DNA Aptamer Specifically Binding to glycated haemoglobin and Use thereof
Patent Information
- Application Number
- KR1020260008929
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-01-24
- Filing Date
- 2026-01-16
- Publication Date
- 2026-08-03
Smart Images

Figure PAT00005_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a DNA aptamer that specifically binds to glycated hemoglobin and its uses. Background Technology
[0002] Diabetes is a name derived from the fact that abnormally high blood glucose levels lead to the excretion of glucose in the urine. When carbohydrates are consumed, they are broken down into glucose by digestive enzymes and absorbed into the bloodstream. Cells use glucose as an energy source, and a hormone called insulin is required to utilize it. However, if there is a deficiency of insulin or increased resistance to insulin, glucose cannot be absorbed by cells and accumulates in the blood, eventually being excreted in the urine.
[0003] Persistent hyperglycemia caused by diabetes can lead to various complications. These complications are classified into microvascular and macrovascular complications. Microvascular complications include diabetic retinopathy, renal disease, and neuropathy, while macrovascular complications include coronary artery disease, stroke, and peripheral artery disease. In particular, macrovascular complications, often referred to as cardiovascular disease, are a major cause of death in 50–70% of diabetic patients. Therefore, it is essential to comprehensively evaluate and manage cardiovascular risk factors, such as hypertension and dyslipidemia, in addition to blood sugar control.
[0004] According to the Korean Diabetes Association, as of 2020, the number of diabetes patients in Korea reached approximately 6 million, and the high-risk group corresponding to pre-diabetes is estimated at about 15.83 million. This means that more than 20 million people are exposed to diabetes or its risk.
[0005] Currently, common diagnostic methods for the early diagnosis of diabetes include blood glucose tests, oral glucose tolerance tests, and glycated hemoglobin (HbA1c) tests. While blood glucose tests measure blood sugar levels on an empty stomach, they are not widely used for diagnostic purposes due to significant individual variability. Oral glucose tolerance tests measure blood sugar changes after sugar intake; although they offer high diagnostic accuracy, they are time-consuming and cause discomfort to patients. The HbA1c test is the most widely used diagnostic method, providing relatively stable values regardless of fasting status and serving as an important indicator for diabetes management. However, the development of biosensors capable of measuring this is still ongoing, and significant attention is being focused on research related to this area.
[0006] Currently, methods for measuring glycated hemoglobin include the minicolumn method, immunoassay, and high-performance liquid chromatography (HPLC). However, these methods have disadvantages, such as technical complexity, high analytical instrumentation, and slow measurement speeds. Furthermore, the specialized reagents required for measurement largely rely on expensive imports, and the purchase of dedicated equipment entails a significant financial burden. Therefore, there is a need for the development of an efficient glycated hemoglobin detection system, as well as research on the discovery of specific substances and functional analysis. Prior art literature
[0007] Korean Patent Publication 10-2016-0090096 The problem to be solved
[0008] Accordingly, the inventors developed a DNA aptamer that specifically binds to glycated hemoglobin and established a method for detecting the aptamer using Raman spectroscopy. The present invention was completed by confirming that the DNA aptamer devised in this invention can accurately and rapidly detect glycated hemoglobin in the blood through its high specific binding activity with glycated hemoglobin.
[0009] Accordingly, the object of the present invention is to provide a DNA aptamer that specifically binds to a glycated hemoglobin protein, characterized by having a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs 1 to 8.
[0010] Another objective of the present invention is to provide a composition for detecting glycated hemoglobin and a kit for detecting glycated hemoglobin comprising the DNA aptamer of the present invention.
[0011] Another objective of the present invention is to provide a method for detecting glycated hemoglobin, comprising the step of reacting the detection composition of the present invention with a sample.
[0012] Another objective of the present invention is to provide a composition for diagnosing or determining the prognosis of any one of the diseases selected from the group consisting of diabetes, cardiovascular disease, diabetic nephropathy, and retinopathy, comprising the DNA aptamer of the present invention as an active ingredient. means of solving the problem
[0013] Therefore, the present invention provides a DNA aptamer that specifically binds to a glycated hemoglobin protein, characterized by having a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs 1 to 8.
[0014] In one embodiment of the present invention, the DNA aptamer may have a label selected from the group consisting of fluorescent substances, biotin, streptavidin, amine groups, biotin, and thiol groups labeled on the 5' end or 3' end of the DNA aptamer.
[0015] In addition, the present invention provides a composition for detecting glycated hemoglobin comprising the DNA aptamer of the present invention.
[0016] In addition, the present invention provides a kit for detecting glycated hemoglobin comprising the detection composition of the present invention.
[0017] In addition, the present invention provides a method for detecting glycated hemoglobin, comprising the step of reacting the detection composition of the present invention with a sample.
[0018] In one embodiment of the present invention, the sample may be blood, saliva, leakage, urine, synovial fluid, mucus, cells, or body fluid.
[0019] Furthermore, the present invention provides a composition for diagnosing or determining the prognosis of any one of the diseases selected from the group consisting of diabetes, cardiovascular disease, diabetic nephropathy, and retinopathy, comprising the DNA aptamer of the present invention as an active ingredient.
[0020] In one embodiment of the present invention, the cardiovascular disease may be coronary artery disease, stroke, peripheral artery disease, myocardial infarction, or angina pectoris. Effects of the invention
[0021] The DNA aptamer provided in the present invention is characterized by having a specifically high binding affinity to glycated hemoglobin protein. Therefore, the DNA aptamer of the present invention can be usefully employed not only for the detection of glycated hemoglobin protein but also for the diagnosis of diabetes. Furthermore, since it can replace antibodies currently used for disease diagnosis, it has the effect of being useful for the rapid and accurate diagnosis of various diseases related to glycated hemoglobin. Brief explanation of the drawing
[0022] Figure 1 shows (a): the result of purifying dsDNA, a product of amplifying a random DNA aptamer pool using the PCR technique, using a PCR purification kit, and (b): the result of confirming ssDNA, amplified using the asymmetric PCR technique, by electrophoresis using an agarose gel. A: Lane M: 100 bp DNA marker, Lane 1: result of amplifying DNA aptamers using the PCR technique. Na: Lane M: 10 bp DNA marker, Lane 1: result of amplifying DNA aptamers using PCR, Lane 2: ssDNA result of amplifying DNA aptamers using asymmetric PCR. Figure 2 shows the results of real-time PCR using DNA aptamer candidates obtained in each round that specifically bind to glycated hemoglobin protein recovered in each SELEX round to produce DNA aptamers that specifically bind to glycated hemoglobin protein. Figure 3 is a diagram showing the secondary structures of four DNA aptamer candidates (Hb_1, Hb_2, Hb_3, Hb_4) out of eight DNA aptamer candidates for binding to glycated hemoglobin protein selected during the SELEX process for producing DNA aptamers that specifically bind to glycated hemoglobin protein. Figure 4 is a diagram showing the secondary structures of four DNA aptamer candidates (Hb_5, Hb_6, Hb_7, Hb_8) among eight DNA aptamer candidates for binding to glycated hemoglobin protein selected during the SELEX process for producing DNA aptamers that specifically bind to glycated hemoglobin protein. Figure 5 shows the results of analyzing the Raman spectrum of normal hemoglobin and glycated hemoglobin combined with aptamers using Raman spectroscopy. Specific details for implementing the invention
[0023] The present invention is characterized by providing a DNA aptamer that specifically binds to glycated hemoglobin protein.
[0024] In one embodiment of the present invention, to select DNA aptamers that specifically bind to glycated hemoglobin protein, a technique utilizing Ni-NTA agarose beads was used to immobilize glycated hemoglobin protein onto Ni-NTA agarose beads, induce the formation of a complex with a DNA aptamer pool, and then recover the DNA aptamers that specifically bind to glycated hemoglobin protein.
[0025] In this specification, the term "DNA aptamer" refers to a DNA nucleic acid molecule capable of binding to a specific molecule with high affinity and specificity. In this specification, "DNA aptamer" is used interchangeably with "DNA oligonucleotide." Aptamers are short-length oligomers that form a stable tertiary structure and possess the characteristic of having specific binding affinity to target substances. Furthermore, since aptamers are composed of nucleic acids such as DNA or RNA, they are more stable than antibodies made of proteins and have the advantage of being able to specifically bind to various target substances (proteins, peptides, metals, chemicals, etc.). In addition, because they can be produced using chemical synthesis techniques, they can be mass-produced in a short time and at low cost, and possess the excellent advantage of being able to continuously produce aptamers with the same capabilities after a single production run. Moreover, due to their high stability against ambient pH and temperature, their potential for application in various fields such as environment and medicine, including the detection of target substances and the development of disease diagnostic sensors, is highly regarded.
[0026] The DNA aptamer that specifically binds to the glycated hemoglobin protein selected in the present invention may have any one base sequence selected from the group consisting of the base sequences of SEQ ID NOs. 1 to 8, and may also be an oligonucleotide having a base sequence having 90% or more identity with said base sequence. The DNA aptamer may be one in which the hydroxyl group at the ribose 2' position of one or more nucleotides constituting the DNA aptamer is substituted with any one selected from the group consisting of a hydrogen atom, a fluorine atom, -OR, -COOR, and an amino group.
[0027] In addition, the DNA aptamer may be composed of additional labeling substances, wherein any one labeling substance selected from the group consisting of fluorescent substances, amine groups, biotin, thiol groups, and digoxigenin may be labeled on the 5' end or 3' end of the DNA aptamer.
[0028] In this specification, the term “oligonucleotide” generally refers to a nucleotide polymer having a length of about 200 or fewer, which may include DNA and RNA, and preferably is a DNA nucleic acid molecule. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or analogs thereof, or any substrate that can be introduced into the polymer by DNA or RNA polymerase or by a synthesis reaction. If modifications to the nucleotide structure are present, such modifications may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be interrupted by non-nucleotide components. The oligonucleotide may be further modified after synthesis, for example by binding with a label.
[0029] The DNA aptamers of the present invention can typically be obtained by in vitro selection methods for binding to target molecules. Methods for selecting aptamers that specifically bind to target molecules are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, and polysaccharides can be suitable target molecules for isolating aptamers capable of specifically binding to each ligand. Aptamer selection can be performed using in vivo or in vitro selection techniques known as the SELEX method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al., Science 249, 505-10, 1990). Specific methods for the screening and preparation of aptamers are described in U.S. Patent 5,582,981, WO 00 / 20040, U.S. Patent 5,270,163, Lorsch and Szostak, Biochemistry, 33:973 (1994), Mannironi et al., Biochemistry 36:9726 (1997), Blind, Proc. Natl. Acad. Sci. USA 96:3606-3610 (1999), Huizengan and Szostak, Biochemistry, 34:656-665 (1995), WO 99 / 54506, WO 99 / 27133, WO 97 / 42317 and U.S. Patent 5,756,291, which are incorporated herein by reference.
[0030] The structures of each DNA aptamer composed of the nucleotide sequences of SEQ ID NOs 1 to 8 that specifically bind to the glycated hemoglobin protein discovered in the present invention are shown in FIGS. 3 and 4.
[0031] In addition, the DNA aptamer of the present invention is interpreted to include an oligonucleotide having a base sequence that exhibits substantial identity with any one of the base sequences of SEQ ID NOs 1 to 8 while maintaining the characteristic of binding to glycated hemoglobin protein. The substantial identity described above is achieved by aligning the nucleotide sequence of the present invention described above with any other sequence as closely as possible and using algorithms commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2:482(1981); Needleman and Wunsch, J. Mol. Bio. 48:443(1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31(1988); Higgins and Sharp, Gene 73:237-44(1988); Higgins and Sharp, CABIOS 5:151-3(1989); Corpet et al., Nuc. Acids Res. 16:10881-90(1988); Huang et al., Comp. Appl. BioSci. 8:155-65(1992) and Pearson et al., Meth. Mol. Biol. It means a nucleotide sequence that exhibits at least 90% identity, more preferably at least 95% identity, and most preferably at least 98% identity when the aligned sequence is analyzed using 24:307-31 (1994).
[0032] In addition, the present invention may provide a method for producing DNA aptamers that specifically bind to glycated hemoglobin protein, wherein the method preferably comprises: (1) a step of amplifying DNA aptamers using PCR and asymmetric PCR techniques and selecting single-stranded DNA aptamers; (2) a step of inducing binding between the single-stranded DNA aptamers and glycated hemoglobin protein; (3) a step of binding the glycated hemoglobin protein bound to the single-stranded DNA aptamers to Ni-NTA agarose resin; (4) a step of removing DNA aptamers that did not bind to the glycated hemoglobin protein; and (5) a step of recovering and selecting DNA aptamers that specifically bind to glycated hemoglobin protein through the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technique.
[0033] Here, the above step (5) specifically comprises: a real-time PCR step for selecting SELEX rounds with optimal affinity; a PCR and cloning step for selecting DNA aptamer candidates that bind to the glycated hemoglobin protein in the optimal SELEX rounds; a step for measuring the affinity of the DNA aptamer candidates that bind to the glycated hemoglobin protein for the glycated hemoglobin protein; and a DNA sequencing step of the selected DNA aptamer candidates.
[0034] In one embodiment of the present invention, to select DNA aptamers of the present invention, asymmetric PCR was performed to amplify only ssDNA (single strand DNA) from dsDNA (double strand DNA) amplified using PCR, and the ssDNA was obtained by performing PCR using forward primers and reverse primers. In addition, the method for selecting ssDNA aptamers involves attaching biotin to the reverse primer during PCR to amplify dsDNA, treating the 3' end of the amplified product with streptavidin to form a biotin-streptavidin complex, and selectively removing the complex to obtain only the ssDNA aptamer on the opposite side that is not bound to biotin.
[0035] Subsequently, DNA aptamers having the ability to bind to glycated hemoglobin protein were selected using a SELEX technique with glycated hemoglobin protein targeting the selected ssDNA aptamers. According to one embodiment of the present invention, a process of selecting an optimal SELEX round having high affinity and specificity was performed by making one round of steps: a step of amplifying and securing the aptamer sequence, then fixing the glycated hemoglobin protein to a resin; a step of binding the fixed envelope protein to the DNA aptamer; and a step of recovering only the binding DNA aptamer that is reactive with the glycated hemoglobin protein.
[0036] In addition, the selection process for the optimal SELEX round was carried out through the following steps: an optimal round selection step using quantitative analysis with a NanoDrop spectrophotometer (USA) and real-time PCR; a PCR and cloning step to secure DNA aptamer candidates specifically binding to glycated hemoglobin protein from the optimal SELEX round; and a DNA sequencing step of the secured DNA aptamer candidates.
[0037] In the present invention, the “SELEX method” refers to a method for determining the DNA binding sequence of a specific molecule by selecting and amplifying DNA that has a high binding affinity to the specific molecule from a set of randomly synthesized DNAs (Louis et al. 1992. Nature 355, 564-566).
[0038] The present invention allows for the selection of glycated hemoglobin protein-specific binding DNA aptamers recovered from each round via nanodrops to determine whether to continue SELEX and to select the optimal round. Subsequently, PCR and cloning were performed to secure the sequences of the glycated hemoglobin protein-specific binding DNA aptamer candidate group from the selected optimal SELEX round, and then the DNA sequences of the selected glycated hemoglobin protein-specific binding DNA aptamer candidate group were determined.
[0039] The DNA aptamer of the present invention, which specifically binds to glycated hemoglobin protein discovered through the above method, can be used to directly detect glycated hemoglobin protein or to detect glycated hemoglobin protein in biological samples from patients, and can be utilized for the diagnosis of diabetes, cardiovascular disease, diabetic nephropathy, or retinopathy.
[0040] The detection of glycated hemoglobin protein according to the present invention is based on a method for detecting a complex of glycated hemoglobin protein and a DNA aptamer that specifically binds to glycated hemoglobin protein. In one embodiment of the present invention, the DNA aptamer that specifically binds to glycated hemoglobin protein may include a nucleotide labeled with a fluorescent substance (e.g., fluorescein, Cy3, Cy5, or HRP), a radioactive substance, or a chemical substance such as biotin, or modified with a primary amine, to facilitate the detection of the complex.
[0041] In addition, the DNA aptamer of the present invention can be fabricated in the form of a biosensor, kit, and chip comprising an immobilized substrate and used to detect glycated hemoglobin protein.
[0042] In this specification, the term “sensor and chip” refers to a sensor and chip in which a specific material is attached at high density to a specific area of a substrate. In this specification, the term “substrate” of the biosensor and sensor chip refers to a support having suitable rigidity or semi-rigidity, and includes, but is not limited to, glass, membrane, slide, filter, chip, wafer, fiber, magnetic or non-magnetic bead, gel, tubing, plate, polymer, microparticle, and capillary. The DNA aptamer of the present invention may be arranged and immobilized on the substrate. Such immobilization may be achieved by a chemical bonding method or a covalent bonding method such as UV. For example, the DNA oligonucleotide may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bonded by UV on a polylysine coated surface. Additionally, the DNA oligonucleotide may be bonded to the substrate through a linker (e.g., ethylene glycol oligomer and diamine).
[0043] The DNA aptamer that specifically binds to the glycated hemoglobin protein of the present invention can be biotinylated, for example, and can be successfully immobilized on a streptavidin-coated substrate. The DNA aptamer that specifically binds to the glycated hemoglobin protein of the present invention, immobilized on the substrate, can bind to and capture the glycated hemoglobin protein, and the capture of the captured glycated hemoglobin protein can be visualized using the DNA aptamer that specifically binds to the glycated hemoglobin protein.
[0044] In addition, the composition for detecting glycated hemoglobin protein in the present invention may be provided in the form of a kit. In the present invention, the kit comprises, as an active ingredient, a DNA oligonucleotide having the nucleotide sequence of SEQ ID NOs 1 to 8 or a nucleotide sequence having 90% or more identity with the sequence. The kit in the present invention may additionally include instructions or a label for using the kit to detect glycated hemoglobin protein in a sample.
[0045] According to another aspect of the present invention, the present invention can provide useful information for diagnosing or determining the prognosis of any one of the diseases selected from the group consisting of diabetes, cardiovascular disease, diabetic nephropathy, and retinopathy through the specific detection of glycated hemoglobin protein.
[0046] In addition, the present invention may provide a method for detecting glycated hemoglobin protein, comprising: (1) a step of contacting a biological sample separated from a living organism with a DNA aptamer of the present invention; and (2) a step of measuring the presence or content of glycated hemoglobin protein in the biological sample by confirming a specific binding reaction between the biological sample and the DNA aptamer with the glycated hemoglobin protein.
[0047] Furthermore, the present invention may provide a composition for the diagnosis or prognosis determination of any one disease selected from the group consisting of diabetes, cardiovascular disease, diabetic nephropathy, and retinopathy, comprising the DNA aptamer of the present invention as an active ingredient, and may also provide a method for providing information necessary for the diagnosis of any one disease selected from the group consisting of diabetes, cardiovascular disease, diabetic nephropathy, and retinopathy using the DNA aptamer of the present invention.
[0048] The method for providing information necessary for the diagnosis of a disease using the DNA aptamer of the present invention comprises: (1) a step of bringing a biological sample isolated from a living organism into contact with the DNA aptamer of the present invention; and (2) a step of measuring the presence or content of glycated hemoglobin protein in the biological sample by confirming a specific binding reaction between the biological sample and the DNA aptamer with the glycated hemoglobin protein.
[0049] Here, if the level or content of glycated hemoglobin protein contained in the above sample is higher than that of the normal control group (sample from a normal person), the prognosis can be determined as having developed diabetes, cardiovascular disease, diabetic nephropathy, or retinopathy, or as being in a high-risk group.
[0050] In the present invention, the “biological sample” may include blood, saliva, tears, urine, synovial fluid, mucus, cells, or body fluids, but is not limited thereto.
[0051] In addition, the cardiovascular disease in the present invention may be coronary artery disease, stroke, peripheral artery disease, myocardial infarction, or angina pectoris.
[0052] Glycated hemoglobin, also known as hemoglobin A1c (HbA1c), is a type of hemoglobin found in human red blood cells. Since HbA1c levels correlate with blood glucose levels over the past two to three months, it can be recognized as a measure of blood glucose levels during that period. Measuring HbA1c is important because it can be used as an indicator for diabetes management and future medication adjustments.
[0053] Furthermore, glycated hemoglobin is reported to be associated with the development of cardiovascular disease, stroke, diabetic nephropathy, and retinopathy, and an increase in glycated hemoglobin levels is used as a key indicator that significantly increases the risk of developing these diseases.
[0054] Therefore, the DNA aptamer capable of specifically binding to glycated hemoglobin protein discovered in the present invention can also be usefully employed for the diagnosis and prognosis assessment of cardiovascular disease, stroke, diabetic nephropathy, and retinopathy.
[0056] The present invention will be explained in more detail below through examples. These examples are intended to explain the invention more specifically, and the scope of the invention is not limited to these examples.
[0058] <Example 1>
[0059] Production of DNA aptamers
[0060] <1-1> DNA Random Library Amplification Using PCR Technique
[0061] To construct a single-stranded DNA aptamer that specifically binds to glycated hemoglobin protein, a 76-mer template DNA (5'-ATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3', SEQ NO. 9) containing 40 random sequences in the ratio dA : dG : dC : dT = 1.5 : 1.15 : 1.25 : 1, and a primer pair capable of amplifying this to 76 mer, consisting of a forward primer (5'-ATACCAGCTTATTCAATT-3', SEQ NO. 10) and a biotinylated reverse primer (5'-Biotin-AGATAGTAAGTGCAATCT-3', SEQ NO. 11), were commissioned from Bioneer (Korea). The random DNA library was amplified using PCR (Bioneer). The reaction composition for the amplification of a 76-mer DNA library by PCR consisted of 1 µl of template DNA, 5 µl of 10X PCR buffer, 4 µl of each 2.5 mM dNTP mixture, 2 µl of 25 µM forward primer, 2 µl of 25 µM biotinylated reverse primer, 0.25 µl (1 unit / µl) of Ex Taq polymerase (TaKaRa, Japan), and 35.75 µl of distilled water. The PCR reaction conditions involved first denaturation at 95°C for 5 minutes, followed by 16 cycles of reaction at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds, and then an additional extension at 72°C for 7 minutes. After the PCR reaction, 4 µl was taken, and the amplified product was verified by 2% agarose gel electrophoresis; the results are shown in Figure 1. The DNA library obtained by performing PCR was purified using a PCR purification kit (Qiagen, USA) and then recovered using 50 µl of distilled water.
[0063] <1-2> ssDNA Amplification Using Asymmetric PCR Technique
[0064] Asymmetric PCR was performed to amplify only ssDNA from dsDNA amplified using the PCR technique. The asymmetric PCR reaction composition consisted of 7 µl of template DNA obtained in Example <1-1>, 10 µl of 10X PCR buffer, 8 µl of 2.5 mM dNTP mixture, 10 µl of 25 µM forward primer, 2 µl of 25 µM biotinylated reverse primer, 0.5 µl of Ex Taq polymerase (Takara, Japan) (1 unit / µl), and 62.5 µl of distilled water. The asymmetric PCR reaction conditions were as follows: first, denaturation at 95°C for 5 minutes; then, the reaction was repeated for 16 cycles of 30 seconds at 95°C, 30 seconds at 55°C, and 30 seconds at 72°C; and finally, an additional extension reaction was performed at 72°C for 7 minutes. After the PCR reaction, 4 µl was taken and a 2% agarose gel was used to check for the appearance of bands of the correct size, and the remaining DNA was subjected to the commonly used PCI extraction and ethanol precipitation method to recover the pure DNA aptamer pool.
[0065] An equal volume of PCI (Phenol : Chloroform : Isoamyl alcohol = 25 : 24 : 1) solution was added to the reaction mixture and stirred vigorously. The mixture was then centrifuged at 13,000 rpm at 4°C for 15 minutes to recover only the supernatant. To the supernatant, 1 / 100th of the volume of tRNA (Sigma Aldrich, USA) and 3 times the volume of 100% ethanol were added, and the reaction was carried out at -70°C for more than 1 hour. After the reaction, the mixture was centrifuged at 13,000 rpm at 4°C for 20 minutes to recover only the DNA. The recovered DNA was dried at 65°C and dissolved in 50 µl of distilled water. 4 µl of the recovered DNA was taken and subjected to 2% agarose gel electrophoresis to check for the appearance of bands of the correct size; the results are shown in Figure 1.
[0067] <1-3> Synthesis and Recovery of ssDNA Using the Heating-Cooling Technique
[0068] In order to remove biotin-attached dsDNA and ssDNA from the PCR products amplified using asymmetric PCR and to obtain only pure forward ssDNA, 50 µl of distilled water was added to 50 µl of DNA obtained in Example <1-2>, and the dsDNA was denatured into ssDNA using a heating-cooling technique. The dsDNA was reacted at 85°C for 5 minutes to denature it into ssDNA, and after the reaction was finished, the reaction mixture was cooled to 4°C to prepare the ssDNA.
[0069] Subsequently, 50 µl of streptavidin (Sigma) was added and the reaction was carried out at room temperature for 1 hour. After the reaction was complete, the mixture was centrifuged at 13,000 rpm at 4°C for 10 minutes, and only the supernatant was collected to obtain ssDNA. To obtain pure ssDNA from the reaction mixture, PCI extraction and ethanol precipitation were performed. An equal volume of PCI (Phenol : Chloroform : Isoamyl alcohol = 25 : 24 : 1) solution was added to the reaction mixture and vigorously stirred; the mixture was then centrifuged at 13,000 rpm at 4°C for 15 minutes to collect the supernatant. To the supernatant, 1 / 100th of the volume of tRNA (Sigma Aldrich) and three times the volume of 100% ethanol were added, and the mixture was reacted at -70°C for at least 1 hour. After the reaction, the sample was centrifuged at 13,000 rpm at 4°C for 20 minutes to recover only the ssDNA. The recovered ssDNA was dried at 65°C and dissolved in 50 µl of distilled water. 4 µl of the recovered ssDNA was taken and subjected to 2% agarose gel electrophoresis to check for the appearance of bands of the correct size.
[0071] <Example 2>
[0072] Selection of ssDNA aptamers specifically binding to glycated hemoglobin protein using the SELEX technique
[0073] <2-1> Composition of each solution used in SELEX and protein preparation
[0074] The composition of each solution used in SELEX is as follows.
[0075] 2X SELEX buffer (Aptamer screening solution): 100 mM Tris-HCl pH 7.5, 300 mM NaCl, 10 mM KCl, 2 mM CaCl2, 2 mM MgCl2
[0076] 1X SELEX buffer (Aptamer screening solution): 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2
[0077] Glycated hemoglobin protein: Human recombinant His-tagged (C0858) glycated hemoglobin protein purchased from Sigma was prepared at a concentration of 50 pmol in 1X aptamer screening solution.
[0079] <2-2> Selection of Aptamers Specifically Binding to Glycated Hemoglobin Protein Using DVB Core-Shell Nanoparticles
[0080] In order to select DNA aptamers that specifically bind to glycated hemoglobin protein, 60 µl of distilled water was added to 40 µl of ssDNA prepared and obtained in Example 1 above, and 100 µl of 2X aptamer selection solution was added, then heated at 85°C for 5 minutes to denature, and then slowly cooled at room temperature to form a stable three-dimensional structure of ssDNA aptamers.
[0081] To select DNA aptamers that specifically bind to glycated hemoglobin protein, a fixative was prepared for glycated hemoglobin protein. To prepare silica divinylbenzene (DVB) core-shell nanoparticles as the fixative, a silica core was prepared by polymerizing tetraethyl orthosilicate (TEOS), NH4OH, ethanol, and octadecyltrimethoxysilane (C10TMS), and pores were created through a crystallization and carbonization process. Divinylbenzene (DVB) was added as a carbon source into the pores of the prepared silica core, and DVB core-shell nanoparticles were prepared by removing the internal silica core using HF. The prepared DVB core-shell nanoparticles were analyzed using an electron microscope.
[0082] To immobilize glycated hemoglobin protein on the surface of fabricated DVB core-shell nanoparticles, carboxyl functional groups were introduced to the surface of the DVB core-shell nanoparticles, followed by treatment with EDC (1-Ethyl-3-(dimeth / ylaminopropyl)-carbodiimide) and NHS (N-hydroxysuccinimide), and then the glycated hemoglobin was immobilized. After immobilization, the surface was treated with ethanol amine.
[0083] The DNA aptamer with the above structure was mixed with a pre-prepared glycated hemoglobin protein, and the total reaction volume was adjusted to 200 µl using 1X SELEX buffer. The mixture was then reacted at 4°C for at least 12 hours. To select DNA aptamers that specifically bind to glycated hemoglobin protein, 500 µl of 2X SELEX buffer was added to 200 µl of Ni-NTA agarose beads (QIAGEN) and stirred. The mixture was centrifuged at 13,000 rpm for 10 minutes at 4°C to remove the supernatant, after which the aptamer prepared above and the glycated hemoglobin protein were added and reacted at 4°C for 1 hour. Subsequently, the mixture was centrifuged at 13,000 rpm for 10 minutes at 4°C to remove the supernatant, and the Ni-NTA agarose beads were washed three times with 2X SELEX buffer. Distilled water was added to the washed beads and reacted at 85°C for 5 minutes, followed by centrifugation at 13,000 rpm at 4°C for 10 minutes to obtain denatured DNA aptamers, and this process was repeated twice. Subsequently, as described above, PCI extraction and ethanol precipitation were performed to finally recover DNA aptamers suspended in 50 µl of distilled water. The concentration of the recovered aptamers was measured using a Nano-drop.
[0085] <2-3> Removal of Non-specific ssDNA Aptamers via Negative SELEX
[0086] To remove DNA aptamers that bind nonspecifically to Ni-NTA agarose beads other than glycated hemoglobin protein, negative SELEX was performed between cycles 6 and 7 using Ni-NTA agarose beads without immobilized glycated hemoglobin protein. After activating the Ni-NTA agarose beads using 1X SELEX buffer, they were reacted with DNA aptamers that had formed a three-dimensional structure, and then centrifuged at 13,000 rpm at 4°C for 5 minutes to collect the supernatant. Through this process, DNA aptamers that bind nonspecifically to Ni-NTA agarose beads were removed. The buffer containing DNA aptamers that did not bind to the filter was recovered, treated with an equal volume of PCI, and then centrifuged at 13,000 rpm at 4°C for 15 minutes to collect only the supernatant again. Subsequently, 100% ethanol at three times the volume of the supernatant and tRNA at 1 / 100th the volume were added and reacted at -70°C for at least one hour, and the reaction mixture was centrifuged at 13,000 rpm at 4°C for 20 minutes. The DNA aptamers recovered through PCI treatment and ethanol precipitation were dried at 37°C for at least 25 minutes and then dissolved in 50 µl of distilled water. Subsequently, SELEX was performed a total of 10 times using the same method.
[0088] <2-4> Determination of SELEX Rounds for the Selection of Optimal Glycated Hemoglobin-Binding DNA Aptamers Using Real-Time PCR
[0089] SELEX was completed with the 8th run, and subsequently, the affinity of DNA aptamers obtained in each round was indirectly quantified through real-time PCR. Each aptamer candidate obtained in rounds 7, 8, and 9, which were the selection rounds following the negative round, was amplified using PCR, and real-time PCR was performed using these amplified aptamers.
[0090] Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad, USA) under the same conditions as the amplification using the PCR technique described above. The results obtained are shown in Figure 2, and the aptamer candidates obtained in round 8, which had the lowest C(t) value, were selected as the optimal aptamer candidates.
[0092] <Example 3>
[0093] Cloning of DNA aptamer candidates that specifically bind to glycated hemoglobin protein
[0094] dsDNA was obtained by performing PCR using forward and reverse primers on the ssDNA aptamer from round 9, which was determined to have the highest binding efficiency with glycated hemoglobin protein. The obtained dsDNA was cloned using Solgent's T-Blunt Cloning Kit. Cloning was performed under conditions where 1 µl of T-vector (10 ng / µl), 4 µl of PCR product (20 ng / µl), and 1 µl of 6× T-Blunt buffer were mixed and reacted at 25°C for 5 minutes. 6 µl of the T-Blunt Cloning solution was mixed with 100 µl of DH5α, transformed by applying heat shock at 42°C for 30 seconds, and then reacted on ice for 2 minutes. Subsequently, 900 µl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose) was added, and the mixture was incubated at 37°C for 40 minutes. After incubation, 200 µl of the solution was taken and spread onto an LB culture plate containing ampicillin (50 µg / ml), kanamycin (50 µg / ml), X-gal (50 µg / ml), and IPTG (5 µg / ml). The mixture was incubated at 37°C for 15 hours, after which only white colonies were selected and sent to Solgent (Korea) for analysis of the aptamer sequences. Through sequence analysis, eight non-overlapping DNA aptamer sequences that bind to glycated hemoglobin protein were obtained and are shown in Table 1 below.
[0095] DNA aptamer candidates that bind to glycated hemoglobin protein Aptamer name Sequence number Aptamer sequence Sequence size (bp) Hb_1 1 CTCTTTCTATACAGAGTCACTAGAAGTTGTGCAGGTGTTGG 40 Hb_2 2 TCGTCGTGGAGACGTACGTCCACTTTGGTGCATGGTCG 38 Hb_3 3 AAGTCCTTAACACGCTATCTGTGAATAAGAGTCGTGTTG 39 Hb_4 4 TAGTGAGATGTAGGTCCATGCTGACGGGTTGCGTACTGTG 40 Hb_5 5 GTGTCATGCGCAATTGTGTTGTTGTGGTCGCGTTTTGGTCG 40 Hb_6 6 GGCGTAGCCAAAGCGGCGTACTGGAATTGTTGCATTCCCG 40 Hb_7 7 GCAAGGTTCGAACCACGCATCCACTATTTAACGGGTGTCG 40 Hb_8 8 GGGCGCTGTAGCTGCGCACCTGGTGACCTTAGCTGTTACG 40
[0097] <Example 4>
[0098] Determination of the structure of DNA aptamers that specifically bind to glycated hemoglobin protein
[0099] The secondary structures of eight DNA aptamer candidates that specifically bind to glycated hemoglobin protein obtained in Example 3 above were imaged using the DNA mfold website (https: / / www.unafold.org / ) and are shown in Figures 3 and 4.
[0101] <Example 5>
[0102] Prediction of the 3D binding structure of a DNA aptamer specifically binding to glycated hemoglobin protein with glycated hemoglobin protein
[0103] We intended to analyze the three-dimensional binding structure of the glycated hemoglobin protein and the DNA aptamer of the present invention using a three-dimensional model. To this end, three-dimensional structure predictions for eight candidate DNA aptamers were obtained using the RNAcomposer website (https: / / rnacomposer.cs.put.poznan.pl / ). The MOE 2022.06 program was used for structure prediction, and structural analysis was performed using the Pymol program to visualize the results. Prior to structure prediction, the three-dimensional structures of the glycated hemoglobin protein and the DNA aptamer were prepared by minimizing all energy, and the interaction between the glycated hemoglobin protein and the DNA aptamer was predicted using the Triangle Matcher method. All structure predictions were repeated 10 times, and among the total of eight aptamers, only those aptamers in which a binding structure was formed at the glycosylated site during binding with the glycated hemoglobin protein were selected.
[0105] <Example 6>
[0106] Detectability test of glycated hemoglobin protein-binding DNA aptamers via SPR
[0107] <6-1> Fabrication of an Aptamer Immobilization Chip for Affinity Analysis of DNA Aptamers Binding to Glycated Hemoglobin Protein
[0108] Experiments were conducted to verify the glycated hemoglobin protein detection capability of aptamers confirmed to have high affinity for glycated hemoglobin protein. For this purpose, Surface Plasmon Resonance (SPR) analysis was performed using the SPR detection system instrument BIAcoreX100 (BIACORE), and a sensor chip CM5 (Cytiva) with a surface coated with streptavidin was used for the SPR experiment. To immobilize the aptamers on the sensor chip CM5, the surface of the chip was activated by flowing a mixture of 0.1 M N-hydroxysuccinimide (NHS) and 0.4 M N-ethyl-N'-(dimethylaminopropyl)carbodiimide (EDC) over the chip at a rate of 10 µl / min for 7 minutes. Subsequently, to immobilize glycated hemoglobin protein on the activated chip surface, the protein was diluted in 10 mM sodium acetate (pH 5.0) buffer and immobilized by treating at a rate of 10 µl / min for 7 minutes. To prevent aptamers from immobilizing on the chip surface with the immobilized glycated hemoglobin protein, the reaction was terminated by flowing 1 M ethanolamine hydrochloride (pH 8.5) over the chip at a rate of 10 µl / min for 7 minutes. Aptamers were injected into the chip at various concentrations to quantify their affinity with the target glycated hemoglobin protein.
[0110] <6-2> Evaluation of the Affinity of Optimal Glycated Hemoglobin Protein-Binding DNA Aptamers with Target Glycated Hemoglobin Protein
[0111] To evaluate the quantitative affinity of aptamers that specifically bind to glycated hemoglobin protein, glycated hemoglobin protein was prepared by diluting it to various concentrations in 1X PBS buffer. The prepared glycated hemoglobin protein was treated with solutions of glycated hemoglobin protein diluted to various concentrations at a rate of 5 µl / min for 10 minutes on a sensor chip without any binding (Channel 1) and a sensor chip immobilized with glycated hemoglobin protein-binding DNA aptamers (Channel 2), and the affinity between the glycated hemoglobin protein and the DNA aptamer candidates was quantitatively analyzed. The dissociation constant between the target glycated hemoglobin protein and the DNA aptamer ( K D The results obtained (dissociation) are shown in Table 2 below.
[0112] Results of affinity analysis between target glycated hemoglobin protein and DNA aptamers Aptamer name Sequence number K D (pM) Aptamer name Sequence number K D (pM) Hb_1 1 0.296 Hb_5 5 0.506 Hb_2 2 0.453 Hb_6 6 0.197 Hb_3 3 0.381 Hb_7 7 0.156 Hb_4 4 0.53 Hb_8 8 0.517
[0114] <Example 7>
[0115] Evaluation of Glycated Hemoglobin Detection Using Raman Spectroscopy-Based Aptamers
[0116] The detection capability of glycated hemoglobin was analyzed using Raman spectroscopy with an aptamer discovered in this invention that specifically binds to glycated hemoglobin protein. The aptamer (Hb_7) and glycated hemoglobin protein were reacted at a molar ratio of 1:10 for 1 hour, and then immobilized using an aminosilane-coated plate. Gold nanoparticle coating was performed on the plate immobilized with the glycated hemoglobin-aptamer complex using a GNP colloidal solution.
[0117] The glycated hemoglobin-aptamer complex coated on the plate was induced to an excited state at a wavelength of 532.05 nm using a Raman spectrometer and irradiated with an intensity of 1.11 mW. The wavelength was measured after an exposure of 10 seconds, and the Raman spectrum was analyzed.
[0119] As a result, as shown in Figure 5, HPLC analysis confirmed that the aptamer of the present invention binds more specifically to glycated hemoglobin protein compared to normal hemoglobin protein, and a peak was observed in the state where the aptamer of the present invention is bound to glycated hemoglobin. Through these results, it was found that the aptamer discovered in the present invention can specifically detect glycated hemoglobin protein.
[0121] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.
Claims
Claim 1 A DNA aptamer that specifically binds to glycated hemoglobin protein, characterized by having any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs 1 to 8. Claim 2 A DNA aptamer that specifically binds to glycated hemoglobin protein, wherein the DNA aptamer is characterized by having a label selected from the group consisting of fluorescent substances, biotin, streptavidin, amine groups, biotin, and thiol groups labeled on the 5' or 3' end of the DNA aptamer. Claim 3 A composition for detecting glycated hemoglobin comprising the DNA aptamer of claim 1. Claim 4 A kit for detecting glycated hemoglobin comprising the detection composition of claim 3. Claim 5 A method for detecting glycated hemoglobin, comprising the step of reacting the detection composition of claim 3 with a sample. Claim 6 A method for detecting glycated hemoglobin according to claim 5, characterized in that the sample is blood, saliva, tears, urine, synovial fluid, mucus, cells, or body fluid. Claim 7 A composition for the diagnosis or prognosis determination of any one disease selected from the group consisting of diabetes, cardiovascular disease, diabetic nephropathy, and retinopathy, comprising the DNA aptamer of claim 1 as an active ingredient. Claim 8 A composition for diagnosis or prognosis determination according to claim 7, characterized in that the cardiovascular disease is coronary artery disease, stroke, peripheral artery disease, myocardial infarction, or angina pectoris.