrose, sodium, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.
[0102] The pharmaceutical composition of the present invention may additionally include, in addition to the above components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Science (19th ed., 1995).
[0103] The pharmaceutical composition of the present invention may be administered orally or parenterally, and according to one embodiment of the present invention, it may be administered orally, and according to another embodiment of the present invention, it may be administered transdermally.
[0104] Suitable dosages of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, mode of administration, age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity. A preferred daily dosage of the pharmaceutical composition of the present invention is 3.3 to 16.7 g for an adult weighing 70 kg.
[0105] The pharmaceutical composition according to the present invention may be prepared in a unit volume form or contained in a multi-volume container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by a person skilled in the art to which the invention belongs. The formulation may be in the form of a solution, suspension, syrup, or emulsion in an oil or aqueous medium, or in the form of an extract, powder, powder, granule, tablet, or encapsulated agent, and may additionally include a dispersant or a stabilizer.
[0106] The present invention will be described in more detail below through examples. These examples are intended solely to explain the present invention more specifically, and it will be obvious to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.
[0107] <Preparation Example>
[0108] A mixture of 500 mL of distilled water, 100 g of potato, and 10 g of sugar was boiled at 110°C for at least 20 minutes, and the liquid phase of the mixture was obtained.
[0109] 250g of the above liquid medium was placed in a container and sterilized at 120℃ for 40 minutes or more under high temperature and high pressure. 5g of Cordyceps militaris spawn was inoculated into 250g of the sterilized liquid medium and cultivated for 40 days to obtain the Cordyceps militaris SS2.0 (accession number KFCC11997P) strain.
[0110] <Example 1>
[0111] A mixture containing 20 kg of soybeans and 60 L of distilled water was prepared, and 250 g of the mixture was placed in an 850 mL bottling vessel and sterilized at 121°C for 40 minutes or more under high temperature and high pressure. 5 g of the Cordyceps militaris SS2.0 strain (accession number KFCC11997P) obtained from the above preparation example was inoculated into 250 g of the sterilized culture medium, and after cultivation for 40 days in a low temperature and low humidity (RH 20% or less) environment at 22°C, mutant Cordyceps mycelia were harvested.
[0112] The harvested mutant Cordyceps mycelium was extracted using an extract consisting of 100% water. At this time, 20 kg of the mutant Cordyceps mycelium and 60 L of the extract consisting of 100% water were used to extract a total of 80 kg. Hot water extraction was performed at 100°C for 2 hours, and this process was repeated once. After filtering the extract through a 100 mesh stainless steel screen, it was concentrated using a rotary concentrator to obtain 20 kg of extract, with a yield of 100%, and the extract contained 20,000 ppm of cordycepin.
[0113] <Examples 2 to 5>
[0114] The cordycepin content of the extract was analyzed and summarized in Table 1 by performing the same procedure as in Example 1, except that the period of cultivation was changed by inoculating the Cordyceps militaris SS2.0 (accession number KFCC11997P) strain into the sterilized culture medium and culturing it in a low temperature and low humidity (RH 20% or less) environment at 22℃.
[0115] Cordycepin content analysis
[0116] Cordycepin content was analyzed using HPLC (Aligent 1200 Infinity series, Aligent Easy Access software). The analysis was performed under the following conditions: a 25 cm C18 column, mobile phase A was 95% distilled water containing 0.1% TFA, mobile phase B was 5% acetonitrile (ACN), detection at DAD Sig 260 nm and Ref. 360 nm and 100 nm, flow rate 1 ml / min, injection volume 10 µl, measurement temperature 30°C, runtime 25 min, and RT 6 min.
[0117] Sample Cultivation date Cordycepin content (ppm) Example 1 40 20,000 Example 2 25 10,000 Example 3 30 13,000 Example 4 35 16,000 Example 5 45 30,000
[0118] The improvement, prevention, or treatment effects of a composition containing 20,000 ppm of cordycepin according to the present invention on atopic dermatitis, inflammation, and hypersensitivity reactions were confirmed.
[0119] Preparation of testing samples
[0120] The backs of 7-week-old female Balb / C mice were completely depilated from the lower part of the ears to the upper part of the tail. After leaving the area for 24 hours, 200 µl of a 1% DNCB solution (acetone:olive oil volume ratio = 3:1) was applied to the depilated area, followed by a second application 3 days later. Starting from the 7th day after the first application, 200 µl of a 0.4% DNCB solution was reapplied twice a week for 5 weeks to induce atopic dermatitis. Histological changes and mast cell expression were confirmed through H&E and Giema staining of the skin tissue to verify whether atopic dermatitis had been induced.
[0121] Protein analysis
[0122] Skin tissue with induced atopic dermatitis was excised, frozen in liquid nitrogen, and rapidly homogenized in RIPA buffer containing 0.1 mM phenylmethylsulfonylfluoride and 1% protease inhibitor cocktail. Then, after centrifugation at 4°C and 12,000 rpm for 30 minutes, only the supernatant was separated, and the protein was quantified to 20 μg using the BCA method, followed by Western blot analysis.
[0123] Proteins separated by SDS-PAGE were transferred to a PDVF-membrane, and after blocking the membrane with 5 wt% skim milk, primary antibodies were incubated with p-ERK, ERK, p-JNK, JNK, pp38, p38, NLRP3, procaspase-1, caspase-1, p20, p10, ASC, IL-1β, iNOS, COX-2, and β-actin, and then secondary antibodies were treated with horseradisperoxide to confirm the bands using an ECL detection reagent.
[0124] RNA analysis
[0125] Skin tissue with induced atopic dermatitis was lysed in Trizol reagent, and then centrifuged with chloroform to separate the supernatant. Isopropyl alcohol was added to the separated supernatant and centrifuged to remove the supernatant, then 75% ethanol was added and centrifuged to remove the supernatant, after which the mixture was dried. The resulting solution was dissolved in RNAse-free water, and the total RNA amount was quantified. cDNA synthesis was performed using the GoScript™ Reverse Transcription system kit (Promega, WI, USA). 1 μg of total RNA and 1 μl of oligo(dT)15 primer (0.5 μg / reaction) were added and preheated at 70°C for 5 minutes. Subsequently, 4 μl of 5X reaction buffer, 3 μl of 25 mM MgCl2, 1 μl of PCR nucleotide mix, 0.5 μl of RNase inhibitor, 0.5 μl of Goscript reverse transcriptase, and 6 μl of nuclease-free water were added to a PCR tube, and the reaction was stopped by heating at 25°C for 5 minutes, 42°C for 60 minutes, and 70°C for 15 minutes. Real-time PCR was performed using the HotStart-IT SYBR Green qPCR Master mix (USB, OH, USA). After preparing a master mix by adding 10 μl of 2X SYBR master mix, 1 μl of 15 pmol forward primer, 1 μl of 15 pmol reverse primer, 0.5 μl of 25 mM MgCl2, 0.4 μl of 25 μM passive reference dye (ROX), and PCR qualified water, 19 μl of the mixture was placed in each tube, and 1 μl of cDNA was added. The mixture was then reacted for 1 cycle at 95°C for 10 minutes, followed by 40 cycles of 5 seconds at 95°C and 15 seconds at 60°C, and the reaction was completed through the melt curve step.
[0126] The primers used for Real-time PCR were synthesized by Bioneer Co., Ltd. (Choongbook, Korea), and the nucleotide sequences of each primer are shown in Table 2.
[0127] Gene Sequences for primers Tnfa FOR: AGGGTCTGGGCCATAGAACT REV: CCACCACGCTCTTCTGTCTAC IL-1b FOR: GGTCAAAGGTTTGGAAGCAG REV: TGTGAAATGCCACCTTTTGA IL-6 FOR: ACCAGAGGAAATTTTCAATAGGC REV: TGATGCACTTGCAGAAAACA IL-4 FOR: TCGGCATTTTGAACGAGGTC REV: GAAAAGCCCGAAAGAGTCTC IL-13 FOR: CGCAAGGCCCCCACTAC REV: AAAGTGGGCTACTTCGATTTTGG
[0128] Verification of histological improvement efficacy
[0129] Lung tissues, which were excised and fixed from skin tissues induced by DNCB-induced atopic dermatitis, were prepared into paraffin blocks and sectioned to a thickness of 4 µm for histopathological analysis, after which they were stained and interpreted. Histopathological examination was performed using hematoxylin & eosin staining (H&E staining), and the lesions and inflammation progression scores of the lung tissue were observed by a histopathologist.
[0130] Blood biochemical analysis
[0131] Experimental animals that had been fasted for more than 14 hours immediately after the end of the experiment were anesthetized with ketamine, and 1 mL of blood was collected via cardiac blood sampling. The collected blood was centrifuged at 3000 rpm for 30 minutes to obtain serum, which was then transferred to an EP tube and stored at -80℃. Biochemical analysis was performed on triglycerides, total cholesterol, aspartate aminotransferase (AST), and alanine aminotransferase (ALT). For this purpose, triglyceride measurement reagents (Asan Pharmaceutical Co., Ltd., AM-157S-K), cholesterol measurement reagents (Asan Pharmaceutical Co., Ltd., AM-202-K), GOT reagents (Asan Pharmaceutical Co., Ltd., AM-103K), and GPT reagents (Asan Pharmaceutical Co., Ltd., AM-102K) were used.
[0132] As can be seen from Figure 3, the expression of p-ERK, p-JNK, and p-p38 is increased in DNCB-induced atopic dermatitis, but in the group treated with the composition of the present invention, the expression of p-ERK, p-JNK, and p-p38 is suppressed.
[0133] As can be seen from Figure 4, in DNCB-induced atopic dermatitis, the inflammasome complex of NLRP3, ASC, and procaspase-1 is formed, causing the activity of p20, p10, or IL-1β, but in the group treated with the composition of the present invention, the formation of the inflammasome complex of NLRP3, ASC, and procaspase-1 is inhibited, and the activity of IL-1β is reduced.
[0134] To evaluate the immunomodulatory efficacy of the composition according to the present invention, the activity of transcription factor (NF-χB) induced by various inflammation and allergy-inducing substances and the expression of proteins (iNOS, COX-2) were compared using the Toll-like receptor (TLR) signaling system, which is known to play an important role in innate immune responses (see Fig. 5). It was found that while the expression of iNOS and COX-2 increases in DNCB-induced atopic dermatitis, the expression of iNOS and COX-2 is suppressed in the group treated with the composition according to the present invention.
[0135] From Figure 6, it was observed that the skin on the east side became rough and wounds formed in an animal model of atopic dermatitis induced by DNCB; however, in the group treated with the composition according to the present invention, it was confirmed that the degree of wounds on the dorsal skin decreased and the atopic-induced dermatitis decreased. In atopic dermatitis induced by DNCB, epidermal thickness and dermis thickness increased, but in the group treated with the composition according to the present invention, epidermal thickness and dermis thickness decreased. In addition, H&E staining results showed that in the Normal group, the epidermis was thinly distributed and almost no inflammatory cells were observed, whereas in the Control group, the thickness of the epidermis was hyperplastic and expanded, and hyperkeratosis, pigmentation, parakeratosis, and infiltration of inflammatory cells around it increased significantly compared to the Normal group. On the other hand, in the group treated with the composition according to the present invention, the thickness of the epidermis decreased to be closer to that of the Normal group compared to the disease group, and cell deformation, keratinization symptoms, and infiltration of inflammatory cells around it decreased.
[0136] Figure 7 shows photographs of DNCB-induced 7-week-old female Balb / C mice before and after treatment with the composition according to the present invention, and it can be seen that atopic dermatitis is improved by treating the mice with the composition according to the present invention.
[0137] Figure 8 shows the change in body weight of mice with DNCB-induced atopic dermatitis. It can be seen that there is no change in body weight in mice with DNCB-induced atopic dermatitis depending on whether or not they are treated with the composition according to the present invention.
[0138] The skin forms the boundary between the external environment and the body, coming into contact with numerous antigens. When atopic dermatitis develops, the skin is scratched; the irritation and inflammatory response from scratching cause the stratum corneum cells to secrete cytokines, intensifying the inflammatory response. Additionally, deformation of the stratum corneum is induced, activating immune cells. The activation of immune cells induces increased IgE production and increases the activity of IgE-dependent histamine vitreous humor, thereby promoting histamine secretion. Histamine and other substances induce the infiltration of eosinophils, causing acute hypersensitivity reactions and itching. The severity of atopic dermatitis was evaluated based on the degree of skin itching, skin deformation (erythema, dry skin, edema and hematoma, chafing, lichenification), and IgE content that occur during this process. Figure 9 shows the results of confirming the effect on IgE production in mice with atopic dermatitis treated with the composition according to the present invention.
[0139] The mouse group that developed atopic dermatitis with DNCB showed increased blood IgE compared to the Normal group, and when the mouse group that developed atopic dermatitis with DNCB was treated with the composition according to the present invention, the IgE content decreased, and the higher the content of cordycepin contained in the composition, the greater the decrease in IgE.
[0140] As a result of confirming the expression of inflammation in the blood of a mouse group with atopic dermatitis induced by DNCB, the expression of IL-6 in the blood of the mouse group with atopic dermatitis increased, but the amount of expressed IL-6 decreased upon treatment with the composition according to the present invention. In addition, in the tissues of mice with DNBC-induced atopic dermatitis, the expression of IL-1β, IL-4, IL-6, IL-13, and IL-17 increased, but the amount of expressed IL-1β, IL-4, IL-6, IL-13, and IL-17 decreased upon treatment with the composition according to the present invention (Fig. 10).
[0141] Therefore, it can be seen that a composition containing 10,000 ppm or more of cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P) according to the present invention has an effect of improving, treating, or preventing atopic dermatitis, inflammation, immune hypersensitivity reactions, and itching.
[0142] In addition, a composition containing 10,000 ppm or more of cordycepin produced from the Cordyceps militaris SS2.0 strain (accession number KFCC11997P) according to the present invention can be used as an adjuvant to improve, treat, or prevent atopic dermatitis, inflammation, immune hypersensitivity, and itching, and can be used for cosmetics, health functional foods, food, and feed.
[0143] The present invention is not limited by the embodiments described above, but is intended to be limited by the claimed scope. Accordingly, various substitutions, modifications, and changes may be made by those skilled in the art within the scope of the technical concept of the present invention as described in the claims, and such are also to be considered to fall within the scope of the present invention.
[0144] Name of depositing institution: Korean Culture Collection of Microorganisms Trustee Number: KFCC11997P Date of Deposit: 2024-04-26
Claims
Claim 1 Cordyceps militaris SS2.0 (Accession No. KFCC11997P) strain. Claim 2 In claim 1, the Cordyceps strain is a strain having the ability to produce 10,000 to 30,000 ppm of cordycepin. Claim 3 A method for producing a variant Cordyceps, comprising: a step of preparing a culture medium; a step of sterilizing the prepared culture medium at high temperature and high pressure; and a step of inoculating the Cordyceps SS2.0 strain of claim 1 into the sterilized culture medium. Claim 4 A method for preparing a culture comprising the step of culturing the Cordyceps militaris SS2.0 strain (accession number KFCC11997P) in a culture medium. Claim 5 A composition containing cordycepin produced from the strain of claim 1. Claim 6 In claim 5, the composition containing 10,000 ppm or more of the cordycepin. Claim 7 A composition for improving atopic dermatitis containing cordycepin produced from the strain of claim 1. Claim 8 A composition for improving atopic dermatitis according to claim 7, wherein the cordycepin contains 10,000 ppm or more. Claim 9 A composition for improving inflammation containing cordycepin produced from the strain of claim 1. Claim 10 In claim 9, the composition for improving inflammation contains 10,000 ppm or more of cordycepin. Claim 11 A cosmetic composition containing cordycepin produced from the strain of claim 1. Claim 12 A cosmetic composition according to claim 11, wherein the cordycepin contains 10,000 ppm or more. Claim 13 A composition for improving immune hypersensitivity reactions containing cordycepin produced from the strain of claim 1. Claim 14 In claim 13, a composition for improving immune hypersensitivity reactions containing 10,000 ppm or more of cordycepin. Claim 15 A composition for a health functional food containing cordycepin produced from the strain of claim 1. Claim 16 A composition for a health functional food according to claim 15, wherein the cordycepin contains 10,000 ppm or more.