Method for amplifying G-quadruplexes based on the slippage of T7 RNA polymerase and its biosensing applications

KR1020260122433APending Publication Date: 2026-08-12KOREA ADVANCED INST OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
KR · KR
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-02-04
Publication Date
2026-08-12

Smart Images

  • Figure PAT00001_ABST
    Figure PAT00001_ABST
Patent Text Reader

Abstract

The present invention relates to a method for amplifying a guanine quadruplex through the slipping phenomenon of T7 RNA polymerase and a method for detecting biomaterials using the same. More specifically, the invention relates to a method for amplifying a guanine polymer (poly G) sequence that forms a guanine quadruplex (G-quadruplex) under specific conditions when T7 RNA polymerase fails to proceed with a normal transcription reaction and slips at the transcription start site of the T7 promoter, and a method for detecting a target nucleic acid using the same. According to the present invention, target nucleic acids can be detected with enhanced sensitivity compared to conventional transcription methods.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a method for amplifying a guanine quadruplex through the slipping phenomenon of T7 RNA polymerase and a method for detecting biomaterials using the same. More specifically, the invention relates to a method for amplifying a guanine polymer (poly G) sequence that forms a guanine quadruplex (G-quadruplex) under specific conditions when T7 RNA polymerase fails to proceed with a normal transcription reaction and slips at the transcription start site of the T7 promoter, and a method for detecting a target nucleic acid using the same. Background Technology

[0003] T7 RNA polymerase is an RNA polymerase derived from the T7 bacteriophage, characterized by its ability to synthesize RNA by binding with high specificity to the T7 promoter, a double-stranded DNA promoter sequence. In particular, in vitro transcription reactions based on T7 RNA polymerase are a useful tool widely used in various fields such as gene expression research, mRNA synthesis, and biosensing, as they can synthesize RNA of desired sequences with high efficiency.

[0004] Generally, T7 RNA polymerase synthesizes an RNA sequence complementary to a template strand located downstream of the T7 promoter sequence. This requires a process of designing the template strand to match the desired sequence. Utilizing these characteristics, T7 RNA polymerase-based in vitro transcription reactions have been incorporated into various isothermal amplification technologies such as recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), and strand displacement amplification (SDA). By generating a T7 promoter sequence through the amplification of target nucleic acids and ultimately inducing an in vitro transcription reaction, these methods are utilized to significantly increase the sensitivity of target nucleic acid detection. However, these methods had problems such as complex design due to the additional introduction of T7 promoter and template strand sequences into the detection probe, and frequent occurrence of non-specific signals caused by the added sequences.

[0005] Meanwhile, the slip reaction of T7 RNA polymerase is a phenomenon first reported by Martin et al. in 1988 (Martin et al., Biochemistry (, 27, 3966-3974, 1988), this relates to the phenomenon in which, under specific conditions, T7 RNA polymerase slips at the transcription start site of the T7 promoter and can synthesize a poly G sequence independently of the downstream template strand. In order to synthesize a poly G through the slip phenomenon of T7 RNA polymerase, the following two conditions must be satisfied:

[0006] 1) If three or more repeating guanine (G)-cytosine (C) base pairs are present at the transcription start site of the T7 promoter terminal; and

[0007] 2) When rGTP is the only ribonucleotide that T7 RNA polymerase can utilize for transcription.

[0008] Under the above conditions, T7 RNA polymerase fails to synthesize RNA complementary to the template strand and remains near the GC base pair at the transcription start site, and repeatedly synthesizes RNA at that site to form a polyguanine (hereinafter poly G) sequence.

[0009] Accordingly, the inventors of the present invention have strived to resolve the problems of conventional T7 RNA polymerase-based biomaterial detection technology by utilizing the slip reaction of T7 RNA polymerase. As a result, they have for the first time established conditions under which the poly G sequence generated by the slip reaction of T7 RNA polymerase can form a guanine quadruplex (G-quadruplex) structure. Furthermore, by utilizing this, they confirmed that a double-stranded T7 promoter is synthesized only in the presence of a target nucleic acid, and that the target nucleic acid can be detected and quantified through a method of amplifying the G-quadruplex by utilizing the mechanism that induces the slip reaction of T7 RNA polymerase, thereby completing the present invention. The problem to be solved

[0011] The objective of the present invention is to provide a technology capable of amplifying G-quadruplexes with high efficiency through the slip reaction of T7 RNA polymerase.

[0012] Another objective of the present invention is to provide a new method for detecting various target nucleic acids by utilizing the above-described technology. means of solving the problem

[0014] To achieve the above objective, the present invention provides a method for amplifying a guanine quadruplex (G-quadruplex) using the slip phenomenon of T7 RNA polymerase, comprising the following steps:

[0015] (a) a step of forming a T7 promoter / T7 RNA polymerase complex by attaching T7 RNA polymerase to a double-stranded T7 promoter that is not connected to a template;

[0016] (b) a step of synthesizing poly G by the T7 RNA polymerase of the complex under conditions of a ribonucleotide mixture containing rGTP; and

[0017] (c) A step of reacting the poly G synthesized in step (b) above in a buffer containing metal ions to form a guanine quadruplex (G-quadruplex).

[0018] The present invention also provides a method for amplifying a guanine quadruplex (G-quadruplex) through the slip phenomenon of T7 RNA polymerase, comprising the following steps:

[0019] (a) a step of forming a T7 promoter / T7 RNA polymerase complex by attaching T7 RNA polymerase to a double-stranded T7 promoter connected to a template strand;

[0020] (b) a step of synthesizing poly G by the T7 RNA polymerase of the complex under conditions where only rGTP can be used; and

[0021] (c) A step of reacting the poly G produced through the above reaction in a buffer containing metal ions to form a guanine quadruplex (G-quadruplex).

[0022] The present invention also provides a method for detecting a target nucleic acid using a guanine quadruplex (G-quadruplex) amplified through a slip reaction of T7 RNA polymerase, comprising the following steps:

[0023] (a) a step of generating a double-stranded T7 promoter product through a nucleic acid amplification reaction with a target nucleic acid using a primer having a sequence at the 3' end capable of binding to the target nucleic acid and a T7 promoter sequence at the 5' end;

[0024] (b) a step in which the T7 promoter of the above product binds to T7 RNA polymerase to form a T7 promoter / T7 RNA polymerase complex;

[0025] (c) a step of synthesizing poly G by the T7 RNA polymerase of the above complex; and

[0026] (d) a step of reacting the poly G synthesized in step (c) above in a buffer containing metal ions to form a guanine quadruplex (G-quadruplex); and

[0027] (e) A step of detecting a target nucleic acid by combining the generated guanine quadruplex (G-quadruplex) with a signaling substance capable of specifically binding to the guanine quadruplex. Effects of the invention

[0029] The method for amplifying a G-quadruplex based on T7 RNA polymerase according to the present invention can easily amplify a G-quadruplex and, compared to the conventional transcription method of a G-quadruplex based on a template strand, can amplify a fluorescent signal with higher efficiency through a reaction with thioflavin T, a signaling substance, thereby enabling the detection of target nucleic acids with improved sensitivity compared to the conventional transcription method. Brief explanation of the drawing

[0031] Figure 1 illustrates a method for amplifying a G-quadruplex through the slip phenomenon of T7 RNA polymerase according to the present invention. Figure 2 shows experimental results confirming the amplification reaction of G-quadruplex through the slip phenomenon of T7 RNA polymerase according to the present invention. Figure 3 shows the experimental results of analyzing the reaction product produced through the slip phenomenon of T7 RNA polymerase according to the present invention using Matrix-Assisted Laser Desorption Ionization Time-of-Flight (MALDI-TOF). Figure 4 shows the experimental results of analyzing the reaction product produced through the slip phenomenon of T7 RNA polymerase according to the present invention using Circular Dichorism (CD). Figure 5 shows the experimental results comparing the fluorescence signal amplification efficiency through interaction with thioflavin T dye of a G-quadruplex produced through the slip phenomenon of T7 RNA polymerase according to the present invention and a G-quadruplex produced through the reaction of a conventional template strand-based T7 RNA polymerase. Figure 6 illustrates a method for detecting miR-141, a model target nucleic acid, by utilizing the Exponential amplification reaction (EXPAR), a representative isothermal amplification technique, as an example of utilizing the reaction of generating a G-quadruplex through the slipping phenomenon of T7 RNA polymerase according to the present invention in a target nucleic acid detection technology. Figure 7 shows experimental results to demonstrate the validity of the above miR-141 detection method. Figure 8 shows the results of a sensitivity experiment of the miR-141 detection method. Figure 9 shows the results of the specificity experiment of the above miR-141 detection method. Specific details for implementing the invention

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by a skilled expert in the art to which this invention pertains. In general, the nomenclature used herein is well known and commonly used in the art.

[0033] In the present invention, a method for amplifying a guanine quadruplex (hereinafter referred to as "G-quadruplex") through the slip phenomenon of T7 RNA polymerase and a method for detecting a target nucleic acid utilizing the same were developed.

[0034] That is, the present invention relates to a method for forming a G-quadruplex structure through a phenomenon in which the T7 RNA polymerase slides at three GC base pair positions located at the end of the T7 promoter when the T7 RNA polymerase is unable to proceed with a normal transcription reaction.

[0035] Furthermore, the present invention relates to the development of a technology for detecting a target nucleic acid by generating an amplification product containing a T7 promoter through various nucleic acid amplification reactions initiated by a target nucleic acid, forming a T7 polymerase complex with the T7 promoter of the amplification product, and then amplifying a G-quadruplex structure through the slip phenomenon of T7 RNA polymerase.

[0036] Accordingly, in one aspect, the present invention relates to a method for amplifying a guanine quadruplex (G-quadruplex) using the slip phenomenon of T7 RNA polymerase, comprising the following steps:

[0037] (a) a step of forming a T7 promoter / T7 RNA polymerase complex by attaching T7 RNA polymerase to a double-stranded T7 promoter that is not connected to a template;

[0038] (b) a step of synthesizing poly G by the T7 RNA polymerase of the complex under conditions of a ribonucleotide mixture containing rGTP; and

[0039] (c) A step of reacting the poly G synthesized in step (b) above in a buffer containing metal ions to form a guanine quadruplex (G-quadruplex).

[0040] In the present invention, the metal ions may be potassium ions, sodium ions, calcium ions, and lead ions, but are not limited thereto.

[0041] In another aspect, the present invention relates to a method for amplifying a guanine quadruplex (G-quadruplex) through the slip phenomenon of T7 RNA polymerase, comprising the following steps:

[0042] (a) a step of forming a T7 promoter / T7 RNA polymerase complex by attaching T7 RNA polymerase to a double-stranded T7 promoter connected to a template strand;

[0043] (b) a step of synthesizing poly G by the T7 RNA polymerase of the complex under conditions where only rGTP can be used, and;

[0044] (c) A step of reacting the poly G produced through the above reaction in a buffer containing metal ions to form a guanine quadruplex (G-quadruplex).

[0045] In the present invention, the metal ions may be potassium ions, sodium ions, calcium ions, and lead ions, but are not limited thereto.

[0046] According to the present invention, in the case of a T7 promoter sequence not connected to a template strand, T7 RNA polymerase remains at three GC base pairs present at the transcription start of the T7 promoter, and when a ribonucleotide mixture (rNTP mix) containing rGTP is present, T7 RNA polymerase repeatedly recognizes the GC base pairs to generate a poly G sequence capable of forming a G-quadruplex structure. Additionally, when a template strand is connected downstream of the T7 promoter, under conditions where T7 RNA polymerase can only utilize rGTP, it fails to synthesize an RNA sequence complementary to the template strand and remains at three GC base pairs present at the transcription start of the T7 promoter, generating a poly G sequence capable of forming a G-quadruplex structure using adjacent rGTP (Fig. 1).

[0047] To verify this phenomenon, in one embodiment of the present invention, a T7 promoter without a template strand connected, a T7 promoter connected to a template strand of a random sequence, and a T7 promoter connected to a template strand of a sequence complementary to the RNA G-quadruplex were utilized to carry out transcription reactions using rNTP mix and rGTP, respectively, and the resulting products were confirmed through PAGE gel analysis.

[0048] As a result, it was confirmed that for the T7 promoter without a connected template strand, a smearing band formed at the bottom of the gel under both conditions. Meanwhile, when the template strand was present, it was confirmed that RNA complementary to the template strand was generated when the transcription reaction was carried out using an rNTP mix; however, when transcription was performed using only rGTP, a smearing band was observed, identical to the case where the template strand was absent. When the gel was stained with thioflavin T, a dye capable of specifically binding to the G-quadruplex to produce a fluorescent signal, it was observed that when a template strand with a random sequence was present, no band appeared because the random sequence complementary to the template strand was transcribed when the transcription reaction was performed using an rNTP mix, thus not reacting with thioflavin T. However, when a template strand with a sequence complementary to the RNA G-quadruplex was present, it was confirmed that a band bound to thioflavin T appeared when the RNA G-quadruplex complementary to the template strand was transcribed and the transcription reaction was performed using an rNTP mix. On the other hand, when a template strand connected to the T7 promoter was absent, or when the transcription reaction was performed using only rGTP even if a template strand was present, smearing bands identical to the previous results were formed when the gel was stained with thioflavin T (Fig. 2, (a)).

[0049] In addition, when the fluorescence signal generated by reacting the product produced under each reaction condition with thioflavin T was measured, it was confirmed that a strong fluorescence signal was generated only when the template strand was absent and when the transcription reaction was carried out via rGTP when the template strand was present.

[0050] On the other hand, when a template strand of a random sequence was present and the transcription reaction was carried out using an rNTP mix, the sequence complementary to the template strand was transcribed and did not react with thioflavin T, resulting in no fluorescence signal being generated. In the generally used method, when the transcription reaction was carried out using an rNTP mix in the presence of a template strand complementary to the RNA G-quadruplex, the G-quadruplex complementary to the template strand was transcribed and bound to thioflavin T, generating a fluorescence signal. However, it was confirmed that the intensity of the fluorescence signal was lower than that generated from the G-quadruplex produced through the present invention (Fig. 2, (b)). Through this, it was confirmed that when a transcription reaction is carried out using a ribonucleotide mixture containing rGTP from a T7 promoter not connected to a template strand, or when a transcription reaction is carried out using only rGTP when the T7 promoter is connected to a template strand, a product capable of binding to thioflavin T is produced, and the fluorescence intensity is also higher than when using a template strand complementary to the existing G-quadruplex (Fig. 2).

[0051] In another aspect of the present invention, experiments using Matrix-Assisted Laser Desorption Ionization Time-of-Flight (MALDI-TOF) were conducted to analyze the mass of the product produced through the slip reaction of the T7 RNA polymerase as described above.

[0052] As a result, peaks corresponding to the molecular weight of polyguanine of 3 mer or more were observed, confirming that poly G is produced through the slip reaction of T7 RNA polymerase (Fig. 3).

[0053] In another aspect of the present invention, based on previous experimental results indicating that poly G generated through the slip reaction of T7 RNA polymerase can amplify fluorescent signals through interaction with thioflavin T dye that specifically binds to G-quadruplex, an experiment was conducted to verify whether the reaction product can form a secondary structure such as a G-quadruplex. To this end, potassium ions (K), capable of stabilizing the G-quadruplex structure, were used to form the product generated through the slip phenomenon of T7 RNA polymerase. + After diluting in a buffer containing ), Circular Dichroism (CD) analysis was performed.

[0054] As a result, by confirming the appearance of CD peaks (negative peak at 240 nm; positive peak at 260 nm) specifically formed in parallel G-quadruplex structures, it was proven that a product capable of forming G-quadruplex structures is produced through the slip phenomenon of T7 RNA polymerase (Fig. 4).

[0055] In another aspect of the present invention, an experiment was conducted to compare the signal amplification efficiency of a G-quadruplex generated through the slip reaction of a newly invented T7 RNA polymerase with the method of transcribing RNA G-quadruplexes through a conventional template strand. To this end, the transcription product produced through the slip reaction of T7 RNA polymerase and the transcription product produced by performing transcription reactions from a T7 promoter having a template strand complementary to five previously reported types of RNA G-quadruplexes were reacted with a thioflavin T dye, and the resulting fluorescence signal was measured. As a result, it was confirmed that the reaction forming a G-quadruplex through the slip reaction of T7 RNA polymerase exhibited a much superior fluorescence signal amplification efficiency compared to the method of transcribing RNA G-quadruplexes through a conventional template strand (Fig. 5).

[0056] In another aspect, the present invention relates to a method for detecting a target nucleic acid using a guanine quadruplex (G-quadruplex) amplified through a slip reaction of T7 RNA polymerase, comprising the following steps:

[0057] (a) a step of generating a double-stranded T7 promoter product through a nucleic acid amplification reaction with a target nucleic acid using a primer having a sequence at the 3' end capable of binding to the target nucleic acid and a T7 promoter sequence at the 5' end;

[0058] (b) a step in which the T7 promoter of the above product binds to T7 RNA polymerase to form a T7 promoter / T7 RNA polymerase complex;

[0059] (c) a step of synthesizing poly G by the T7 RNA polymerase of the above complex; and

[0060] (d) a step of reacting the poly G synthesized in step (c) above in a buffer containing metal ions to form a guanine quadruplex (G-quadruplex); and

[0061] (e) A step of detecting a target nucleic acid by combining the generated guanine quadruplex (G-quadruplex) with a signaling substance capable of specifically binding to the guanine quadruplex.

[0062] In the present invention, the nucleic acid amplification reaction may be performed by methods such as polymerase chain reaction (PCR) and isothermal amplification technique, but is not limited thereto.

[0063] In the present invention, the signal material preferably includes fluorescent dyes (thioflavin T, N-methyl mesoporphyrin IX, etc.), color-changing dyes (ABTS, TMB, etc.), but is not limited thereto.

[0064] In one aspect of the present invention, as a representative example of a method for detecting a target nucleic acid by utilizing a G-quadruplex generated through the slip phenomenon of T7 RNA polymerase as described above, a technique for detecting miR-141, a model target nucleic acid, was developed by fusing the Exponential Amplification Reaction (EXPAR), a representative isothermal nucleic acid amplification technique, with the slip phenomenon of T7 RNA polymerase.

[0065] To this end, the inventors introduced two types of probes for detecting miR-141, namely an EXPAR template (ET) and a T7 promoter template (TT). The ET is a probe for initiating the EXPAR reaction, having sequences at both ends to which the same target nucleic acid can bind, and a region between the two sequences that can be recognized by a nicking enzyme. Meanwhile, the TT has a sequence at the 3' end to which the target nucleic acid can bind, and the 5' end is composed of a T7 promoter sequence.

[0066] When the target nucleic acid miR-141 is present in the sample, it binds to ET and mediates repetitive nicking and extension reactions mediated by DNA polymerase and nicking enzymes. This leads to the mass generation of target-mimicking sequences that possess the same sequence as the target miR-141. These target-mimicking sequences either bind to other ET sequences to contribute to the generation of additional target-mimicking sequences through the same reaction, or bind to the complementary portion of TT and participate in the reaction to form double-stranded T7 promoters by being extended by DNA polymerase. Through this process, a large number of double-stranded T7 promoters without attached template strands are formed; these are recognized by T7 RNA polymerase, triggering a slip reaction and consequently generating numerous G-quadruplex sequences. These sequences react with adjacent thioflavin T dyes to produce a strong fluorescent signal.

[0067] On the other hand, when the target miR-141 is absent, no reaction occurs, so the double-stranded T7 promoter is not formed, and consequently, the G-quadruplex is not formed, so no fluorescence signal is generated (Fig. 6). The inventors have demonstrated that the target miR-141 can be specifically detected through this mechanism and have identified that the generation of non-specific signals, which is raised as a major limitation of existing EXPAR technology, can be successfully suppressed (Figs. 7-9).

[0069] The present invention will be described in more detail below through examples. These examples are intended solely to explain the present invention more specifically, and it will be obvious to those skilled in the art that the scope of the present invention is not limited to these examples.

[0071] [Example]

[0073] Example 1. Establishment of reaction conditions for the generation of G-quadruplexes through the slip phenomenon of T7 RNA polymerase.

[0074] The reaction conditions for the generation of a G-quadruplex through the slip phenomenon of T7 RNA polymerase are as follows, but are not limited thereto. The reaction solution (final 20 μL) used in this invention was prepared by mixing 7.5 μL of distilled water, 4 μL of transcription buffer (5X), 1 μL of rGTP (100 mM), 2 μL of MgCl2 (10X), 2 μL of DTT (100 mM), 1 μL of enhancer solution (20X), 1 μL of double-stranded T7 promoter (1 μM), and 0.5 μL of T7 RNA polymerase (200 U / μL). The reaction solution prepared in this manner was carried out at 37 ℃ for 60 minutes.

[0075] In the process of analyzing the fluorescence signal through the interaction between the transcription product and the thioflavin T dye, 1 μL of thioflavin T (500 mM) was additionally added to the reaction solution, and the intensity of the fluorescence signal generated from thioflavin T was measured.

[0077] Example 2. Comparison of fluorescence signal amplification efficiency between the technology for generating a G-quadruplex via the slip phenomenon of T7 RNA polymerase and the technology for generating a G-quadruplex by transcribing a conventional template strand.

[0078] Using the reaction conditions mentioned in Example 1, an experiment was conducted to compare the fluorescence signal amplification efficiency of a technique for generating a G-quadruplex through the slip phenomenon of T7 RNA polymerase with that of a conventional technique for generating a G-quadruplex through a template strand complementary to the RNA G-quadruplex. To this end, the products produced by transcription reactions from a T7 promoter without a template strand, a T7 promoter with a template strand complementary to five different sequences of G-quadruplex, and a T7 promoter with a template strand of a random sequence were reacted with a thioflavin T dye, and the resulting fluorescence signals were measured. However, in the case where a template strand was present, an rNTP mix was added instead of the rGTP mentioned in the reaction conditions of Example 1 to induce the T7 RNA polymerase to synthesize a sequence complementary to the template strand.

[0079] As a result, it was confirmed that when the template strand according to the present invention is not present, the product transcribed generates a significantly higher fluorescence signal compared to the conventional transcription method (Fig. 5). Through this, it was confirmed that the fluorescence signal can be amplified with higher efficiency than the existing method through the slip phenomenon of T7 RNA polymerase.

[0080] The nucleic acid sequences used in this example are as shown in Table 1.

[0081] Sequence number Sequence information (5'→3') T7 promoter (Sense strand) 1 TAATACGACTCACTATAGGG T7 promoter (Antisense strand) 2 CCCTATAGTGAGTCGTATTA T7 promoter / random sequence template strand 3 CGAATATATACAATTAAGCTCACCTATAGTGAGTCGTATTA T7 Promoter / G-quadruplex Molding Wire 1 (rG4) 4 CCCTAACCCTAACCCTAACCCTAACCCTATAGTGAGTCGTATTA T7 Promoter / G-quadruplex Molding Strand 2 (ADAM10) 5 CCCCTACCTCTCCGCCCCTACCCGTCCCCCCCCTATAGTGAGTCGTATTA T7 Promoter / G-quadruplex Molding Strand 3 (BCL-2) 6 CCCCAGCTCCCACCCCACGGGCCCCCTCCCTATAGTGAGTCGTATTA T7 Promoter / G-quadruplex Molding Strand 4 (VEGF) 7 TCCTCCTCCCCCTCCTCCCCCTATAGTGAGTCGTATTA T7 Promoter / G-quadruplex Molding Strand 5 (Bulges-TB1) 8 ACCCACCCACCCACCACAACCCTATAGTGAGTCGTATTA

[0083] Example 3. Establishment of reaction conditions for the generation of G-quadruplex via T7 RNA polymerase slippage and the detection of target miR-141 using EXPAR

[0084] In order to provide an example of a method for detecting a target nucleic acid by utilizing the slip phenomenon of T7 RNA polymerase according to the present invention, a technology for detecting miR-141, a model target nucleic acid, was developed by fusing EXPAR, a representative isothermal nucleic acid amplification technology, with a new G-quadruplex transcription method as shown in Fig. 6.

[0085] The process for preparing a reaction solution to detect target miR-141 is as follows, but is not limited thereto. First, the EXPAR reaction solution (10 μL) consists of 5 μL of DW, 1 μL of Thermopol buffer (10X, 200 mM Tris-HCl, 100 mM (NH4)2SO4, 100 mM KCl, 2 mM MgSO4, 1% TritonX-100, pH 8.8), 1 μL of NEBuffer r3.1 (10X, 500 mM Tris-HCl, 1 M NaCl, 100 mM MgCl2, 1 mg / ml recombinant albumin, pH 7.9), 0.5 μL of dNTP mix (40 mM), 1 μL of ET (1 μM), 1 μL of TT (1 μM), 0.6 μL of Vent (exo-) DNA polymerase (0.5 U / μL), 0.4 μL of Nt.BstNBI (10 U / μL), and various concentrations of It contains miR-141. The EXPAR reaction is carried out by storing the reaction solution prepared in this way at 55 °C for 20 minutes. After the reaction is complete, 2 μL of DW, 2 μL of transcription buffer (5X), 2 μL of rNTP mix (100 mM), 1 μL of MgCl2 (10X), 1 μL of DTT (100 mM), 0.5 μL of enhancer solution (20X), 0.5 μL of T7 RNA polymerase (200 U / μL), and 1 μL of thioflavin T (500 μM) are added to the solution, and the transcription reaction is carried out at 37 °C for 30 minutes. After the reaction is complete, the fluorescence signal generated through the interaction between the generated G-quadruplex and thioflavin T is measured.

[0087] The nucleic acid sequences used in this example are as shown in Table 2.

[0088] Sequence information (5'→3') Target miR-141 (Sequence No. 9) uaacacugucugguaaagaugg ET (Sequence No. 10) CCATCTTTACCAGACAGTGTTAAACAGACTCCCATCTTTACCAGACAGTGTTA [phosphate] TT (sequence number 11) CCCTATAGTGAGTCGTATTAAAAACCATCTTTACCAGACAGTGTTA [phosphate]

[0089] (Uppercase: DNA sequence, Lowercase: RNA sequence)

[0091] Example 4. Verification of Sensitivity and Specificity of Target miR-141 Detection Technology

[0092] A sensitivity verification experiment of the present technology was conducted using the reaction conditions mentioned in Example 3. After preparing analytical samples containing miR-141 at various concentrations and performing the analytical reaction, it was confirmed that the limit of detection (LOD) of the target miR-141 of the present technology is 2.06 fM (Fig. 8).

[0093] In addition, a specificity verification experiment of the present technology was conducted using the reaction conditions used in Example 3. 1 nM of target miR-141 and non-target miRNA (one-base mismatched miR-141 (miR-141 * As a result of performing an analysis reaction on an analysis sample containing miR-21, miR-200a, miR-200b, let-7a, and let-7b, it was confirmed that a strong fluorescence signal was generated only in the analysis sample containing the target miR-141 (Fig. 9).

[0095] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.

Claims

Claim 1 A method for amplifying a guanine quadruplex (G-quadruplex) using the slip phenomenon of T7 RNA polymerase comprising the following steps: (a) forming a T7 promoter / T7 RNA polymerase complex by attaching T7 RNA polymerase to a double-stranded T7 promoter that is not connected to a template strand; (b) synthesizing poly G by the T7 RNA polymerase of the complex under conditions of a ribonucleotide mixture containing rGTP; and (c) forming a guanine quadruplex (G-quadruplex) by reacting the poly G synthesized in step (b) in a buffer containing metal ions. Claim 2 A method for amplifying a guanine quadruplex (G-quadruplex) through the slip phenomenon of T7 RNA polymerase comprising the following steps: (a) forming a T7 promoter / T7 RNA polymerase complex by binding T7 RNA polymerase to a double-stranded T7 promoter connected to a template strand; (b) synthesizing poly G by the T7 RNA polymerase of the complex under conditions where only rGTP can be used; and (c) forming a guanine quadruplex (G-quadruplex) by reacting the poly G produced through the above reaction in a buffer containing metal ions. Claim 3 A method according to claim 1 or 2, characterized in that the metal ion is selected from the group consisting of potassium ions, sodium ions, calcium ions, and lead ions. Claim 4 A method for detecting a target nucleic acid using a guanine quadruplex (G-quadruplex) amplified by a slip reaction of T7 RNA polymerase comprising the following steps: (a) generating a double-stranded T7 promoter product through a nucleic acid amplification reaction for the target nucleic acid using a primer having a sequence capable of binding to the target nucleic acid at the 3' end and a T7 promoter sequence at the 5' end; (b) forming a T7 promoter / T7 RNA polymerase complex by binding the T7 promoter of the product to the T7 RNA polymerase; (c) synthesizing poly G by the T7 RNA polymerase of the complex; and (d) forming a guanine quadruplex (G-quadruplex) by reacting the poly G synthesized in step (c) in a buffer containing metal ions. and (e) a step of detecting a target nucleic acid by combining the generated guanine quadruplex (G-quadruplex) with a signaling substance capable of specifically binding to the guanine quadruplex. Claim 5 A method for detecting a target nucleic acid according to claim 4, wherein the nucleic acid amplification reaction is a polymerase chain reaction (PCR) or an isothermal amplification technique. Claim 6 A method according to claim 4, wherein the signal material is preferably a fluorescent dye or a color-changing dye. Claim 7 A method according to claim 4, characterized in that the signaling substance is selected from the group consisting of thioflavin T, N-methyl mesoporphyrin IX, ABTS, and TMB.