RNA inhibitors that suppress complement system gene expression and their uses

Abstract

The present application belongs to the field of biopharmaceuticals, and more specifically, relates to an RNA inhibitor that inhibits a type of complement system gene expression or a pharmaceutically acceptable salt thereof, wherein the structure of the RNA inhibitor further comprises vector structures 5' MVIP and 3' MVIP. The RNA inhibitor provided in the present application interferes with the translation template function of complement system mRNA to continuously and highly inhibit complement system gene expression, thereby continuously lowering the levels of complement system CFB, C5, and C3 proteins in the blood, and thus can be applied to the treatment and / or prevention of diseases related to elevated complement system levels.

Description

Technology Field

[0001] This application belongs to the field of biopharmaceuticals, and more specifically, relates to an RNA inhibitor that inhibits a type of complement system gene expression and its uses. Background Technology

[0002] RNAi

[0003] RNAi (RNA interference) was discovered in 1998 by Andrew Z. Fire and others while conducting RNA inhibition experiments on the nematode *Caenorhabditis elegans*, and this process was named RNA interference. This discovery was selected as one of the top 10 scientific advancements in 2001 by *Science* magazine and was also named the top 10 scientific advancements in 2002. From this point on, siRNA, which uses RNA interference as its mechanism of action, received great attention as a potential gene therapy drug, and in 2006, Andrew Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of the RNA interference mechanism. RNAi can be induced by double-stranded RNA (dsRNA) in various organisms, including animals, plants, and fungi. During the RNA inhibition process, a type of endonuclease called "Dicer" cleaves or "dices" long-stranded dsRNA into small fragments 21 to 25 nucleotides long. These small fragments are called short interfering RNAs (siRNA), and among them, the guide strand is loaded onto the Argonaute protein (AGO2). AGO2 loading occurs within a RISC-loading complex, which is a ternary complex composed of the Argonaute protein, Dicer, and a dsRNA binding protein (abbreviated as TRBP). During the loading process, the passenger strand is degraded by AGO2 and expelled. Next, AGO2 uses an antisense chain to bind to mRNA containing a fully complementary sequence, and then promotes the cleavage of these mRNAs, causing mRNA fragmentation and the loss of the translation template's function, and further inhibits the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense chain is circulated for cleavage in another cycle.

[0004] According to statistics, approximately over 80% of disease-related proteins in the human body are classified as undruggable proteins because they are not targeted by current standard small molecule drugs and large biological agents. Gene therapy, which aims to treat diseases through functions such as gene expression and gene silencing, is recognized by the industry as the third major therapeutic agent following chemical small molecule drugs and large biological agents; as this therapy realizes disease treatment at the genetic level, it is not subject to the limitations of undruggable proteins. RNAi technology, the most major type of gene therapy, treats diseases at the mRNA level and possesses higher efficiency than chemical small molecule drugs or large biological agents in treating at the protein level. Using RNAi technology, sequences of siRNA sense chains and antisense chains with high specificity and good inhibitory effect according to a specific gene sequence are designed, and these single-strand sequences are synthesized through a solid phase. Then, the sense chain and antisense chain are paired into siRNA according to the base pairing principle in a specific annealing buffer, and finally, they are transported to a corresponding target in the body through a vector system to degrade the target mRNA and destroy its function as a translation template for the target mRNA, thereby inhibiting the synthesis of the related protein.

[0005] siRNA delivery system

[0006] SiRNA is unstable in blood and tissues and is easily degraded by nucleases. While this can be achieved by modifying the siRNA sense chain and / or antisense chain to enhance siRNA safety, such chemical modifications provide only limited protection against nuclease degradation and may ultimately affect siRNA activity. Therefore, it is necessary to ensure that siRNA passes through the cell membrane safely and efficiently via a corresponding delivery system. Since siRNA molecules have a relatively large molecular mass, carry a large negative charge, and possess high solubility, they cannot smoothly pass through the cell membrane and reach the cell on their own.

[0007] The basic structure of liposomes consists of a hydrophilic nucleus and a phospholipid bilayer, and because they possess a phospholipid bilayer similar to a biofilm and have very high biocompatibility, liposomes were once the most preferred and widely applicable siRNA vectors. Liposome-mediated siRNA delivery primarily involves encapsulating siRNA within the liposome to protect it from degradation by nucleases, thereby improving the efficiency of siRNA passing through the cell membrane and promoting cellular uptake. For example, there have been certain advancements in anionic liposomes, pH-sensitive liposomes, immunoliposomes, fusogenic liposomes, cationic liposomes, etc. However, since liposomes themselves easily induce an inflammatory response, it is necessary to use various antihistamines and hormones, such as cetirizine and dexamethasone, to reduce the acute inflammatory response that may occur before administration. Therefore, they are not suitable for all therapeutic fields in actual clinical application, and particularly in the treatment of some chronic diseases, there is a potential safety risk that toxicity may accumulate with long-term use, so it is necessary to deliver siRNA using a safer and more effective vector system.

[0008] In the liver, the asialoglycoprotein receptor (ASGPR) is a type of highly efficient endocytotic receptor expressed specifically by liver cells. Under physiological conditions, since the distal end of various glycoproteins is a galactose residue exposed after sialic acid is decomposed by enzymes or acids, the sugar that specifically binds to ASGPR is the galactose group; therefore, it is also called a galactose-specific receptor. Monosaccharide and polysaccharide molecules such as galactose, galactosamine, and n-acetylgalactosamine all exhibit high affinity for ASGPR. The primary physiological function of ASGPR is to mediate the removal of substances such as asialoglycoproteins and lipoproteins from the blood, and it is also closely associated with the onset and progression of liver diseases such as viral hepatitis, cirrhosis, and liver cancer. The discovery of these properties of ASGPR plays an important role in the diagnosis and treatment of hepatogenous diseases (Ashwell G, Harford J, Carbohydrate specific Receptors of the Liver, Ann Rev Biochem 1982 51:531-554). Hepatogenous disease treatment drugs containing galactose, galactosamine, and their derivatives have a specific affinity for ASGPR and therefore possess active hepatic targeting, making it unnecessary to transport them through other vector systems.

[0009] Complement system

[0010] The complement system activates three pathways, including the Classical Pathway, the Lectin Pathway, and the Alternative Pathway, which are the three pathways commonly observed in complement system activation. The main difference among these three pathways lies in the initiation process. Following initiation, C3-converterase is formed and subsequently degrades C3. The C3b fragment binds to the preceding complex to form C5-converterase, which degrades C5b and C5a to trigger the assembly of MAC; MAC then degrades cells and stimulates the generation of an inflammatory response to remove foreign substances.

[0011] The classical pathway (CP) is typically initiated by the attachment of C1q to an immune complex (e.g., IgM or IgG). Subsequently, C1q activates C1r, thereby altering the stereochemical structure of the C1r2-C1s2 structure. C1r releases C1s, which possesses serine protease (sp) activity and cleaves C4 and C2 to produce C4b2a (C3 convertase). C3 convertase forms C5 convertase through C3 cleavage and subsequent binding with C3b. C4a, C3a, and C5a stimulate an inflammatory response. C5b forms the C5b-9 MAC in coordination with C6, C7, C8, and C9 to attack host cells or pathogens.

[0012] Activation of the lectin pathway (LP) is identical to activation of the classical pathway (CP), the difference being that the initiator of LP is mannose-binding lectin (MBL), which forms a polylexin complex through binding with ficolin. This binding causes the activation of mbl-associated serine proteases (MASP), thereby triggering the complement system. MASP-1 and MASP-2 are analogous to C1r and C1s, respectively. MASP-1 and MASP-2 sufficiently activate the complement system by forming C3 convertases through the cleavage of C4 and C2.

[0013] The difference between the alternative pathway (AP) and the classical pathway (CP) is that the three components C1, C4, and C2 do not participate in the activation, but rather C3 is directly activated. Upon detection of pathogen invasion, a metastable state is generated in a large amount of the C3 thioester domain, exposing C3 to the factor b (Fb) binding site, and C3b is identified by factor B to form the complex C3bB. Conversely, the C3bB complex is degraded by factor D to produce the active form of C3-converterase (C3bBb), and C3-converterase (C3bBb) degrades C3 into C3a and C3b, with C3b binding to the pathogen or target cell as an active fragment. In response to C3-converterase, C3b generates C5-converterase, which degrades C5 to recruit the membrane attack complex (MAC) and degrade the pathogen. Both of these types of C3 convertases (C3bB / C3bBb) degrade C3 to form C3b. C3b then binds to more B factors, enhancing complement activation via AP. Alternatively, C3b leads to the formation of active C5 convertases (C3bBbC3b or C4bC2bC3), which degrade C5 and trigger subsequent events resulting in the formation of the Membrane Attack Complex (MAC) (C5b-9).

[0014] Diseases caused by the inappropriate activation of the complement system

[0015] Inhibitors that suppress the expression of complement C3 and C5 genes can be used to treat diseases such as paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), rheumatoid arthritis, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), schizophrenia, Parkinson's disease (PD), prion diseases, complement component C3-related eye diseases, ischemia-reperfusion injury, and neurodegenerative diseases.

[0016] Inhibitors that suppress the expression of the complement factor B gene can be used to treat subjects suffering from complement factor B-related diseases, such as, for example, lupus nephritis, IgA nephropathy, C3 glomerulopathy such as diabetic nephropathy and polycystic kidney disease, and systemic lupus erythematosus.

[0017] Combination use of drugs

[0018] Currently available complement inhibitors include Soliris, Ultomiris, Empaveli, Eculizumab, Ravulizumab, and Iptacopan (LNP023). These polypeptides, monoclonal antibodies, or small molecule drugs enhance the ability to suppress the systemic complement system when used in combination with RNAi inhibitors that inhibit complement expression. However, most current complement inhibitors are evaluated for clinical administration frequency at once every 1 to 2 weeks, resulting in high costs and causing low levels of hemolysis in PNH subjects. Therefore, novel alternative drugs or combination therapies are still needed for patients with complement disorders.

[0019] In one aspect, the present invention provides an RNA inhibitor that inhibits a type of complement system gene expression or a pharmaceutically acceptable salt thereof.

[0020] In an RNA inhibitor that inhibits a type of complement system gene expression or a pharmaceutically acceptable salt thereof, the RNA inhibitor is formed by base pairing a sense strand and an antisense strand having a chain length of 15-30, wherein the chain length is preferably 19-23, wherein the antisense strand comprises a region complementary to the mRNA encoding the complement system, and further wherein the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides compared to any one of the antisense strands shown in Table 1-1, Table 1-2, or Table 1-3.

[0021] In the aforementioned RNA inhibitor that inhibits complement system gene expression or a pharmaceutically acceptable salt thereof, the RNA inhibitor is an RNA inhibitor that inhibits CFB gene expression, and the antisense chain comprises a region complementary to a target sequence, wherein the target sequence comprises: a 5' gucuagucaacuuaauugaga 3' SEQ ID NO: 25, NM_001710.5, the starting position is at site 1157, and at least 85% of the bases between the sense chain and the antisense chain are complementary.

[0022] In the aforementioned RNA inhibitor that inhibits complement system gene expression or a pharmaceutically acceptable salt thereof, the RNA inhibitor is an RNA inhibitor that inhibits C5 gene expression, wherein the antisense chain comprises a region complementary to the target sequence, the target sequence is 5' uugucccaguauucuauguuu 3' SEQ ID NO: 826, the starting position in NM_001735.3 is at site 3073, and at least 85% of the bases between the sense chain and the antisense chain are complementary.

[0023] In the aforementioned type of RNA inhibitor that inhibits complement system gene expression or a pharmaceutically acceptable salt thereof, said RNA inhibitor is an RNA inhibitor that inhibits C3 gene expression, wherein the antisense chain comprises a region complementary to the target sequence, and the target sequence is as follows: 5' gguguugacagauacaucu 3' SEQ ID NO: 1952, NM_000064.4, where the start position is site 4329; the target sequence is 5' ggagccuacagagaaauucua 3' SEQ ID NO: 2039, NM_000064.4, where the start position is site 771; 5' agaaauucuacuacaucuaua 3' SEQ ID NO: 2048, NM_000064.4, where the start position is site 782; The target sequence is 5' gcugaggagaauugcuucaua 3' SEQ ID NO: 2240, NM_000064.4, with the starting position at site 4603; the target sequence is 5' ggagaauugcuucauacaaaa 3' SEQ ID NO: 2245, NM_000064.4, with the starting position at site 4608; and at least 85% of the bases between the sense chain and the antisense chain are complementary.

[0024] In the aforementioned CFB RNA inhibitor or its pharmaceutically acceptable salt, the antisense chain is selected from the following sequences:

[0025] 5' ucucaauuaaguugacuagacac 3' SEQ ID NO: 293;

[0026] Or a sequence having at least 15 consecutive nucleotides identical to the antisense chain, or a sequence differing from the antisense chain by 1, 2 or 3 nucleotides, and the sense chain may be any sequence that is complementary to the antisense chain by at least 85% of the bases.

[0027] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0028] In the aforementioned CFB RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is selected from the following sequences:

[0029] 5' gucuagucaacuuauugaga 3' SEQ ID NO: 25;

[0030] or a sequence having at least 15 consecutive nucleotides identical to the sense chain, or a sequence differing from the sense chain by 1, 2, or 3 nucleotides, the sense chain may be any sequence in which at least 85% of the bases are complementary to the antichain;

[0031] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, and c=cytidyl acid.

[0032] In the aforementioned C5 RNA inhibitor or its pharmaceutically acceptable salt, the antisense chain is selected from the following sequences:

[0033] 5' aaacauagaauacugggacaacg 3' SEQ ID NO: 1278;

[0034] Or at least 15 consecutive nucleotide sequences identical to the antisense chain, or a sequence different from the antisense chain by 1, 2 or 3 nucleotides, and the sense chain may be any sequence that is complementary to the antisense chain by at least 85% of the bases.

[0035] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0036] In the aforementioned C5 RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is selected from the following sequences:

[0037] 5' uugucccaguauucuauguuu 3' SEQ ID NO: 826;

[0038] Or a sequence having at least 15 consecutive nucleotides identical to the sense chain, or a sequence differing from the sense chain by 1, 2 or 3 nucleotides, and the antisense chain may be any sequence that is complementary to the sense chain by at least 85% of the bases.

[0039] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, and c=cytidyl acid.

[0040] In the aforementioned C3 RNA inhibitor or its pharmaceutically acceptable salt, the antisense chain is selected from the following sequences:

[0041] 5' agauguaucugucaacaccau 3' SEQ ID NO. 2543;

[0042] 5' uagaauuucucuguaggcuccac 3' SEQ ID NO. 2630;

[0043] 5' uauagauguaguagaauuucucu 3' SEQ ID NO. 2639;

[0044] 5' uaugaagcaauucuccucagcac 3' SEQ ID NO. 2831;

[0045] 5' uuuuguaugaagcaauucuccuc 3' SEQ ID NO. 2590;

[0046] Or a sequence having at least 15 consecutive nucleotides identical to the antisense chain, or a sequence differing from the antisense chain by 1, 2, or 3 nucleotides,

[0047] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide; the sense chain can be any sequence that is at least 85% complementary to the antisense chain.

[0048] In the aforementioned C3 RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is selected from the following sequences:

[0049] 5' gguguugacagauacaucu 3' SEQ ID NO. 1952;

[0050] 5' ggagccuacagagaaauucua 3' SEQ ID NO. 2039;

[0051] 5' agaaauucuacuacaucuaua 3' SEQ ID NO. 2048;

[0052] 5' gcugaggagaauugcuucaua 3' SEQ ID NO. 2240;

[0053] 5' ggagaauugcuucauacaaaa 3' SEQ ID NO. 2245;

[0054] Or a sequence having at least 15 consecutive nucleotides identical to the antisense chain, or a sequence differing from the sense chain by 1, 2, or 3 nucleotides,

[0055] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid; the antisense chain can be any sequence in which at least 85% of the bases are complementary to the sense chain.

[0056] In the aforementioned CFB RNA inhibitor or pharmaceutically acceptable salt thereof, the sense chain is a sequence having 15 consecutive nucleotides identical to SEQ ID NO:25 or at least the same, or a sequence different from it by 1, 2, or 3 nucleotides; and the antisense chain is a sequence having at least 15 consecutive nucleotides identical to SEQ ID NO:293 or the same, or a sequence different from it by 1, 2, or 3 nucleotides.

[0057] Sense Chain: 5' gucuagucaacuuaauugaga 3' SEQ ID NO:25;

[0058] Antisense chain: 5' ucucaauuaaguugacuagacac 3' SEQ ID NO:293;

[0059] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0060] In the aforementioned C5 RNA inhibitor or pharmaceutically acceptable salt thereof, the sense chain is a sequence having 15 consecutive nucleotides equal to SEQ ID NO: 826 or at least identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides; and also the antisense chain is a sequence having at least 15 consecutive nucleotides equal to SEQ ID NO: 1278 or identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides.

[0061] Sense Chain: 5' uugucccaguauucuauguuu 3' SEQ ID NO:826;

[0062] Antisense chain: 5' aaacauagaauacugggacaacg 3' SEQ ID NO:1278;

[0063] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0064] In the aforementioned C3 RNA inhibitor or pharmaceutically acceptable salt thereof, the sense chain is a sequence having 15 consecutive nucleotides equal to SEQ ID NO: 2048 or at least identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides; and also the antisense sequence is a sequence having at least 15 consecutive nucleotides equal to SEQ ID NO: 2639 or identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides.

[0065] Sense Chain: 5' agaaauucuacuacaucuaua 3' SEQ ID NO:2048;

[0066] Antisense chain: 5' uauagauguaguagaauuucucu 3' SEQ ID NO:2639;

[0067] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0068] In the aforementioned C3 RNA inhibitor or pharmaceutically acceptable salt thereof, the sense chain is a sequence having 15 consecutive nucleotides equal to SEQ ID NO: 2639 or at least identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides; and also the antisense chain is a sequence having at least 15 consecutive nucleotides equal to SEQ ID NO: 2831 or the same thereto, or a sequence differing from it by 1, 2, or 3 nucleotides.

[0069] Sense Chain: 5' gcugaggagaauugcuucaua 3' SEQ ID NO:2240;

[0070] Antaesense Chain: 5' uaugaagcaauucuccucagcac 3' SEQ ID NO:2831;

[0071] Here, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0072] In the aforementioned RNA inhibitor or its pharmaceutically acceptable salt, the RNA inhibitor is modified by at least one nucleotide.

[0073] In the aforementioned RNA inhibitor or its pharmaceutically acceptable salt, said modification is a 2'-fluorine modification, a 2'-methoxy group modification, a phosphorothioate group modification, an invAb modification, a glycerol nucleotide, a 3'-terminal deoxythymidine (dT) nucleotide, a locking nucleotide, an unlocking nucleotide, a conformational restriction nucleotide, a constrained ethyl nucleotide, a 2'-amino group modified nucleotide, a 2'-O-allyl group modified nucleotide, a 2'-C-alkyl group modified nucleotide, a 2'-hydroxy group modified nucleotide, a 2'-methoxyethyl group modified nucleotide, a 2'-O-alkyl group modified nucleotide, a 2'-phosphate modification, or a 2-O-(N-methylacetamide) modification. It is selected from one or a combination of several types selected from morpholino nucleotides, phosphoramidate, baseless nucleotides, baseless deoxynucleotides, nucleotides containing non-natural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, methylphosphonate modified nucleotides, 5'-phosphate modified nucleotides, 5'-phosphate analog modified nucleotides, heat-unstable nucleotides, and nucleotide analogs.

[0074] In the aforementioned CFB RNA inhibitor or its pharmaceutically acceptable salt, the antisense chain is selected from the following sequences:

[0075] 5' UsdCsUCdAATUAGTUfGACUAGACsAsC 3' SEQ ID NO: 588;

[0076] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidilic acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Cs=2'-O-methyl-3'-thiocytidilic acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid; fGs=2'-fluoro-3'-thioguanylic acid, T=2'-deoxy-thymidylic acid, dA=2'-deoxy-adenylic acid, dG=2'-deoxy-guanylic acid; The sense chain is any sequence that is at least 85% complementary to the antisense chain, and the modification method is not limited.

[0077] In the aforementioned C5 RNA inhibitor or its pharmaceutically acceptable salt, the antisense chain is selected from the following sequences:

[0078] 5' AsdAsACdAUdAGAAAUdACfUGGGACAAsCsG 3' SEQ ID NO: 1598;

[0079] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidilic acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Cs=2'-O-methyl-3'-thiocytidilic acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid; fGs=2'-fluoro-3'-thioguanylic acid, T=2'-deoxy-thymidylic acid, dA=2'-deoxy-adenylic acid, dG=2'-deoxy-guanylic acid; The sense chain is any sequence that is at least 85% complementary to the antisense chain, and the modification method is not limited.

[0080] In the aforementioned C3 RNA inhibitor or its pharmaceutically acceptable salt, the antisense chain is selected from the following sequences:

[0081] 5' UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO: 1665;

[0082] 5' UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO: 1671;

[0083] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, dG=2'-deoxy-guanylic acid, dAs=2'-deoxy-3'-thioadenylic acid; the sense chain is any sequence in which at least 85% of the bases are complementary to the antisense chain, and the modification method is not limited.

[0084] In the aforementioned CFB RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is selected from the following sequences:

[0085] 5' GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO: 559;

[0086] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidylic acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidylic acid; the antisense chain is any sequence in which at least 85% of the bases are complementary to the sense chain, and the modification method is not limited.

[0087] In the aforementioned C5 RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is selected from the following sequences:

[0088] 5' UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO: 1537;

[0089] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidylic acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidylic acid; the antisense chain is any sequence in which at least 85% of the bases are complementary to the sense chain, and the modification method is not limited.

[0090] In the aforementioned C3 RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is selected from the following sequences:

[0091] 5' AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO: 1645;

[0092] 5' GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO: 1651;

[0093] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidylic acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidylic acid; the antisense chain is any sequence in which at least 85% of the bases are complementary to the sense chain, and the modification method is not limited.

[0094] Preferably, in the aforementioned CFB RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is SEQ ID NO: 559 or a sequence different from this by one, two, or three nucleotides; and the antisense chain is SEQ ID NO: 588 or a sequence different from this by one, two, or three nucleotides.

[0095] Sense Chain: 5' GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO:559;

[0096] Antisense chain: 5' UsdCsUCdAATUAAGTUfGACUAGACsAsC 3' SEQ ID NO:588;

[0097] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenilic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenilic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, Ts=2'-deoxy-3'-thiothymidylic acid, dA=2'-deoxy-adenilic acid.

[0098] Preferably, in the aforementioned C5 RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is SEQ ID NO: 1537 or a sequence different from this by one, two, or three nucleotides; and the antisense chain is SEQ ID NO: 1598 or a sequence different from this by one, two, or three nucleotides,

[0099] Sense Chain: 5' UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO:1537;

[0100] Antisense chain: 5' AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3' SEQ ID NO:1598;

[0101] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenilic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenilic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, Ts=2'-deoxy-3'-thiothymidylic acid, dA=2'-deoxy-adenilic acid.

[0102] Preferably, in the aforementioned C3 RNA inhibitor or its pharmaceutically acceptable salt, the sense chain is SEQ ID NO: 1651 or a sequence different from this by one, two, or three nucleotides; and the antisense chain is SEQ ID NO: 1671 or a sequence different from this by one, two, or three nucleotides,

[0103] Sense Chain: 5' AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO:1645;

[0104] Antisense chain: 5' UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO:1665;

[0105] or the sense chain is a sequence that differs from SEQ ID NO: 1645 or by 1, 2, or 3 nucleotides; and also the antisense chain is a sequence that differs from SEQ ID NO: 1665 or by 1, 2, or 3 nucleotides,

[0106] Sense Chain: 5' GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO:1651;

[0107] Antisense chain: 5' UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO:1671;

[0108] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, dG=2'-deoxy-guanylic acid, dAs=2'-deoxy-3'-thioadenylic acid.

[0109] In some embodiments, the sense chain or antisense chain of the RNA inhibitor according to the present application allows for mispairing, whereby the mispairing site may occur at the 5', 3' end or within the sequence, and preferably, the mispairing does not exceed 3 nucleotides, for example, the mispairing may be 0, 1, 2, or 3 nucleotides.

[0110] In one embodiment, preferably, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof may further comprise vector structures 5' MVIP and 3' MVIP, the structures of the RNA inhibitor as shown in Formula Ia, Ib or Ic:

[0111]

[0112] Ia

[0113]

[0114] Ib

[0115]

[0116] Ic

[0117] Here,

[0118] The above vector structure includes a 5' MVIP (5' MultiValent Import Platform) and a 3' MVIP (3' MultiValent Import Platform).

[0119] The 5' MVIP is composed of a switching linkage R1, a link chain D, a joint B, a branching chain L, and a liver target-specific ligand X, which is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the switching linkage R1, and its structure is as indicated by General Formula I:

[0120]

[0121] I

[0122] The 3' MVIP is composed of a switching linkage R2, a link chain D, a joint B, a branching chain L, and a liver target-specific ligand X, which is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the switching linkage R2, and its structure is as shown by General Formula II:

[0123]

[0124] II

[0125] Here,

[0126] n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and also an integer from n+m=2 to 6, preferably n+m=2, 3 or 4, and more preferably 4.

[0127] The transition connection point R1 is a heterocyclic or carbon ring structure containing N, S, or O as shown below:

[0128] ;

[0129] Or, R1 is -NH(CH2) x CH2O-, where, x is any integer from 3 to 12, preferably, any integer from 4 to 6;

[0130] The transition connection point R2 is a heterocyclic or carbon ring structure containing N, S, or O as shown below:

[0131] ;

[0132] Or, the switching connection point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where, x1 is any integer from 1 to 4, preferably, x2 is any integer from 0 to 4;

[0133] The liver target-specific ligand X is selected from structures that enhance the uptake of RNA inhibitors by hepatocytes, may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, is selected from monosaccharides or derivatives thereof, preferably n-acetylgalactosamine and derivatives thereof, and more preferably is selected from the following structures:

[0134] ;

[0135] Here, W is -OH, -NHCOOH and -NHCO(CH2) q One or two types selected from CH3, where q is an integer from 0 to 4;

[0136] The branched chain L may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, and is selected from one or more of the following structures:

[0137]

[0138]

[0139] Here, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, Z is H, an alkyl group, or an amide group, and the alkyl group is, for example, a C1-C5 alkyl group;

[0140] Joint B may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, and is selected from the following structures:

[0141]

[0142] Here, A1 and A2 are each independently selected from C, O, S, -NH-, carbonyl group, amide group, phosphoryl group, or thiophosphoryl group, and r is any integer from 0 to 4;

[0143] Link chain D may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, and is selected from the following structures:

[0144]

[0145]

[0146]

[0147]

[0148]

[0149] Here, each p is independently any integer from 1 to 20; s is any integer from 2 to 13; and Z1 and Z2 are the same or different substituents, e.g., C3-C10 alkyl groups.

[0150] In some embodiments, the 5' MVIP is selected from any one of 5' MVIP01 to 5' MVIP22 in Table 11.

[0151] In some embodiments, the 3' MVIP is selected from any one of 3' MVIP01 to 3' MVIP27 in Table 12.

[0152] In some embodiments, in the RNA inhibitor or pharmaceutically acceptable salt thereof according to the present application, wherein 5' MVIP is 5' MVIP01 or 5' MVIP09 as shown below, and 3' MVIP is 3' MVIP01, 3' MVIP09 or 3' MVIP17 as shown below:

[0153] 5'MVIP01

[0154] 5'MVIP09

[0155] 3'MVIP01

[0156] 3'MVIP09

[0157] 3'MVIP17.

[0158] In some embodiments, in the RNA inhibitor or pharmaceutically acceptable salt thereof according to the present application, wherein the combination of sense chain 5' MVIP and antisense chain 3' MVIP is 5' MVIP01 / 3' MVIP01, 5' MVIP01 / 3' MVIP17 or 5' MVIP09 / 3' MVIP09, or the combination of sense chain 5' MVIP and sense chain 3' MVIP is 5' MVIP01 / 3' MVIP09 or 5' MVIP09 / 3' MVIP01.

[0159] In another aspect, the CFB RNA inhibitor is selected from Kylo-17-DS2911.

[0160] In another aspect, the C5 RNA inhibitor is selected from Kylo-19-DS7881.

[0161] In another aspect, the C3 RNA inhibitor is selected from Kylo-27-DS8201 and Kylo-27-DS8141.

[0162] In another aspect, the present application provides for the use of RNA inhibitors or pharmaceutically acceptable salts thereof in the manufacture of drugs for the treatment and / or prevention of diseases associated with elevated levels of the complement system, said diseases including lipid metabolism disorders.

[0163] In another aspect, the present application provides a pharmaceutical composition, said pharmaceutical composition comprising the above RNA inhibitor or other therapeutic agents for the treatment or prevention of complement system-related diseases.

[0164] In another aspect, the present application provides a pharmaceutical composition, said pharmaceutical composition comprising the above RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable additive, said formulation being an oral administration, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

[0165] Those skilled in the art will readily understand other aspects and advantages of this application from the following detailed description. The following detailed description describes exemplary embodiments of this application. As will be known to those skilled in the art, the content of this application may be modified by those skilled in the art without departing from the subject and scope of the invention related to this application. Correspondingly, the descriptions in the drawings and specification of this application are merely illustrative and not restrictive. Brief explanation of the drawing

[0166] The specific features of the invention related to this application are as set forth in the appended claims. The features and advantages of the invention related to this application can be better understood by referring to the exemplary embodiments described below and the attached drawings. A brief description of the drawing is as follows: FIG. 1 is a high-resolution mass spectrum of ERCd-01-c2 synthesized in 3.1.15 of Example 3 of the present application; FIG. 2 is a high-resolution mass spectrum of 3'MVIP17-c1 synthesized in 3.1.2.6 of Example 3 of the present application; FIG. 3 is a high-resolution mass spectrum of 5'MVIP09-ERCd-PFP-c2 of the synthesis in 3.2.1.2 of Example 3 of the present application; FIG. 4 is an explanatory diagram of the effect on the inhibition rate of hCFB protein in mouse serum after administration of the hCFB mouse drug of the present application; FIG. 5 is an explanatory diagram of the effect on the inhibition rate of hC5 protein in mouse serum after administration of the hC5 mouse drug in Example 7-2 of the present application; FIG. 6 is an explanatory diagram of the effect on the inhibition rate of hC5 protein in mouse serum after administration of the hC5 mouse drug in Example 7-3 of the present application; FIG. 7 is an explanatory diagram of the effect on the inhibition rate of hC3 protein in mouse serum after administration of the hC3 mouse drug of the present application; FIG. 8 is an explanatory diagram of the effect of the CFB RNA inhibitor of the present application on the inhibition rate of CFB protein in NHP cynomolgus monkeys; FIG. 9 is an explanatory diagram of the effect of the CFB RNA inhibitor of the present application on CFB mRNA levels in cynomolgus monkey liver tissue; FIG. 10 is an explanatory diagram of the effect of the C5 RNA inhibitor of the present application on the inhibition rate of C5 protein in NHP cynomolgus monkeys; FIG. 11 is an explanatory diagram of the effect of the C5 RNA inhibitor of the present application on the level of preservation of CH50 activity in NHP cynomolgus monkeys; Figure 12 is an explanatory diagram of the effect of the C3 RNA inhibitor of the present application on the inhibition rate of C3 protein in NHP cynomolgus monkeys. Specific details for implementing the invention

[0167] The manner of practice of the present application will be described through specific embodiments below. Those skilled in the art will be able to easily understand the other advantages and effects of the invention of the present application through the contents disclosed in the present application.

[0168] Definition of Terms

[0169] In this application, examples of complement system mRNA sequences can be easily obtained from already published databases, such as gene project sites like GenBank, UniProt, OMIM, and Macaca.

[0170] The term "CFB" refers to complement factor B, and its mRNA sequences can be found in GenBank NM_001710.5; 001710; cynomolgus monkey NC_041757.1; mouse M_001142706 and NM_008198; rat NM_212466 .3.

[0171] The term "C3" refers to complement C3, and its mRNA sequences can be found in GenBank NM_000064.4; cynomolgus monkey NC_000019.10; mouse NM_009778; and rat NM_016994.

[0172] The term "C5" refers to complement C5, and its mRNA sequence can be found in GenBank NM_001735.3; mouse NM_013485; and rat NM_057146.

[0173] Indicators for determining "inhibition of CFB expression" may include any level of inhibition, such as inhibition of the mRNA level of the CFB gene or inhibition of the protein level of the CFB gene, and may also be CH50 activity, which is a measure of total hemolytic complement, AH50 measurement of hemolytic activity of the extra-complement pathway, and / or lactate dehydrogenase levels, which are a measure of intravascular hemolysis, and / or hemoglobin levels; and may also evaluate the level of CFB expression by measuring the levels of C3, C9, C5, C5a, C5b and soluble C5b-9 complex.

[0174] Indicators for determining "suppression of C3 expression" include C3 measurement, total complement measurement, immune complex measurement, C3 plasma concentration measurement, and C3 antibody immobilization method measurement. C3 measurement may be any level of suppression, such as suppression at the mRNA level or protein level of the C3 gene; C3 measurement may be performed in conjunction with other complement components to evaluate the function of the overall complement system. This typically includes the measurement of indicators such as C4 concentration and CH50. Regarding the measurement of immune complexes, immune complexes are structures composed of antibodies and antigens and are formed in some autoimmune diseases. Serum immune complex measurement can assess whether these immune complexes cause activation of the immune system leading to a decrease in C3, and C3 plasma concentration measurement evaluates the function of the complement system by measuring the concentration of C3 in the plasma. Under normal conditions, the concentration of C3 should naturally be within the normal range, and regarding the C3 antibody immobilization method, this method is used to evaluate the function of the complement system by measuring the binding ability of C3 to a specific antigen. In addition, indicators related to C3 gene levels, such as CH50 activity which is a measure of total hemolytic complement, AH50 measurement of hemolytic activity of the extra-complement pathway, and / or levels of lactate dehydrogenase which is a measure of intravascular hemolysis, and / or levels of hemoglobin, may be measured. In addition, C3 expression may be evaluated by measuring the levels of CFB, C9, C5, C5a, C5b, and soluble C5b-9 complex.

[0175] Indicators for determining "inhibition of C5 expression" may include any level of inhibition, such as inhibition of the mRNA level of the C5 gene or inhibition of the protein level of the C5 gene, and may also be CH50 activity, which is a measure of total hemolytic complement, AH50 measurement of hemolytic activity of the extra-complement pathway, and / or lactate dehydrogenase levels, which are a measure of intravascular hemolysis, and / or hemoglobin levels; and may also evaluate the expression level of C5 by measuring the levels of C3, C9, C5, C5a, C5b, and soluble C5b-9 complex.

[0176] In the present application, the “target sequence” refers to a single continuous portion of the nucleotide sequence of an mRNA molecule formed during the complement gene transcription process, comprising mRNA of an RNA processing product which is the primary transcription product. In some embodiments, the target portion of the sequence must have at least sufficient length to be used as a degraded primer used to induce an RNA inhibitor at or near said portion of the nucleotide sequence of the mRNA molecule formed during the complement gene transcription process. The length of the “target sequence” is typically about 1,530 nucleotides.

[0177] In this application, the term “RNA inhibitor” typically comprises RNA agents as defined in the terms of this application, which induce targeted cleavage of RNA transcripts through the RNA-induced silencing complex (RISC) pathway. Through a process called RNA inhibition, it guides the specific degradation of mRNA sequences and regulates (e.g., inhibits) the expression of complement system genes in cells (e.g., cells of a subject such as a mammal).

[0178] In some embodiments, the RNA inhibitor is a single-stranded siRNA (siRNA inhibitor) capable of being introduced into a cell or organism to inhibit target mRNA (i.e., a complement system gene). The single-stranded RNA inhibitor binds to the RISC endonuclease Argonaute 2, which subsequently cleaves the target mRNA. The length of the single-stranded siRNA is typically 15 to 30 nucleotides and has undergone chemical modification.

[0179] In some embodiments of this application, the “RNA inhibitor” used herein is double-stranded RNA, and is also referred to as “double-stranded RNA inhibitor,” “double-stranded RNA (dsRNA, DS) molecule,” “dsRNA agent,” or “dsRNA” in this application. The term “dsRNA” refers to a complex of ribonucleic acid molecules having a double-stranded structure comprising two reversely parallel and generally complementary nucleic acid chains, and is said to have a tendency to be “sense” and “antisense” relative to target mRNA. In some embodiments of this application, double-stranded RNA (dsRNA) causes degradation of target mRNA through a post-transcriptional gene synchronizing mechanism (referred to herein as RNA inhibition or RNA interference).

[0180] The double-stranded structure is of any length at which the complement system mRNA can cause specific degradation via the RISC pathway and is also within the range of approximately 15 to 36 base pairing lengths, for example, approximately 15 to 30 base pairing lengths, for example, approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or 36 base pairing lengths. In some embodiments, the RNA inhibitor of the present application is a dsRNA of 15 to 30 nucleotides which interacts with a target sequence to guide the cleavage of the complement system mRNA.

[0181] Typically, the sense and antisense chains of dsRNA molecules consist mostly of ribonucleotides, but as described in detail in this application, they also include non-ribonucleic acids such as one or more deoxyribonucleotides or modified nucleotides. Additionally, RNA inhibitors mentioned herein may include ribonucleotides having chemical modifications and may have modified nucleotides in multiple regions. As used in the present invention, the term "modified nucleotide" refers to a nucleotide that is independently modified by a sugar portion, a linkage between modified nucleotides, or a modified nucleobase, or any combination thereof. Accordingly, the term "modified nucleotide" includes linkages between nucleotides, substitution, addition, or removal of functional groups or atoms, for example, of the sugar portion or nucleobase. Modifications of RNA inhibitors applicable to this application include all types of modifications disclosed in the present invention or already known in the art.

[0182] In this application, the term “nucleotide sequence” typically refers to a series or a certain order of nucleotides, described as a series of alphabets using standard nucleotide nomenclature and the modified nucleotide code table described in this application, whether modified or not. The nucleotide sequence according to this application is a polymer formed through a phosphodiester bond (or a related structural variant or synthetic analog) and includes naturally occurring nucleotide polymers, and should be understood that the scope of the term also includes various analogs, such as peptide nucleic acid (PNA), phosphoramidate, phosphorothioate, methylphosphonate, and 2’-O-methylribonucleic acid, but is not limited thereto. Typically, it has about 15 to 30 nucleotides, but the term may refer to molecules of any length.

[0183] In some embodiments, the nucleotide sequence comprises one or more unmodified ribonucleic acid (RNA) and / or unmodified deoxyribonucleic acid (DNA) and / or one or more modified nucleotides. The term “nucleotide sequence modification” typically refers to a series or a certain order of nucleotides connected by chemical bonds between at least one modification and / or at least one modified nucleotide.

[0184] In this application, the term "modified nucleotide" refers to one comprising at least one chemical modification compared to a naturally occurring RNA or DNA nucleotide. For example, it may be a 2'-deoxy-thymidylic acid 2'-O-methyl group modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy-modified nucleotide, lock nucleotide, debasic nucleotide, 2'-amino-modified nucleotide, 2'-O-long chain alkyl-modified nucleotide (e.g., hexadecyl group), morpholino nucleotide, phosphoramidate nucleotide, non-natural nucleobase nucleotide, 5'-phosphorothioate nucleotide and a cholesteryl derivative or a nucleotide to which a lauric acid decanedimide functional group is attached.

[0185] Modified nucleotides contain modified glycosyl groups and / or modified nucleobases.

[0186] In this application, the terms “nucleobase” or “base” typically refer to heterocyclic pyrimidine or purine compounds, which are constituent components of all nucleic acids and include adenine, guanine, cytosine, thymine, and uracil. Nucleotides may include modified nucleotides or simulants of nucleotides, abasics, or substituted portions. The terms “unmodified nucleobase” or “naturally occurring nucleobase” typically refer to naturally occurring heterocyclic nucleobases of RNA or DNA, including the purine bases adenine and guanine; and the pyrimidine bases thymine, cytosine, and uracil. “Modified nucleobase” typically refers to any nucleobase that is not a naturally occurring nucleobase.

[0187] In this application, the term "glycosyl" typically refers to a naturally occurring glycosyl group or a modified glycosyl group of a nucleotide. The term "naturally occurring glycosyl group" typically refers to a ribofuranose group found in naturally occurring RNA or a deoxyribofuranose group found in naturally occurring DNA. "Modified glycosyl group" refers to a substituted glycosyl group or sugar substitute, for example, a fluoro substitution or a methoxy substitution at the 2' position of the glycosyl group.

[0188] In this application, the term “chemical bonding between nucleotides” typically refers to a connection between adjacent nucleotides in a nucleotide sequence by a covalent bond. “Naturally occurring chemical bonding between nucleotides” refers to a connection by a 3’ to 5’ phosphodiester bond. “Modified chemical bonding between nucleotides” refers to a chemical bonding between any nucleotides excluding a connection by a naturally occurring chemical bonding between nucleotides.

[0189] In this application, the term “antisense chain (AS)” typically refers to a chain of RNA inhibitor (e.g., dsRNA) comprising a region substantially complementary to a target sequence. As used in this application, the term “complementary region” typically refers to a region in the antisense chain that is substantially complementary to the sequence defined in this application (e.g., target sequence).

[0190] In this application, the term “sense chain (SS)” typically refers to a chain in an RNA inhibitor (e.g., dsRNA) as follows, said chain comprising a region generally complementary to the region of the “antisense chain (AS).” The “sense” chain is also referred to in some cases as the “significant” chain, “passenger” strand, or “reverse guide” chain. By borrowing the sequence of the sense chain, the antisense chain targets a desired mRNA, while the sense chain may simultaneously target or degrade other possible targets. Thus, when the antisense chain is introduced into RISC, the correct target is targeted. The introduction of the sense chain may result in off-target effects. These off-target effects can be limited by using modifications in the sense chain or by using a 5’ end cap.

[0191] To load the siRNA double strand onto an AGO protein, it must first be initiated by identifying the 5' end of the antisense chain, which is a prerequisite for introducing the other portion of the double strand into the AGO protein and the nucleic acid binding channel. The identification of the MID domain of the AGO protein is located at the nucleotide at the 5' end; after identification, the siRNA double strand is introduced into the AGO protein and the nucleic acid binding channel to form pre-RISC. After introducing the siRNA double strand into the nucleic acid binding channel, pre-RISC releases the sense chain (passenger chain) to form RISC with the other antisense chain (guide chain).

[0192] In this application, the term “complementary” refers to two strands of nucleotide sequences having the ability to hybridize under certain conditions to form base pairing hydrogen bonds and to form a double-stranded or double helix structure. For example, an RNA inhibitor antisense chain hybridizes with an RNA inhibitor sense chain or complement system mRNA to form Watson-Crick base pairs or non-Watson-Crick base pairs, and includes natural or modified nucleotides or nucleotide simulants. In “complementary,” it is not necessary for all nucleotides to have nucleobase complementarity. On the contrary, some mispairing is acceptable.

[0193] In this application, regarding the term "miss pairing," if the complementary region and the target sequence are not completely complementary, the miss pairing may be in the core region or the terminal region. Typically, the most acceptable miss pairing is in the terminal region, for example, within 5, 4, 3, or 2 nucleotides of the 5' end and / or 3' end, and does not exceed 3 miss pairings.

[0194] Gu S, Jin L, Zhang F, Huang Y, Grimm D, Rossi JJ, Kay MA. Thermodynamic stability of small hairpin RNAs highly influences the loading process of different mammalian Argonautes. Proc Natl Acad Sci USA As revealed in the study in 2011, 108:9208-9213, all factors affecting double-chain thermodynamic stability, such as mispairing and non-Watson-Crick base pairing, are favorable for pre-RISC to expel sense chains and form RISC.

[0195] In this application, the term “ligand” refers to any compound or molecule that is typically bound to a bioactive substance (e.g., dsRNA) by covalent bonding or other chemical means. In some embodiments, the ligand may interact directly or indirectly with another type of compound, e.g., a receptor, the receptor interacting with the ligand may be present on the cell surface or, generally, intracellular and / or intercellular receptors, and the interaction between the ligand and the receptor may result in a biochemical reaction or merely a physical interaction or binding.

[0196] In this application, the term “pharmaceuticalally acceptable” typically refers to one or more non-toxic substances that do not inhibit the efficacy of the biological activity of an active ingredient. Such formulations may typically include salts, excipients, buffers, preservatives, biocompatible vectors, and any other therapeutic agents. Such pharmaceutically acceptable formulations may typically include biocompatible solid or liquid fillers, diluents, or microencapsulation materials suitable for human administration. For pharmaceutical applications, the salt may be a pharmaceutically acceptable salt, or a pharmaceutically acceptable salt may be readily prepared using a non-pharmaceutically acceptable salt, and these should not be excluded from the scope of this application. Such pharmacologically or pharmaceutically acceptable salts include, but are not limited to, salts prepared with the following acids, e.g., hydrochloric acid, hydrobromide, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, boric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can be prepared as alkali metal salts or alkaline earth metal salts, for example, sodium salts, potassium salts, or calcium salts.

[0197] In this application, the terms “lipid nanoparticle” or “LNP” typically refer to a vesicle comprising a lipid layer encapsulating a pharmacologically active molecule (e.g., dsRNA). The LNP is as described, for example, in Chinese Patent No. CN103189057B, the entire contents of which are incorporated into the present invention by reference.

[0198] Detailed description of the invention

[0199] In one aspect, the present invention provides an RNA inhibitor that inhibits a type of complement system gene expression or a pharmaceutically acceptable salt thereof.

[0200] siRNA design

[0201] Using proprietary design sequence selection software, one group of human complement system genes was selected: siRNA: CFB human: GenBank NM_001710.5; C3 human: GenBank NM_000064.4; C5 human: GenBank NM_001735.3.

[0202] The first-class sequence adopted by CFB is as shown in Table 1-1, and the first-class sequence adopted by C5 is as shown in Table 1-2.

[0203] The second-level sequences adopted by CFB are as shown in Table 2-1, the second-level sequences adopted by C5 are as shown in Table 2-2, and the second-level sequences adopted by C3 are as shown in Table 2-3.

[0204] siRNA synthesis: iRNA is synthesized and annealed using standard methods already known in the field.

[0205] In some embodiments, the antisense chain and the sense chain among them form a double-stranded structure (complementary region), wherein the complementary region comprises at least 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243]

[0244]

[0245]

[0246]

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276]

[0277]

[0278]

[0279]

[0280]

[0281]

[0282]

[0283]

[0284]

[0285]

[0286]

[0287]

[0288]

[0289]

[0290]

[0291]

[0292]

[0293]

[0294]

[0295] Here, n is a or u or g or c, g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide.

[0296] In some selection embodiments, the sense chain and antisense chain of the RNAi agent are selected from the sequences in Table 1 or from the sequences in Table 1 that differ from each sequence by one, two, or three nucleotides.

[0297] In some embodiments, base pairs of the sense chain in Table 1 and the corresponding antisense chain in Table 1 form a dsRNA that is complementary, and may be partially complementary or completely complementary. Partially complementary means that at least 85% of the bases may be paired.

[0298] In some embodiments, the combination method of the sense chain and the antisense chain is not limited to the double chain combination method of Table 1, and one strand of the sense chain in Table 1 can be paired complementarily with any one strand of the antisense chain.

[0299] The object of the present invention is to protect the core sequence of the sequence in Table 1, wherein the core sequence is a sequence of at least 15 consecutive nucleotides of any one paragraph of the above sequence, where at least 15 refers to 15, 16, 17, 18, 19, 20, 21, 22, 23, etc. In some embodiments, the sense chain is Formula (1): 5′-X core sequence Y-3′, at least 85% of the bases are complementary between the antisense chain and the sense chain, X and Y contain 0, 1, 2, 3, 4, 5, and 6 nucleotides, and 0, 1, 2, and 3 non-pairing bases may be allowed at the terminal positions in the double chain.

[0300] The antisense chain comprises a sequence of nucleotides with 0, 1, 2, or 3 nucleotides different from Formula (2), Formula (2): 5′-X' core sequence Y'-3′, at least 85% of the bases between the antisense chain and the sense chain are complementary, X', Y' comprises 0, 1, 2, 3, 4, 5, or 6 nucleotides, and 0, 1, 2, or 3 non-pairing bases may be allowed at the terminal positions in the double chain.

[0301] In one embodiment, the core sequence allows for 0, 1, 2, or 3 nucleotides to be different, and said difference may be base pairs generated by the Watson-Crick principle or mispairing.

[0302] In some embodiments, the RNA inhibitor is introduced into a cell line via a cell transfection method or a liposomal nucleic acid nanoparticle method familiar to those skilled in the art, and sequence selection is performed. The lipid compounds and liposomal nucleic acid nanoparticle manufacturing methods of patents US9233971B2, US9080186B2, CN102985548B and CN103189057B are incorporated herein by reference in their entirety.

[0303] In some embodiments, the amphipathic lipids among the lipid compounds are preferably macrocycle lipid compounds D1C1, T1C1, T1C6, T4C4, B2C1, B2C6, B2C7, and M10C1.

[0304] To those skilled in the art, it is evident that dsRNA with a double-strand structure of approximately 20 to 23 base pairs, for example 21 base pairs, can already induce RNA inhibition particularly effectively (Elbashir et al., EMBO 2001, 20: 6877-6888). However, other researchers have already found that shorter or longer RNA double-strand structures are also effective (Chu and Rana (2007) RNA 14: 1714-1719; Kim et al. (2005) Nat Biotech 23: 222-226). In reasonable terms, removing or increasing a few nucleotide double strands at one or both ends of the sequences in Tables 1 and 2 can produce an effect similar to that of the above dsRNA. Accordingly, all dsRNAs having at least 15, 16, 17, 18, 19, 20, 21, or more consecutive nucleotide sequences of a sequence derived from Tables 1 and 2, and differing from the dsRNA of the entire sequence in terms of ability to inhibit complement system gene expression, and whose inhibition rate does not exceed approximately 5, 10, 15, 20, 25, or 30%, are included within the scope of this application.

[0305] The dsRNA of the present application may further comprise one or more single-strand nucleotide protruding termins, for example, 1, 2, 3, or 4 nucleotides. The nucleotide protruding terminus may further comprise a nucleotide / nucleotide analog or a combination thereof, and may comprise a deoxynucleotide. The protruding terminus may be located on a sense chain, an antisense chain, or a combination thereof. Additionally, the nucleotides of the protruding terminus may be present at the 5' end, 3' end, or both ends of the antisense chain or sense chain of the dsRNA. The protruding terminus may be formed such that one strand is longer than the other, or may be formed by the crossing of two strands of equal length. The protruding terminus may be on the antisense chain and may be mispaired with, complementary to, or one other sequence of the complement system mRNA. For example, the protruding terminus may be at the 3' end of the sense chain, or optionally, located at the 3' end of the antisense chain.

[0306] The above dsRNA may have blunt ends, and blunt ends indicate that the dsRNA does not have unpaired nucleotides at said ends, that is, that there are no nucleotide protrusions. The blunt ends may be located at the 5' end of the antisense chain and the 3' end of the sense chain, and vice versa; or both ends may be blunt, and the dsRNA is double-stranded over its entire length, that is, there are no nucleotide protrusions at either end of the molecule.

[0307] In some embodiments, the sense chain or antisense chain of the dsRNA has a nucleotide protrusion at the 3' end, the protrusion contains 1, 2, 3 or 4 nucleotides, and the 5' end is a flat end.

[0308] In some embodiments, the protrusion is simultaneously present at the 3' end of the sense chain and the antisense chain, and the protrusion comprises 1, 2, 3, or 4 nucleotides, and the protrusion comprises, but is not limited to: TT, UU, AU, or UA.

[0309] In some embodiments, the dsRNA is a bilateral flattened end of 19, 21, or 23 nucleotides in length and is double-stranded dsRNA over its entire length, that is, there are no nucleotide protrusions at either end of the molecule.

[0310] In some embodiments, the dsRNA has a length of 21 nucleotides, and the sense chain and the antisense chain both have two nucleotide protrusions at the 3' end.

[0311] In order to enhance the stability of the RNA inhibitor according to the present application in the body, the sense chain and antisense chain of the RNA inhibitor may be modified without affecting its activity and even in a situation where the activity may be enhanced, wherein the nucleotides therein may have modified genes and the entire chain or a portion thereof may be modified. In some embodiments, one or more nucleotides on the sense chain and / or antisense chain are modified to form modified nucleotides.

[0312] In some embodiments, the sense chain and antisense chain of the RNA inhibitor (e.g., dsRNA) according to the present application are unmodified. In other embodiments, the sense chain and antisense chain of the RNA inhibitor according to the present application have their stability or other properties enhanced through methods known in the art and chemical modification or conjugation methods described in the present invention. In other embodiments of the present application, all nucleotides or generally all nucleotides of the RNA inhibitor according to the present application may be modified, that is, the chain of the RNA inhibitor contains no more than 5, 4, 3, 2, or 1 unmodified nucleotide.

[0313] For example, the sense chain and antisense chain of the RNA inhibitor according to the present application may be synthesized and / or modified by methods known in the art, and the entire contents thereof as described, for example, in “Current protocols in nucleic acid chemistry”, Beaucage, SL et al. (edit), John Wiley & Sons, Inc., New York, NY, USA are incorporated into the present application. In the RNA inhibitor provided in the present application, the sense chain and antisense chain of the RNA inhibitor do not need to be uniformly modified, and one or more modifications may be introduced into a single nucleotide.

[0314] In some embodiments, nucleotide modifications include 5' end modification nucleotides, 3' end modification nucleotides, base modifications, glycosylation modifications or glycosyl substitutions, and main chain modifications. 5' end modifications refer to phosphorylation, conjugation, and reverse linkage. 3' end modifications refer to conjugation, DNA nucleotides, reverse linkage, etc.; base modifications refer to the use of a stable base, removal of a stable base or base substitution paired with an extended gametophyte base, base removal (base-free nucleotide), or conjugated bases. Glycosyl modifications are typically located at the 2' or 4' position. Main chain modifications refer to modifications or substitutions of phosphodiester bonds.

[0315] Specific nucleotide modifications include, but are not limited to, the following: nucleotide modifications comprising a phosphorus group at the ' end, vinylphosphonate deoxyribonucleotide, vinylphosphonate group-containing nucleotide and cyclopropylphosphonate-containing nucleotide, 3'-terminal deoxythymidine (dT) nucleotide, 2'-O-methyl group modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy modified nucleotide, 2'-amino group modified nucleotide, 2'-O-allyl group modified nucleotide, 2'-C-alkyl group modified nucleotide, 2'-hydroxy group modified nucleotide, 2'-methoxyethyl group modified nucleotide, 2'-O-alkyl group modified nucleotide, 2-O-(N-methylacetamide) Modified nucleotide, 3'-O-methoxy group (link between 2' nucleotides) nucleotide, 2'-F-arabinose nucleotide, 5'-Me / 2'-fluorosubstituted nucleotide, locking nucleotide, unlocking nucleotide, unlocked nucleobase analog, stereostructure-restricted nucleotide, restriction ethyl group nucleotide, baseless nucleotide, morpholino nucleotide, phosphoramidate, nucleotide containing a non-natural base, tetrahydropyran modified nucleotide, 1,5-hexanol anhydrous modified nucleotide, cyclohexenyl modified nucleotide, methylphosphonate group-containing nucleotide, thermally unstable nucleotide, GNA, deoxyribonucleotide, nucleotide analog, morpholino nucleotide, debase Nucleotide, 3' to 3' linked (nucleotide inversion) nucleotide, bridged nucleotide, peptide nucleic acids (PNA).

[0316] The nucleotide modification containing a 5'-terminal phosphorus functional group may be a nucleotide of a 5'-phosphate ester or a deoxynucleotide containing a 5'-phosphate ester analog, such as a 5'-terminal phosphate ester (5'-P), a 5'-terminal phosphorothioate (5'-PS), a 5'-terminal phosphorodithioate (5'-PS2), a 5'-terminal vinylphosphonate (5'-VP), a 5'-terminal methylphosphonate (MePhos), or a 5'-deoxy-5'-C-malonyl (Malonyl-) 5'-terminal phosphorus-containing group. If the 5'-terminal phosphorus-containing group is a 5'-terminal vinylphosphonate (5'-VP), then 5'-VP is a 5'-E-VP isomer (i.e., trans). It includes, but is not limited to, vinylphosphonate), 5'-Z-VP isomers (i.e., cis-vinylphosphonate) or mixtures thereof.

[0317] Modifications between nucleotides include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl trisphosphates, alkylphosphates, phosphinates, phosphoramidates, thiocarbonyl phosphoramidates, thiocarbonylalkyl phosphonates, thiocarbonylalkyl phosphotriesters, borane phosphates, various salts, free acids, etc.

[0318] Terminal modifications of the sense chain or antisense chain can prevent the degradation of exonuclease and enhance the stability of the nuclease, for example, by a cap structure such as an inverted deoxy abasic cap (abbreviated as invAb). invAb is already known in the art, and detailed performance verification can be found in F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16.

[0319] In some embodiments, the 2' position of a nucleotide glycosyl group on at least two or more even positions of the antisense chain 5' end start position is fluorine.

[0320] In some embodiments, the 2' positions of nucleotide glycosyl groups on even positions of the antisense chain 5' end start position are all fluorine.

[0321] In some embodiments, the 2' positions of nucleotide glycosyl groups at the 2nd, 4th, 6th, 8th, 12th, and 14th positions of the antisense chain 5' end start position are fluorine. For example, at least the 2' positions of nucleotide glycosyl groups at the 2nd, 4th, 6th, 8th, 12th, and 14th positions of the antisense chain 5' end start position are all fluorine.

[0322] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 2nd, 6th, 8th, 10th, 14th, and 16th positions of the antisense chain 5' end start position is a methoxy group.

[0323] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 2nd, 4th, 6th, 8th, 14th, and 16th positions of the antisense chain 5' end start position is a methoxy group.

[0324] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 2nd, 4th, 6th, 8th, 14th, 16th, 18th, and 20th positions of the antisense chain 5' end start position is a methoxy group.

[0325] In some embodiments, at least two or more nucleotide glycosyl group 2' positions on the odd positions of the sense chain 5' end start position are fluorine.

[0326] In some embodiments, the 2' positions of the nucleotide glycosyl groups on the odd positions of the sense chain 5' end start position are all fluorine.

[0327] In some embodiments, at least one of the 2' positions of the nucleotide glycosyl groups on the 5th, 7th, 8th, and 9th positions of the sense chain 5' end start position is fluorine. For example, the 2' positions of the nucleotide glycosyl groups on the 5th, 7th, 8th, and 9th positions of the sense chain 5' end start position are all fluorine.

[0328] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 5th, 7th, 8th, and 9th positions of the antisense chain 5' end start position is a methoxy group.

[0329] In some embodiments, at least one of the 2' positions of the nucleotide glycosyl group on the 7th, 9th, 10th, and 11th positions of the sense chain 5' end start position is fluorine. For example, the 2' positions of the nucleotide glycosyl group on the 7th, 9th, 10th, and 11th positions of the sense chain 5' end start position are all fluorine.

[0330] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 7th, 9th, 10th, and 11th positions of the sense chain 5' end start position is a methoxy group.

[0331] In some embodiments, at least one of the 2' positions of nucleotide glycosyl groups on the 3rd, 5th, 7th, 9th, 10th, 11th, 13th, and 15th positions of the sense chain 5' end start position is fluorine. For example, the 2' positions of nucleotide glycosyl groups on the 3rd, 5th, 7th, 9th, 10th, 11th, 13th, and 15th positions of the sense chain 5' end start position are all fluorine.

[0332] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 3rd, 5th, 7th, 9th, 10th, 11th, 13th, and 15th positions of the sense chain 5' end start position is a methoxy group.

[0333] In some embodiments, at least one of the 2' positions of the glycosyl group of a nucleotide other than the nucleotide on the 7th, 8th, 9th, and 10th positions of the sense chain 5' end start position is a methoxy group.

[0334] For example, part or all of the -OH at the 2' position of a nucleotide glycosyl group of the sense chain and / or antisense chain may be substituted, wherein the substituent is fluorine or a methoxy group, and preferably, the 2' position of a nucleotide glycosyl group at the 9th, 10th, and 11th positions from the 5' end start position of the sense chain is fluorine and the 2' position of a nucleotide glycosyl group at the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions from the 5' end start position of the antisense chain is fluorine and all other 2' positions of nucleotide glycosyl groups are methoxy groups; Preferably, the 2' positions of nucleotides at the 5th, 7th, 8th, and 9th positions from the sense chain 5' end start position are fluorine, and the 2' positions of nucleotide glycosyl groups at the 2nd, 4th, 8th, 14th, and 16th positions from the antisense chain 5' end start position are fluorine, and all other nucleotide glycosyl group 2' positions are methoxy groups.

[0335] In some embodiments, there are at least two consecutive phosphorothioate bonds between nucleotides of the sense chain and / or antisense chain.

[0336] In some embodiments, there are at least two consecutive phosphorothioate bonds between at least three consecutive nucleotides of at least one of the sense chain ends and / or antisense chain ends.

[0337] For example, there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' and 3' ends of the sense chain and the antisense chain.

[0338] Also, for example, the 2' positions of the nucleotide glycosyl groups at the 9th, 10th, and 11th positions from the 5' end start position of the sense chain are fluorine, and the 2' positions of the nucleotide glycosyl groups at the 2nd, 4th, 6th, 12th, 14th, 16th, 18th, and 20th positions from the 5' end start position of the antisense chain are fluorine, and all other 2' positions of the nucleotide glycosyl groups are methoxy groups, and there are at least two consecutive phosphorothioate bonds between three consecutive nucleotides at the 5' end and 3' end of the sense chain and the antisense chain.

[0339] In some embodiments, partial nucleotide 2' positions of the sense chain are fluorine or methoxy groups, and phosphate ester bonds between at least three adjacent nucleotides at the end of the antisense chain may be substituted with sulfur. The 5th, 7th, 8th, and 9th positions or the 3rd, 5th, 7th, 8th, 9th, 11th, 13th and 15th nucleotide 2' positions from the 5' end start position of the sense chain are fluorine and other nucleotide 2' positions are methoxy groups, and phosphate ester bonds between at least three adjacent nucleotides at the end of the antisense chain may be substituted with sulfur.

[0340] In some embodiments, partial nucleotide 2' positions of the sense chain are fluorine or methoxy groups, and phosphate ester bonds between at least three adjacent nucleotides at the end of the antisense chain may be substituted with sulfur. Nucleotide 2' positions at the 9th, 10th, and 11th positions or at the 3rd, 5th, 7th, 8th, 9th, 11th, 13th, 15th and / or 17th positions from the 5' end start position of the sense chain are fluorine and other nucleotide 2' positions are methoxy groups, and phosphate ester bonds between at least three consecutive nucleotides at the end of the antisense chain may be substituted with sulfur.

[0341] In some embodiments, the RNA inhibitor of the CFB modified sequence according to the present invention is selected from Table 2-1 below, the RNA inhibitor of the C5 modified sequence is selected from Table 2-2 below, and the RNA inhibitor of the C3 modified sequence is selected from Table 2-3 below:

[0342]

[0343]

[0344]

[0345]

[0346]

[0347]

[0348]

[0349]

[0350]

[0351]

[0352]

[0353]

[0354]

[0355]

[0356]

[0357]

[0358]

[0359]

[0360]

[0361]

[0362]

[0363]

[0364]

[0365]

[0366]

[0367]

[0368] Here, G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Ts=2'-O-methyl-3'-thiothymidyl acid, Cs=2'-O-methyl-3'-thiocytidyl acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenilic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fT=2'-fluorothymidylic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenilic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=deoxythymidylic acid, dA=2'-deoxy-adenilic acid, invAb is an inverted deoxy abasic cap, and Tgn is ethylene glycol deoxythymidylic acid.

[0369] In some embodiments, the sense chain or antisense chain of the RNA inhibitor according to the present invention may be a sequence having at least 15 consecutive nucleotides identical to the sense chain or antisense chain of Tables 1 to 2, or a sequence having 1, 2, or 3 different nucleotides.

[0370] In some embodiments, a ligand of a target tissue receptor may be introduced into the vector to alter the distribution, targeting, or stability of the RNA inhibitor. For example, compared to a species in which the ligand is not present, a full-attribute ligand may provide enhanced affinity for a selected target (e.g., a molecule, cell or cell type, small thread (e.g., a cell or visceral thread, body tissue, visceral organ or region)).

[0371] The ligand may include naturally occurring substances such as proteins (e.g., human serum protein (HSA), low-density cholesterol (LDL), or globulin); carbohydrates (e.g., glucan, pullulan, chitin, chitosan, inulin, cyclodextrin, N-acetylglucosamine, N-acetylgalactosamine, or hyaluronic acid); or lipids. The ligand may be a recombinant or synthetic molecule, such as a synthetic polymer, e.g., a synthesized polyamino acid.

[0372] The ligand may include a target gene, for example, a cell or tissue targeting agent that binds to a specified cell type such as kidney cells, for example, a lectin, glycoprotein, lipid, or protein, for example, an antibody. Target genes include thyroid hormone, melanocyte-stimulating hormone, lectin, glycoprotein, surfactant protein A, mucin, carbohydrate, polyvalent lactose, polyvalent galactose, N-acetylgalactosamine, N-acetylglucosamine, polyvalent mannose, polyvalent fucose, glycosylated polyamino acid, polyvalent galactose, transferrin, bisphosphonates, polyglutamic acid, polyaspartic acid, lipids, cholesterol, steroid, cholic acid, folic acid, vitamin B12, vitamin A, biotin, and RGD. It may be a peptide or an RGD peptide simulant. In some embodiments, the corresponding ligand may be a multivalent galactose, for example, N-acetylgalactosamine.

[0373] The sense chain and antisense chain included in the RNA inhibitor according to the present invention can be prepared by a conventional method through known techniques of solid-phase synthesis. Alternatively, other methods used for this type of synthesis known in the art, such as liquid-phase synthesis or fermentation, may also be used.

[0374] In some embodiments, in addition to commercially available and commonly used standard nucleoside phosphoramidite monomers and non-standard nucleoside phosphoramidite, the sense chain and antisense chain included in the RNA inhibitor of the present application are synthesized using the phosphoramidite method derived from vector-nucleoside phosphoramidite monomers through an automatic synthesizer.

[0375] In some embodiments, the ligand according to the present invention is conjugated to the 5' end and / or 3' end of the antisense chain and / or the 5' end and / or 3' end of the sense chain through a vector structure.

[0376] For example, the vector structure may be conjugated to the 5' end and / or 3' end of the sense chain; or the vector structure may be conjugated to the 5' end of the antisense chain and the vector structure may be conjugated to the 3' end of the sense chain; or the vector structure may be conjugated to the 3' end of the antisense chain and the ligand may be conjugated to the 5' end of the sense chain.

[0377] In some embodiments, the vector structure comprises a 5' MVIP and a 3' MVIP, wherein the 5' MVIP is conjugated to the 5' end of the sense chain and / or antisense chain and the 3' MVIP is conjugated to the 3' end of the antisense chain and / or sense chain, the structure of the 5' MVIP is as shown in Formula I and the structure of the 3' MVIP is as shown in Formula II.

[0378] ,

[0379] I

[0380] ,

[0381] II

[0382] Here,

[0383] X is a liver target-specific ligand;

[0384] L is a branched chain;

[0385] B is a joint;

[0386] D is a link chain;

[0387] R1 and R2 are switching connection points;

[0388] The above 5' MVIP is connected to the 5' end of the sense chain or the 5' end of the antisense chain through a switching connection point R1, and the above 3' MVIP is connected to the 3' end of the sense chain or the 3' end of the antisense chain through a switching connection point R2, and n and m are each independently any integer from 0 to 4 and an integer n+m=2-6, preferably n+m=2, 3 or 4, and more preferably 4.

[0389] In some embodiments, the above R1 or R2 and The connection of the sense chain or antisense chain is realized through a phosphate ester or a modified phosphate ester, and R1 or R2 can preferably be connected to the sense chain or antisense chain through a phosphate ester or a phosphorothioate.

[0390] In some embodiments, m or n may be 0, that is, 3' MVIP or 5' MVIP does not exist.

[0391] In some embodiments, when n is 0 (i.e., no 5' MVIP exists), the structure of the 3' MVIP is as follows:

[0392]

[0393] .

[0394] In some embodiments, when n=1, the structure of the 3' MVIP is as follows:

[0395] .

[0396] In some embodiments, when n=2, the structure of the 3' MVIP is as follows:

[0397] .

[0398] In some embodiments, when n=3, the structure of the 3' MVIP is as follows:

[0399] .

[0400] In some embodiments, when n=4, the structure of the 3' MVIP is as follows:

[0401] .

[0402] In some embodiments, n refers to the sum of n placed simultaneously in the sense chain and antisense chain 5' end 5' MVIP of the RNA inhibitor, and m refers to the sum of m placed simultaneously in the sense chain and antisense chain 3' end 3' MVIP of the RNA inhibitor.

[0403] In some embodiments, the R1 and R2 structures have -NH-, -S- and / or -O-, and R1 and R2 are connected to the 5' end and 3' end of the sense chain and / or antisense chain, respectively, through the -NH-, -S- or -O- in the structure, and R1 and R2 may be the same or different.

[0404] In some embodiments, R1 and R2 are optionally selected from a series carbon chain, or a series carbon chain having a branched chain of an amide group, a carboxyl group, or an alkyl group, or a cyclic structure, wherein the cyclic structure comprises a saturated and / or unsaturated aliphatic carbon ring, or a pentatonic or hexacyclic heterocyclyl group or an aromatic aryl group comprising a sulfur, oxygen, or nitrogen atom.

[0405] In some embodiments, the R1 and / or R2 is -E1(CH2) x CH2E2-, where x is any integer from 3 to 12, and functional groups E1 and E2 can be -NH-, -S- or -O-, respectively.

[0406] In some embodiments, the R1 and / or R2 is -E1(CH2) x1 CH(OH)(CH2) x2 E2-, where x1 or x2 is each independently any integer from 3 to 10, and E1 and E2 can be -NH-, -S- or -O-, respectively.

[0407] In some embodiments, R1 is a heterocyclic or carbon ring structure containing N, S, or O, as shown below:

[0408] .

[0409] In some embodiments, the switching connection point R1 is -NH(CH2) x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6, and is introduced in the manner of the following two phosphoramidite monomers.

[0410] i. One -O- or -S- in the R1 structure is used for the synthesis of the R1 phosphoramidite monomer and is introduced to the 5' end of the RNA inhibitor sense chain or antisense chain by a solid-phase synthesis method. The -NH-, -S-, or -O- in the structure is used to link with link chain D in the 5' MVIP, and thus the 5' end of the sense chain or antisense chain in the RNA inhibitor is introduced into the liver target-specific ligand X. The monomer introduced to the 5' end of the RNA inhibitor sense chain or antisense chain may be, for example, the following structure:

[0411]

[0412] In some embodiments, the structure may preferably be as follows:

[0413]

[0414] ii. One -NH-, -S-, or -O- in the R1 structure is first connected to link chain D, and the other -NH-, -S-, or -O- forms an ester with phosphoramidite during the synthesis of the 5' MVIP phosphoramidite monomer, and examples of the sense chain or antisense chain 5' MVIP phosphoramidite monomer structure are as follows:

[0415] .

[0416] In some embodiments, the sense chain or antisense chain 5' MVIP phosphoramidite monomer may preferably have the following structure:

[0417] .

[0418] In the general formula, when n is 1 to 4, the joint B portion of the monomer is branched 1 to 4 times to obtain a corresponding monomer compound, and the target-specific ligand X borrowed from the monomer compound is introduced to the 5' end of the sense chain or antisense chain through solid-state synthesis.

[0419] In some embodiments, the switching connection point R1 is -NH(CH2) x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6.

[0420] In some embodiments, the 5' MVIP phosphoramidite monomer is selected from the following structures:

[0421]

[0422]

[0423]

[0424]

[0425] .

[0426] In some embodiments, the switching connection point R2 is a heterocyclic or carbon ring structure containing N, S, or O, as shown below:

[0427] .

[0428] In some embodiments, the switching connection point R2 is -NH(CH2) x1 CH(OH)(CH2) x2CH2O-, where x1 is any integer from 1 to 4, and preferably x2 is any integer from 0 to 4.

[0429] The conversion linkage R2 according to the present application forms an ester or amide with -NH-, -S-, or -O- in the R2 structure through succinic anhydride, and at the same time is conjugated with -NH- in the blank solid support to form a 3' MVIP solid support, and then introduces the 3' MVIP to the 3' end of the sense chain or antisense chain through a phosphoramidite solid-phase synthesis method.

[0430] In some embodiments, the heterocycle in the transition linkage point R2 structure is a pyrrole ring or a piperidine ring, and is connected to the linkage chain D of the 3' MVIP through the nitrogen heterocycle in the ring, and an exemplary structure for introducing a 3' MVIP solid support is as follows:

[0431]

[0432] In the general formula, when m is 1-4, the joint B portion of the monomer is branched 1 to 4 times to obtain a corresponding Solid Support.

[0433] In some embodiments, the switching connection point R2 is -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, where x1 is any integer from 1 to 4, x2 is any integer from 0 to 4, B4 and B5 are -NH-, -S-, or -O-, respectively, and an exemplary structure for introducing a 3' MVIP solid spport is as follows:

[0434]

[0435] In the general formula, when m is 1-4, the joint B portion of the monomer is branched 1 to 4 times to obtain a corresponding Solid Support.

[0436] In some embodiments, R2 is -NHCH2CH(OH)CH2O-, and an exemplary structure for introducing a 3' MVIP solid spport is as follows:

[0437]

[0438] In the general formula, when m is 1-4, the joint B portion of the monomer is branched 1 to 4 times to obtain a corresponding Solid Support.

[0439] In some embodiments, the 3' MVIP solid support structure is as follows:

[0440]

[0441]

[0442]

[0443]

[0444] In some embodiments, the liver target-specific ligand X is selected from structures that enhance the uptake of RNA inhibitors by hepatocytes, and is selected from lipid, steroid, vitamin, sugar, protein, peptide, polyamine, and peptide simulant structures. Among the RNA inhibitors provided in this application, the liver target-specific ligand X introduced at the end of the RNA inhibitor sense chain or antisense chain may be the same or different; for example, in terms of specificity, some may enhance liver targeting, some may be structures that modulate the pharmacokinetics of the RNA inhibitor in vivo, and some may have structures that provide soluble activity in vivo. In some embodiments, the liver target-specific ligand X may be one of the following structures or various monosaccharides and other derivatives.

[0445] In some embodiments, the monosaccharide is one or more selected from the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, ribose. The monosaccharide derivative is selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives.

[0446] In some embodiments, the liver target-specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and its structure is as follows:

[0447]

[0448] Here, W1 is a hydrogen or hydroxyl protecting group and may be the same or different; W is -OH, -NHCOOH, or -NHCO(CH2) q CH3, where, q is an integer from 0 to 4; W2 is -NH-, O, S or C.

[0449] In some embodiments, the liver target-specific ligand X is N-acetylgalactosamine and derivatives thereof.

[0450] In some embodiments, the liver target-specific ligand X is selected from the following structures:

[0451] ;

[0452] Here, W is -OH, -NHCOOH and -NHCO(CH2) q One or two types selected from CH3, where q is an integer from 0 to 4.

[0453] In some embodiments, the liver target-specific ligand X may be the same or different among the same 5' MVIP or 3' MVIP structures.

[0454] In some embodiments, X between the 5' MVIP and the 3' MVIP may be the same or different.

[0455] In some embodiments, the branched chain L is -NH-, -C(=O)-, -O-, -S-, amide group, phosphoryl-, thiophosphoryl, C4-C 10 C4-C of an aliphatic carbon cyclyl group, a phenyl group, or a combination of these functional groups 18 It contains carbon chains.

[0456] In some embodiments, the branched chain L may also have a hydroxyethyl group or a carboxylic acid type side chain.

[0457] In some embodiments, the branched chain comprises a C7-C amide group or a hexavalent aliphatic carboncyclile group. 18 It is a carbon chain.

[0458] In some embodiments, the branched chain L is one or more selected from the following structures:

[0459]

[0460] Here, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, Z is H, an alkyl group or an amide group, and the alkyl group is, for example, a C1-C5 alkyl group.

[0461] In some embodiments, the structure of the joint B is related to the number of X that can be drawn, wherein the joint B includes -NH-, C, O, S, amide group, phosphoryl group, and thiophosphoryl group, and when n or m is 1, the joint B is a single straight chain, and when n or m is 2, 3 or 4, the number of branches is 2, 3 or 4, respectively.

[0462] In some embodiments, the joint B has the following structure:

[0463]

[0464] Here, A1 and A2 are each independently C, O, S, -NH-, carbonyl group, amide group, phosphoryl group, or thiophosphoryl group, and r is an integer from 0 to 4.

[0465] In some embodiments, the joint B is selected from the following structures:

[0466]

[0467]

[0468]

[0469] Here, r is any integer from 0 to 4.

[0470] In some embodiments, the joint B is selected from the following structures:

[0471]

[0472]

[0473]

[0474] .

[0475] In some embodiments, the joint B is selected from the following structures:

[0476] .

[0477] In some embodiments, the linking chain D is -NH-, C=O, O, S, amide group, phosphoryl-, thiophosphoryl, aryl group, C4-C 10 Aliphatic carbon cyclil groups, pent- or hexacyclic groups containing 1 to 3 nitrogens, or a combination of these groups of C3-C 18 It contains carbon chains.

[0478] In some embodiments, the link chain D has side chains of hydroxymethyl groups, methyltert-butyl groups, methylphenol groups, and C5-C6 aliphatic cyclyl groups.

[0479] In some embodiments, the linking chain D comprises two C=O, hexavalent aliphatic carboncyclile groups or phenolic groups, forming a C3-C 10 It is a carbon chain.

[0480] In some embodiments, the link chain D comprises a C3-C containing two C=Os. 10 It is a carbon chain.

[0481] In some embodiments, the link chain D is selected from the following structures:

[0482]

[0483]

[0484]

[0485]

[0486]

[0487]

[0488] Here, each p is independently any integer from 1 to 20; s is any integer from 2 to 13; Z1 and Z2 are the same or different substituents, e.g., C3-C 10 It is an alkyl group.

[0489] In some embodiments, the link chain D is selected from the following structures:

[0490]

[0491]

[0492] .

[0493] In some embodiments, the link chain D is selected from the following structures:

[0494] .

[0495] In some embodiments, among the 5' MVIP structure and among the 3' MVIP structures is one or more selected from the following structures:

[0496]

[0497]

[0498]

[0499]

[0500]

[0501]

[0502]

[0503]

[0504]

[0505]

[0506]

[0507]

[0508] In some embodiments, X, L, B, and D may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP.

[0509] In some embodiments, of the 5' MVIP structure is selected from the structures shown in Table 3 below:

[0510]

[0511]

[0512]

[0513]

[0514] In some embodiments, the 5' MVIP may not exist, in which case m can be any integer from 2 to 4.

[0515] In some embodiments, of the 3' MVIP structure is selected from the structures shown in Table 4 below:

[0516]

[0517]

[0518]

[0519]

[0520] In some embodiments, of the vector structure 5' MVIP The combinations of and R1 are as shown in Table 5 below:

[0521]

[0522]

[0523] In some embodiments, the 3' MVIP may not exist, in which case n can be any integer from 2 to 4.

[0524] In some embodiments, of the vector structure 3' MVIP The combinations of and R2 are as shown in Table 6 below:

[0525]

[0526]

[0527] In some embodiments, the 5' MVIP is any one or several selected from 5' MVIP01 to 5' MVIP 22 in Table 5.

[0528] In some embodiments, the 3' MVIP is any one or several selected from 3' MVIP 01 to 3' MVIP 27 in Table 6.

[0529] In some embodiments, the 5' MVIP in Table 5 can be combined with any one of the 3' MVIPs in Table 6, where n+m=2, 3, 4, 5 or 6.

[0530] In some embodiments, the sense chain and antisense chain conjugated with the vector among the CFB RNA inhibitors may be selected from Table 7-1 below, the sense chain and antisense chain conjugated with the vector among the C5 RNA inhibitors may be selected from Table 7-2 below, and the sense chain and antisense chain conjugated with the vector among the C3 RNA inhibitors may be selected from Table 7-3 below.

[0531]

[0532]

[0533]

[0534]

[0535]

[0536]

[0537]

[0538]

[0539]

[0540]

[0541]

[0542]

[0543]

[0544]

[0545]

[0546]

[0547]

[0548]

[0549]

[0550]

[0551]

[0552]

[0553]

[0554]

[0555]

[0556]

[0557]

[0558]

[0559]

[0560]

[0561]

[0562]

[0563]

[0564]

[0565]

[0566] In some embodiments, the sense chain or antisense chain of the RNA inhibitor according to the present invention may be a sequence having at least 15 consecutive nucleotides identical to the sense chain or antisense chain of Table 7, or a sequence differing from the sense chain or antisense chain of Table 7 by 1, 2, or 3 nucleotides.

[0567] It should be emphasized that the combination method of the sense chain and antisense chain is not limited only to the double-chain combination method of Table 7, and one strand of the sense chain in Table 7 can be paired complementarily with any single strand of the antisense chain; GsUsCUAGfUCfAfAfCUUAAUUGAsGsA (SEQ ID NO: 554) in Table 7-1 is UsfCsUfCAfAUfUAAGUUfGAfCUAGACsAsC (SEQ ID NO: 583), UsfCsUfCAfAUfUAAGUUfGAfCUAGsAsC (SEQ ID NO: 584), UsdCsUCdAATUAGTUfGACUAGACsAsC (SEQ ID NO: 588), UsfCsUCAfAUfUfAAGUUfGAfCUAGACsAsC (SEQ ID NO: 591), UsfCsUfCAfAUfUAAGUUfGAfCUAGACsAsCTT (SEQ ID NO: 593), Can be complementary paired with UsfCsUCAfAUfUfAAGUUfGAfCUAGACsAsC (SEQ ID NO: 594) In this invention, any single strand of sense chain or antisense chain is an independent entity and the combination method is not limited, and if at least 85% of the nucleotides are paired complementarily with each other, they can all form a double-strand inhibitor.

[0568] In some embodiments, any one strand of sense chain or antisense chain according to the present invention may be connected to a vector of a different structure, and in one embodiment, the 5' end and / or 3' end of any one strand of sense chain or antisense chain according to the present invention may be connected to a 5' MVIP and / or 3' MVIP of a different structure, and the combination of conjugations is not limited.

[0569] In some embodiments, the double-stranded RNA inhibitor according to the present invention may optionally be conjugated with one or more ligands, and any ligand capable of enhancing the activity, cell distribution, or cell uptake (e.g., entry into a cell) of the double-stranded RNA inhibitor may be applied to the double-stranded RNA inhibitor of the present invention. The ligand may be connected to a sense chain, an antisense chain, or a bistrand at the 3' end, the 5' end, or both ends. The vector may include, but is not limited to, GalNac vectors of any structure, cationic lipid vector preparations, viral vectors, hydrophilic portions, amphiphilic portions, target genes, small molecules, proteins, peptides, and antibodies.

[0570] In some embodiments, the antisense chain of the RNA inhibitor according to the present invention can be obtained by conjugating the antisense chain of Table 1-2 with a 5' MVIP and / or a 3' MVIP.

[0571] In some embodiments, the antisense chain of the RNA inhibitor according to the present invention may be obtained by conjugating a sequence having at least 15 consecutive nucleotides identical to the antisense chain of Table 1-2, or a sequence differing from the antisense chain of Table 1-2 by 1, 2, or 3 nucleotides with a 5' MVIP and / or a 3' MVIP.

[0572] In some embodiments, the double-stranded RNA inhibitor according to the present invention may optionally be conjugated with one or more ligands, and any ligand capable of enhancing the activity, cell distribution, or cell uptake (e.g., entry into a cell) of the double-stranded RNA inhibitor may be applied to the double-stranded RNA inhibitor of the present invention. The ligand may be connected to a sense chain, an antisense chain, or both strands thereof at the 3' end, the 5' end, or both ends. The vector is not limited to the MVIP exemplified in the present invention and may include, but is not limited to, GalNac vectors of any structure, cationic lipid vector preparations, viral vectors, hydrophilic portions, amphiphilic portions, target genes, small molecules, proteins, peptides, and antibodies.

[0573] The effect of differences in X, L, B, D, R1, and R2 of the 5' MVIP and / or 3' MVIP structures in Patent CN113171371B on RNA inhibitor activity was studied, and the entire contents of said patent are incorporated into the present invention.

[0574] When X is galactose, galactosamine, N-acetylgalactosamine, and derivatives thereof, among the RNA inhibitors provided in the present invention, preferably N-acetylgalactosamine and derivatives thereof are used as liver target-specific ligands, for example, as shown in Table 8:

[0575]

[0576] The length of L has a significant effect on the action of RNA inhibitors, and the L chain should not be excessively short or excessively long; when it contains -NH-, C=O, O, S, amide groups, phosphoryl groups, thiophosphoryl groups, aliphatic carbon cyclyl groups (e.g., cyclohexane) or combinations of such functional groups, or when the L structure is different between the same 5' MVIP and 3' MVIP structures or between 5' MVIP and 3' MVIP, the length of the carbon chain is in the C7-C18 range, and the difference in activity of the obtained RNA inhibitor is not significant, as shown in Table 9.

[0577]

[0578]

[0579] In addition to the structural modification of Joint B, the 5' MVIP09 / 3' MVIP09 combination with X, L, D, and R1 / R2 When it is consistent with the general formula of joint B, A1 and A2 are each independently C, O, S, -NH-, carbonyl group, amide group, phosphoryl group, or thiophosphoryl group, and r is any integer from 0 to 4, and when joint B is the same or different between 5' MVIP and 3' MVIP, the obtained RNA inhibitory activity does not differ significantly.

[0580]

[0581]

[0582]

[0583]

[0584]

[0585]

[0586]

[0587]

[0588] When the MVIP structure and RNA inhibitor are the same, different linkage chain D affects the activity of the RNA inhibitor, where the effects of D1, D2, and D4 are similar and superior to D3, and the D structures are as shown in Table 11.

[0589]

[0590]

[0591] Different switching linkage points R1 affect RNA inhibitor activity, where the RNA inhibitor activity obtained with R1-1 as the switching linkage point is the best, and the structure of R1 is shown in Table 12.

[0592]

[0593] Different switching linkage sites R2 affect RNA inhibitor activity, where R2-1 is the switching linkage site, and RNA inhibitor activity is best, and the R2 structure is as shown in Table 13.

[0594]

[0595]

[0596] In some embodiments, n+m among the RNA inhibitors according to the present invention are 2, 3, 4, 5, and 6, respectively. The sites where the 5' MVIP and / or 3' MVIP are conjugated include the 5' end and / or 3' end of the antisense chain, the 5' end and / or 3' end of the sense chain, the 5' end and 3' end of the antisense chain and the 3' end of the sense chain, and the 5' end and 3' end of the sense chain.

[0597] In some embodiments, n+m among the RNA inhibitors according to the present invention are 2, 3, 4, 5, and 6, respectively. The positions where the 5' MVIP and / or 3' MVIP are conjugated include the 5' end and / or 3' end of the antisense chain in Tables 1-2, the 5' end and / or 3' end of the sense chain in Tables 1-2, the 5' end and 3' end of the antisense chain in Tables 1-2, and the 5' end and 3' end of the sense chain in Tables 1-2, and the 5' end and 3' end of the sense chain in Tables 1-2, and the obtained 5' MVIP and 3' MVIP combinations are as shown in Table 14:

[0598]

[0599]

[0600]

[0601] In some embodiments, n and m are each independently any integer from 0 to 4, preferably each independently an integer from 1 to 3, and also an integer from n+m=2 to 6, preferably n+m=2, 3 or 4, and more preferably 4.

[0602] In some embodiments, the RNA inhibitor according to the present application or the pharmaceutically acceptable salt thereof is preferably prepared or synthesized in the form of a sodium salt and a triethylamine salt or other pharmaceutically acceptable salt.

[0603] In some embodiments, the RNA inhibitor or the pharmaceutically acceptable salt thereof according to the present application is more preferably a sodium salt and a triethylamine salt.

[0604] In another aspect, the present application further provides a pharmaceutical composition comprising a type of RNA inhibitor or a pharmaceutically acceptable salt thereof.

[0605] In some embodiments, the present application provides a pharmaceutical composition comprising a type of RNA inhibitor or a pharmaceutically acceptable salt thereof and any pharmaceutically acceptable additive. The present application provides for the use of the RNA inhibitor or its pharmaceutically acceptable salt in the manufacture of drugs for the treatment and / or prevention of diseases associated with elevated levels of the complement system, said diseases including lipid metabolism disorders.

[0606] In some embodiments, the complement system limits the release of fatty acids by inhibiting the activity of LPL (hepatic lipase) in the liver and adipose tissue, and further regulates triglyceride levels in the plasma. This affects insulin resistance, lipid metabolism, and overall energy balance. Factors capable of inhibiting complement system mRNA expression in vivo and / or in vitro include 5 to 10, such as PPARδ, statins, insulin, leptin, thyroid hormone, and lipopolysaccharide, and the inhibitor of the present invention has the potential to further enhance therapeutic effects on lipid metabolism, glucose metabolism, cardiovascular disease, etc., when used in combination with these drugs.

[0607] In one embodiment, a composition administered systemically by an extraintestinal delivery method may be prepared, for example, by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. The pharmaceutical composition provided in this application is administered in an amount sufficient to suppress complement system gene expression.

[0608] A pharmaceutically acceptable “additive” or “excipient” is a pharmaceutically acceptable solvent, suspension, or any other pharmaceutically inert medium for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and may be considered for selection in a planned administration method to provide the necessary volume, viscosity, etc. when combined with the nucleic acid and other compositional components of the specified pharmaceutical composition. The RNA inhibitor according to the present invention may be delivered in a manner that targets specific tissues (e.g., liver cells).

[0609] In some embodiments, the pharmaceutical composition according to the present application may further comprise a delivery medium (e.g., nanoparticles, dendrimers, polymers, liposomes, or cation delivery systems).

[0610] In some embodiments, the delivery medium according to the present application comprises liposomes.

[0611] In some embodiments, the delivery medium according to the present application comprises nano lipids, which can form lipid molecules and liposomal nucleic acid nanoparticles.

[0612] In some embodiments, the delivery medium according to the present application comprises the amphiphilic lipid compound M10C1.

[0613] The pharmaceutical compositions provided in this application include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be produced from various compositional components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. The formulations include those targeting the liver. The drug formulations of this application, which exist conveniently as a single formulation, may be manufactured by techniques common in the pharmaceutical industry. Such techniques include the step of combining an active ingredient with a pharmaceutically acceptable additive or excipient.

[0614] use

[0615] In another aspect, the present application provides a method for reducing complement system mRNA or protein expression in a cell or tissue, the method comprising contacting the cell or tissue with an effective amount of an RNA inhibitor that inhibits the aforementioned complement system gene expression or a pharmaceutically acceptable salt thereof and / or the aforementioned pharmaceutical composition.

[0616] Cells suitable for treatment by the method according to the present application are cells expressing any complement system gene, e.g., liver cells, brain cells, gallbladder cells, heart cells, or kidney cells, preferably liver cells. Cells suitable for the method according to the present application are mammalian cells, and upon contact with cells expressing a complement system gene, an RNA inhibitor inhibits the expression of the complement system gene (e.g., human, primate, non-primate, or rat complement system gene) by at least 50%, which can be measured, e.g., through a method based on PCR or branched DNA (bDNA), or through a protein-based method, e.g., immunofluorescence analysis, Western blotting, or flow cytometry.

[0617] In some embodiments, the tissue is liver tissue.

[0618] In some embodiments, the cells and tissues are separated out of the body.

[0619] In some embodiments, the cells and tissues are located in the body of the test subject.

[0620] The term "inhibition" as used in the present invention may be used interchangeably with "decrease," "decrease," "silence," "down-adjustment," "suppression," and other similar terms, and includes any level of inhibition. The expression of complement system genes may be evaluated based on the level or change in level of any variable associated with complement system gene expression, for example, based on complement system mRNA. This level may be analyzed from a single cell or from a group of cells (e.g., including samples derived from subjects). The control level may be any type of control level used in the art, for example, a reference level prior to drug administration or a level measured from a similar subject, cell, or sample receiving untreated or control treatment (e.g., a control using only a buffer or an inactive agent control).

[0621] The inhibition of complement system gene expression may be expressed as the amount of mRNA expressed by a first cell or group of cells (such as cells may be present in samples derived from the subject) that inhibits complement system gene expression by transcribing the complement system gene and already treating (e.g., by contacting one or more cells with an RNA inhibitor according to the present application or by administering an RNA inhibitor according to the present application to a subject in which the cell is present) is the same as that of the first cell or group of cells but is lowered compared to a second cell or group of cells that is not treated as described above (a control cell that is not treated with an RNA inhibitor or is not treated with an RNA inhibitor targeting the target gene).

[0622] In a preferred embodiment, an evaluation is performed on a cell line of a high-expression complement system using a suitable siRNA concentration, and the mRNA level in the interfered cells is expressed as a percentage of the mRNA level in the uninterfered control cells.

[0623] In other embodiments, inhibition of complement system gene expression can be evaluated through a decrease in parameters functionally related to complement system gene expression, for example, through the level of the complement system in the subject blood or serum. Inhibition of complement system genes can be measured in any complement-expressing cells (endogenous or exogenous of the expression construct) using any analytical method known in the art.

[0624] Inhibition of complement system expression can be expressed as a decrease in the level of the complement system expressed by cells, cell populations, or test sample (e.g., protein levels in blood samples derived from the test subject).

[0625] Control cells, cell groups, or experimental samples that may be used to evaluate complement system gene suppression may be cells, cell groups, or experimental samples that have not come into contact with the RNA inhibitor according to the present application. For example, control cells, cell groups, or experimental samples may be derived from a single subject (e.g., human or animal subject) or an appropriately matched colony control prior to treatment with the RNA inhibitor.

[0626] The level of complement system mRNA expressed by a cell or cell population can be measured by any method known in the art for mRNA expression. For example, a decrease in gene expression can be evaluated by qRT-PCR. A decrease in protein production can be evaluated by any method known in the art, for example, ELISA. In some embodiments, a liver biopsy sample is used as a sample for monitoring the decrease in complement system gene expression. In other embodiments, a blood sample is used as a sample for monitoring the decrease in complement system expression.

[0627] In another aspect, the present application provides for use in the manufacture of a drug a RNA inhibitor that inhibits the aforementioned complement system gene expression or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition said thereof, said drug being used to prevent and / or treat a disease or condition or to reduce the risk of a disease or condition.

[0628] In another aspect, the present application provides a method for preventing and / or treating a disease or pathology, the method comprising administering an effective amount of the aforementioned RNA inhibitor that inhibits complement system gene expression or a pharmaceutically acceptable salt thereof and / or the aforementioned pharmaceutical composition to a necessary subject.

[0629] A method in vivo according to the present application comprises administering a pharmaceutical composition comprising an RNA inhibitor to a subject, wherein the RNA inhibitor comprises a nucleotide sequence that is at least partially complementary to the complement system mRNA of the mammal receiving the RNA inhibitor. The pharmaceutical composition according to the present invention may be administered in any manner known in the art, including but not limited to oral, intraperitoneal or extraintestinal routes, intracerebral (e.g., intraventricular, intracerebral parenchyma and spinal canal), intravenous, intramuscular, subcutaneous, sclera, airway (aerosol), nasal, rectal, and local (intrabulcular and sublingual) administration. In some embodiments, the pharmaceutical composition may be administered via intravenous infusion or injection. In some embodiments, the pharmaceutical composition may be administered via subcutaneous injection. In some embodiments, the composition may be administered via intramuscular injection.

[0630] The RNA inhibitor provided in this application may be administered as a "free RNA inhibitor." The free RNA inhibitor is administered in a situation where no pharmaceutical composition is present. The naked RNA inhibitor may be in a suitable buffer. The buffer may contain acetate, citrate, prolamin, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer is phosphate buffer (PBS). The pH and osmotic pressure of the buffer containing the RNA inhibitor may be adjusted to be suitable for administration to a subject.

[0631] Alternatively, the RNA inhibitor provided in this application may be administered as a pharmaceutical composition, for example, as a liposomal preparation.

[0632] The pharmaceutical composition provided in this application is administered in an amount sufficient to suppress complement system gene expression. Typically, a suitable dosage of the RNA inhibitor according to this application is in the range of approximately 0.001 to 200.0 mg per 1 kg of subject body weight daily, and typically in the range of approximately 1 to 50 mg per 1 kg of subject body weight daily. Typically, a suitable dosage of the RNA inhibitor according to this application is in the range of approximately 0.1 mg / kg to approximately 5.0 mg / kg, for example, in the range of approximately 0.3 mg / kg to approximately 3.0 mg / kg.

[0633] In some embodiments, the method further includes measuring the level of the complement system in a sample derived from the subject of the experiment.

[0634] For example, the method further includes measuring the complement system level in the blood sample, serum sample, or urine sample derived from the above-mentioned test subject.

[0635] In another aspect, the present application provides a cell comprising an RNA inhibitor that inhibits the expression of the aforementioned complement system genes or a pharmaceutically acceptable salt thereof.

[0636] In another aspect, the present application provides a drug kit comprising an RNA inhibitor that inhibits the aforementioned complement system gene expression, a pharmaceutically acceptable salt thereof, or the aforementioned pharmaceutical composition.

[0637] In order not to be limited to any theory, the embodiments described below are merely for the purpose of illustrating the RNA inhibitor, manufacturing method, and use provided in this application, and the scope of the invention of this application is not limited thereto.

[0638] Examples

[0639] explanation:

[0640] DMSO: Dimethyl sulfoxide;

[0641] DMF: Dimethylformamide;

[0642] HOBt: 1-hydroxybenzotriazole;

[0643] HBTU: O-(1H-Benzotriazole-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate;

[0644] DIPEA(DIEA): N,N-diisopropylethylamine;

[0645] DCM: Dichloromethane;

[0646] DMAP: 4'-Dimethylaminopyridine;

[0647] DMT-CL: 4,4'-Dimethoxytriphenylmethyl chloride;

[0648] MEOH: methanol;

[0649] TBTU: O-(1H-Benzotriazole-1-yl)-N,N,N',N'-tetramethyluronium tetrafluoroborate;

[0650] The name is a solid-phase vector, for example, a macroporous aminomethyl resin.

[0651] Example 1: Synthesis of RNA Inhibitors

[0652] The sense chain and antisense chain of the beconjugated vector structure are synthesized using the standard solid-phase phosphoramidite method and a multi-channel solid-phase peptide synthesizer, and the corresponding RNA inhibitor is prepared by complementarily annealing the antisense chain corresponding to the sense chain.

[0653] The solid-phase phosphoramidate method generally comprises the following steps:

[0654] 1) Deprotection: Remove the Solid Support Hydroxyl Protecting Group (DMTr) in the initiation monomer;

[0655] 2) Conjugation: A first phosphoramidite monomer is added, and the conjugation reaction is carried out in the 3' to 5' direction;

[0656] 3) Oxidation: Oxidizes the acquired nucleotide phosphoramidate into the more stable nucleotide phosphite (i.e., oxidizes trivalent phosphorus to pentavalent phosphorus).

[0657] 4) Blocking: The failed nucleotide sequence 5'-OH of the previous step is capped and blocked so that it does not participate further in the reaction; the above step is repeated to graft the last single phosphoramidite monomer; then, the ester bond between the Solid Support and the initiator monomer is broken using an aqueous methylamine solution and water ammonia, and the protecting group on each base and phosphate of the obtained nucleotide sequence is removed; after HPLC separation and purification, the sample is filtered, sterilized, and freeze-dried to obtain the corresponding sense chain or antisense chain.

[0658] The synthesis method for RNA inhibitors is as follows:

[0659] The freeze-dried powders of the sense chain and antisense chain are redissolved separately and mixed in equal molar proportions. An appropriate amount of water for injection is added, followed by an appropriate amount of TRIS buffer solution. The solution is mixed uniformly by gently shaking for approximately 1 to 2 minutes. The temperature of the water bath is raised to 92 to 95°C. The reaction mixture is heated in the water bath for 3 to 5 minutes and gently shaken to ensure uniform heating. The mixture is cooled by leaving it at room temperature. A colorless, pale yellow transparent liquid is obtained, and a sample is taken to measure its concentration.

[0660] Example 2-1 In vitro inhibition experiment of complement system gene expression by CFB and C5 RNA inhibitors

[0661] The RNA inhibitor of this example is selected from Table 1-1 and Table 1-2 and is obtained by preparing it according to the method of Example 1.

[0662] Hep3B and huh7 cells were cleaved with trypsin, adjusted to an appropriate density, and seeded into a 96-well plate; the concentration of viable cells was 0.2 × 10⁶. 6 It is per mL. Simultaneously with inoculation, test siRNA or control siRNA is transfected into cells using Lipofectamine RNAiMax (Invitrogen-13778150). The test is performed in three batches using siRNA at the following concentrations: 0.1 nM, 0.02 nM, 0.015 nM, 0.001 nM, 10 nM, 1 nM, and 0.01 nM. At the same time, a non-siRNA control group containing only RNAiMax and a positive control group are established.

[0663] 24 hours after transfection, the cells obtained by removing the medium are used for RNA extraction. Total RNA is extracted using a 96-channel fully automatic nucleic acid extraction and purification instrument or a romega total RNA extraction kit.

[0664] According to the manual, perform cDNA synthesis using the TransScript® II All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit. Measure the target cDNA via qPCR and perform parallel testing using GAPDH cDNA as an internal control. Perform the following steps using a fluorescence quantitative PCR machine (Thermo QuantStudio 1): run at 95°C for 30 seconds, run at 95°C for 10 seconds, and run at 60°C for 30 seconds for 40 cycles.

[0665] Data Analysis:

[0666] Based on the Ct value of each sample, the target gene mRNA expression level in the sample is calculated using the ΔΔCt relative quantification method, where the relative expression amount of the target gene is 2 -ΔΔCt It is displayed as.

[0667] The equation is as follows:

[0668] ΔCT = Target gene average Ct - GAPDH average Ct

[0669] ΔΔCT=ΔCT(sample)-ΔCT(random control or Lipofectamine RNAiMax control);

[0670] Relative quantification of target gene mRNA = 2 (-ΔΔCT)

[0671] Inhibition% = (Relative quantification of control group - Relative quantification of sample) / Relative quantification of control group × 100%.

[0672] Refer to Tables 15-1 to 15-4 for the results of transfection experiments with CFB RNA inhibitors in Hep3B cells.

[0673] Refer to Tables 15-5 to 15-11 for the results of transfection experiments with C5 RNA inhibitors in Hep3B cells.

[0674]

[0675]

[0676]

[0677]

[0678]

[0679]

[0680]

[0681]

[0682]

[0683]

[0684]

[0685]

[0686]

[0687]

[0688]

[0689]

[0690]

[0691]

[0692]

[0693]

[0694]

[0695]

[0696]

[0697] Example 2-2 In vitro inhibition experiment of C3 gene expression by RNA inhibitor

[0698] The RNA inhibitors of this example are as shown in Table 1-3. Plasmid DNA (C3_PSICHECK(TM)-2 plasmid) is transfected into Hep3B and Huh7 cells using Fugene HD. After transfection, the cells are seeded into a 96-well plate at a cell density of 10,000 cells per well, and 100 μL of culture medium is added to each well. The cells are placed in a 5% CO2, 37°C incubator and cultured overnight. Next, the RNA inhibitor is prepared as a nano-encapsulated RNA inhibitor sample solution of the corresponding concentration using PBS. RNAiMAX / Opti-MEM is added to each corresponding well, and the RNA inhibitor sample solution diluted to the corresponding concentration is taken, added to the well, and uniformly mixed for incubation. After incubation, the mixture is uniformly mixed with DMEM containing 10% FBS. After removing the medium from each well, a new medium containing the sample is added, and after the addition is complete, the well is incubated in a 5% CO2, 37℃ incubator, and the measured sample concentration is 0.01 nM.

[0699] Remove the cells from the incubator, remove the supernatant, add fresh medium and measurement reagents, and shake in a dark room until the cells are sufficiently lysed. Then, transfer the sample to a light-blocking white plate and measure the luminescence signal of Firefly; add Dual-Glo®Stop & Glo® detection reagents to each well and shake in a dark room to measure the renilla luciferase signal. Calculate the ratio of the main report gene signal to the reference gene signal for each well. Refer to Table 15-9 below for the obtained experimental results.

[0700]

[0701]

[0702]

[0703]

[0704]

[0705]

[0706]

[0707] Based on the screening results of the first-grade sequence, a portion is selected, modified, and vector added to further screen for inhibitors.

[0708] Example 3 Synthesis of Vector Structures

[0709] When the vector structure 3' MVIP is conjugated to the 3' end of the sense chain or antisense chain of the RNA inhibitor according to the present application, the solid support of the 3' MVIP is used as the initiating monomer for solid-phase synthesis. When the vector structure 5' MVIP is conjugated to the 5' end of the sense chain or antisense chain of the RNA inhibitor according to the present application, the 5' MVIP phosphoramidite monomer is used as the final monomer for solid-phase synthesis.

[0710] The general formula for the solid support of a 3' MVIP is as follows:

[0711]

[0712] When m is 1-4, the joint B portion of the general formula is branched 1 to 4 times each to obtain a solid support of the corresponding 3' MVIP.

[0713] The general formula of the 5' MVIP phosphoramidite monomer is as follows:

[0714]

[0715] When n is 1-4, the joint B portion of the general formula is branched 1 to 4 times each to obtain the corresponding 5' MVIP phosphoramidite monomer.

[0716] The chemical synthesis process for several 3' MVIP solid support and 5' MVIP phosphoramidite monomers is described below by way of example. By referring to the method according to the examples, those skilled in the art can easily synthesize other 3' MVIP solid support and 5' MVIP phosphoramidite monomers according to this application. The synthesis process is as follows:

[0717] 3.1 Synthesis of Solid Supports in 3' MVIP

[0718] 3.1.1 Synthesis of Solid Supports in 3' MVIP09

[0719] Solid Support of 3' MVIP09

[0720] Synthesis Process Description:

[0721] 3.1.1.1 Synthesis of ERC-01-c1

[0722]

[0723] 2-Amino-1,3-propanediol (5.0 g, 54.9 mmol) was taken, 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL) were added, the temperature was lowered to 0°C, and tert-butyl acrylate (20 mL, 137.8 mol) was added dropwise over 2 hours. The mixture was reacted at room temperature for 48 hours, petroleum ether (100 mL) was added, and the organic layer was separated and dried by washing twice with saturated saline solution. The mixture was passed through a chromatography column (mobile phase: ethyl acetate: petroleum ether = 25%-75%), and 0.05% triethylamine was added to the column to obtain 6.2 g of a colorless oily substance.

[0724] 3.1.1.2 Synthesis of ERC-01-c2

[0725]

[0726] ERC-01-c1 (6.2g, 17.9mmol) was taken, 50mL of dichloromethane and 23mL of sodium carbonate solution (25%) were added, and benzyl chloroformate (8.2mL, 57.4mmol) was added dropwise at room temperature for 2 hours, reacted overnight at room temperature, washed 3 times with saturated saline solution, dried with anhydrous sodium sulfate, and the solvent was evaporated and dried. The mixture was then passed through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0g of oily substance.

[0727] 3.1.1.3 Synthesis of ERC-01-c3

[0728]

[0729] Take ERC-01-c2 (4.0g, 8.3mmol), add 12ml of formic acid, react overnight at room temperature, and evaporate the solvent under reduced pressure to obtain 2.8g of product.

[0730] 3.1.1.4 Synthesis of ERCd-01-c1

[0731]

[0732] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by the addition of HOBt (2.24 g) and HBTU (3.36 g), and then slowly added DIEA (4.16 mL). The reaction mixture was stirred at room temperature and reacted for 3 hours. Next, water was added to extract the aqueous layer with dichloromethane (2 x 10 mL). The organic layer was washed sequentially with sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated saline (60 mL). The mixture was dried with anhydrous sodium carbonate, dried under reduced pressure, and purified using silica gel column chromatography (mobile phase: 3-15 % MeOH in DCM). 3.24 g of pale yellow solid was obtained.

[0733] 3.1.1.5 Synthesis of ERCd-01-c2

[0734]

[0735] ERCd-01-c1 (3.24 g, 2.6 mmol) is dissolved in methanol (60 mL), and 10% carbon-supported palladium (0.3 g) and acetic acid (2.0 mL) are added. Then, hydrogen is added at atmospheric pressure and the reaction is carried out overnight. The reaction solution is filtered through diatomaceous earth, and the filtrate is dried by vacuum evaporation to obtain 2.9 g of the oily substance ERCd-01-c2, and its high-resolution mass spectrum is shown in Fig. 1.

[0736] 3.1.1.6 Synthesis of 3' MVIP09-c1

[0737]

[0738] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added sequentially to a reaction flask, and 10 mL of DCM was added and stirred to dissolve. Then, TBTU (0.963 g) and DIPEA (0.517 g) were added sequentially and reacted overnight. Water was added and extracted with DCM, and the organic phase was washed again with saturated saline, dried, filtered, and concentrated. Finally, the product was purified using a silica gel column to obtain 1.3 g of product.

[0739] 3.1.1.7 Synthesis of 3' MVIP09-c2

[0740]

[0741] 3' MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added sequentially to a reaction flask and stirred at room temperature to dissolve, then DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added sequentially and stirred at room temperature to react, and TLC analysis was performed. The reaction solution was combined and concentrated to remove DCM, water was added to extract with DCM, the organic phase was washed again with saturated saline, the organic phase was dried with anhydrous sodium carbonate, filtered and concentrated, and finally purified with a silica gel column to obtain 1.55 g of product.

[0742] 3.1.1.8 Solid Support Composite of 3' MVIP09

[0743]

[0744] 3' MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL DMF were added to the reaction flask in succession and dissolved, followed by HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g). After shaking on a shaking table for 24 hours, the mixture was filtered, the resin was washed with 10% methanol / DCM, and then end-capping was performed with 25% acetic acid / pyridine, with a degree of substitution of 150 μmol / g.

[0745] 3.1.2 Synthesis of Solid Supports for 3' MVIP17

[0746]

[0747] 3' MVIP17 Solid Support

[0748] 3.1.2.1 Synthesis of SANC-01-c1

[0749]

[0750] For the synthesis step, refer to 3.1.1.1. Synthesis of ERC-01-c1.

[0751] 3.1.2.2 Synthesis of SANC-01-c2

[0752]

[0753] For the synthesis step, refer to 3.1.1.2. Synthesis of ERC-01-c2.

[0754] 3.1.2.3 Synthesis of SANC-01-c3

[0755]

[0756] For the synthesis step, refer to 3.1.1.3. Synthesis of ERC-01-c3.

[0757] 3.1.2.4 Synthesis of SANCd-01-c1

[0758]

[0759] For the synthesis step, refer to 3.1.1.4. Synthesis of ERCd-01-c1.

[0760] 3.1.2.5 Synthesis of SANCd-01-c2

[0761]

[0762] For the synthesis step, refer to 3.1.1.5. Synthesis of ERCd-01-c2.

[0763] 3.1.2.6 Synthesis of 3' MVIP17-c1

[0764]

[0765] For the synthesis steps, refer to 3.1.1.6. Synthesis of 3' MVIP09-c1, and for the high resolution mass spectrum of the 3' MVIP17-c1 obtained by synthesis, refer to Fig. 2.

[0766] 3.1.2.7 Synthesis of 3' MVIP17-c2

[0767]

[0768] For the synthesis step, refer to the synthesis of 3' MVIP09-c2 in section 3.1.1.7.

[0769] 3.1.2.8 Synthesis of Solid Supports for 3' MVIP17

[0770]

[0771] For the synthesis step, refer to Solid Support synthesis in 3.1.1.8 3' MVIP09.

[0772] 3.1.3 Composite of Solid Supports in 3' MVIP01:

[0773]

[0774] 3' MVIP01 Solid Support

[0775] Description of the synthesis process:

[0776] 3.1.3.1 Synthesis of 3' MVIP01-c1

[0777]

[0778] For the synthesis step, refer to 3.1.1.6. Synthesis of 3' MVIP09-c1.

[0779] 3.1.3.2 Synthesis of 3' MVIP01-c2

[0780]

[0781] For the synthesis step, refer to 3.1.1.7. Synthesis of 3' MVIP09-c2.

[0782] 3.1.3.3 Synthesis of Solid Supports of 3' MVIP01

[0783]

[0784] For the synthesis step, refer to Solid Support synthesis in 3.1.1.8. 3' MVIP09.

[0785] 3.2 Synthesis of 5' MVIP Phosphoramidite Monomer

[0786] 3.2.1 Synthesis of 5' MVIP09 Phosphoramidite Monomer:

[0787]

[0788] 5' MVIP09 Phosphoramidite monomer

[0789] 3.2.1.1 Synthesis of 5' MVIP09-ERCd-PFP-c1

[0790]

[0791] ERCd-01-c2 (2.18g, 2.0mmol) was taken and dissolved in DMF (50mL), pentanedioic acid monobenzyl ester (1,5-Pentanedioic Acid Monobenzyl Ester) (0.53g, 2.4mmol), DIPEA (0.78g), and TBTU (0.84g) were added and stirred overnight at room temperature, water (50mL) was added for annealing, extracted with DCM (30mL*3), washed with 10% citric acid (50mL*3), 50mL of saturated sodium bicarbonate, and 100mL of pyridine, dried with anhydrous sodium sulfate, filtered, rotary evaporated, loaded onto a column, and purified to obtain the product 5' MVIP09-ERCd-PFP-c1 (2.15g).

[0792] 3.2.1.2 Synthesis of 5' MVIP09-ERCd-PFP-c2

[0793]

[0794] 5' MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% carbon-supported palladium (0.21 g) were taken, methanol (50 mL) was added, and the mixture was stirred overnight at room temperature while adding hydrogen. After the reaction was complete, the carbon-supported palladium was filtered with diatomaceous earth and evaporated to obtain a 5' MVIP09-ERCd-PFP-c2 product (1.9 g), the high-resolution mass spectrum of which is shown in FIG. 3.

[0795] 3.2.1.3 Synthesis of 5' MVIP09-ERCd-PFP

[0796]

[0797] 5' MVIP09-ERCd-PFP-c2 prepared product (1.9g, 1.58mmol) is taken and dissolved in DCM (60mL), DIPEA (1.33g) is added and cooled, Pentafluorophenyl Trifluoroacetate (2.21g, 7.9mmol) is added and stirred at room temperature for 2 hours to react, then rotary evaporated, continued to dissolve in DCM (60mL), washed with saturated sodium bicarbonate (30mL*3), 10% citric acid (30mL*1), and saturated saline solution (50mL*1), dried with anhydrous sodium sulfate, filtered, and rotary evaporated to obtain 5' MVIP09-ERCd-PFP prepared product (2.35g), dried under reduced pressure, and used directly in the next step reaction without purification.

[0798] 3.2.1.4 Synthesis of 5' MVIP09 Phosphoramidite Monomer-C1

[0799]

[0800] The prepared product of 5' MVIP09-ERCd-PFP (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL), and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added and the mixture was stirred overnight at room temperature. Extraction was performed by adding 10% citric acid (30 mL) and DCM (30 mL * 3), washing with saturated saline (50 mL), drying with anhydrous sodium sulfate, filtering, rotary evaporating, and loading onto a column for purification to obtain the product 5' MVIP09 monomer-c1 (1.73 g).

[0801] 3.2.1.5 5' MVIP09 Phosphoramidite Monomer

[0802]

[0803] 5' MVIP09 phosphoramidite monomer-c1 (1.3g, 1.0mmol) is taken and dissolved in acetonitrile (30mL), diisopropylamine triazole (0.22g) is added, and bis(diisopropylamino)(2-cyanoethoxy)phosphine (0.36g, 1.2mmol) is added dropwise in an ice bath and reacted at room temperature for 4 hours. After the reaction passes HPLC analysis, the mixture is concentrated and loaded onto a column to obtain the purified product 5' MVIP09 monomer (1.2g).

[0804] 3.2.2 Synthesis of 5' MVIP01 Phosphoramidite Monomer:

[0805]

[0806] 5' MVIP01 Phosphoramidite monomer

[0807] Take 5' MVIP01 phosphoramidite monomer YICd-01-c2 (1.12 g, 2.0 mmol) and refer to 3.2.1.1 to 3.2.1.5 for the following operations.

[0808] Example 4 Synthesis of an RNA inhibitor having vector conjugation

[0809] The synthesis of the antisense chain (3' MVIP 09 conjugation) of the conjugation vector is as follows: Purge the test tube with argon gas for at least 2 minutes. Add phosphoramidite monomer or acetanitrile to the test tube in sequence, close the stopper tightly, and shake until the solid is completely dissolved visually. Then add a 3A molecular sieve and let stand for at least 8 hours. Purge the test tube with argon gas for at least 2 minutes. Add xanthane hydride and dry pyridine to the test tube in sequence, close the stopper tightly, shake until the solid is completely dissolved visually, and let stand for a while. Perform the following operations under ambient conditions of 20–30°C: Take a 3’ MVIP Solid Support and add it to a test tube, then add acetonitrile and shake to mix uniformly, transfer it into a synthesis column, and wash any remaining portion in the test tube with acetonitrile and transfer it into the synthesis column. After washing is complete, add acetonitrile to fill the synthesis column and record the amount of acetonitrile used. Mount and secure the synthesis column according to the instrument operation.

[0810] Connect the above-prepared monomer solution, CAP A, CAP B, oxidizing agent, sulfidation agent, activator, decapping agent, and acetanitrile to the corresponding AKTA PILOT100 pipeline and ensure that the pipeline reaches the bottom of the reagent ampoule.

[0811] After completing the synthesis method settings and ensuring each task of the instrument is ready, click 'Start' to begin synthesis. Record and observe the area of ​​each detritylation peak in real time. During the synthesis process, perform replenishment operations based on the actual amount of deprotectant used.

[0812] After the synthesis is complete, the synthesis column is purged with argon gas for at least 2 hours, and the synthesis column is desorbed according to the operation manual. The solid-phase vector within the synthesis column is transferred to a reaction flask, and an aqueous methylamine solution and ammonia water are added. The reaction flask is then placed on a shaking table and reacted at 35°C for 2-3 hours. The solution is filtered into a round-bottom flask, and the remaining solid phase is washed with a 50% aqueous ethanol solution and filtered again. The filtrate is combined with the first filtrate, and the round-bottom flask is connected to a rotary evaporator dryer with the water temperature set to 50°C. Evaporation is performed until no more distillate remains. Ethanol is added into the round-bottom flask and mixed uniformly. Evaporation is performed again until no more distillate remains, and the above operation is repeated until a white powder is formed at the bottom of the flask. The obtained white powder is prepared into a solution, purified using a reverse-phase chromatography column, and a sample is taken to measure the OD260 and purity. Place the purified antisense chain solution in a vial, freeze-dry it, and wait; then, seal and store the product in a refrigerator at -20°C.

[0813] The synthesis procedure for the sense chain (5' MVIP09 conjugation) of the conjugation vector is the same as that for the antisense chain, wherein the solid support loaded onto the column is a universal vector. Dipaea is added to the obtained intermediate to prepare a solution, 5' MVIP phosphoramidite monomer is added and mixed uniformly, and the reaction flask is placed on a shaking table and reacted at 35°C for 2-3 hours.

[0814] The synthetic annealing process for RNA inhibitors is as follows:

[0815] Take the obtained sense chain and antisense chain, mix them in a 1:1 equimolar ratio in a reaction flask, and react in a 95°C water bath for 5 minutes. Then, turn off the power to the water bath and allow it to cool naturally to below 40°C at room temperature. Add 3M sodium acetate solution to the double-chain solution and mix uniformly. Then, add an appropriate volume of anhydrous ethanol and mix uniformly. Place the reaction mixture in a refrigerator at -20°C for 45 minutes. Pre-cool a high-speed freezing centrifuge to 4°C; once the temperature is reached, add the double-chain solution and operate the centrifuge. After centrifugation, remove the double solution, remove the supernatant, and add ultrapure water to completely dissolve the solid. Take a sample, measure the OD260 and purity to obtain the RNA inhibitor listed in Table 14, and place the purified sample solution in a vial, freeze-dry it, seal it, and store it in a refrigerator at -20°C.

[0816] Although the synthesis of 5' MVIP09 / 3' MVIP09 conjugated RNA inhibitors has been described exemplarily above, RNA inhibitors not exemplified by the present invention are also subject to these rules, namely, when the vector structure 3' MVIP is conjugated to the 3' end of the sense chain or antisense chain of the RNA inhibitor, the solid support of 3' MVIP is the initiating monomer for solid-phase synthesis; and when the vector structure 5' MVIP is conjugated to the sense chain or antisense chain of the RNA inhibitor, the 5' MVIP phorforamidite monomer becomes the final monomer for solid-phase synthesis. By referring to the above method of the present example, those skilled in the art can easily synthesize other RNA inhibitors related to the present invention.

[0817] Example 5 Screening experiment of CFB inhibitor and C5 inhibitor in PHH cells

[0818] The RNA inhibitor of this example is selected from Tables 1-7, and the inhibitory effect of the RNA inhibitor is verified through the uptake of PHHs in cells.

[0819] Verification Method: Day 0, cells are plated and transfected into the cells with the compound using Lipofectamine® RNAiMAX. 48 hours after transfection, total RNA is extracted using the Eastep® Super Total RNA Kit (Promega-LS1040), cDNA is synthesized using One-Step gDNA Removal, and qPCR measurements are performed using PerfectStart® Green qPCR SuperMix (+Dye I).

[0820] Data Analysis: Based on the Ct value of each sample, the expression level of the target gene mRNA in the sample is calculated using the ΔΔCt relative quantification method. The relative expression level of the target gene is expressed as 2 - ΔΔCT. The calculation formula is as follows: ΔCT = Target gene mean Ct value - Reference gene mean Ct value; ΔΔCT = ΔCT (Drug-added group) - ΔCT (Control group); Target gene mRNA relative expression level = 2 - ΔΔCT; Target gene inhibition rate = (1 - Sample value / Mean value of RNAiMAX Control) × 100%, and the result is expressed as the mean ± SD of three duplicate wells. The complement system mRNA inhibitory effect of RNA inhibitors on PHH cells at concentrations of 500 nM, 100 nM, 10 nM, 1 nM, 0.02 nM, 0 nM, 1 nM, and 0.1 nM is investigated. Refer to Table 16-1 for the experimental results of the inhibitory effect of CFB RNA inhibitors on PHH cells.

[0821]

[0822] Example 6 In vitro inhibition experiment of complement system gene expression by CFB, C5, and C3 modified sequence RNA inhibitors

[0823] The RNA inhibitor of this embodiment is selected from Table 7.

[0824] Example 6-1. RNA inhibitors were prepared according to the method of Example 4. The inhibitory effects of RNA inhibitors on CFB mRNA, C5 mRNA, and C3 mRNA in Hep3B cells at concentrations of 1 nM and 0.01 nM were investigated according to the experimental method of Example 2. The experimental results obtained are as shown in Tables 17-1 to 17-5.

[0825]

[0826]

[0827]

[0828]

[0829] Example 6-2 Experiment to measure in vitro inhibition of RNA inhibitor on C3 gene EC50

[0830] The RNA inhibitors of this example are selected from Table 7. The C3 mRNA inhibitory effects of the RNA inhibitors Kylo-27-DS8201, Kylo-27-DS8771, and Kylo-27-DS8141 on Hep3B cells were studied at different concentrations, and inhibition rate data were measured three times at each concentration to obtain the average value. Based on the experimental data, inhibition rate-concentration curves were constructed to calculate the corresponding EC50, EC75, EC85, and EC95. The obtained experimental results are shown in Tables 18-1 and 18-2.

[0831]

[0832]

[0833] Example 7 Evaluation of In vivo activity of RNA inhibitors using mice

[0834] The RNA inhibitor according to the present embodiment is selected from Table 7, and the inhibitory effect of the RNA inhibitor is verified through humanized CFB mice.

[0835] Example 7-1: Inhibitory effect of Kylo-17 inhibitor on humanized CFB mouse protein levels

[0836] After adaptive rearing, experimental animals are randomly divided into physiological saline, Kylo-17-DS2761, Kylo-17-DS2821, Kylo-17-DS2811, Kylo-17-DS2751, and Kylo-17-DS2861 groups based on the hCFB protein content in plasma on Day -1. Five animals are assigned to each group. The drug is administered via a single subcutaneous injection; the dosage is 3 mg / kg, the injection volume is 5 mL / kg, and the concentration is 0.6 mg / mL. The day of drug administration is recorded as Day 0. Individual animals are identified by ear numbering. Rearing cages are identified by hanging cards on the cages.

[0837] Measurement time: Approximately 200 μL of blood is collected from the inner corner of the eye on Day -1 before drug administration, and on Days 7, 14, 21, 28, 35, and 42 after drug administration. Fresh blood samples are obtained by heating the whole blood samples in a 37°C water bath for 1 hour before centrifugation and centrifuging at 3000 r for 10 minutes to collect the supernatant, which is used for the measurement of hCFB protein.

[0838] The method for measuring hCFB protein levels is as follows: measurements are taken using an ELISA kit (single well), and the blood sample is a fresh sample obtained by centrifuging a whole blood sample.

[0839] Experimental data are expressed as mean ± standard deviation (Mean ± SD), and represent the effect of the inhibitor on the mouse hCFB protein inhibition rate (%, Mean ± SD). The data were statistically analyzed using a t-test. P < 0.05 indicates statistical significance. The experimental results are shown in Table 19 and Figure 4.

[0840]

[0841] Example 7-2: Inhibitory effect of Kylo-19 inhibitor on phosphorylated C5 mouse protein levels

[0842] After adaptive rearing of experimental animals, they are randomly divided into physiological saline, Kylo-19-DS7511, Kylo-19-DS7901, Kylo-19-DS7891, Kylo-19-DS7921, and Kylo-19-DS8001 groups based on Day-3 serum hC5 protein content, with 5 animals in each group. The drug is administered via a single subcutaneous injection with a dosage of 3 mg / kg, a volume of 5 mL / kg, and a concentration of 0.6 mg / mL; the day of drug administration is recorded as Day 0. Individual animals are identified by ear numbering. Rearing cages are identified by hanging cards on the cages.

[0843] Measurement time: Approximately 200 μL of blood is collected from the inner corner of the eye on Day -3 before drug administration and on Days 7, 14, 21, 28, 35, 42, and 49 after drug administration. Fresh blood samples are obtained by heating the whole blood samples in a 37°C water bath for 1 hour before centrifugation and centrifuging at 3000 r for 10 minutes to collect the supernatant, which is used for hC5 protein measurement.

[0844] Experimental data are expressed as mean ± standard deviation (Mean ± SD) and converted into the effect of the inhibitor on the inhibition rate of mouse hC5 protein (%, Mean ± SD). Data were statistically analyzed using a t-test, and P < 0.05 indicates statistical significance. The experimental results are shown in Table 20 and Figure 5.

[0845]

[0846] Example 7-3: Inhibitory effect of Kylo-19 inhibitor on humanized C5 mouse protein levels

[0847] After adaptive rearing of experimental animals, they are randomly divided into physiological saline, Kylo-19-DS7871, and Kylo-19-DS7881 groups based on Day-3 serum hC5 protein content, with 5 animals assigned to each group. The drug is administered via a single subcutaneous injection with a dosage of 3 mg / kg, a volume of 5 mL / kg, and a concentration of 0.6 mg / mL; the day of drug administration is recorded as Day 0. Individual animals are identified by ear numbering. Rearing cages are identified by hanging cards on the cages.

[0848] Measurement time: Approximately 200 μL of blood is collected from the inner corner of the eye on Day -3 before drug administration and on Days 7, 14, 21, 28, 35, 42, and 49 after drug administration. Fresh blood samples are obtained by heating the whole blood samples in a 37°C water bath for 1 hour before centrifugation and centrifuging at 3000 r for 10 minutes to collect the supernatant, which is used for hC5 protein measurement.

[0849] Experimental data are expressed as mean ± standard deviation (Mean ± SD) and converted into the effect of the inhibitor on the inhibition rate of mouse hC5 protein (%, Mean ± SD). Data were statistically analyzed using a t-test, and P < 0.05 indicates statistical significance. The experimental results are shown in Table 21 and Figure 6.

[0850]

[0851] Inhibitors with significant inhibitory effects are selected and optimized, and then cynomolgus monkey experiments are conducted.

[0852] Example 8 Evaluation of In vivo Activity of RNA Inhibitors Using Cynomolgus Monkeys

[0853] Example 8-1 Experiment to Verify the In vivo Pharmacological Activity of CFB Inhibitors in NHP Cynomolgus Monkeys

[0854] The RNA inhibitor of this example is selected from Table 7, and the inhibitors, a positive control and Kylo-17-DS2911, are evaluated for their inhibitory effects on serum CFB protein expression levels and CFB mRNA levels in NHP cynomolgus monkeys. The inhibitors selected as positive controls are sense chain: AsAsGAGAfAGfUfCfGUUUCAUUCAU-L96; antisense chain: AsfUsGAAfUGfAfAACGAfCUfUCUCUUsGsU.

[0855] After adaptive rearing of healthy cynomolgus monkeys, blood was collected on Day -1 to measure the serum CFB protein content. Based on the CFB protein content, animal groups were divided into a normal control group, a positive control group, and a Kylo-17-DS2911 group. The drug dosage was 6 mg / kg; the normal control group consisted of 2 animals, one female and one male; the positive control group and G3 group each consisted of 3 animals, with 2 males and 1 female. The drug was administered via a single subcutaneous injection (injection into the neck and back), with a dosage of 1 mL / kg, and the day of administration was recorded as Day 0. CFB protein levels in the serum of NHP cynomolgus monkeys were measured by collecting venous blood once a week until the end of the D91 experiment, starting on Day -2 before drug administration and on Days 7, 14, 21, and 28 after drug administration.

[0856] The method for measuring CFB protein levels is as follows: Measurements are performed using an ELISA kit (single well), and the blood sample used is a fresh sample obtained by centrifuging a whole blood sample. Measurement times: Venous blood is collected once a week until the end of the experiment on Day -1 before drug administration, and on Days 7, 14, 21, and 28 after drug administration. Each collection is approximately 2 ml. A fresh blood sample is obtained by leaving the whole blood sample at room temperature for 1 hour before centrifugation, centrifuging at 3000 r for 10 minutes, and collecting the supernatant, which is then used for CFB protein measurement.

[0857] The method for measuring CFB mRNA levels in liver tissue is as follows: A liver biopsy is performed on a cynomolgus monkey, and the mRNA levels of target sites in the liver are measured using the probe method qPCR.

[0858] Experimental data is displayed as mean ± standard deviation (Mean ± SD), and plots are produced by analyzing the data using GraphPad Prism 8.3 analysis software. The data is statistically analyzed using a t-test, and P < 0.05 indicates statistical significance.

[0859] The experimental results for the CFB protein level are as shown in Table 23 and Figure 8; and the experimental results for the CFB mRNA level are as shown in Table 24 and Figure 9.

[0860]

[0861]

[0862] As can be seen from the experimental results in Table 23, regarding CFB protein levels, the inhibition rate in D28 rapidly increased after drug administration and continuously inhibited CFB protein levels in D28-D63 (the inhibition rate ranges were 78.8%-89.52%, P<0.05 or P<0.01 or P<0.001, respectively), while the inhibition rate ranges in D70-D91 were 64.23%-72.18%, respectively. The inhibition rate of Kylo-17-DS2911 in D21 showed a significant inhibitory effect that inversely surpassed the positive control, and it can be seen from the inhibition rates in D21-D91 that the inhibitory effect is stable. As can be seen from the inhibition rates of Kylo-17-DS2911 in D70-D91 compared to the positive control, the inhibitor according to the present invention has a more stable inhibitory effect.

[0863] As can be seen from the experimental results in Table 24, regarding CFB mRNA levels in liver tissue, Kylo-17-DS2911 significantly lowered CFB mRNA levels in D35 liver tissue after drug administration with an inhibition rate of 96.5%, and continued to stably and highly efficiently inhibit CFB mRNA expression in D67 and D84 with inhibition rates of 89.66% and 89.17%, respectively. Compared to the positive control group, it exhibits a more significant level of CFB mRNA inhibition and inhibits it more stably and sustainably.

[0864] Example 8-2 Effects of C5 Inhibitors on C5 Protein Content and CH50 Activity in NHP Cynomolgus Monkey Serum

[0865] The RNA inhibitor of this example is selected from Table 7, and the effects of the positive control (sense chain: AsAsfGCfAAfGAfUfAfUUfUUUfAUfAAUA-L96, antisense chain: UsfAsfUUfAUAfAAfAAUAfUCfUUfGCUUsUsUdTdT) and Kylo-19-DS7881 inhibitor on C5 protein content and CH50 activity in the serum of NHP cynomolgus monkeys are verified through cynomolgus monkeys.

[0866] After adaptive rearing of healthy cynomolgus monkeys, blood was collected on Day -2 to measure the serum C5 protein content. Based on the C5 protein content, animal groups were divided into Normal Control G1, Positive Control G2, and Kylo-19-DS7881 G3. The drug dosage was 6 mg / kg. The Normal Control group consisted of 2 animals, one female and one male; the G2 and G3 groups each consisted of 3 animals, with 2 females and 1 male. The drug was administered via a single subcutaneous injection (injection into the neck and back), with a dosage of 1 mL / kg. The day of drug administration was recorded as Day 0. C5 protein levels in the serum of NHP cynomolgus monkeys were measured by collecting venous blood once a week until the end of the D91 experiment, starting on Day -2 before drug administration and on Days 7, 14, 21, and 28 after drug administration.

[0867] Venous blood is collected once a week until the end of the experiment, starting on Day -1 before drug administration and on Days 7, 14, 21, and 28 after drug administration. Each collection is approximately 2 ml. Fresh blood samples are obtained by leaving whole blood samples at room temperature for 1 hour before centrifugation, then centrifuging at 3000 r for 10 minutes and collecting the supernatant; these samples are used for C5 protein measurement. The method for detecting C5 protein levels is as follows: measurements are performed using an ELISA kit (single well), and the blood sample used is the fresh sample obtained by centrifuging the whole blood sample.

[0868] CH50 activity in serum samples is measured on Day -2 before drug administration, and on Days 14, 28, 42, 49, 56, 63, 70, and 77 after drug administration. The method for detecting CH50 protein levels is as follows: measurements are taken using an ELISA kit (single well), and blood samples are obtained by centrifuging whole blood samples.

[0869] Experimental data is displayed as mean ± standard deviation (Mean ± SD), and plots are produced by analyzing the data using GraphPad Prism 8.3 analysis software. The data is statistically analyzed using a t-test, and P < 0.05 indicates statistical significance.

[0870] The experimental results of the C5 protein inhibition rate are as shown in Table 24 and Figure 10; and the experimental results of the CH50 activity level are as shown in Table 25 and Figure 11.

[0871]

[0872]

[0873] As can be seen from Table 24 and Figure 10, Kylo-19-DS7881 of the present invention significantly lowers serum C5 protein levels at D7 after drug administration, with an inhibition rate of 71.4%, further decreases at D14, and continuously and stably inhibits serum C5 protein expression levels during the period D14-D77 (the inhibition rate range is 89.2%-100%, respectively). P <0.05 or P <0.01 or P After drug administration, protein levels in D84 increase to some extent, but the inhibition rates in D84 and D91 are 83.4% and 79.4%, respectively. Compared to the positive control group, the inhibitory ability after D56 is significantly superior, and compared to the positive control group, it is more stable and the inhibitory effect is more sustained.

[0874] As can be seen from Table 25 and Figure 11, Kylo-19-DS7881 of the present application significantly lowers serum CH50 activity at D14 after drug administration, with a CH50 activity retention level of 35%, and continuously and stably lowers serum CH50 activity during the D28-D63 period (the retention level range is 38.8%-40.3%, respectively). P (<0.05), CH50 activity at D70 is slightly increased after drug administration, and the preservation levels of CH50 activity at D70 and D77 are 48.7% and 58.4%, respectively; compared to the positive control, the CH50 activity lowering effect is superior and the duration of the lowering effect is better.

[0875] Example 8-3 Effect of C3 Inhibitor on C3 Protein Content in NHP Cynomolgus Monkey Serum

[0876] The RNA inhibitors of this example are selected from Table 7, and the effects of the Kylo-27-DS8141 and Kylo-27-DS8201 inhibitors on the inhibitory effect on serum C3 protein expression levels in NHP cynomolgus monkeys are evaluated through cynomolgus monkeys.

[0877] After adaptive rearing of healthy cynomolgus monkeys, blood was collected on Day 1 to measure the serum C3 protein content. Based on the C3 protein content, the animals were divided into normal control, Kylo-27-DS8141, Kylo-27-DS8131, Kylo-27-DS8201, and Kylo-27-DS8211 groups. The drug dosage was 6 mg / kg, with 3 animals in each group, consisting of 2 males and 1 female. The drug was administered via a single subcutaneous injection (injection into the neck and back), with a dosage of 1 mL / kg, and the day of drug administration was recorded as Day 0.

[0878] Venous blood is collected once a week until the end of the experiment, starting on Day -1 before drug administration and on Days 7, 14, 21, 28, 35, and 42 after drug administration. Each collection is approximately 2 ml. Fresh blood samples are obtained by leaving the whole blood samples at room temperature for 1 hour before centrifugation and then centrifuging at 3000 r for 10 minutes to collect the supernatant, which is used for C3 protein measurement.

[0879] The method for detecting C3 protein levels is as follows: measurements are taken using an ELISA kit (single well), and the blood sample is a fresh sample obtained by centrifuging a whole blood sample.

[0880] Experimental data are expressed as mean ± standard deviation (Mean ± SD), and graphs are produced by analyzing the data using GraphPad Prism 8.3 analysis software. The data is statistically analyzed using a t-test, and P < 0.05 indicates statistical significance. The experimental results are shown in Table 26 and Figure 12.

[0881]

[0882] As can be seen from Table 26 and Figure 12, the inhibition rates of C3 protein by Kylo-27-DS8141 and Kylo-27-DS8201 are relatively significant and have good persistence. Kylo-27-DS8141 inhibits serum C3 protein expression levels consistently and stably during the D14-D70 period (inhibition rates ranged from 79.6% to 91.6%, P<0.05 or P<0.01, respectively), and the inhibition rates at D77 and D84 remained at 74.3% and 67.9%, respectively, showing good persistence. Kylo-27-DS8201 inhibits serum C3 protein expression levels consistently and stably during the D14-D98 period, with the inhibition rate reaching 96.8% at D42 and remaining at 85.1% at D98, showing good persistence.

Claims

Claim 1 RNA inhibitor or pharmaceutically acceptable salt thereof for inhibiting a type of complement system gene expression, wherein the RNA inhibitor is characterized in that a sense strand and an antisense strand having a chain length of 15-30 are formed through base pairing, the chain length is preferably 19-23, wherein the antisense strand comprises a region complementary to the mRNA encoding the complement system, and further wherein the complementary region comprises at least 15 consecutive nucleotides that differ by 0, 1, 2, or 3 nucleotides compared to any one of the antisense strands shown in Table 1-1, Table 1-2, and Table 1-3. Claim 2 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 1, the RNA inhibitor is an RNA inhibitor that inhibits CFB gene expression, wherein the antisense chain comprises a region complementary to a target sequence, wherein the target sequence is 5' gucuagucaacuuaauugaga 3' SEQ ID NO: 25, the starting position in NM_001710.5 is site 1157, and at least 85% of the bases between the sense chain and the antisense chain are complementary. Claim 3 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 1, the RNA inhibitor is an RNA inhibitor that inhibits C5 gene expression, wherein the antisense chain comprises a region complementary to a target sequence, said target sequence is 5' uugucccaguauucuauguuu 3' SEQ ID NO: 826, the starting position in NM_001735.3 is site 3073, and at least 85% of the bases between said sense chain and antisense chain are complementary. Claim 4 In claim 1, the RNA inhibitor is an RNA inhibitor that inhibits C3 gene expression, wherein the antisense chain comprises a region complementary to a target sequence, the target sequence is 5' gguguugacagauacaucu 3' SEQ ID NO: 1952 and the start position in NM_000064.4 is site 4329; the target sequence is 5' ggagccuacagagaaauucua 3' SEQ ID NO: 2039 and the start position in NM_000064.4 is site 771; the target sequence is 5' agaaauucuacuacaucuaua 3' SEQ ID NO: 2048 and the start position in NM_000064.4 is site 782; An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that the target sequence is 5' gcugaggagaauugcuucaua 3' SEQ ID NO: 2240 and the start position in NM_000064.4 is site 4603; the target sequence is 5' ggagaauugcuucauacaaaa 3' SEQ ID NO: 2245 and the start position in NM_000064.4 is site 4608; and at least 85% of the bases between the sense chain and the antisense chain are complementary. Claim 5 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in paragraph 2, the antisense chain is selected from the following sequence 5' ucucaauuaaguugacuagacac 3' SEQ ID NO: 293; or a sequence having at least 15 consecutive nucleotides identical to the sequence SEQ ID NO: 293; or a sequence differing from the sequence SEQ ID NO: 293 by 1, 2 or 3 nucleotides, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide. Claim 6 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that the sense chain is selected from the following sequence 5' gucuagucaacuuaauugaga 3' SEQ ID NO:25; or a sequence having at least 15 consecutive nucleotides identical to the SEQ ID NO:25 sequence; or a sequence differing from the SEQ ID NO:25 sequence by 1, 2 or 3 nucleotides, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid. Claim 7 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 3, the antisense chain is selected from the following sequence 5' aaacauagaauacugggacaacg 3' SEQ ID NO: 1278; or a sequence having at least 15 consecutive nucleotides identical to the sequence SEQ ID NO: 1278; or a sequence differing from the sequence SEQ ID NO: 1278 by 1, 2 or 3 nucleotides, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide. Claim 8 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in paragraph 3, the sense chain is selected from the following sequence 5' uugucccaguauucuauguuu 3' SEQ ID NO: 826; or a sequence having at least 15 consecutive nucleotides identical to the sequence SEQ ID NO: 826; or a sequence differing from the sequence SEQ ID NO: 826 by 1, 2 or 3 nucleotides, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid. Claim 9 In claim 4, the antisense chain is the following sequence 5' agauguaucugucaacaccau 3' SEQ ID NO. 2543; 5' uagaauuucucuguaggcuccac 3' SEQ ID NO. 2630; 5' uauagauguaguagaauuucucu 3' SEQ ID NO. 2639; 5' uaugaagcaauucuccucagcac 3' SEQ ID NO. 2831; 5' uuuuguaugaagcaauucuccuc 3' SEQ ID NO. 2590; or a sequence having at least 15 consecutive nucleotides identical to the above sequence, or a sequence different from the above sequence by 1, 2 or 3 nucleotides, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide, characterized by being selected from the above sequence, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, t=thymidine deoxyribonucleotide. Claim 10 In claim 4, the sense chain is characterized as being selected from the following sequences: 5' gguguugacagauacaucu 3' SEQ ID NO. 1952; 5' ggagccuacagagaaauucua 3' SEQ ID NO. 2039; 5' agaaauucuacuacaucuaua 3' SEQ ID NO. 2048; 5' gcugaggagaauugcuucaua 3' SEQ ID NO. 2240; 5' ggagaauugcuucauacaaaa 3' SEQ ID NO. 2245; or a sequence having at least 15 consecutive nucleotides identical to the above sequence, or a sequence differing from the above sequence by 1, 2 or 3 nucleotides, wherein g=guanylic acid, a=adenylic acid, u=uridylic acid, c=cytidilic acid, an RNA inhibitor or a pharmaceutically acceptable salt thereof. Claim 11 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in paragraph 2, the sense chain is a sequence having at least 15 consecutive nucleotides identical to SEQ ID NO: 25 or a sequence different from it by 1, 2, or 3 nucleotides; and the antisense chain is a sequence having at least 15 consecutive nucleotides identical to SEQ ID NO: 293 or a sequence different from it by 1, 2, or 3 nucleotides, wherein the sense chain is 5' gucuagucaacuuaauugaga 3' SEQ ID NO: 25; and the antisense chain is 5' ucucaauuaaguugacuagacac 3' SEQ ID NO: 293; wherein g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidylic acid, and t = thymidine deoxyribonucleotide. Claim 12 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 3, the sense chain is SEQ ID NO: 826 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence different from it by 1, 2, or 3 nucleotides; and the antisense sequence is SEQ ID NO: 1278 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence different from it by 1, 2, or 3 nucleotides, wherein the sense chain is 5' uugucccaguauucuauguuu 3' SEQ ID NO: 826; and the antisense chain is 5' aaacauagaauacugggacaacg 3' SEQ ID NO: 1278; wherein g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidilic acid, and t = thymidine deoxyribonucleotide. Claim 13 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 4, the sense chain is SEQ ID NO: 2048 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides; and the antisense sequence is SEQ ID NO: 2639 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides, wherein the sense chain is 5' agaaauucuacuacaucuaua 3' SEQ ID NO: 2048; and the antisense chain is 5' uauagauguaguagaauuucucu 3' SEQ ID NO: 2639; wherein g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidilic acid, and t = thymidine deoxyribonucleotide. Claim 14 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 4, the sense chain is SEQ ID NO: 2639 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides; and the antisense sequence is SEQ ID NO: 2831 or a sequence having at least 15 consecutive nucleotides identical thereto, or a sequence differing from it by 1, 2, or 3 nucleotides, wherein the sense chain is 5' gcugaggagaauugcuucaua 3' SEQ ID NO: 2240; and the antisense chain is 5' uaugaagcaauucuccucagcac 3' SEQ ID NO: 2831; wherein g = guanylic acid, a = adenylic acid, u = uridylic acid, c = cytidilic acid, and t = thymidine deoxyribonucleotide. Claim 15 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 1, the RNA inhibitor is modified by at least one nucleotide. Claim 16 In paragraph 15, the modifications are 2'-fluorine modification, 2'-methoxy group modification, phosphorothioate group modification, invAb modification, glycerol nucleotide, 3'-terminal deoxythymidine (dT) nucleotide, lock nucleotide, unlock nucleotide, conformational restriction nucleotide, constrained ethyl nucleotide, 2'-amino group modification nucleotide, 2'-O-allyl group modification nucleotide, 2'-C-alkyl group modification nucleotide, 2'-hydroxy group modification nucleotide, 2'-methoxyethyl group modification nucleotide, 2'-O-alkyl group modification nucleotide, 2'-phosphate modification or 2-O-(N-methylacetamide) modification, morpholino nucleotide, An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized by being selected from one or a combination of phosphoramidate, baseless nucleotide, baseless deoxynucleotide, nucleotide containing a non-natural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, methylphosphonate modified nucleotide, 5'-phosphate modified nucleotide, 5'-phosphate analog modified nucleotide, heat-unstable nucleotide, and nucleotide analogs. Claim 17 In claim 16, the RNA inhibitor is an RNA inhibitor that inhibits CFB gene expression, and the antisense chain is the following sequence 5' UsdCsUCdAATUAAGTUfGACUAGACsAsC 3' SEQ ID NO: 588; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Cs=2'-O-methyl-3'-thiocytidylic acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidylic acid; An RNA inhibitor or a pharmaceutically acceptable salt thereof characterized by being selected from fGs=2'-fluoro-3'-thioguanylic acid, T=2'-deoxy-thymidylic acid, dA=2'-deoxy-adenylic acid, and dG=2'-deoxy-guanylic acid. Claim 18 In claim 16, the RNA inhibitor is an RNA inhibitor that inhibits C5 gene expression, and the antisense chain is the following sequence 5' AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3' SEQ ID NO: 1598; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidyl acid; An RNA inhibitor or a pharmaceutically acceptable salt thereof characterized by being selected from fGs=2'-fluoro-3'-thioguanylic acid, T=2'-deoxy-thymidylic acid, dA=2'-deoxy-adenylic acid, and dG=2'-deoxy-guanylic acid. Claim 19 In claim 16, the RNA inhibitor is an RNA inhibitor that inhibits C3 gene expression, and the antisense chain is the following sequence 5' UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO: 1665; 5' UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO: 1671; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, dG=2'-deoxy-guanylic acid, and dAs=2'-deoxy-3'-thioadenylic acid. Claim 20 In claim 16, the RNA inhibitor is an RNA inhibitor that inhibits CFB gene expression, and the sense chain is the following sequence 5' GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO: 559; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; RNA inhibitor or pharmaceutically acceptable salt thereof, characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, and fC=2'-fluorocytidyl acid. Claim 21 In claim 16, the RNA inhibitor is an RNA inhibitor that inhibits C5 gene expression, and the sense chain is the following sequence 5' UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO: 1537; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; RNA inhibitor or pharmaceutically acceptable salt thereof, characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, and fC=2'-fluorocytidyl acid. Claim 22 In claim 16, the RNA inhibitor is an RNA inhibitor that inhibits C3 gene expression, and the sense chain is the following sequence 5' AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO: 1645; 5' GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO: 1651; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidyl acid; Gs=2'-O-methyl-3'-thioguanylic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocytidyl acid; RNA inhibitor or pharmaceutically acceptable salt thereof, characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, and fC=2'-fluorocytidyl acid. Claim 23 In paragraph 16, the RNA inhibitor is an RNA inhibitor that inhibits CFB gene expression, and the sense chain is a sequence SEQ ID NO: 559 or differs from this by one, two, or three nucleotides; and the antisense chain is a sequence SEQ ID NO: 588 or differs from this by one, two, or three nucleotides, wherein sense chain: 5' GsUsCUAGfUCfAfAfCUUAAUUGAsGsA 3' SEQ ID NO: 559; antisense chain: 5' UsdCsUCdAATUAAGTUfGACUAGACsAsC 3' SEQ ID NO: 588; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanilic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocitidilic acid; An RNA inhibitor or a pharmaceutically acceptable salt thereof characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, Ts=2'-deoxy-3'-thiothymidylic acid, and dA=2'-deoxy-adenylic acid. Claim 24 In paragraph 16, the RNA inhibitor is an RNA inhibitor that inhibits C5 gene expression, and the sense chain is a sequence SEQ ID NO: 1537 or differs from it by one, two, or three nucleotides; and the antisense chain is a sequence SEQ ID NO: 1598 or differs from it by one, two, or three nucleotides, wherein sense chain: 5' UsUsGUCCfCAfGfUfAUUCUAUGUsUsU 3' SEQ ID NO: 1537; antisense chain: 5' AsdAsACdAUdAGAAUdACfUGGGACAAsCsG 3' SEQ ID NO: 1598; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanilic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocitidilic acid; An RNA inhibitor or a pharmaceutically acceptable salt thereof characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, Ts=2'-deoxy-3'-thiothymidylic acid, and dA=2'-deoxy-adenylic acid. Claim 25 In paragraph 16, the RNA inhibitor is an RNA inhibitor that inhibits C3 gene expression, and the sense chain is a sequence SEQ ID NO: 1651 or differs from this by one, two, or three nucleotides; and the antisense chain is a sequence SEQ ID NO: 1671 or differs from this by one, two, or three nucleotides, wherein the sense chain is 5' AsGsAAAUfUCfUfAfCUACAUCUAsUsA 3' SEQ ID NO: 1645; the antisense chain is 5' UsdAsUAdGATGUAGTAfGAAUUUCUsCsU 3' SEQ ID NO: 1665; or the sense chain is a sequence SEQ ID NO: 1645 or differs from this by one, two, or three nucleotides; In addition, the antisense chain is SEQ ID NO: 1665 or a sequence differing from it by one, two, or three nucleotides, where sense chain: 5' GsCsUGAGfGAfGfAfAUUGCUUCAsUsA 3' SEQ ID NO: 1651; antisense chain: 5' UsfAsUGAfAGfCAAUUCfUCfCUCAGCsAsC 3' SEQ ID NO: 1671; where G=2'-O-methylguanylic acid, A=2'-O-methyladenylic acid, U=2'-O-methyluridylic acid, C=2'-O-methylcytidylic acid; Gs=2'-O-methyl-3'-thioguanilic acid, As=2'-O-methyl-3'-thioadenylic acid, Us=2'-O-methyl-3'-thiouridylic acid, Cs=2'-O-methyl-3'-thiocitidilic acid; An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized by being selected from fG=2'-fluoroguanylic acid, fA=2'-fluoroadenylic acid, fU=2'-fluorouridylic acid, fC=2'-fluorocytidilic acid, fGs=2'-fluoro-3'-thioguanylic acid, fAs=2'-fluoro-3'-thioadenylic acid, fUs=2'-fluoro-3'-thiouridylic acid, fCs=2'-fluoro-3'-thiocytidilic acid, T=2'-deoxy-thymidylic acid, dG=2'-deoxy-guanylic acid, and dAs=2'-deoxy-3'-thioadenylic acid. Claim 26 In any one of claims 1 to 25, the RNA inhibitor may further comprise vector structures 5' MVIP and 3' MVIP, wherein the structure of the RNA inhibitor is as shown in formula Ia, Ib, or Ic: Ia Ib Ic Here, the 5' MVIP is composed of a switching junction R1, a link chain D, a joint B, a branching chain L, and a liver target-specific ligand X, which is connected to the 5' end of the sense chain or the 5' end of the antisense chain through the switching junction R1, and its structure is as indicated by general formula I: I The above 3' MVIP is composed of a switching linkage R2, a link chain D, a joint B, a branching chain L, and a liver target-specific ligand X, which is connected to the 3' end of the sense chain or the 3' end of the antisense chain through the switching linkage R2, and its structure is as shown by General Formula II: II Here, n and m are each independently any integer from 0 to 4, preferably, each independently an integer from 1 to 3, and also n+m = 2 to 6, preferably n+m = 2, 3 or 4, more preferably 4; the switching connection point R1 is a heterocyclic or carbon ring structure comprising N, S or O as shown below: ;or, the above R1 is -NH(CH2) x CH2O-, where x is any integer from 3 to 12, preferably any integer from 4 to 6; and the switching connection point R2 is a heterocyclic or carbon ring structure comprising N, S, or O as shown below: ;or, the above switching connection point R2 is -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where x1 is any integer from 1 to 4 and x2 is any integer from 0 to 4; the liver target-specific ligand X may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, is selected from monosaccharides or derivatives thereof, preferably n-acetylgalactosamine and derivatives thereof, more preferably selected from the following structures: ; Here, W is one or two selected from -OH, -NHCOOH and -NHCO(CH2)qCH3, where q is an integer from 0 to 4; the branched chain L may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, and is selected from one or more of the following structures: Here, r1 is any integer from 1 to 12, r2 is any integer from 0 to 20, Z is H, an alkyl group or an amide group, and said alkyl group is, for example, a C1-C5 alkyl group; said joint B may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, and is selected from the following structures: Here, A1 and A2 are each independently selected from C, O, S, -NH-, carbonyl group, amide group, phosphoryl group, or thiophosphoryl group, and r is any integer from 0 to 4; the link chain D may be the same or different within each of the 5' MVIP and 3' MVIP or between the 5' MVIP and 3' MVIP, and is selected from the following structures: An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, where each p is independently any integer from 1 to 20; s is any integer from 2 to 13; and Z1 and Z2 are the same or different substituents. Claim 27 In paragraph 26, the above 5' MVIP is 5' MVIP01 or 5' MVIP09 as shown below, and the above 3' MVIP is 3' MVIP01, 3' MVIP09 or 3' MVIP17 as shown below, and: 5' MVIP01 5' MVIP09 3' MVIP01 3' MVIP09 An RNA inhibitor characterized by being 3' MVIP17 or a pharmaceutically acceptable salt thereof. Claim 28 An RNA inhibitor or a pharmaceutically acceptable salt thereof, characterized in that, in claim 27, the combination of the sense chain 5' MVIP and the antisense chain 3' MVIP is 5' MVIP01 / 3' MVIP01, 5' MVIP01 / 3' MVIP17, or 5' MVIP09 / 3' MVIP09, or the combination of the sense chain 5' MVIP and the sense chain 3' MVIP is 5' MVIP01 / 3' MVIP09 or 5' MVIP09 / 3' MVIP01. Claim 29 In claim 1, the CFB RNA inhibitor is characterized as being selected from Kylo-17-DS2911, an RNA inhibitor or a pharmaceutically acceptable salt thereof. Claim 30 In claim 1, the RNA inhibitor or its pharmaceutically acceptable salt is characterized in that the C5 RNA inhibitor is selected from Kylo-19-DS7881. Claim 31 In claim 1, the C3 RNA inhibitor is characterized as being selected from Kylo-27-DS8201 and Kylo-27-DS8141, an RNA inhibitor or a pharmaceutically acceptable salt thereof. Claim 32 An RNA inhibitor according to any one of claims 1 to 31 or a pharmaceutically acceptable salt thereof is used in the manufacture of a drug for the treatment and / or prevention of a disease associated with an elevation of the complement system level, wherein said disease comprises a lipid metabolism disorder. Claim 33 A pharmaceutical composition comprising an RNA inhibitor or other therapeutic agent for the treatment or prevention of complement system-related diseases according to any one of claims 1 to 31. Claim 34 A pharmaceutical composition characterized by comprising an RNA inhibitor according to any one of claims 1 to 31, a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable additive, wherein the formulation is an oral administration, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

Images