Peptide having Anti-inflammatory activity and use thereof

Abstract

The present invention relates to a peptide having anti-inflammatory activity and a pharmaceutical composition containing the same for the prevention or treatment of inflammatory diseases.

Description

Technology Field

[0001] The present invention relates to a novel peptide having anti-inflammatory activity and an anti-inflammatory effect, and the use thereof. Background Technology

[0003] Inflammation is a type of defense response of biological tissues that occurs when tissues or cells are damaged or injured, or when infected by external agents (viruses, bacteria, fungi, allergens, etc.). It refers to a complex series of conditions caused by immune cells involved in various immune responses that gather around damaged or infected areas, and the inflammatory factors they secrete. It is a lesion that induces three conditions: tissue degeneration, circulatory disorders and exudation, and tissue proliferation. In general, inflammation is initiated and maintained by the chemotaxis of neutrophils among white blood cells. Major factors involved in the inflammatory response include histamine secreted by mast cells, interferon gamma (IFNγ) secreted by T cells or NK cells, various interleukins secreted by macrophages, nitric oxide (NO), and prostaglandins.

[0004] In principle, the inflammatory response is a defense mechanism of the body, serving to regenerate damaged tissue or eliminate external sources of infection to restore damaged bodily functions. However, if external sources of infection are not completely eliminated or if a persistent and excessive inflammatory response occurs due to internal substances, such abnormal inflammatory responses can lead to various human diseases and are associated with autoimmune diseases and cancer. Representative examples include acute inflammation occurring within the joints, diseases such as rheumatoid arthritis, skin diseases manifesting as psoriasis, and allergic inflammatory diseases such as bronchial asthma.

[0005] It is possible to devise methods to treat or improve inflammatory diseases by stopping the inflammatory response through inhibiting the activity of cells involved in inducing or maintaining the inflammatory response, or by inhibiting the production of inflammation-inducing substances or enzymes secreted by them. With the advancement of molecular biology, cytokines that cause inflammatory diseases are being understood at the molecular level, and research on identifying inflammation-related factors has been ongoing. Efforts have also been made to develop therapeutic agents by attempting to suppress inflammation by inhibiting the expression or activity of the aforementioned cytokines.

[0006] Currently known treatments for inflammatory diseases include dexamethasone and cortisone, which utilize adrenal cortical hormone components; however, while these drugs are active as treatments, they have problems such as high toxicity and the potential to cause side effects like edema. Furthermore, it has been reported that problems may arise because they do not act selectively on the causes of inflammation, leading to severe immunosuppression. As described above, treating inflammatory diseases using drugs containing steroid components entails side effects and problems; therefore, there is an urgent need to develop treatments for inflammatory diseases using non-steroidal drugs that can provide stable anti-inflammatory effects without side effects. Prior art literature

[0008] Republic of Korea Registered Patent No. 10-2246636 (Published May 3, 2021) The problem to be solved

[0009] The problem that the present invention aims to solve is to provide a peptide having anti-inflammatory activity.

[0010] Another problem that the present invention aims to solve is to provide a pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising the above-mentioned peptide.

[0011] Another problem that the present invention aims to solve is to provide a health functional food composition for preventing or improving inflammatory diseases containing the above-mentioned peptide.

[0012] Another problem that the present invention aims to solve is to provide a cosmetic composition for preventing or improving inflammatory diseases containing the above peptide. means of solving the problem

[0014] One embodiment of the present invention provides a peptide composed of the amino acid sequence of SEQ ID NO. 1.

[0015] In one embodiment of the present invention, the peptide may have anti-inflammatory activity.

[0016] In one embodiment of the present invention, the peptide can inhibit the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α, IL-1β, IL-6, IL-17, and IFNγ.

[0017] In one embodiment of the present invention, the peptide can increase the expression of IL-10.

[0018] In one embodiment of the present invention, the N-terminus of the peptide may be bonded to any one of the protecting groups selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).

[0019] In one embodiment of the present invention, the N-terminus of the peptide may be bonded to any one of the protecting groups selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).

[0020] One embodiment of the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding the peptide of SEQ ID NO. 1.

[0021] One embodiment of the present invention provides a recombinant vector comprising a nucleic acid molecule.

[0022] One embodiment of the present invention provides a host cell transformed with the recombinant vector.

[0023] One embodiment of the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising a peptide having the amino acid sequence of SEQ ID NO. 1.

[0024] In one embodiment of the present invention, the inflammatory disease is rhinitis, bronchitis, periodontitis, pancreatitis, gastritis, gastric ulcer, inflammatory skin disease, atopic dermatitis, encephilitis, sepsis, inflammatory enteritis, chronic obstructive pulmonary disease, septicemic shock, pulmonary fibrosis, undifferentiated spondyloarthrosis, undifferentiated arthropathy, arthritis, inflammatory osteolysis, chronic inflammatory disease caused by chronic viral or bacterial infection, colitis, inflammatory bowel disease, type 1 diabetes mellitus, rheumatoid arthritis, reactive arthritis, osteoarthritis, psoriasis, scleroderma, osteoporosis, atherosclerosis, myocarditis, endocarditis, pericarditis, cystic fibrosis, Hashimoto's thyroiditis, Graves' disease, leprosy, syphilis, Lyme disease, borreliosis, neuro-borreliosis, tuberculosis, sarcoidosis, lupus, It may be a disease selected from the group consisting of discoid lupus, chilblain lupus, lupus nephritis, systemic lupus erythematosus, macular degeneration, uveitis, irritable bowel syndrome, Croesia, Sjögren's syndrome, fibromyalgia, chronic fatigue syndrome, chronic fatigue immunodeficiency syndrome, myalgiatic encephalomyelitis, amyotrophic lateral sclerosis, Parkinson's disease, and multiple sclerosis.

[0025] One embodiment of the present invention provides a food composition for preventing or improving inflammatory diseases comprising a peptide having the amino acid sequence of SEQ ID NO. 1.

[0026] One embodiment of the present invention provides a cosmetic composition for preventing or improving inflammatory diseases comprising a peptide having the amino acid sequence of SEQ ID NO. 1. Effects of the invention

[0028] The peptide of the present invention has the effect of suppressing an inflammatory response, thereby suppressing the expression and secretion of one or more inflammatory cytokines selected from the group consisting of TNF-α, IL-1β, IL-6, IL-17, and IFNγ, or increasing the expression of IL-10. Therefore, the peptide can be usefully used as an active ingredient in a pharmaceutical composition for preventing or treating inflammatory diseases accompanied by an inflammatory response or caused by inflammation, and can also be usefully used as an active ingredient in a health functional food or cosmetic composition for preventing or improving said inflammatory diseases.

[0029] However, the effects of the present invention are not limited to those mentioned above, and other unmentioned effects will be clearly understood by those skilled in the art from the following description. Brief explanation of the drawing

[0031] Figure 1 shows the effect of inhibiting the production of the inflammatory cytokine IL-1β when the peptide of the present invention is treated at different concentrations to human astrocytes U87-MG pretreated with LPS. Figure 2 shows the effect of inhibiting the production of the inflammatory cytokine TNF-α when the peptide of the present invention is treated at different concentrations to human astrocytes U87-MG pretreated with LPS. Figure 3 shows the effect of increasing the expression of the inflammatory cytokine IL-10 when the peptide of the present invention was treated at different concentrations to human astrocytes U87-MG pretreated with LPS. Specific details for implementing the invention

[0032] The present invention will be described in more detail below.

[0033] The following specific functional descriptions are merely illustrative to explain embodiments according to the concept of the present invention, and embodiments according to the concept of the present invention may be implemented in various forms and should not be interpreted as being limited to the embodiments described herein.

[0034] Since embodiments according to the concept of the present invention may be subject to various modifications and may take various forms, specific embodiments are to be described in detail in this specification. However, this is not intended to limit the embodiments according to the concept of the present invention to specific disclosed forms, and it should be understood that they include all modifications, equivalents, and substitutions that fall within the spirit and scope of the present invention.

[0035] The terms used in this specification are used merely to describe specific embodiments and are not intended to limit the invention. Singular expressions include plural expressions unless the context clearly indicates otherwise.

[0036] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the present invention pertains. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in this specification.

[0037] According to one embodiment of the present invention, the present invention provides a peptide comprising the amino acid sequence of the peptide of SEQ ID NO. 1.

[0038] In this specification, the peptide may comprise at least one additional amino acid at the C-terminus and / or N-terminus of the peptide. The additional amino acid residues may be added individually or collectively for purposes, for example, to enhance productivity, purification, stabilization in vivo or in vitro, coupling of the complex, or detection. For example, the peptide may additionally comprise cysteine ​​residues at the C-terminus and / or N-terminus of the peptide. The additional amino acid residues may provide a "tag" for purification or detection of the peptide, for example, the tag is intended for interaction with an antibody specific to the tag. For immobilized metal affinity chromatography (IMAC), a tag such as a His6 tag, (HisGlu)3 tag ("HEHEHE" tag), "myc(cmyc) tag," or "FLAG" tag may be provided.

[0039] Additionally, a protecting group may be attached to the N- or C-terminus of the peptide to obtain chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broad spectrum of biological activity), and reduced antigenicity. In one embodiment, the N-terminus of the peptide may be attached to any one protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG); and / or the C-terminus of the peptide may be attached to any one protecting group selected from the group consisting of an amino group (-NH2) and an azide (-NHNH2). In addition, the peptide may optionally additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence prepared for a specific purpose to increase half-life or peptide stability.

[0040] The term "stability" as used in this specification may mean not only in vivo stability, which protects the peptide from attack by protein-cleaving enzymes in vivo, but also storage stability (e.g., room temperature storage stability).

[0041] A peptide comprising the amino acid sequence of SEQ ID NO. 1 of the present invention is interpreted to include the amino acid sequence of SEQ ID NO. 1 and also include a sequence that exhibits substantial identity with the sequence of SEQ ID NO. 1. The substantial identity refers to a sequence that, when any other sequence is aligned to correspond as much as possible with the sequence of the present invention described above and the aligned sequence is analyzed using an algorithm commonly used in the art, preferably exhibits at least 80% homology, more preferably at least 85% homology, even more preferably at least 90% homology, and most preferably at least 95% homology. Alignment methods for sequence comparison are known in the art.

[0042] As the peptide used in the present invention, biological functional equivalents that are amino acid sequence variants exhibiting biological activity equivalent to that of the peptide containing the amino acid sequence of SEQ ID NO. 1 of the present invention may also be used. Such amino acid variants are made based on the relative similarity of amino acid side chain substituents, e.g., hydrophobicity, hydrophilicity, charge, size, etc. By analyzing the size, shape, and type of amino acid side chain substituents, it can be seen that arginine, lysine, and histidine are all positively charged residues; alanine, glycine, and serine have similar sizes; and phenylalanine, tryptophan, and tyrosine have similar shapes. Therefore, based on these considerations, arginine, lysine, and histidine; alanine, glycine, and serine; and phenylalanine, tryptophan, and tyrosine can be considered biologically functional equivalents.

[0043] In introducing mutations, the hydropathic index of the amino acid may be considered. Each amino acid is assigned a hydropathic index based on its hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine / cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). The hydrophobic amino acid index is very important in conferring interactive biological functions of proteins. It is a known fact that similar biological activity can be achieved by substituting with amino acids having similar hydrophobic indices. When introducing a variation based on the hydrophobic index, the substitution is preferably made between amino acids exhibiting a difference in hydrophobic index within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

[0044] Meanwhile, it is also well known that substitution between amino acids with similar hydrophilicity values ​​results in proteins with uniform biological activity. The following hydrophilicity values ​​are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); aspalate (+3.0 ± 1); glutamate (+3.0 ± 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 ± 1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). When introducing a variation by referring to the hydrophilicity value, substitution is made between amino acids that exhibit a difference in hydrophilicity value within ± 2, more preferably within ± 1, and even more preferably within ± 0.5.

[0045] Amino acid exchanges in proteins that do not alter the overall activity of the molecule are known in the art. The most common exchanges are those between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly.

[0046] According to another embodiment of the present invention, the present invention provides a nucleic acid molecule comprising a nucleotide sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO. 1.

[0047] In this specification, the term "nucleic acid molecule" comprehensively includes DNA (gDNA and cDNA) and RNA molecules, and nucleotides, which are the basic building blocks of nucleic acid molecules, include not only natural nucleotides but also analogues in which sugar or base sites are modified.

[0048] It is obvious to those skilled in the art that the nucleotide sequence encoding the peptide of the present invention is sufficient to be the nucleotide sequence encoding the amino acid sequence of the peptide of SEQ ID NO. 1, and is not limited to any specific nucleotide sequence.

[0049] This is because even if a mutation occurs in the nucleotide sequence, there are cases where expressing the mutated nucleotide sequence as a protein does not lead to a change in the protein sequence. This is called codon degeneracy. Therefore, the above nucleotide sequence includes a nucleotide sequence containing functionally equivalent codons or codons coding for the same amino acid (for example, due to codon degeneracy, there are six codons for arginine or serine), or codons coding for biologically equivalent amino acids.

[0050] According to another embodiment of the present invention, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding a nucleic acid molecule comprising a nucleotide sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO. 1.

[0051] In this specification, the term "vector" includes plasmid vectors; cosmid vectors; and viral vectors such as bacteriophage vectors, adenovirus vectors, retrovirus vectors, and adeno-associated virus vectors, as means for expressing a target gene in a host cell.

[0052] According to a specific embodiment of the present invention, in a vector of the present invention, a nucleic acid molecule comprising a nucleotide sequence encoding a peptide comprising the amino acid sequence of the peptide of SEQ ID NO. 1 is operatively linked to a promoter of the vector.

[0053] In this specification, the term “operationally coupled” means a functional coupling between a nucleic acid expression regulatory sequence (e.g., a promoter, a signal sequence, or an array of transcription factor binding sites) and another nucleic acid sequence, thereby allowing the regulatory sequence to regulate the transcription and / or translation of the other nucleic acid sequence.

[0054] The recombinant vector system of the present invention can be constructed through various methods known in the art.

[0055] The vector of the present invention can typically be constructed as a vector for gene cloning or as a vector for protein expression. Additionally, the vector of the present invention can be constructed using prokaryotic or eukaryotic cells as a host.

[0056] For example, when the vector of the present invention is an expression vector and the host is a eukaryotic cell, a promoter derived from the genome of a mammalian cell (e.g., metallothionein promoter, beta actin promoter, human cycloglobin promoter and human muscle creatine promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, HSV tk promoter, mouse mammary tumor virus (MMTV) promoter, HIV LTR promoter, Moloney virus promoter, Epstein-Barr virus (EBV) promoter and Rhooussagoma virus (RSV) promoter) may be used, and these generally have a polyadenylation sequence as a transcription termination sequence.

[0057] The vector of the present invention may be fused with other sequences to facilitate the purification of polypeptides or proteins expressed therefrom. Examples of sequences to be fused include glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA), and His(hexahistidine; Quiagen, USA).

[0058] Meanwhile, the expression vector of the present invention includes antibiotic resistance genes commonly used in the art as selection markers, such as resistance genes for ampicillin, gentamicin, cabbageillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, and tetracycline.

[0059] According to another embodiment of the present invention, the present invention provides a host cell transformed with the recombinant vector.

[0060] Host cells capable of stably and continuously cloning and expressing the vector of the present invention are known in the art, and any host cell may be used. For example, suitable eukaryotic host cells for the vector include, but are not limited to, monkey kidney cells 7 (COS7), NSO cells, SP2 / 0, Chinese hamster ovary (CHO) cells, 138, baby hamster kidney (BHK) cells, MDCK, myeloma cell line, HuT 78 cells, and HEK-293 cells.

[0061] In this specification, the terms “transformed,” “transduced,” or “transfected” refer to the process in which exogenous nucleic acids are delivered or introduced into a host cell. “Transformed,” “transduced,” or “transfected” cells are cells that have been transformed, transduced, or transfected with exogenous nucleic acids, and said cells include said cells and progeny cells resulting from the passage of said cells.

[0062] The anti-inflammatory activity of the present invention refers to suppressing inflammation, and the inflammation is a type of defense response of biological tissue to a stimulus, referring to a pathological condition of an abscess formed when tissues or cells are damaged or infected by various infectious agents such as bacteria, fungi, viruses, or allergens originating from the outside. Furthermore, since the inflammatory response involves complex physiological reactions such as the activation of enzymes, secretion of inflammatory mediators, fluid infiltration, cell migration, and tissue destruction involving inflammatory mediators and immune cells in local blood vessels and body fluids, as well as external symptoms such as erythema, edema, fever, and pain, the peptide of the present invention has an activity that suppresses inflammation, and thus has the effect of reducing and improving a series of pathological conditions and symptoms as described above.

[0063] In addition, the peptide of the present invention can inhibit the expression of one or more inflammatory cytokines selected from the group consisting of TNFα, IL-1β, IL-6, IL-17, and IFNγ. In an inflammatory response, when a wound occurs or an external infectious agent invades the wound site and enters the body, leukocytes responsible for the initial stage of the immune response gather around the wound site or the infectious agent and induce an inflammatory response by expressing and secreting inflammation-related cytokines. Therefore, anti-inflammatory activity can be exhibited by inhibiting the expression of inflammatory cytokines, and the anti-inflammatory activity and inflammation-inhibiting effect of the peptide of the present invention can be confirmed by verifying the expression level of the said inflammatory cytokines.

[0064] The above-mentioned inhibited inflammatory cytokines may be one or more selected from the group consisting of TNFα, IL-1β, IL-6, IL-17, and IFNγ. TNFα, short for 'tumor necrosis factor α', is a cytokine produced and secreted by macrophages and various cells that are activated during immune responses to bacterial infections or tumor diseases. It is known as a major mediator of inflammatory responses and plays an important role in inflammatory diseases such as rheumatoid arthritis (RA), psoriatic arthritis, Crohn's disease, psoriasis, and ankylosing spondylitis (AS). IL-6 (interleukin 6) is a cytokine produced by macrophages and various lymphocytes that promotes inflammatory responses and is known to cause inflammatory diseases if produced in excess. IL-17 (interleukin 17) is also an inflammation-promoting cytokine that is produced by Th17 cells and plays a role in inducing or mediating inflammatory responses. The above-mentioned IFNγ (interferon γ) can be produced in T lymphocytes and macrophages and is secreted in response to infection by viruses or bacteria that have invaded from the outside, and is known to play a role in autoimmune or autoinflammatory diseases. Therefore, the peptide of the present invention has the effect of suppressing inflammation by inhibiting the expression of such inflammatory cytokines and inhibiting the secretion of expressed cytokines.

[0065] In addition, the peptide of the present invention can increase the expression of the inflammatory cytokine IL10. IL10 (Interleukin 10) can exhibit anti-inflammatory activity by inhibiting the expression of inflammation-related enzymes such as iNOS (inducible Nitric Oxide Synthase) and COX-2 (inducible Cyclooxygenase) in macrophages.

[0066] According to another embodiment of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory diseases comprising a peptide having the amino acid sequence of SEQ ID NO. 1.

[0067] The above-mentioned inflammatory disease refers to a pathological condition that causes inflammation induced by neutrophil chemotaxis among white blood cells, and may include any disease that develops due to an inflammatory response or involves an inflammatory response. For example, the above inflammatory diseases include rhinitis, bronchitis, periodontitis, pancreatitis, gastritis, gastric ulcer, inflammatory skin disease, atopic dermatitis, encephilitis, sepsis, inflammatory enteritis, chronic obstructive pulmonary disease, septicemic shock, pulmonary fibrosis, undifferentiated spondyloarthrosis, undifferentiated arthropathy, arthritis, inflammatory osteolysis, chronic inflammatory disease caused by chronic viral or bacterial infection, colitis, inflammatory bowel disease, type 1 diabetes, rheumatoid arthritis, reactive arthritis, osteoarthritis, psoriasis, scleroderma, osteoporosis, atherosclerosis, myocarditis, endocarditis, pericarditis, cystic fibrosis, Hashimoto's thyroiditis, Graves' disease, leprosy, syphilis, Lyme disease, borreliosis, neuro-borreliosis, tuberculosis, sarcoidosis, lupus, It may be discoid lupus, chilblain lupus, lupus nephritis, systemic lupus erythematosus, macular degeneration, uveitis, irritable bowel syndrome, Croesia, Sjögren's syndrome, fibromyalgia, chronic fatigue syndrome, chronic fatigue immunodeficiency syndrome, myalgic encephalomyelitis, amyotrophic lateral sclerosis, Parkinson's disease, or multiple sclerosis, but is not limited thereto.

[0068] The pharmaceutical composition of the present invention may be used to prevent the occurrence of inflammatory diseases by inhibiting the expression or secretion of factors that induce an inflammatory response, or to inhibit additional inflammatory responses occurring in damaged or wounded cells of a patient with the disease, thereby inhibiting the worsening of the condition and treating the disease.

[0069] The term "prevention" in this specification means treatment that inhibits, delays, prevents, or protects against the onset of a disease or diseased state. The term "treatment" in this specification means reduction, inhibition, soothing, or eradication of a diseased state. It refers to any form of treatment that provides effects including improvement of the individual's condition (e.g., one or more symptoms), delay of disease progression, delay of symptom onset, or slowing of symptom progression. Accordingly, "treatment" and "prevention" are not intended to mean the cure or complete elimination of symptoms.

[0070] More specifically, in the present invention, "prevention" means any act of suppressing or delaying the onset of an inflammatory disease, "treatment" means any act of improving or beneficially altering an inflammatory disease by administering a pharmaceutical composition according to the present invention, and "improvement" means any act of reducing parameters related to an inflammatory disease, such as the degree of symptoms, by administering a composition according to the present invention.

[0071] The above "individual" refers to a subject requiring treatment for a disease, and more specifically, to mammals such as human or non-human primates, mice, dogs, cats, horses, and cattle.

[0072] The pharmaceutical composition of the present invention may be formulated as a powder, granule, tablet, coated tablet, pill, sugar-coated tablet, capsule, liquid, suspension, gel, syrup, slurry, suppository, enema, emulsion, paste, ointment, cream, lotion, powder, spray, or suspension.

[0073] The pharmaceutical composition of the present invention may further include a suitable carrier, excipient, or diluent commonly used in the manufacture of pharmaceutical compositions. Examples include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, mannitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrridone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.

[0074] The weight ratio between the above peptide and the pharmaceutically acceptable carrier may be, for example, 500:1 to 1:500, and as an example, said weight ratio may be 450:1 to 1:450, 400:1 to 1:400, 350:1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1:6, 4:1 to 1:4, or It may be 2:1 to 1:2, but is not limited thereto.

[0075] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, a pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable risk-to-harm ratio applicable to medical treatment, and the effective dose level may be determined based on factors including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and elimination rate, duration of treatment, concurrently used drugs, and other factors well known in the medical field. Although the amount of the composition may vary depending on the patient's age, gender, and weight, a sufficient amount may be administered once or several times daily so that the peptide reaches a blood concentration useful for the treatment of inflammatory diseases.

[0076] The dosage of the above composition may be increased or decreased depending on the route of administration, severity of the disease, gender, body weight, age, etc. Therefore, the above dosage does not limit the scope of the present invention in any way.

[0077] The pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration are expected, for example, intracerebral administration, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal (intradural) injection, sublingual administration, non-mucosal administration, rectal insertion, vaginal insertion, ocular administration, ear administration, nasal administration, inhalation, spray through the mouth or nose, skin administration, transdermal administration, etc.

[0078] The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as a single or multiple doses. It is important to administer an amount that obtains maximum effect with a minimum amount without side effects by taking all of the above-mentioned factors into consideration, and this can be easily determined by a person skilled in the art to which the present invention belongs.

[0079] According to another embodiment of the present invention, the present invention provides a health functional food composition for the prevention or improvement of inflammatory diseases comprising a peptide having the amino acid sequence of SEQ ID NO. 1.

[0080] The above-mentioned health functional food may be used for the prevention or improvement of a disease, either simultaneously with or separately from a drug for treatment, before or after the onset of the disease.

[0081] In the health functional food of the present invention, the active ingredient may be added directly to the food or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient may be appropriately determined according to its purpose of use (for prevention or improvement). Generally, when manufacturing food or beverages, the composition of the present invention may be added in an amount of preferably 15% by weight or less, and preferably 10% by weight or less, relative to the raw materials. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the above amount may be less than the above range.

[0082] The health functional food of the present invention may include other ingredients as essential ingredients without special limitations, in addition to the active ingredients mentioned above. For example, it may include various flavoring agents or natural carbohydrates as additional ingredients, such as in conventional beverages. Examples of the natural carbohydrates mentioned above may be monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; polysaccharides, e.g., dextrin, cyclodextrin, etc., and conventional sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents other than those mentioned above, natural flavoring agents (taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The proportion of the natural carbohydrates may be appropriately determined by the choice of a person skilled in the art.

[0083] In addition to the above, the health functional food of the present invention may include various nutritional supplements, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These ingredients may be used independently or in combination, and the proportion of these additives may also be appropriately selected by a person skilled in the art.

[0084] According to another embodiment of the present invention, the present invention provides a cosmetic composition for the prevention or improvement of inflammatory diseases comprising a peptide having the amino acid sequence of SEQ ID NO. 1. The cosmetic composition of the present invention can be usefully used for the prevention or improvement of inflammatory diseases such as inflammatory skin diseases and atopic dermatitis that occur on the skin.

[0085] The above peptide may be included in an amount of 0.001 to 30 weight% of the total 100 weight% of the cosmetic composition, for example, 0.1 to 20 weight%, 0.1 to 10 weight%, 1 to 10 weight%, or 2 to 5 weight%, but is not limited thereto.

[0086] A cosmetic composition comprising the peptide of the present invention as an active ingredient may additionally include other ingredients that, for example, have a synergistic effect on the activity of the peptide, within a range that does not affect the anti-inflammatory activity of the peptide. For example, it may include auxiliary ingredients commonly used in the field of cosmetics or dermatology, such as fatty substances, organic solvents, solvents, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or non-ionic emulsifiers, fillers, metal ion chelating agents and chelating agents, preservatives, vitamins, blockers, humectants, essential oils, dyes, pigments, fragrances, hydrophilic or lipophilic active agents, lipid vesicles, or any other ingredients commonly used in cosmetics, and said ingredients may be included in amounts commonly used in the field of cosmetics or dermatology.

[0087] The cosmetic composition of the present invention can be prepared in any formulation commonly manufactured in the art, for example, as a solution, suspension, emulsion, gel, lotion, essence, cream, powder, soap, shampoo, rinse, pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation, or spray.

[0088] In the case where the above formulation is a solution or an emulsion, a solvent, a solubilizing agent, or an emulsifying agent may be used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan may be used. In the case where the above formulation is a suspension, a liquid diluent such as water, ethanol, or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, aluminum metahydroxide, microcrystalline cellulose, bentonite, agar, or tracanthenic acid may be used as a carrier component. In the case where the above formulation is a cream or gel, wax, paraffin, tracanth, animal oil, starch, cellulose derivative, silicone, bentonite, polyethylene glycol, silica, zinc oxide, or talc may be used as a carrier component. In the case where the above formulation is a powder or spray, a propellant such as silica, talc, aluminum hydroxyl group, lactose, calcium silicate, chlorofluorohydrocarbon, propane / butane, or dimethyl ether may be included as a carrier component. In the case where the above formulation is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, imidazolinium derivative, isethionate, methyl taurate, sarcosinate, fatty acid amide ether sulfate, aliphatic alcohol, alkylamidobetaine, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc. may be used as a carrier component.

[0090] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0092] Example 1: Synthesis of Peptides

[0093] Peptides having the amino acid sequence of SEQ ID NO. 1 listed in Table 1 below were synthesized using an automated peptide synthesizer (Milligen 9050, Millipore, USA), and these synthesized peptides were purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). An ACQUITY UPLC BEH300 C18 column (2.1 mm Y 100 mm, 1.7 µm, Waters Co, USA) was used.

[0094] Sequence number Amino acid sequence (N'-> C') 1 IVIRKKLGWNYHEE

[0095] ※IVIRKKLGWNYHEE: Ile-Val-Ile-Arg-Lys-Lys-Leu-Gly-Trp-Asn-Tyr-His-Glu-Glu

[0097] Example 2: Confirmation of inhibitory effect on inflammatory cytokine expression by peptide treatment

[0098] Human astrocytes U87-MG were treated with LPS, an inflammation-inducing antigen, to induce an inflammatory response in the cells. Subsequently, a peptide containing the amino acid sequence of SEQ ID NO. 1 was added at concentrations of 0.001 mM, 0.01 mM, 0.1 mM, and 1 mM, and treated for 16 hours. Afterward, Real-Time qPCR was performed using the primers shown in Table 2 below. As a result, the expression levels of inflammatory cytokines IL-1β and TNF-α were measured and are shown in Figures 1 and 2. Referring to Figures 1 and 2, it was confirmed that the expression levels of inflammatory cytokines IL-1β and TNF-α were inhibited in a concentration-dependent manner.

[0099] Sequence number denomination Sequence (5'-> 3') 2 IL-1β Forward primer CCACAGACCTTCCAGGAGAATG 3 IL-1β reverse primer GTGCAGTTCAGTGATCGTACAGG 4 TNF-α Forward primer CTCTTCTGCCTGCTGCACTTTG 5 TNF-α Reverse Primer ATGGGCTACAGGCTTGTCACTC

[0101] Example 3: Confirmation of the effect of peptide treatment on increasing cytokine IL-10 expression

[0102] Human astrocytes U87-MG were treated with LPS, an inflammation-inducing antigen, to induce an inflammatory response in the cells. Subsequently, a peptide containing the amino acid sequence of SEQ ID NO. 1 was added at concentrations of 0.001 mM, 0.01 mM, 0.1 mM, and 1 mM. After treatment for 16 hours, the expression level of the inflammatory cytokine IL-10 was measured using ELISA and is shown in Figure 3. Referring to Figure 3, it was confirmed that the expression level of the inflammatory cytokine IL-10 increased.

[0103] When considering the results of the above experimental examples, it was confirmed that even in cells with induced inflammation, treatment with the peptide of the present invention reduces the amount of proteins or gene expression related to the inflammation response, and reduces the expression and secretion of cytokines that promote the inflammation response, thereby having an inhibitory effect on the inflammation response. Furthermore, when a larger amount of the peptide of the present invention is applied, the above effect is more pronounced; thus, it can be seen that the inhibitory effect on the inflammation response observed in the results of the above experimental examples is due to the peptide of the present invention.

[0104] Furthermore, it was confirmed that inhibiting the expression of inflammation-related enzymes such as iNOS (inducible nitric oxide synthase) and COX-2 (inducible cyclooxygenase) in macrophages increased the expression and secretion of IL-10, a cytokine exhibiting anti-inflammatory activity, thereby having an inhibitory effect on the inflammatory response.

[0106] Foregoing, specific parts of the present application have been described in detail. It is evident to those skilled in the art that such specific descriptions are merely preferred embodiments and that the scope of the present application is not limited thereto. Accordingly, the actual scope of the present application shall be defined by the appended claims and their equivalents. Furthermore, various modifications and improvements by those skilled in the art using the basic concept of the present application as defined in the claims are also within the scope of the rights of the present application.

Claims

Claim 1 A peptide composed of the amino acid sequence of SEQ ID NO.

1. Claim 2 The peptide of claim 1, wherein the peptide has anti-inflammatory activity. Claim 3 The peptide of claim 2, wherein the peptide inhibits the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α, IL-1β, IL-6, IL-17, and IFNγ, or increases the expression of IL-10. Claim 4 A pharmaceutical composition for the prevention or treatment of inflammatory diseases, comprising a peptide of any one of claims 1 to 3 as an active ingredient. Claim 5 In claim 4, the inflammatory disease is rhinitis, bronchitis, periodontitis, pancreatitis, gastritis, gastric ulcer, inflammatory skin disease, atopic dermatitis, encephilitis, sepsis, inflammatory enteritis, chronic obstructive pulmonary disease, septicemic shock, pulmonary fibrosis, undifferentiated spondyloarthrosis, undifferentiated arthropathy, arthritis, inflammatory osteolysis, chronic inflammatory disease caused by chronic viral or bacterial infection, colitis, inflammatory bowel disease, type 1 diabetes mellitus, rheumatoid arthritis, reactive arthritis, osteoarthritis, psoriasis, scleroderma, osteoporosis, atherosclerosis, myocarditis, endocarditis, pericarditis, cystic fibrosis, Hashimoto's thyroiditis, Graves' disease, leprosy, syphilis, Lyme disease, borreliosis, neuro-borreliosis, tuberculosis, sarcoidosis. A pharmaceutical composition for the prevention or treatment of inflammatory diseases, comprising one or more selected from the group consisting of lupus, discoid lupus, chilblain lupus, lupus nephritis, systemic lupus erythematosus, macular degeneration, uveitis, irritable bowel syndrome, Croesia, Sjögren's syndrome, fibromyalgia, chronic fatigue syndrome, chronic fatigue immunodeficiency syndrome, myalgiatic encephalomyelitis, amyotrophic lateral sclerosis, Parkinson's disease, and multiple sclerosis. Claim 6 A health functional food composition for the prevention or improvement of inflammatory diseases, comprising a peptide of any one of claims 1 to 3 as an active ingredient. Claim 7 A cosmetic composition for the prevention or improvement of inflammatory diseases, comprising a peptide of any one of claims 1 to 3 as an active ingredient.

Images