A platform for lysosomal protein degradation and therapeutics using the same

KR1020260122797APending Publication Date: 2026-08-12国立がんセンター
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
KR · KR
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-03
Publication Date
2026-08-12

Smart Images

  • Figure PAT00012_ABST
    Figure PAT00012_ABST
Patent Text Reader

Abstract

The present invention relates to a novel CMATAC molecule and its therapeutic use. According to one aspect, CMATAC can effectively induce chaperone-mediated autophagy by inducing a target protein into a lysosome through a novel lysosomal binding motif within its composition, and can be used for the prevention, improvement, or treatment of cancer and / or immune diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention relates to a lysosome-based protein degradation platform and its uses. Background Technology

[0002] Cancer development is a complex process influenced by various factors beyond genetic mutations, one possible factor being the overactivation of tumor-inducing proteins due to defects in the degradation of target proteins. Chaperone-mediated autophagy is a lysosomal-selective protein degradation pathway, and its impact on tumor formation is not clearly known.

[0003] Retinoic acid receptor responder 1 (RARRES1) is a RAR agonist gene that was initially identified as a novel retinoid-inducible gene in the skin. It has been reported that RARRES1 expression is suppressed by promoter DNA hypermethylation in various cancers, including prostate, breast, lung, liver, and colorectal cancers. However, there is controversy regarding whether RARRES1 functions as a tumor suppressor or an oncogene, and research on this topic remains insufficient [Sahab ZJ, Hall MD, Me Sung Y, Dakshanamurthy S, Ji Y, Kumar D, et al. Tumor suppressor RARRES1 interacts with cytoplasmic carboxypeptidase AGBL2 to regulate the alpha-tubulin tyrosination cycle. Cancer Res. 2011;71(4):1219-28.].

[0004] Meanwhile, the inventors confirmed that after RARRES1 binds to CDK1 and PDL1, it is transported to the lysosome via LLYKQ, a sequence within the KFERQ-like motif of RARRES1, and CDK1 is degraded. Through this, the inventors established a novel platform for CMATAC (Chaperone-Mediated Autophagy TArgeting Chimaeras) technology capable of lysosome-based degradation of any protein using LLYKQ, the sequence within the KFERQ-like motif, thereby completing the present invention. The problem to be solved

[0005] One aspect provides a conjugate for target protein degradation comprising a lysosome-binding moiety and a target protein-binding moiety, wherein the lysosome-binding moiety comprises the following amino acid sequence:

[0006] X1LX3KX5

[0007] X1 is L, Q, or R, and

[0008] X3 is Y or E, and

[0009] X5 is Q or L.

[0010] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of cancer comprising the above-mentioned conjugate.

[0011] Another aspect is to provide a health functional food for the prevention or improvement of cancer comprising the above-mentioned compound.

[0012] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of immune diseases comprising the above-mentioned conjugate.

[0013] Another aspect is to provide a health functional food for the prevention or improvement of immune diseases comprising the above-mentioned conjugate.

[0014] Another aspect provides a method for preventing, treating, or improving cancer, comprising the step of administering an effective amount of the said conjugate to an individual in need thereof.

[0015] Another aspect is to provide the use of the above-mentioned combination for the prevention, treatment, or improvement of cancer.

[0016] Another aspect is to provide the use of the said conjugate for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of cancer.

[0017] Another aspect provides a method for preventing, treating, or improving an immune disease, comprising the step of administering an effective amount of the said conjugate to an individual in need thereof.

[0018] Another aspect is to provide the use of the above-mentioned conjugate for the prevention, treatment, or improvement of immune diseases.

[0019] Another aspect is to provide the use of the said conjugate for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of immune diseases. means of solving the problem

[0020] One aspect provides a conjugate for target protein degradation comprising a lysosome-binding moiety and a target protein-binding moiety, wherein the lysosome-binding moiety comprises the following amino acid sequence:

[0021] X1LX3KX5

[0022] X1 is L, Q, or R, and

[0023] X3 is Y or E, and

[0024] X5 is Q or L.

[0025] In the present invention, the lysosome-binding moiety can perform a function similar to the KFERQ motif. The "KFERQ motif" is a cytoplasmic protein region recognized by chaperones that forms a complex with the chaperone to target the substrate to the lysosome surface, specifically LAMP-2A (lysosome-associated membrane protein type 2A). When the substrate binds to the LAMP-2A monomer, the assembly of the LAMP-2A multiple begins. After unfolding, this multiple acts as an active potential complex through which the substrate can pass, and after translocation, the substrate protein can be rapidly degraded by degradation proteins within the lysosome. That is, the lysosome-binding moiety of the present invention is a moiety that performs the function of the aforementioned KFERQ, and can induce selective autophagy by delivering the substrate to LAMP-2A. More specifically, it can induce chaperone-mediated autophagy (CMA).

[0026] In one embodiment, the lysosome binding moiety may be a fragment comprising one or more amino acid sequences selected from the group consisting of LLYKQ (SEQ No. 1), LLYKL (SEQ No. 2), LLEKQ (SEQ No. 3), LLEKL (SEQ No. 4), QLYKQ (SEQ No. 5), QLYKL (SEQ No. 6), QLEKQ (SEQ No. 7), QLEKL (SEQ No. 8), RLYKQ (SEQ No. 9), RLYKL (SEQ No. 10), RLEKQ (SEQ No. 11) and RLEKL (SEQ No. 12).

[0027] In one embodiment, the lysosome binding moiety may be a fragment containing the amino acid sequence of LLYKQ (Sequence No. 1).

[0028] In one embodiment, the lysosome binding moiety may be a fragment of RARRES1 containing the amino acid sequence. More specifically, the lysosome binding moiety may be a fragment containing an amino acid corresponding to positions 160 to 164 of RARRES1.

[0029] In this specification, "corresponding amino acid" refers to an amino acid residue at a corresponding position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the amino acid residue at that position. Identifying the amino acid at the corresponding position may involve determining a specific amino acid in a sequence that references a specific sequence. In the present invention, "corresponding position" generally refers to a similar or corresponding position in the amino acid sequence of a related protein or in a reference sequence. For example, any amino acid sequence can be aligned with X1LX3KX5, and based on this, each amino acid residue of said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of X1LX3KX5. For example, through a sequence alignment algorithm known in the art, the position of the corresponding amino acid, or the position where modifications such as substitution, insertion, or deletion occur, can be identified by comparing it with a query sequence (also referred to as a "reference sequence").

[0030] In the present invention, the target protein binding moiety may include, but is not limited to, one or more of an antibody or its antigen-binding fragment that binds to a target protein, a partial domain of an interacting protein, a ligand, and the C-terminus of RARRES1, and may include any moiety capable of binding to or altering the activity of a target protein. Specifically, the target protein binding moiety may be the C-terminus of RARRES1.

[0031] In one embodiment, the C-terminus of RARRES1 may comprise an amino acid sequence represented by SEQ ID NO. 17 or 18 or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the same.

[0032] In one embodiment, the target protein may be a tumor-inducing protein. Specifically, it may be a cell cycle regulator and / or immune checkpoint protein of a tumor cell.

[0033] In one embodiment, the target protein may be CDK1, CDK4 / 6, Cyclin D1, Cyclin B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, B7-1 or B7-2.

[0034] In one embodiment, the antibody or its antigen-binding fragment may comprise one or more selected from the group consisting of a monoclonal antibody, a domain antibody (dAb), a single chain antibody (scAb), a Fab fragment, a Fab' fragment, an F(ab')2 fragment, a scFab fragment, a Fv fragment, a dsFv fragment, a single chain variable fragment (scFv), a scFv-Fc fragment, a single domain heavy chain antibody, a single domain light chain antibody, a variant antibody, a multimeric antibody, a minibody, a diabody, a bispecific antibody, and a multispecific antibody. Preferably, the antibody or its antigen-binding fragment may be a scFv-Fc fragment.

[0035] In one embodiment, the lysosome binding moiety and the target protein binding moiety may be connected directly or via a linker.

[0036] In this specification, "linker" may be a peptide linker or a non-peptide linker (e.g., a linker containing ethylene glycol repeating units).

[0037] The term "peptide linker" refers to a linker containing one or more amino acids, and may, for example, contain from one to 1,000 amino acids, but is not particularly limited thereto. In order to connect the lysosome-binding moiety and the target protein-binding moiety in the present invention, various known peptide linkers may be used in the present invention, specifically including [GS]n linkers, [GGGS]n linkers, and [GGGGGS]n linkers, etc., wherein n may be a natural number greater than or equal to 1. However, the invention is not limited to the above examples.

[0038] The above linker may be a short oligopeptide or polypeptide linker, and is not particularly limited in its length or type, and any linker known in the art may be applied without limitation.

[0039] The above linker may be a flexible linker. For example, it may be a peptide linker composed of glycine, serine, alanine, or proline, and more specifically, it may be (GS)n, (GGGGS)n, (GGGGA)n, (GGGGP)n, (GGGA)n, (GGS)n, (GSGGS)n, or (GGGS)n, etc. The copy number "n" is any natural number and can be adjusted considering the optimization of the linker.

[0040] The term "non-peptide linker" includes a biocompatible polymer comprising two or more repeating units. The repeating units are connected to each other through any covalent bond other than a peptide bond. In the present invention, the non-peptide linker includes a reactive group at a terminal end and can form a complex through a reaction with other components constituting the complex. The non-peptide linker may be a component forming a moiety of the complex of the present invention.

[0041] The non-peptide linker that can be used in the present invention may be used without limitation as long as it is a non-peptide polymer that is resistant to in vivo proteolytic enzymes. In the present invention, the non-peptide linker may be used in combination with the non-peptide polymer. Specifically, the non-peptide linker may be selected from the group consisting of fatty acids, saccharides, high molecular weight polymers, low molecular weight compounds, nucleotides, and combinations thereof.

[0042] In one embodiment, the non-peptide linker may be selected from the group consisting of polyethylene glycol, polypropylene glycol, copolymers of ethylene glycol and propylene glycol, polyoxyethylated polyols, polyvinyl alcohol, polysaccharides (e.g., dextran, etc.), polyvinyl ethyl ether, biodegradable polymers such as PLA (polylactic acid) and PLGA (polylactic-glycolic acid), lipid polymers, chitins, hyaluronic acid, oligonucleotides, and combinations thereof, but is not limited thereto.

[0044] Another aspect provides a pharmaceutical composition for the prevention or treatment of cancer comprising the above-mentioned conjugate.

[0045] Another aspect provides a pharmaceutical composition for the prevention or treatment of immune diseases comprising the above-mentioned conjugate.

[0046] In this specification, "prevention" refers to any act of suppressing or delaying a disease by administering the composition of the present invention to an individual. For preventive benefit, the composition may be administered to a subject at risk of developing a specific disease, condition, or symptom, or to a subject reporting one or more physiological symptoms of a disease, even if the disease, condition, or symptom has not yet appeared.

[0047] In this specification, "treat" refers to any act of administering the composition of the present invention to an individual to improve or benefit from the symptoms of a disease. As used herein, "treat," "relief," or "improvement" may be used interchangeably. A therapeutic benefit refers to any therapeutically significant improvement of one or more diseases, conditions, or symptoms under treatment, or an effect thereon.

[0048] The cancer of the present invention may be a cancer that expresses a target antigen recognized by the conjugate of the present invention. Specifically, the cancer may be a cancer that expresses CDK1 and / or PD-L1. That is, the composition may be a composition for the prevention or treatment of cancer, solid tumors, and / or hematological malignancies that express CDK1 and / or PD-L1.

[0049] The above types of cancer are not particularly limited and include solid tumors and blood cancers. Specifically, the cancer may include one or more selected from the group consisting of breast cancer, lung cancer, skin cancer, kidney cancer, colorectal cancer, head and neck cancer, stomach cancer, colon cancer, prostate cancer, bladder cancer, rectal cancer, thyroid cancer, liver cancer, cervical cancer, melanoma, rectal cancer, anal cancer, urethral cancer, ovarian cancer, esophageal cancer, and pancreatic cancer.

[0050] The pharmaceutical composition of the present invention may be in any form suitable for the intended method of administration. In the pharmaceutical composition of the present invention, "administration" means introducing a specific substance to a patient by any appropriate method, and the route of administration of said pharmaceutical composition may be administered through any general route as long as the drug can reach the target tissue. Examples may include, but are not limited to, ocular local administration (e.g., periocular (e.g., subtenon's), subconjunctival, intraocular, intravitreal, anterior chamber, subretinal, supracorbital, and retroocular administration), intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, local administration, intranasal administration, intrapulmonary administration, and rectal administration. Additionally, the pharmaceutical composition of the present invention may be administered by any device capable of delivering the active ingredient to target cells. It is preferable that the route of administration of the pharmaceutical composition of the present invention be determined according to the type of disease to which it is applied.

[0051] The pharmaceutical composition of the present invention may be used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, or parenteral formulations such as suspensions, emulsions, lyophilized preparations, topical preparations, suppositories, sterile injectable solutions, and implantable preparations, which are formulated according to conventional methods. In addition to the active ingredient, the pharmaceutical composition may further include pharmaceutically acceptable excipients that can be used for formulation.

[0052] The above excipients comprise a carrier, a vehicle, a diluent, a solvent, e.g., a monohydric alcohol, e.g., ethanol, isopropanol, and a polyhydric alcohol, e.g., glycerol, and an edible oil, e.g., soybean oil, coconut oil, olive oil, safflower oil, cottonseed oil, an oily ester, e.g., ethyl oleate, isopropyl myristate; It may include one or more selected from the group consisting of binders, adjuvants, solubilizers, thickeners, stabilizers, disintegrants, lubricants, buffers, emulsifiers, wetting agents, suspending agents, sweeteners, coloring agents, flavoring agents, coating agents, preservatives, antioxidants, processing agents, drug delivery modifiers and enhancers, such as calcium phosphate, magnesium state, talc, monosaccharides, disaccharides, starch, gelatin, cellulose, methylcellulose, sodium carboxymethyl cellulose, dextrose, hydroxypropyl-β-cyclodextrin, polyvinylpyrrolidone, low-melting point waxes, ion exchange resins, etc., but is not limited thereto.

[0053] The above carrier is one that is commonly used in formulations and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0054] The pharmaceutical composition of the present invention being formulated in the form of an oral administration formulation may be, for example, a tablet, a pill, a hard or soft capsule, a liquid, a suspension, an emulsifier, a syrup, a granule, an elixir, etc. Depending on the conventional composition of each formulation, such oral administration formulations may include, in addition to the active ingredient, a pharmaceutically acceptable carrier such as a diluent such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine, or a lubricant such as silica, talc, stearic acid and its magnesium or calcium salt and / or polyethylene glycol.

[0055] When the above oral formulation is a tablet, it may include a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethyl cellulose and / or polyvinylpyrrolidine, and in some cases, it may include a disintegrant such as starch, agar, alginic acid or its sodium salt, a boiling mixture and / or an absorbent, a coloring agent, a flavoring agent or a sweetener, etc.

[0056] The fact that the pharmaceutical composition of the present invention is formulated in the form of a parenteral administration formulation may mean that it is administered by a method of administration such as subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. In this case, in order to formulate the pharmaceutical composition into the parenteral administration formulation, the active ingredient is mixed in water with a stabilizer or a buffer to prepare a solution or suspension, and such a solution or suspension may be prepared in a unit dosage form in an ampoule or vial.

[0057] In addition, the above pharmaceutical composition may be sterilized or further include adjuvants such as preservatives, stabilizers, hydrating agents or emulsification promoters, salts and / or buffers for osmotic pressure regulation, and further include other therapeutically useful substances, and may be formulated according to conventional methods of mixing, granulation, or coating.

[0058] The content of the binder in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc. For example, it may be 0.0001 to 99.9% by weight or 0.001 to 50% by weight based on the total weight of the composition, but is not limited thereto. The above content ratio is a value based on the dry weight after removing the solvent.

[0059] The composition according to the present invention may further include a pharmaceutically acceptable carrier. For oral administration, binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, colorants, flavors, etc. may be used; for injectables, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. may be mixed and used; and for topical administration, bases, excipients, lubricants, preservatives, etc. may be used. The formulations of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with the pharmaceutically acceptable carriers described above. For example, for oral administration, it may be prepared in the form of tablets, troches, capsules, ellipsis, suspensions, syrups, wafers, etc., and for injectables, it may be prepared in the form of unit dosing ampoules or multi-dose formulations. In addition, the anticancer composition may typically include a surfactant that facilitates movement across a membrane. These surfactants include those derived from steroids, cationic lipids such as N-[1-(2,3-dioleoyl)propyl-N,N,N-trimethylammonium chloride (DOTMA), or various compounds such as cholesterol hemisuccinate and phosphatidyl glycerol.

[0060] The above composition may be administered in combination with additional anticancer agents. Examples of additional anticancer agents may include alkylating agents, antimetabolites, spindle inhibitors, plant alkaloids, cytotoxic / antitumor antibiotics, topoisomerase inhibitors, antibodies, photosensitizers, and kinase inhibitors. Examples of the above anticancer agents may include compounds used in targeted therapy and conventional chemotherapy. In addition, examples of the above antibodies include alemtuzumab, apolizumab, aselizumab, atlizumab, bapineuzumab, bevacizumab, vivatuzumab mertansine, cantuzumab mertansine, cedelizumab, sertolizumab pegol, sidfucituzumab, sidtuzumab, daclizumab, eculizumab, epalizumab, efratuzumab, erlizumab, felbizumab, pontolizumab, gemtuzumab ozogamicin, inotuzumab ozogamicin, ipilimumab, rabetuzumab, lintuzumab, matuzumab, mepolizumab, motabizumab, motobizumab, natalizumab, nimotuzumab, nolovizumab, numavizumab, ocrelizumab, omalizumab, palivizumab, pascolizumab, Peckfucituzumab, pectuzumab, pertuzumab, pexelizumab, ralibizumab, ranibizumab, reslibizumab, reslibizumab, resaibizumab, lovelizumab, luplizumab, cibrotuzumab, ciplizumab, sontuzumab, tacatuzumab, tetraxetane, tadocizumab, talizumab, tepivazumab, tocilizumab, toralizumab, trastuzumab, tucotuzumab, selmoleukin, tucucituzumab, umavizumab, urtoxazumab, and bicilizumab may be included.

[0061] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. "Pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention, and may be adjusted according to factors including the type of disease of the patient, the severity of the disease, the type of active ingredient administered, the type of formulation, the age, gender, weight, health condition, diet, sensitivity, the time and method of administration of the drug, the combination of the composition or drugs used concurrently, and other factors well known in the medical field.

[0062] The pharmaceutical composition of the present invention can prevent or treat a disease in an individual by including the step of administering to the individual an amount effective for preventing or treating the disease.

[0063] The above individual may be a mammal. The above mammal may be a human, dog, cat, cow, goat, or pig.

[0064] Another aspect provides a method for preventing, treating, or improving cancer, comprising the step of administering an effective amount of the said conjugate to an individual in need thereof.

[0065] Another aspect provides the use of the above combination for the prevention, treatment, or improvement of cancer.

[0066] Another aspect provides the use of the above conjugate for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of cancer.

[0067] Another aspect provides a method for preventing, treating, or improving an immune disease, comprising the step of administering an effective amount of the said conjugate to an individual in need thereof.

[0068] Another aspect provides the use of the above-mentioned combination for the prevention, treatment, or improvement of immune diseases.

[0069] Another aspect provides the use of the above conjugate for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of immune diseases.

[0071] Another aspect provides a health functional food for the prevention or improvement of cancer comprising the above-mentioned compound.

[0072] Another aspect provides a health functional food for the prevention or improvement of immune diseases comprising the above-mentioned conjugate.

[0073] In this specification, "health functional food" refers to a food manufactured or processed by methods such as extraction, concentration, purification, or mixing of specific ingredients contained in food ingredients, or using specific ingredients as raw materials for the purpose of health supplementation, and refers to a food designed and processed to fully exert biological regulatory functions on the body, such as biological defense, regulation of biological rhythms, and prevention and recovery from disease, through said ingredients.

[0074] There are no specific restrictions on the types of the above foods. Examples of the above foods include formulations selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infusions, gum, candies, and health drinks, and include all health foods in the conventional sense.

[0075] The above-mentioned health functional food may include food-grade acceptable food additives and may include a suitable carrier commonly used in the manufacture of health functional foods.

[0076] The terms and methods, etc. described for the above inventions apply equally among the inventions.

[0078] The present invention is capable of various modifications and may have various embodiments. Specific embodiments are illustrated in the drawings and described in detail in the detailed description below. However, this is not intended to limit the present invention to specific embodiments, and it should be understood that it includes all modifications, equivalents, and substitutions that fall within the spirit and scope of the present invention. In describing the present invention, detailed descriptions of related prior art are omitted if it is determined that such detailed descriptions may obscure the essence of the present invention. Effects of the invention

[0079] CMATAC, depending on the mode, can effectively induce chaperone-mediated autophagy by directing target proteins into lysosomes through novel motifs within its composition. Accordingly, it can be used for the prevention, improvement, or treatment of cancer and / or immune diseases. Brief explanation of the drawing

[0080] Figure 1 is a summary diagram of the types of CDK1 and its substrate proteins identified in anti-RARRES1 immunoprecipitation proteins and the cellular processes regulated by them. Figure 2 is a graph showing the MST measurement results for the affinity of purified CDK1 protein to GFP-RARRES1 and GFP alone. Figure 3 is a graph (left) quantifying CDK1 mRNA expression and protein levels in RARRES1-transfected HEK293 cells (top) and MEE cells (bottom), and a Western blotting image (right) of CDK1 in the lysate of said cells. Figure 4 is an image showing the results of immunoblot analysis of CDK1 after exogenous introduction of RARRES1 and Western blot analysis after CHX treatment. Figure 5 is an image showing the results of Western blot analysis of the indicated protein after treatment with a protein degradation pathway inhibitor. Figure 6 is a table showing the types of proteins involved in various chaperone-mediated autophagy, including LAMP1, in anti-RARRES1 immunoprecipitates. Figure 7 is an image showing the results of immunoblot analysis of CDK1 and lysosomal proteins in anti-RARRES1 immunoprecipitates. Figure 8 is a confocal image and a graph showing fluorescence intensity indicating the co-localization of CDK1 and LAMP1 in late cell division. Figure 9 is an image showing the results of an immunoblot analysis of CDK1 protein in HEK293 cells with or without siRNA targeting VPS4 or LAMP2A. Figure 10 shows the amino acid sequence similarity between mammalians of the KFERQ-like motif present in RARRES1 and the results of CDK1 immunoblot analysis in KFERQ-like motif mutants. Figure 11 shows a confocal image of PLA and a quantification result of PLA puncta. Figure 12 is an image showing the results of immunoblot analysis of HEK293 cell lysates co-transfected with CDK1 and RARRES1 WT or Y162A mutations. Figure 13 is an image showing the results of immunoblot analysis of binding of RARRES1 full length (FL) or truncated mutants with CDK1. Figure 14 is an image showing the domain structure of the RARRES1 protein and the amino acid sequence similarity of the carboxyl group terminus between mammals. Figure 15 is an image showing the modeling structure of CDK1 complexed with a RARRES1-derived peptide. Figure 16 is a graph showing the fluorescence intensity of the H2B isolase biosensor on the chromosomes of Rarres1+ / +(WT, n=7) and Rarres1- / -(KO, n=14) MEE cells. Figure 17 is a graph showing the duration / time of cell cycle phases calculated by the fluorescence intensity of fluorescent ubiquitination-based cell cycle markers in Rarres1+ / +(WT, n=32) and Rarres1- / -(KO, n=51) MEE cells. Figure 18 is an image of the immunoblot analysis of cyclins D, E, and B using agarose-conjugated anti-CDK1 antibodies in Rarres1+ / +(WT) and Rarres1- / -(KO) MEE cells. Figure 19 is a graph showing the growth of Rarres1+ / +(WT) and Rarres1- / -(KO) MEE cells and the growth when human RARRES1 is introduced into KO MEE cells. Figure 20 is a graph showing the number and size of spheroidized cells and the quantification thereof when human RARRES1 was added to Rarres1+ / +(WT) and Rarres1- / -(KO) MEE cells or not. Figure 21 is a schematic diagram of the Rarres1- / - knockout mouse generation strategy. Figure 22 is a graph showing the genomic (top) and mRNA (bottom) levels of Rarres1 and its surrounding genes (Gfm1 and Mfsd1) measured in the lungs of Rarres1- / - embryos. Figure 23 is the Kaplan-Meier overall survival curve of Rarres1+ / +(WT, n=50) and Rarres1- / -(KO, n=53) mice. Figure 24 shows the incidence rate graph and tumor images of various tumors in Rarres1+ / +(WT, n=51) and Rarres1- / -(KO, n=59) mice. Figure 25 is an image monitoring FDG uptake in Rarres1+ / +(WT, n=6) and Rarres1- / -(KO, n=6) mice. Figure 26 shows micrographs and quantification results of NKX2.1+CDK1- or NKX2.1+CDK1+ cells in WT and Rarres1- / - mouse (KO) lung tissues. Figure 27 shows the results of immunoblot analysis of lysosomal proteins and cell cycle-related proteins in WT and Rarres1- / - mouse (KO) lung tissues. Figure 28 is a scatter plot showing the correlation between CDK1 protein abundance and RARRES1 mRNA expression. Figure 29 is a heatmap of cell-specific gene expression in lung tissues of WT, Rarres1- / - mice (KO) and human TCGA LUAD cohorts. Figure 30 shows microscopic images and quantitative results of IHC staining for RARRES1 in human lung tissue. Figure 31 shows the results of PD-L1 immunoblot analysis after RARRES1 overexpression and interferon gamma (IFN-γ) treatment following its overexpression. Figure 32 shows the results of PD-L1 immunoblot analysis according to glucose concentration in cell culture medium after overexpression of human RARRES1 normal type (WT) and mutant Y162A in human colorectal cancer cell lines. Figure 33 is a graph showing the volume of colon cancer cells of mice overexpressing human RARRES1 in Rarres1 - / -(KO) mice. Figure 34 is the result of an immunoblot analysis confirming the binding of RARRES1 and Cyclin B1 in a human-derived cell line (HEK293). Figure 35 is a confocal image confirming endogenous Cyclin B1 levels upon RARRES1-GFP overexpression in a human-derived cell line (HEK293). Figure 36 is the result of an immunoblot analysis confirming the binding of RARRES1 full length (FL) or truncated mutants with Cyclin B1 in a human-derived cell line (HEK293). Figure 37 is the result of an immunoblot analysis confirming Cyclin B1 protein levels after concentration-dependent overexpression of RARRES1 in a human-derived cell line (HEK293). Figure 38 is the result of an immunoblot analysis confirming the expression of endogenous Cyclin B1 protein in human-derived cell lines (HEK293) with and without RARRES1 upon treatment with a lysosomal degradation inhibitor. FIG. 39 is a design for fabricating a RARRES1 C-terminal defect (RA1 △C) and its SOS or BAK1 fusion. Figure 40 is the result of an immunoblot analysis confirming the induction of target protein degradation when an SOS or BAK1 binding sequence was fused to a RARRES1 C-terminal deletion (RA1 ΔC). Specific details for implementing the invention

[0081] The following examples will be explained in more detail. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0083] Reference Example

[0085] Reference Example 1. Cell Culture

[0086] HEK293 cells were purchased from ATCC and cultured in DMEM containing 10% (v / v) fetal bovine serum (FBS), 10,000 units / ml penicillin, 10,000 μg / ml streptomycin, and sodium pyruvate.

[0087] Mouse embryonic fibroblasts (MEFs) and mouse embryonic epithelial cells (MEEs) were isolated from 13.5-day-old embryos. MEFs were cultured in DMEM containing 10% (v / v) FBS, 2 mM L-glutamine, 0.1 mM MEM non-essential amino acids, 55 μM beta-mercaptoethanol, 100 units / ml penicillin, and 100 μg / ml streptomycin. MEE was cultured in DMEM / F-12 medium containing 1% (v / v) FBS, 1 mg insulin, 1 mg hydrocortisone, 12.5 μg EGF, 10 mg ascorbic acid, 10 mg transferrin, 14.1 mg phosphoethanolamine, 2.6 ng Na selenite, 1 μg cholera toxin, 6.5 μg triiodothyronine, 35 mg bovine pituitary gland extract, 6 μl / ml ethanolamine, 50 units / ml penicillin, and 50 μg / ml streptomycin. Cells were cultured at 37°C in a 5% CO2 humidified chamber.

[0088] HCT116, a human colorectal cancer cell line, was cultured in DMEM (Dulbecco's Modified Eagle's Media) medium (Invitrogen, Carlsbad, USA) supplemented with 10% FBS and 1% penicillin-streptomycin (P / S) under 5% CO2 atmosphere and 37°C conditions.

[0089] MC38, a mouse colorectal cancer cell line, was cultured in DMEM (Dulbecco's Modified Eagle's Media) medium (Invitrogen, Carlsbad, USA) supplemented with 10% FBS and 1% penicillin-streptomycin (P / S) under 5% CO2 atmosphere and 37°C conditions.

[0091] Reference Example 2. Construction of Plasmid

[0092] For gene delivery using plasmid DNA, Lipofectamine LTX / PLUS (Invitrogen), Lipofectamine 3000 (Invitrogen), or polyethyleneimine (PEI) was used according to the manufacturer's instructions.

[0093] Specifically, human RARRES1 (GenBank: NM_206963) cDNA was subcloned and inserted into the pcDNA3.1 expression vector (Invitrogen) using the BamHI / EcoRV restriction site. RARRES1 cDNA amplified by PCR was downcloned into pcDNA3.1 using the BamHI / EcoRV restriction site to generate RARRES1 cleavages (1-269aa, 43-269aa, 51-294aa, RARRES1ΔC, RARRES1ΔN,C, and RARRES1ΔN, respectively), and the sequence information is shown in Table 2. The RARRES1 fusion plasmid was constructed by downcloning WT RARRES1 cDNA amplified by PCR into the SacI / BamHI restriction site using the pAcGFP-C1 vector (Clontech). The GST-RARRES1:269-294aa construct was generated by subcloning PCR-amplified RARRES1:269-294aa cDNA into the EcoRI / BamHI site of the pEBG-2T-GST vector. Mutagenic products were generated using QuickChange or Q5 site-directed mutagenesis kits according to the manufacturer's instructions, and included the following:

[0094] - RARRES1-Y162A( 160 LLAKQ 164 ) and 3KA(147-153 mut)( 147 RLIEAAA 153 ) Mutation

[0095] - GST-RARRES1:269-294aa and Thr273 non-phosphorylationable mutation (T273A)

[0096] The primers used for mutagenesis are shown in Table 1 below. All sequences were verified via automated DNA sequencing. For virus generation, H2B isolase was subcloned and inserted into a pMSCVpuro retroviral vector containing multiple replication sites, which was created using the BglII / EcoRI restriction site as a modified version of the pMSCVpuro vector (Addgene).

[0097] Mutation Sequence (5' → 3') Tm (°C) RARRES1-Y162A sense caagaggattacctgcttgccaagcaaatgaagcaac(sequence number 21) 60 antisense gttgcttcatttgcttggcaagcaggtaatcctcttg(sequence number 22) RARRES1-147-153mut sense ggcaagacaacaagaggattacctg(sequence number 23) 62 antisense gctgcctcgatgagccgtgtaca(sequence number 24)

[0098] Ranking name amino acids DNA RARRES1 1-269 (RARRES1△C) Sequence No. 14 Sequence number 48 RARRES1 43-269 (RARRES1△N,C) Sequence number 15 Sequence number 49 RARRES1 51-294 (RARRES1△N) Sequence number 16 Sequence number 50 RARRES1 269-294 Sequence number 17 Sequence number 51 RARRES1 270-284 Sequence No. 18 Sequence No. 52

[0100] Reference Example 3. Immunoprecipitation ( immunoprecipitation; IP)

[0101] Cells were lysed in TAP buffer (25 mM Tris, 140 mM NaCl, 0.5% NP-40, 10 mM NaF, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM EDTA, 1 mM Na3VO4, 1 mM β-glycerophosphate, 10% glycerol and 0.2% protease inhibitor cocktail and phosphatase inhibitor; pH 7.4) and then sonicated (Cosmo Bio, Bioruptor). The protein concentration of the lysate was quantified using a BCA protein assay kit (Pierce). Whole cell lysates were incubated with a primary antibody against Ni-NTA (QIAGEN) or RARRES1 (R&D Systems, AF4255), normal goat IgG (Santa Cruz, SC-2028), agarose-conjugated CDK1 (Santa Cruz, SC-54 AC), or normal mouse IgG-agarose (Santa Cruz, SC-2343) at 4°C overnight or for 4 hours, then the lysates were washed with TAP buffer, suspended in 2x Laemmli buffer (4% sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mercaptoethanol, 0.2 M DTT, 0.004% bromophenol blue, 0.125 M Tris-HCl; pH 6.8), boiled for 5 minutes, and then subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE).

[0103] Reference Example 4. Liquid chromatography-mass spectrometry (LC-MS)

[0104] RARRES1-transfected HEK293 cells were immunoprecipitated with IgG (Santa Cruz, SC-2028) or anti-RARRES1 antibody (R&D Systems, AF4255) and then analyzed by LC-MS. Proteins from samples excised from Coomassie-stained polyacrylamide gel slices were reduced with 10 mM dithiothreitol (DTT), alkylated with iodoacetamide, and then digested with trypsin at 37°C for 12 hours. Digested peptides were desalted using C18 spin columns (Thermo Fisher Scientific) and analyzed using a Q Exactive hybrid quadrupole-orbitrap mass spectrometer (Thermo Fisher Scientific) connected to an UltiMate 3000 RSLCnano system (Thermo Fisher Scientific). Peptides were loaded onto a trap column (100 μm x 2 cm) filled with Acclaim PepMap100 C18 resin, separated in an analysis column (EASY-Spray column, 75 μm x 50 cm; Thermo Fisher Scientific), and then ionized with a nano ESI source. The Q Exactive Orbitrap mass spectrometer operated in the top 10 data-dependent modes. The entire MS scan was collected in the 300–2,000 m / z range with a resolution of 70,000 (at m / z 200). The Automatic Gain Control (AGC) target value was 1.00E+06. The 10 most intense peaks with charge states ≥2 were fragmented in a high-energy collision dissociation (HCD) collision cell with a normalized collision energy of 25, and the tandem mass spectra were collected at m / z 200 with a resolution of 17,500 using an Orbitrap mass spectrometer. Database searches for all raw data files were performed using Proteome Discoverer 2.2 software (Thermo Fisher Scientific).SEQUEST-HT was used to search the SwissProt Homo sapiens database. Additionally, a search was performed on the corresponding inversion database to evaluate the False Discovery Rate (FDR) of peptide identification. The database search parameters were as follows: precursor ion mass tolerance, 20 ppm; fragment ion mass tolerance, 0.08 Da; fixed variant, carbamidomethyl cysteine; variable variant, methionine oxidation. Results were filtered for high peptide confidence, with an FDR of less than 1% at the peptide level.

[0106] Reference Example 5. Imaging of living cells

[0107] Cell division dynamics were investigated in HEK293 cells infected with pAcGFP-C1 (GFP-Ctrl) or pAcGFP-C1-RARRES1 (GFP-RARRES1). Images were captured every 10 minutes for 2 days (Carl Zeiss), and phase-contrast images were used to determine the phases of cell division. To measure anaphase activation, live cell imaging was performed after infecting Rarres1 WT and Rarres1- / - MEE cells with the H2B anaphase sensor retrovirus (40 μg / well, Lab-Tek II chamber (Nunc)). Images were acquired at 5-minute intervals using an LSM780 microscope with a 20x objective lens and analyzed quantitatively using ZEN blue 3.1 software. Fluorescence density within the nuclear region was measured in mCherry and eGFP images using a freehand tool, and the mCherry / eGFP ratio was calculated before and after sister chromatin separation (anaphase onset, time 0). After the onset of metaphase, the mCherry / eGFP ratio was calculated using the average fluorescence of the two daughter cells. To measure cell cycle duration, Rarres1+ / +;Fucci2aKI / + and Rarres1- / -;Fucci2aKI / + MEE cells were seeded in a glass-bottom Lab-Tek II chamber, and images (2x2 tile scan and Z-stack) were acquired every 20 minutes using a 20x objective lens with an LSM880 microscope. Nuclear fluorescence intensity, measured using a freeform tool, was recorded in the mCherry and Venus images. The G1 time point was defined as the time from immediately after cell division until just before the appearance of yellow fluorescence, the G1 / S phase was indicated by the appearance of yellow fluorescence, and the S / G2 / M time point was defined as the time from immediately after the transition of yellow fluorescence to green fluorescence until the time of the second cell division.

[0109] Reference Example 6. Immunoblotting

[0110] Cells were lysed in lysis buffer (20 mM Tris, 5 mM EDTA, 10 mM Na4P2O7, 100 mM NaF, 1% NP-40, 1 mM PMSF, 0.2% protease inhibitor cocktail and phosphatase inhibitor; pH 7.4) on ice for at least 30 minutes. The protein concentration of the cell lysate was quantified using a BCA protein assay kit. Subsequently, the protein lysate was resuspended in loading buffer, boiled for 5 minutes, and then transferred to a nitrocellulose membrane (GE Healthcare) via SDS-PAGE. The membrane was blocked in triple-buffered saline containing Tween 20 (TBS-T) and 5% skim milk at room temperature for 20 to 30 minutes, followed by overnight incubation with the primary antibody at 4°C. Afterward, the membrane was washed three times with TBST and incubated with secondary antibodies at room temperature for 2 hours. Protein expression was measured by chemiluminescence using SuperSignal West Pico Chemiluminescent Substrate (Pierce). The major antibodies used are shown in Table 3. As secondary antibodies, HRP (horse radish peroxidase) conjugated anti-mouse IgG (Jackson ImmunoResearch, 315-035-045), anti-rabbit IgG (Jackson ImmunoResearch, 111-035-144), anti-goat IgG (Invitrogen, 611620), and anti-rat IgG (Jackson ImmunoResearch, 112-035-175) were used.

[0111] antibodies Cat no. Company RARRES1 AF4255 R&D Systems CDK1 SC-54 Santa Cruz CDK1 ab131450 Abcam Beta-actin A5441 Sigma-Aldrich Alpha-tubulin T6199 Sigma-Aldrich p62 610832 BD Cathepsin D (CTSD) ab6313 Abcam CHIP #2080 Cell Signaling Technology HSPA1B #4873 Cell Signaling Technology HSPA1B MA3014 Invitrogen LAMP1 ab24170 Abcam LAMP2A ab18528 Abcam VPS4 SC-133122 Santa Cruz Cyclin E SC-481 Santa Cruz Cyclin E SC-248 Santa Cruz Cyclin D1 SC-246 Santa Cruz Cyclin B1 #4135 Cell Signaling Technology PD-L1 #13684 Cell Signaling Technology PD-L1 MAB90781 R&D Systems AMPKα #2532 Cell Signaling Technology Phospho-AMPKα(Thr172) #2535 Cell Signaling Technology E-cadherin #3195 Cell Signaling Technology GST LF-PA0189 Abfrontier

[0112] Reference Example 7. Microscale Thermophoresis (MST) Analysis

[0113] MST analysis was performed to measure the binding affinity of CDK1 to GFP-tagged RARRES1 or free GFP. For the purified full-length CDK1 protein, CDK1 was cloned and inserted into a modified pFastBac vector with an N-terminal His10-tag, and expressed in Sf9 insect cells (Life Technologies) using the pFastBac baculovirus system (Thermo Fisher Scientific). Cells were lysed in a buffer containing 20 mM Tris-HCl (pH 7.9), 500 mM sodium chloride, 50 mM imidazole, 5% glycerol, 5 mM β-mercaptoethanol, 1 mM PMSF, and 0.5% NP-40 using a microscale fluidizer (Micronox) and then centrifuged (25,400 × g). CDK1 protein was purified by a two-step chromatography method using a HiTrap Chelating HP column (GE Healthcare) and a HiLoad 16 / 60 Superdex 200 column (GE Healthcare) equilibrated with Buffer A (20 mM sodium phosphate (pH 6.8), 200 mM NaCl, 5% glycerol, and 2 mM Tris(2-carboxyethyl phosphine). HEK293 cells were infected with pAcGFP-C1 (control) or pAcGFP-C1-RARRES1, and the cell lysates were diluted with lysates from uninfected HEK293 cells to achieve final concentrations that are significantly higher than the detection limit of the Monolith NT.115 instrument (NanoTemper Technologies) and where the fluorescence signals of the GFP-tagged proteins are similar. Lysates from untransformed HEK293 cells were used to evaluate background fluorescence because no background fluorescence was detected even in the undiluted lysates. CDK1 (192 μM) was added to 10 μl of Buffer A. Diluted 1:1, a similar 2-fold dilution series of 16 samples was prepared. 10 microliters of each cell lysate was 192 μM ~ 5.10 μl of CDK1 protein was mixed with various concentrations of 86 nM and incubated at room temperature for 10 minutes prior to MST analysis. GFP-RARRES1-CDK1 and GFP-CDK1 solutions were loaded into NT.115 standard-coated capillaries (NanoTemper Technologies), and MST was performed at parameters of 25°C, 40% LED excitation power, and 60% MST power. Fluorescence signals were monitored for 20 seconds during thermophoresis, and changes in fluorescence were analyzed via thermophoresis with a temperature jump (T-jump). K. D The standard joint curve was calculated by fitting the mean of three independent dilution series (n = 3; mean ± sd).

[0115] Reference Example 8. RT-PCR and Real-time PCR

[0116] Total RNA was extracted from cells using the TRIzol reagent, and 1 μg of it was reverse transcribed into cDNA using Superscript® III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Real-time PCR was performed using LightCycler 480 SYBR Green I Master Mix (Roche, 04707516001) and a LightCycler 96 instrument (Roche), and relative gene expression was evaluated using LightCycler 96 SW1.1 software (Roche). RT-PCR (Table 4), real-time PCR (Table 5), and genotyping PCR (Table 6) were performed using the primers listed in the table below.

[0117] gene Sequence (5' → 3') Tm (°C) Product size (bp) Rarres1 sense gcgctgcacttcttcaactt(sequence number 29) 60 506 antisense agaacagtgaagtcaaagtcgatg(sequence number 30) Rarres1 sense gcgctgcacttcttcaactt(sequence number 29) 60 653 antisense gccatagctgatgcttccat(sequence number 31) Actin sense acggccaggtcatcactattg(sequence number 32) 60 87 antisense cacaggattccatacccaagaag(sequence number 33) Gapdh sense tgcaccaccaactgctta(sequence number 34) 60 177 antisense ggatgcagggatgatgttc(sequence number 35)

[0118] gene Sequence (5' → 3') Tm (°C) Product size (bp) CDK1 sense caggatgtgcttatgcagga(sequence number 36) 60 338 antisense gctgaccccagcaatacttc(sequence number 37) GAPDH / Gapdh sense tgcaccaccaactgctta(sequence number 34) 60 177 antisense ggatgcagggatgatgttc(sequence number 35) Cdk1 sense ttgaaagcgaggaagaagga(sequence number 38) 60 195 antisense aatccatgaactgcccagga(sequence number 39)

[0119] gene Sequence (5' → 3') Tm (°C) Product size (bp) Wild-type allele P1 ctgggttctagccagtttacagtt(sequence number 40) 60 593 P2 actcagctttgggtagcattagtc(sequence number 41) Knock-out allele P3 cagttggtctggtgtcaaaaataa(sequence number 42) 60 478 P4 ctcaggttctagacttccctgaaa(sequence number 43)

[0120] Reference Example 9. Immunofluorescence

[0121] Cells were plated on coverslips and fixed with methanol on ice for 5 minutes. Cells were blocked in PBS with 3% BSA at room temperature for 30 minutes and incubated overnight at 4°C with primary antibodies. The primary antibodies used were: anti-CDK1 (Santa Cruz, SC-54 and Abcam, ab131450), anti-LAMP1 (Abcam, ab24170), and anti-cyclin B1 (Cell Signaling Technology, #4135). After PBS washing, cells were incubated with secondary antibodies (anti-mouse A488, A594, and A647; anti-rabbit A594; Life Technologies) at room temperature for 2 hours. After staining the nuclei with 0.5 μg / ml 4',6-diamidino-2-phenylindole (DAPI), the coverslip was mounted with ProLong Gold anti-discoloration reagent (Life Technologies), and the slides were observed using a confocal microscope (LSM780 or LSM880 Airyscan, Carl Zeiss).

[0123] Reference Example 10. Proximity ligation assay (PLA)

[0124] For protein-protein interaction analysis, HEK293 cells were seeded onto coverslips and co-transfected with His-CDK1 and RARRES1 WT or Y162A. After 24 hours, cells were fixed with 4% paraformaldehyde (PFA) for 15 minutes at room temperature, followed by infiltration with cold methanol at 4°C for 20 minutes. The Duolink In Situ Orange Starter Kit (Sigma-Aldrich, DUO92102) was used for PFA according to the manufacturer's instructions. For the primary antibodies, mouse anti-His-Tag (#2366, 1:200; Cell Signaling Technology) and rabbit anti-LAMP2A (ab18528, 1:200; Abcam) were used. After collecting images using a confocal microscope (LSM880, Carl Zeiss), the number of PLA puncta was calculated using ZEN blue 3.1 software (Carl Zeiss).

[0126] Reference Example 11. Modeling and Docking

[0127] Docking research is Schr The procedure was performed using Glide software on the Dinger UITE 021-02. The structure of the receptor CDK1 (Protein Data Bank ID: 4YC6) was prepared by removing ligand and water molecules from the structure using the Protein Preparation Wizard. The deleted region (amino acids 155-158) in the CDK1 structure was Schr It was modeled using dinger element primes. Using Glide's receptor grid generation panel, 36 grid boxes suitable for peptide docking were generated. X 6 X 6 A grid box was created to encompass most of the CDK1 structure. As for the ligand, the structure of the RARRES1 peptide, which spans from Glu270 to Ser284 and is phosphorylated at Thr273, was prepared using LigPrep with an OPLS4 force field. Docking was performed using Glide's ligand docking tool in SP-peptide precision mode, which is suitable for peptide docking, and the docking results were further evaluated using molecular dynamics (MD) simulations.

[0129] Reference Example 12. Molecular Dynamics (MD) Simulation

[0130] The complex model for CDK1 and RARRES1 peptides in the docking results is Schr Preparation was performed using the Protein Preparation Wizard of Dinger Suite 021-02. All MD simulations were performed by Schr Implemented using Desmond from dinger element 020-4. 10 X 10 X 10 Periodic boundary conditions using a distance-buffered orthorhombic box were applied to the explicit solvent simulation. For the solvation of the system, water according to the TIP3P water model and 150 mM NaCl were added after electrically neutralizing the system with sodium (or chloride) ions. After the solvated system was relaxed and the energy was minimized for 100 ps, ​​MD simulations were performed using an NPT (isothermal and isobaric simulation) ensemble. Here, the Martyna-Tobias-Klein method Nose-Hoover thermostat was adopted for isotropic pressure (1 atm) and constant temperature (300 K), respectively. The system was simulated for 300 ns in an OPLS2005 force field. MD simulation trajectories were saved at 300 ps intervals and analyzed using Desmond's Simulation Interaction Diagram tool.

[0132] Reference Example 13. Reverse Transcription Virus Transmission and Infection

[0133] Platinum-E reverse transcriptase virus-packaged cells (Cell Biolabs, RV-101) were arranged in 6 × 10⁴ on a 10 cm dish. 6Cells were inoculated at a cell density into whole DMEM (10% FBS and 1% penicillin / streptomycin) containing 10 μg / ml blasticidin and 1 μg / ml puromycin. The following day, cells were transfected with the pMSCVpuro-H2B isolase reverse transcriptase virus vector using antibiotic-free whole DMEM and PEI containing 10% FBS. The supernatant containing the reverse transcriptase virus was collected 2 days after transfection and concentrated using a Retro-X™ concentrator (Clontech) according to the manufacturer's instructions. Briefly, the supernatant was filtered through a 0.45 μm filter and mixed with a Retro-X concentrator (3:1 ratio) overnight at 4°C. After centrifugation (1,500×g), the supernatant was removed, and the resulting pellet was resuspended in PBS. MEE cells were exposed to the virus containing 8 μg / ml polybrene to enhance viral delivery efficiency.

[0135] Reference Example 14. Cell proliferation

[0136] 1 × 10 MEE cells per well 3 Cells were seeded in 48-well plates at a certain density and counted quadruple for 5 consecutive days. For reconstitution experiments, double-transplanted MEE cells were cultured triple-in-1 in 24-well plates and counted on day 3. Cells were fixed with 4% PFA for 10 minutes at RT, treated with 0.5% Triton X-100 for 5 minutes at RT, and stained with 0.5 μg / ml DAPI for 10 minutes at RT. Cell growth was measured using a Cytation 3 instrument (BioTek), and the total number of cells was counted using Gen5 data analysis software (version 2.09.1).

[0138] Reference Example 15. Reconstruction of RARRES1

[0139] To reconstitute human RARRES1 in KO (knockout) MEE cells, 2×10⁶ cells were prepared in a 10cm dish. 5Cells were seeded at cell / plate concentrations. The following day, plasmid DNA (pcDNA3.1 or pcDNA3.1-RARRES1) was infected using Lipofectamine 3000 reagent, and a second infection was performed two days later. 24 hours after the second infection, cells were seeded into 6-well or 24-well plates for sphere formation analysis or cell growth analysis, respectively. Cell growth was measured using a Cytation 3 instrument (BioTek) 4 days after the second infection.

[0141] Reference Example 16. Sphere formation analysis

[0142] RARRES1 was reconstituted for sphere formation analysis, and cells were prepared as previously described. The diameter of the spheres was measured on the 5th day of culture.

[0144] Reference Example 17. PET / CT image

[0145] Axial raw data were obtained from a PET scanner 60 minutes after intravenous injection of FDG (370 MBq) during the epileptic period, and the acquisition time was approximately 20 minutes. Axial images were reconstructed with a Shepp-Logan filter (cutoff frequency, 0.35 cycles per pixel) and realigned in the coronal and sagittal planes. The spatial resolution was 6.1 × 6.1 × 4.3 mm (GE Healthcare, eXplore Vista-CT).

[0147] Reference Example 18. Histopathological and immunohistochemical analysis

[0148] All tissues collected from mice were immediately fixed in 10% neutral buffered formalin, and paraffin-contaminated tissue sections were placed on silicone-coated slides to remove the paraffin and rehydrate. Hematoxylin and eosin (H&E) staining was used for histopathological diagnosis.

[0150] Reference Example 19. Genetically modified knockout mouse model

[0151] mouse Rarres1ES cell clones carrying the tm1a allele of the gene were purchased from the Knockout Mouse Project (KOMP) repository. Rarres1 tm1a / + Mice were induced via microinjection of ES cells. The Rarres1-null allele was induced for deletion in Cre-expressing mice (zp3-Cre; The Jackson Laboratory, strain 003651) and Rarres1 tm1a / + It was made by crossbreeding mice.

[0152] Rarres1 - / - ;Fucci2a KI / + Mice were used for cell cycle analysis with Fucci2a KI / + Mouse (52) Rarres1 + / - It was prepared by rearing with mice. The genotype primers used to amplify WT and null alleles are shown in Table 5.

[0153] The mouse model maintained the C57BL / 6 genetic background, and all animal studies and procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center (NCC-11-138).

[0155] Reference Example 20. Statistical Analysis

[0156] All statistical analyses were performed using GraphPad Prism 10. Normal values ​​were expressed as mean ± SD or mean ± SEM. P-values ​​for normally distributed data were determined using unpaired two-tailed Student's t-tests for two-group comparisons. For non-normally distributed data, non-parametric analyses were performed using the Mann-Whitney test or one-way analysis of variance (ANOVA). Survival data were analyzed using the Log-rank (Mantel-Cox) test. All P-values ​​are shown in the figure, and values ​​<0.05, <0.01, and <0.001 were considered significant.

[0159] Experimental Example

[0161] Experimental Example 1. Confirmation of CDK1 activation by RARRES1

[0162] 1.1 Verify CDK1-RARRES1 binding

[0163] First, to confirm the role of RARRES1, cell lysates of HEK293 cells overexpressing RARRES1 were immunoprecipitated (IP) with IgG (Santa Cruz, SC-2028) or anti-RARRES1 antibody (R&D Systems, AF4255). Subsequently, proteins were excised from polyacrylamide gel slices, and proteolytic peptides were analyzed by liquid chromatography-mass spectrometry (LC-MS). Proteins that bind to the RARRES1 antibody at more than twice the rate of IgG, as indicated by LC-MS, were analyzed using the David functional annotation tool, and the results are shown in Figure 1.

[0165] As shown in Figure 1, CDK1 and its substrate proteins were found to be part of the RARRES1 binding protein family involved in various activities including DNA replication, RNA processing, the cell cycle, and mitosis.

[0167] After confirming that CDK1 could be a major functional partner of RARRES1, microscale thermophoresis (MST) measurements of the affinity of purified CDK1 protein were performed to confirm the direct interaction between CDK1 and RARRES1, and the results are shown in Figure 2.

[0168] As shown in Figure 2, CDK1 bound to purified CDK1 protein in vitro with a dissociation constant (KD) of 64.6 ± 33.3 μM.

[0170] 1.2 Confirmation of the effect of RARRES1 on CDK1 protein expression levels

[0171] After confirming that RARRES1 binds to CDK1 in Experimental Example 1.1, the effect of RARRES1 on the function or activation of CDK1 was investigated.

[0172] First, the results of quantifying CDK1 mRNA expression in RARRES1-transfected HEK293 cells and RARRES1 knockout (KO) MEE cells (Rarres1- / - MEE) and measuring the protein level of CDK1 by performing Western blotting for CDK1 in each cell lysate are shown in Figure 3.

[0173] As shown in Figure 3, even if CDK1 mRNA expression did not change significantly, overexpression or depletion of RARRES1 could affect CDK1 protein levels.

[0175] Accordingly, the effect of RARRES1 on CDK1 protein levels was investigated. Specifically, the results of Western blot analysis of lysates from WT and Rarres1- / - MEE cells following exogenous introduction of RARRES1 and treatment with 200 μM cycloheximide (CHX) (Sigma-Aldrich) are shown in Figure 4.

[0176] As shown in Figure 4, the protein level of CDK1 decreased in a dose-dependent manner after expression with RARRES1 and remained higher in Rarres1- / - MEE cells than in WT cells for up to 9 hours after CHX treatment.

[0178] The above results indicate that RARRES1 binds to CDK1 and that the amount of CDK1 protein is regulated by RARRES1.

[0180] Experimental Example 2. Confirmation of association with lysosomal protein degradation pathway

[0181] 2.1 Identification of Protein Degradation Pathways

[0182] The underlying mechanism of RARRES1-mediated CDK1 degradation was investigated by administering various protein degradation pathway inhibitors to cells overexpressing both CDK1 and RARRES1. Immunoblot results are shown in Figure 5 after administering 100 nM Baf (Selleckchem, S1413), 10 μg / ml E-64d (Enzo, BML-PI107), and 10 μg / ml pepstatin A (Sigma-Aldrich, P5318) as lysosomal inhibitors and 5 μM MG132 (Calbiochem, 474790) as a proteasome inhibitor.

[0183] As shown in Figure 5, treatment with the lysosomal inhibitors bafilomycin A1 (Baf) and E-64d / pepstatin A (E / P) restored RARRES1-dependent CDK1 protein degradation, whereas the proteasome inhibitor (MG132) restored this degradation less. However, RARRES1 itself was stabilized by the lysosomal and proteasome inhibitors.

[0185] Additionally, LC-MS / MS analysis and immunoblot analysis of the lysosomal membrane protein LAMP1 in anti-RARRES1 immunoprecipitates were performed. The results are shown in Figures 6 and 7, respectively.

[0186] As shown in Figures 6 and 7, RARRES1 bound to lysosomal protein degradation pathway-related proteins such as cathepsin D (CTSD), CHIP, and HSPA1B, as well as the lysosomal membrane protein LAMP1. In addition, it was observed that these proteins were co-immunoprecipitated (co-IP) when RARRES1 and CDK1 bound to each other.

[0188] 2.2 Investigation of CDK1 Lysosomal Localization

[0189] Whether CDK1 is localized to lysosomes was investigated in cells at various cell cycle stages, and the results are shown in Figure 8.

[0190] As shown in Figure 8, during the late cell cycle, CDK1 in the lysosome was partially co-localized with LAMP1 due to the presence of spots as previously reported.

[0192] 2.3 Confirmation of Selective Autophagy in the RARRES1-Dependent Lysosomal Protein Degradation Pathway

[0193] To determine whether RARRES1-dependent lysosomal CDK1 degradation is a selective autophagy pathway, the amount of CDK1 protein was determined after depleting VPS4 or LAMP2A by treating with siRNA, and the results of the immunoblot analysis are shown in Figure 9.

[0194] siRNA delivery was performed using an Amaxa Nucleofector (Lonza) according to the manufacturer's instructions, and the sequence was designed as follows:

[0195] - Human LAMP2A: 5'-ggcaggaguacuuauucuagu-3' (Sequence No. 44)

[0196] - Mouse LAMP2A: 5'-gcugcagcugaacaucacu-3' (Sequence No. 45)

[0197] - Human VPS4A: 5'-ccgagaagcugaaggauua-3' (Sequence No. 46)

[0198] - Control siRNA: 5'-guucagcguguccgag-3' (Sequence No. 47).

[0200] As shown in Figure 9, the knockdown of VPS4, which is required for lysosomal microautophagy, did not affect RARRES1-dependent CDK1 protein degradation. The presence of CDK1 protein was observed after the knockdown of LAMP2A, an important component of chaperone-mediated autophagy (CMA). According to the results, overexpression of RARRES1 decreased CDK1 levels, but LAMP2A knockdown partially restored CDK1 levels.

[0202] The above results imply that RARRES1-dependent CDK1 degradation depends on lysosomal protein degradation, specifically lysosome-targeted protein degradation during the late stages of cell division. Furthermore, it implies that RARRES1-dependent CDK1 degradation depends on CMA. In addition, as shown in Figure 8, since the RARRES1 protein was stabilized by proteasome and lysosomal protein degradation inhibitors, these results suggest that RARRES1 stability may be regulated by two pathways. Protein stability was increased by transfection with a specific LAMP2A siRNA but not by transfection with VPS4 siRNA.

[0204] Experimental Example 3. Confirmation of CDK1 decomposition motif in RARRES1

[0205] 3.1 Confirmation of KFERQ-like motifs in RARRES1

[0206] We investigated the presence of the KFERQ motif within RARRES1, a recognition site essential for chaperone-mediated autophagy (CMA), and confirmed whether KFERQ-like peptides potentially affect CDK1 degradation. The results of the immunoblot analysis for CDK1 are shown in Figure 10.

[0207] As shown in Fig. 10, RARRES1 has phosphorylation ( 160 LLYKQ 164 ) or acetylation( 147 RLIEKKK 153 There were two potential KFERQ-like motifs that satisfy the physical characteristics required to recognize CMA substrates through post-translational modifications (PTMs) such as ), and the said two motifs were mutant Y162A ( 160 LLAKQ 164 ) and 3KA(147-153 mut)( 147 RLIEAAA 153When transfected with ), both RARRES1 mutants were stabilized, but mutant Y162A( 160 LLAKQ 164 It was observed that only ) reversed CDK1 degradation.

[0209] 3.2 Verification of the effect of LLAKQ on CDK1

[0210] To further investigate the effect of LLAKQ on CDK1 degradation, cells were co-transfected with His-CDK1, WT RARRES1, or Y162A mutants, and a proximity ligation assay (PLA) between CDK1 and lysosomal proteins was performed 24 hours later, and the results are shown in Figure 11.

[0211] In addition, the results of immunoprecipitation and immunoblotting of cells co-transfected with CDK1 and RARRES1 WT or Y162A mutations with an anti-CDK1 antibody are shown in Fig. 12.

[0213] As shown in Figures 11 and 12, CDK1 bound to LAMP2A regardless of the presence of RARRES1. However, this interaction was promoted when WT RARRES1 was present and inhibited in cells transfected with the Y162A mutation.

[0215] These results imply that the motif containing LLYKQ of RARRES1, which is conserved throughout vertebrates, promotes CMA, and that CDK1 is a direct substrate of CMA.

[0217] Experimental Example 4. Confirmation of target protein binding motif in RARRES1

[0218] 4.1 Verification of the function of the RARRES1 C-terminal region for CDK1

[0219] To further clarify the specific region where RARRES1 interacts with CDK1, the sequence conservation and intrinsic structure of the domain were analyzed. N- and / or C-terminal deletion mutants of RARRES1 (residues 1-269, 43-269 and 51-294; RARRES1ΔC (Sequence No. 14), RARRES1ΔN,C (Sequence No. 15), and RARRES1ΔN (Sequence No. 16), respectively) were generated and binding evaluations were performed, and the results are shown in Figure 13.

[0220] As shown in Figure 13, it was confirmed that the C-terminal fragment (residues 269-294) was immunoprecipitated, and while the binding to CDK1 was reduced for RARRES1ΔN,C and RARRES1ΔC, the binding to CDK1 was sustained for RARRES1ΔN, which retained the C-terminal region.

[0221] These results indicate that the C-terminal region of RARRES1 is essential for binding to CDK1 and is different from its homolog, latexin (LXN).

[0223] 4.2 Verification of the Structural Coupling Mode of RARRES1 and CDK1

[0224] First, an analysis of the sequence conservation of the C-terminal region of RARRES1 (residues 269-294, SEQ ID NO. 17) in vertebrates including humans and mice revealed sequence similarity, particularly in residues 270-284 (Fig. 20). Accordingly, to investigate the mechanism by which RARRES1 binds to CDK1, a docking study was performed using the RARRES1 peptide of the C-terminal region (residues 270-284, SEQ ID NO. 18) having an inactive CDK1 structure. The phosphopeptide of RARRES1 was sequenced using LC-nanospray ionization tandem mass spectrometry (nanoLC-NSI / MS / MS).

[0225] The RARRES1 peptide spanning Glu270 to Ser284 with Thr273 phosphorylation is Schr Dinger Uite's Glide was used to dock to the structure of CDK1 (Protein Data Bank ID: 4YC6). The RARRES1 peptide was shown as a bar.

[0226] Figure 15 is an image showing a model in which a combined RARRES1-derived peptide or the entire RARRES1 protein can bind based on a cartoon diagram of the entire structure of CDK1 and an electrostatic distribution diagram of the protein surface.

[0227] As shown in Fig. 15, the RARRES1 peptide bound to the surface of CDK1 and interacted with the αC helix, activation loop, and catalytic loop, extending from the N-leaf to the C-leaf. It was confirmed that the RARRES1 peptide consists mainly of hydrophilic residues and forms electrostatic interactions with CDK1, and that several glutamate amino acids of the RARRES1 peptide bind to basic patches on the surface of the CDK1 C-leaf.

[0229] The results above imply that the C-terminus of RARRES1 is an important region for binding to the inactive form of CDK1, and the subtle characteristics of this protein-protein interaction and the KFERQ-like motif of RARRES1 ( 160 LLYKQ 164 This indicates that it plays an important role in CDK1 degradation through ).

[0231] Experimental Example 5. Confirmation of the association between RARRES1-dependent degradation and cell growth

[0232] 5.1 Verification of the effect on CDK1 activity

[0233] First, to determine whether RARRES1-dependent degradation of CDK1 protein affects CDK1 activity, the fluorescence intensity of an H2B dissociase sensor responding to CDK1 activity was measured in the nuclei of WT and Rarres1- / - MEE cells via living cell imaging, and the results are shown in Figure 16.

[0234] As shown in Figure 16, the relative fluorescence intensity of Rarres1- / - MEE cells increased significantly after the start of chromosome separation (time 0) and remained high even after cell division.

[0236] 5.2 Confirmation of effects on cell cycle progression

[0237] To determine the effect of increased CDK1 activity on cell cycle progression, FUCCI2a mice were crossed with Rarres1+ / - mice (generated by Rarres1+ / +;Fucci2aKI / + or Rarres1- / -;Fucci2aKI / + mice) and the cell cycle was observed. Fluorescence intensity was measured in Rarres1+ / +;Fucci2aKI / + (n=32) or Rarres1- / -;Fucci2aKI / + (n=51) MEE cells via time-lapse imaging, and the results are shown in Figure 17.

[0238] As shown in Figure 17, compared to WT MEE cells, Rarres1- / - MEE cells had a shorter cell cycle. Specifically, the G1 phase was shortened, which accounted for 66% of the total reduction in cell cycle duration.

[0240] Since the G1 phase of the cell cycle is affected, the binding of CDK1 to G1 cyclin, cyclin D, and cyclin E was further evaluated, and the results of the immunoblot analysis of cyclin E using an agarose-conjugated anti-CDK1 antibody in WT and Rarres1- / - MEE cells are shown in Figure 18.

[0241] As shown in Figure 18, cyclin E and CDK1 bound better in Rarres1- / - MEE cells than in wild-type cells. However, binding with cyclin D1 was unaffected. In other words, Rarres1 depletion enhances CDK1 activity through increased CDK1-cyclin E binding after cell division, which is similar to what occurs during the cell cycle of ES cells.

[0243] 5.3 Confirmation of effects on cell growth

[0244] Figure 19 shows the results of observing the growth of WT and Rarres1- / - MEE cells for 5 days, as well as the growth of Rarres1- / - MEE cells transformed with an empty vector (pcDNA3.1) or human RARRES1 in DAPI-stained cells using Cytation 3. Confirmation of RARRES1 reconstitution at the mRNA level was performed via RT-PCR.

[0245] As shown in Figure 19, the growth of Rarres1- / - cells was observed to be greater than that of WT cells, and the growth of cells that re-expressed human RARRES1 was observed to be inhibited compared to Rarres1- / - MEE cells transfected with a mock vector.

[0247] Additionally, to investigate whether increased binding between CDK1-Cycle E and accelerated growth of Rarres1- / - MEE cells contribute to pluripotency, the number and size of cell spheres were observed through spherogenesis analysis, and the results are shown in Figure 20.

[0248] As shown in Figure 20, the number and size of spheres were significantly increased in Rarres1-deficient MEE cells. Consistent with these results, when Rarres1-null MEE cells were reconstituted with human RARRES1, the spheroid formation ability of the cells decreased compared to control cells transformed with a mock vector.

[0249] These results suggest that RARRES1 regulates the activity of the CDK1 protein, potentially affecting the plasticity of epithelial cells, which ultimately influences cell proliferation.

[0251] Experimental Example 6. Confirmation of the association between Rarres1 deficiency and tumor development

[0252] To investigate the proliferation and plasticity-related functions of RARRES1 under physiological conditions, constitutive Rarres1 knockout mice were generated, and their survival rate and tumorigenesis were assessed. Rarres1- / - mice were generated by disrupting the gene locus of exon 3 using the loxP-ZP3 Cre nuclease system and the reporter gene β-galactosidase, and a schematic diagram is shown in Fig. 21. Whole-genome and RNA sequencing results showed that Rarres1 exon 3 was completely deleted and Rarres1 mRNA expression was absent, but the mRNA levels of neighboring genes Gfm1 and Mfsd1 were unaffected (Fig. 22). The survival rate of the generated Rarres1- / - mice was assessed and is shown in Fig. 23, while the tumorigenesis was assessed and is shown in Figs. 24 and 25.

[0253] As shown in Figures 23 and 24, compared to wild-type mice, the overall survival rate of Rarres1- / - mice decreased by more than 40% at 18 months of age, and the intensity of 18F-fluorodeoxyglucose (FDG) labeling increased significantly in PET-CT images of 14 or 15-month-old Rarres1- / - mice. This finding was consistent with a decrease in survival rate after about 1 year.

[0254] As shown in Figures 24 and 25, Rarres1- / - mice developed various types of spontaneous malignant tumors in endoderm-derived organs, including the lungs, liver, stomach, and thyroid, and benign tumors in the small and large intestines up to 18 months of age (Total, P=0.0099). In contrast, WT mice showed benign tumors in both the lungs and small intestines. Notably, thyroid tumors in Rarres1- / - mice metastasized to the liver. The incidence of lymphoma was nearly threefold higher in Rarres1-deficient mice compared to WT mice (Total, P=0.0107), and disseminated lymphoma occurred only in Rarres1-deficient mice. On the other hand, the incidence of histiocytic sarcoma was similar in both genotypes of mice.

[0256] In other words, tumors caused by RARRES1 deficiency are observed in various organs and progress to malignancy through the development of adenocarcinoma, metastasis, and disseminated lymphoma, and these results indicate that RARRES1 plays a role in tumor suppression.

[0258] Experimental Example 7. Confirmation of the association between Rarres1 deficiency and tumor development

[0259] The effect of Rarres1 on the regulation of CDK1 protein expression in a precursor population was investigated in mouse lung progenitor cells as follows.

[0260] As shown in Figure 26, the lungs of 18-month-old rats with Rarres1 deficiency had 2.3 times more AT2 lineage progenitor cells (NKX2.1 labeled cells) and higher nuclear CDK1 expression (more than 7 times) than the lungs of WT rats.

[0261] As shown in Figure 27, the lungs of Rarres1- / - rats had higher levels of CDK1 and cyclin E proteins than the lungs of WT rats.

[0262] In addition, as shown in Figure 28, the C1 subgroup in the human TCGA-LUAD dataset showed an inverse correlation between CDK1 protein levels and RARRES1 mRNA expression. That is, we found an increase in the progenitor cell population in the normal lung tissue of Rarres1- / - mice.

[0264] To better understand this phenomenon, gene expression profiling of lung adenomas / adenocarcinomas developed in these mice was used to identify the abundance of 24 different lung cell types, as shown in Fig. 29, and stained micrographs and quantification results of the lung tissue were shown in Fig. 30.

[0265] As shown in Figure 29, tumor samples from Rarres1- / - mice showed a significant abundance of AT2 cells and embryonic lung stem-like cells (pluripotent progenitor cells) (FC 2.8), but most other cell types were similar between Rarres1- / - normal and tumor samples. The abundance of 24 lung cell types known from the TCGA-LUAD dataset was determined. The C1 subgroup, which had the lowest RARRES1 expression in the human TCGA-LUAD cohort, also had the highest proportion of alveolar pluripotent progenitor cells and AT2 cells, which is consistent with the results in the mouse model (FC= 2.7).

[0266] Furthermore, consistent with these data, as shown in Figure 30, RARRES1 was expressed in cuboidal alveolar epithelial cells of normal tissue adjacent to the tumor, and expression was low in human LUAD tissue.

[0268] The above results indicate that in the absence of RARRES1, degradation via CMA is inhibited, leading to an increase in CDK1 protein levels, which in turn results in vigorous AT2 cell expansion and tumor development.

[0270] Experimental Example 8. Confirmation of PD-L1 expression levels by RARRES1

[0271] 8.1 Confirmation of changes in PD-L1 levels after RARRES1 expression

[0272] First, we checked whether there was a difference in the amount of PD-L1 protein when RA1 was overexpressed using HCT116, a human colorectal cancer cell line with almost no RA1 expression, and the results are shown in Figure 31.

[0273] As shown in Figure 31, it was confirmed that the amount of PD-L1 protein decreased compared to the control group when RA1 was overexpressed.

[0275] 8.2 Confirmation of changes in RA1 and PD-L1 levels after RARRES1 overexpression

[0276] Using HCT116, a human colorectal cancer cell line with almost no RA1 expression, we overexpressed the RA1 and RA1 Y162A gene, a variant of the KFERQ-like motif of RA1, and then checked whether there was a difference in PD-L1 protein amount and ubiquitination, and the results are shown in Fig. 32.

[0277] As shown in Figure 32, the amount of PD-L1 decreased due to RARRES1 overexpression, and at that time, the band of the non-glycosylated form of RA1 (band near 35 kDa) increased.

[0279] Experimental Example 9. Confirmation of tumor-forming ability after RARRES1 expression

[0280] We wanted to determine if there was a difference in tumor-forming ability when RA1 was overexpressed and transplanted into a syngeneic mouse model.

[0281] For tumor cell harvesting, the cells were subjected to two washing steps using opti-MEM (Gibco) medium, resuspended in opti-MEM, and passed through a filter once to convert them into single cells. Mouse-derived tumor cells constructed after inhalation anesthesia with isoflurane using 8-12 week old wild-type B6 mice were 1 x 10⁶ 5 100 µl was injected subcutaneously into the backs of mice, cell by cell, using an insulin syringe. After injecting the tumor cells, the tumor and mouse body weight were measured twice a week. The tumor volume was (shortened) 2 X (long axis) X 0.5 mm 3 The results were calculated and shown in Table 7 and Figure 33.

[0282] DAY3 DAY6 DAY10 DAY13 DAY17 DAY20 DAY24 DAY27 Mock 0 0.72 10.10 51.75 112.19 323.77 411.52 568.87 RA1 0 0.61 4.11 11.19 39.65 67.94 171.10 291.91 SD-Mock 0 1.06 8.27 39.73 90.72 220.15 399.27 396.57 SD-RA1 0 1.06 6.38 18.58 75.77 91.37 205.40 454.22 p.value #DIV / 0! 0.87 0.24 0.05 0.18 0.03 0.27 0.33

[0283] As shown in Table 7 and Figure 33, it was confirmed that tumors formed more slowly in the group of mice transplanted with MC38 cells overexpressing RA1.

[0285] Experimental Example 10. Confirmation of binding between RARRES1 C-terminus and Cyclin B1

[0286] First, the binding of RARRES1 and Cyclin B1 in HEK293 cells was confirmed by immunoblotting and is shown in Fig. 34, and by intracellular imaging (immunofluorescence) and is shown in Fig. 35.

[0287] As shown in Figure 34, when the binding of RARRES1 and Cyclin B1 in HEK293 cells was confirmed, it was confirmed that Cyclin B1 binds to RARRES1.

[0288] As shown in Figure 35, it was confirmed that the endogenous Cyclin B1 level decreased in HEK293 cells in the presence of RARRES1, and the Cyclin B1 level increased in cells with low expression of RARRES1, thereby confirming that Cyclin B1 binds to RARRES1.

[0290] Additionally, the binding of RARRES1 full length (FL) or truncated mutants (1-269aa, 43-269aa, 51-294aa) to Cyclin B1 in HEK293 cells was confirmed by immunoblotting and is shown in Figure 36.

[0291] As shown in Figure 36, when the binding of RARRES1 full length (FL) or truncated mutants with Cyclin B1 was confirmed in HEK293 cells, the binding of Cyclin B1 was reduced in the mutants with the C-terminus of RARRES1 truncated, confirming that the C-terminus of RARRES1 is important for the binding of Cyclin B1 and RARRES1.

[0293] Experimental Example 11. Confirmation of Cyclin B1 expression levels and regulatory pathways by RARRES1

[0294] When RARRES1 was overexpressed in HEK293 cells in a concentration-dependent manner, the expression level of Cyclin B1 was confirmed by immunoblotting and is shown in Figure 37.

[0295] As shown in Figure 37, it was confirmed that the protein level of Cyclin B1 reduced RARRES1 in a concentration-dependent manner.

[0296] additionally, Protein expression of endogenous Cyclin B1 in the presence or absence of RARRES1 was confirmed by immunoblotting after treatment with the lysosomal inhibitor Bafilomycin A1 (BafA1), and this is shown in Figure 38.

[0297] As shown in Figure 38, when treated with BafA1, a lysosome-mediated degradation inhibitor, Cyclin B1 protein levels were not degraded by RARRES1 and Cyclin B1 was restored to empty vector levels, confirming that RARRES1 regulates Cyclin B1 through lysosome-mediated degradation.

[0299] Experimental Example 12. Confirmation of target protein degradation induction using RARRES1 fusion protein

[0300] To determine whether a fusion of the RARRES1 C-terminal deletion and the target binding domain can selectively degrade specific target proteins within cells, the following experiment was performed.

[0301] First, A549 and NCI-H358 cells were cultured in RPMI 1640 medium containing 10% (v / v) FBS and 1× antibiotic-antifungal solution in a humidified incubator maintained at 37°C and 5% CO₂. Plasmid DNA for transduction was introduced using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer's instructions. After performing transfection, the cells were cultured in Opti-MEM medium to induce serum-deficient conditions.

[0302] RARRES1:1-269 aa expressions were constructed by subcloning PCR-amplified RARRES1 cDNA (GenBank: NM_206963) into a pcDNA3.1 expression vector. Fusion plasmids (RARRES1:1-269 aa-SOS and -BAK1) were constructed by inserting the synthesized SOS1 or BAK amino acid sequences into the C-terminus of the RARRES1:1-269 aa vector. The amino acid sequences of SOS1 and BAK1 used for cloning were SOS, FEGIYRLELLKAEEAN (Sequence No. 19); BAK1, GQVGRQLAIIGDDINRRYDSEFQ (Sequence No. 20), respectively (Fig. 39).

[0303] Cells were lysed in lysis buffer (20 mM Tris, 5 mM EDTA, 10 mM Na₄P₂O₇, 100 mM NaF, 1% NP-40, 1 mM PMSF, 0.2% protease inhibitor cocktail, and phosphatase inhibitor; pH 7.4) on ice for at least 30 minutes. The cell lysate was quantified using the BCA Protein Assay Kit, resuspended in loading buffer, and boiled for 5 minutes. The samples were separated by SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was blocked in a solution of TBS-T with 5% skim milk added at room temperature for 30 minutes, followed by overnight incubation with the primary antibody at 4°C. The membrane was washed three times with TBS-T and incubated with the secondary antibody for 2 hours at room temperature. Protein expression was detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific).

[0304] As shown in Fig. 40, it was confirmed that when an SOS binding sequence was fused to the RARRES1 C-terminal deletion (RA1 ΔC), the degradation of the target protein RAS was effectively induced.

[0306] Based on the above results, it was confirmed that the CMATAC according to one embodiment binds to lysosomes through a moiety containing an amino acid sequence including X1LX3KX5 and binds to proteins such as CDK1, PD-L1, and cyclin B1 through a target protein binding moiety, thereby recruiting target proteins into lysosomes to induce chaperone-mediated autophagy and degrade target proteins. In other words, the CMATAC of the present invention has potential as a therapeutic agent for cancer and / or immune diseases by degrading or inactivating proteins closely related to tumor formation and activation.

[0308] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

Claim 1 A conjugate for target protein degradation comprising a lysosome-binding moiety and a target protein-binding moiety, wherein the lysosome-binding moiety comprises the following amino acid sequence: X1LX3KX5, where X1 is L, Q, or R, X3 is Y or E, and X5 is Q or L. Claim 2 A conjugate according to claim 1, wherein the lysosome binding moiety is a fragment of RARRES1 comprising the amino acid sequence. Claim 3 The conjugate of claim 1, wherein the lysosome binding moiety is a fragment comprising the amino acid sequence of LLYKQ (Sequence No. 1). Claim 4 The conjugate of claim 1, wherein the target protein binding moiety comprises one or more of an antibody or its antigen-binding fragment that binds to the target protein, a ligand, and the C-terminus of RARRES1. Claim 5 The conjugate of claim 1, wherein the target protein is one or more selected from the group consisting of CDK1 and PD-L1. Claim 6 The conjugate of claim 1, wherein the lysosome-binding moiety and the target protein-binding moiety are connected directly or by a linker. Claim 7 A pharmaceutical composition for the prevention or treatment of cancer comprising a conjugate of any one of claims 1 to 6, wherein the target protein is CDK1, CDK4 / 6, Cyclin D1, Cyclin B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-1α, A pharmaceutical composition that is B7-1 or B7-2. Claim 8 A health functional food for the prevention or improvement of cancer comprising a conjugate of any one of claims 1 to 6, wherein the target protein is CDK1, CDK4 / 6, Cyclin D1, Cyclin B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-1α, B7-1 or B7-2, a health functional food. Claim 9 A pharmaceutical composition for the prevention or treatment of an immune disease comprising a conjugate of any one of claims 1 to 6, wherein the target protein is CDK1, CDK4 / 6, Cyclin D1, Cyclin B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-1α, A pharmaceutical composition that is B7-1 or B7-2. Claim 10 A pharmaceutical composition according to claim 9, wherein the immune disease is Sjögren's syndrome. Claim 11 A health functional food for the prevention or improvement of immune diseases comprising a conjugate of any one of claims 1 to 6, wherein the target protein is CDK1, CDK4 / 6, Cyclin D1, Cyclin B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-1α, B7-1 or B7-2, a health functional food.