Pharmaceutical composition for treating or preventing cancer comprising inhibitor of NUTM1 and anticancer agent as active ingredients and use thereof
Patent Information
- Application Number
- KR1020250015234
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-02-06
- Publication Date
- 2026-08-14
Smart Images

Figure PAT00002_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of cancer comprising a NUTM1 expression or activity inhibitor; and an anticancer agent as an active ingredient, and to the use thereof. Background Technology
[0002] Cancer treatment methods are broadly classified into three categories: surgical therapy, chemotherapy, and radiation therapy. Currently, cytotoxic anticancer drugs account for the majority of anticancer agents used in chemotherapy. Although advancements in cytotoxic anticancer drugs have been steady, unfortunately, many cancer patients do not respond to initial treatment, experience recurrence after an initial response, and ultimately die from advanced metastatic disease. Therefore, a continuous focus on the design and discovery of novel anticancer drugs remains crucial.
[0003] Accordingly, research targeting mutated proteins that induce cancer progression is gaining attention; however, side effects sometimes occur because the binding strength between biomarker proteins specifically present in cancer cells and anticancer drugs is not specific. Furthermore, although conventional targeted therapies and immunotherapies are less toxic and more effective than traditional chemical anticancer drugs, limitations in treatment are still reported. Consequently, there is an urgent need for the development of therapies that specifically target cancer cells in the treatment of such cancers. In particular, modern anticancer drug development is based on the genomes of cancer cells, enabling treatment for patients who were previously unable to receive therapy due to the lack of personalized treatments. This contributes to efficient treatment, increased survival rates, and reduced side effects.
[0004] Among these, technology based on Antibody-Drug Conjugates (ADCs), which combine a cytotoxic drug with an antibody that binds to an antigen expressed on the surface of cancer cells and capable of internalization, is gaining attention for its ability to selectively deliver drugs to cancer cells, thereby accumulating the drug within the cells and causing cancer cell death.
[0005] Meanwhile, NUT (Nuclear protein in testis) carcinoma [NUT carcinoma (NC), formerly known as NUT midline carcinoma (NMC)] is a fatal malignant tumor first reported in the literature in 1991, with very low survival rates even with chemotherapy. These NUT carcinomas generally exhibit undifferentiated or poorly differentiated histological characteristics, but in some cases, keratin pearl structures are formed due to abrupt keratinization, and the differentiated state indicates a relatively good prognosis.
[0006] The genetic characteristics of NUT carcinoma involve the rearrangement of the NUTM1 (NUT midline carcinoma family member 1) gene with a series of partner genes, with interchromosomal translocations between chromosomes 15q and 19p being primarily observed, forming a BRD4 (Bromodomain containing protein 4)-NUTM1 fusion oncoprotein. This BRD4-NUTM1 fusion oncoprotein induces the overexpression of the oncoprotein Myc through chromatin remodeling, leading to the disruption of the gene expression regulatory network. To date, it is known that more than 70% of NUT carcinomas are caused by the BRD4-NUT fusion gene. While BRD3 or NSD3 have been reported as partner genes for the NUT fusion gene, these are also BET (bromodomain and extra terminal) proteins belonging to the same family as BRD4. Accordingly, the use of BET small molecular inhibitors that inhibit BET function has been proposed as a new treatment method for NUT carcinomas; however, BET small molecular inhibitors have limitations, such as low specificity for oncogenes, which severely affects the expression of normal genes and causes significant side effects, as well as the development of drug resistance after a certain period.
[0007] Therefore, as a more effective approach to improving cancer prevention and treatment, there is a need for a method that can maximize the therapeutic effect of cancer based on various causative factors acting individually or collectively that initiate or promote the onset of cancer. Prior art literature
[0008] (Patent Document 0001) KR 10-2351164 B1(Patent Document 0002) KR 10-2731972 B1 The problem to be solved
[0009] Accordingly, the inventors have made diligent research efforts to develop an effective and novel drug treatment for cancer, and as a result, have completed the present invention by identifying that if a cancer that is refractory to conventional anticancer drugs can be changed (e.g., differentiated) to a state responsive to conventional targeted anticancer therapy depending on the presence or absence (e.g., inhibition) of a therapeutic target (e.g., NUTM1) of the cancer (e.g., NUT carcinoma), then by combining a targeted anticancer drug with an inhibitor that inhibits the expression level of the target gene, not only can excellently maximized cancer treatment efficacy be achieved, but personalized medicine can also be realized.
[0010] Accordingly, one objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cancer comprising a NUTM1 inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients.
[0011] In addition, another objective of the present invention is to provide a pharmaceutical composition for enhancing the responsiveness of a tumor-specific antigen-targeted anticancer drug, comprising a NUTM1 inhibitor as an active ingredient.
[0012] In addition, another objective of the present invention is to provide a tumor-specific antigen-targeted anticancer agent adjuvant composition comprising a NUTM1 inhibitor as an active ingredient.
[0013] In addition, another objective of the present invention is to provide a health functional food for preventing or improving cancer, comprising a NUTM1 inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients.
[0014] In addition, another objective of the present invention is to provide a method for providing information necessary for the diagnosis of a patient who exhibits a response to a tumor-specific antigen-targeted anticancer agent in patients with NUT carcinoma. means of solving the problem
[0015] The terms used in this specification are for illustrative purposes only and should not be interpreted as being limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprising" or "having" are intended to indicate the existence of the features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, and should be understood as not precluding the existence or addition of one or more other features, numbers, steps, actions, components, parts, or combinations thereof.
[0016] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as generally understood by those skilled in the art to which the embodiments pertain. Terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant technology, and should not be interpreted in an ideal or overly formal sense unless explicitly defined in the present invention.
[0018] The present invention will be described in detail below.
[0020] According to one aspect of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of cancer comprising a NUTM1 inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients.
[0021] In the present invention, the term “NUTM1 (NUT midline carcinoma family member 1)” is known as the NUTM1 gene on chromosome 15, FAM22H or C15orf55, and is known to encode the genetic information of NUT (Nuclear protein in testis, NUT family member 1), a nuclear protein that is mainly expressed in testicular tissue.
[0022] The NUTM1 inhibitor of the present invention may be any inhibitor known in the art as long as it can achieve the purpose of the present invention, for example, may be one or more selected from the group consisting of a CRISPR / Cas system comprising a guide RNA (guide RNA or gRNA) and a Cas protein (CRISPR associated protein) that target the NUTM1 gene, antisense oligonucleotide (ASO), siRNA (small interference RNA), shRNA (short hairpin RNA), miRNA (microRNA), and ribozyme, and preferably may be a CRISPR / Cas system comprising a guide RNA and a Cas protein that target the NUTM1 gene, but is not limited thereto.
[0023] In addition, the NUTM1 inhibitor may be one or more selected from the group consisting of compounds, peptides, peptide mimics, substrate analogs, aptamers, and antibodies that specifically bind to NUT proteins, and is not limited thereto as long as it can achieve the purpose of the present invention.
[0024] In addition, the guide RNA targeting the NUTM1 gene may be a guide RNA targeting the NUTM1 gene composed of a nucleotide sequence selected from the group consisting of SEQ ID NOs 1 to 12.
[0025] According to one embodiment of the present invention, a guide RNA composed of a nucleotide sequence selected from the group consisting of SEQ ID NOs 1 to 9 may target different sequences of the exon 3 region of the NUTM1 gene.
[0026] According to one embodiment of the present invention, the guide RNA composed of the nucleotide sequence of SEQ ID NO. 10 may target a portion of the sequence of the exon 6 region of the NUTM1 gene.
[0027] According to one embodiment of the present invention, a guide RNA composed of a nucleotide sequence selected from the group consisting of SEQ ID NOs 11 to 12 may target different sequences of the exon 8 region of the NUTM1 gene.
[0028] In the present invention, the guide RNA may be a dual guide RNA composed of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA), or a single-stranded guide RNA (sgRNA) in which the crRNA and tracrRNA are linked together. Preferably, it may be a single-stranded guide RNA (sgRNA).
[0029] Meanwhile, the present invention may provide a recombinant guide RNA vector for targeting the NUTM1 gene, comprising a sequence encoding the guide RNA.
[0030] As used in the present invention, the term “vector” refers to DNA capable of introducing a target DNA fragment into a host cell and enabling proliferation, and is also referred to as a cloning vehicle. “Expression vector” refers to a recombinant DNA molecule comprising a target coding sequence and an appropriate nucleic acid sequence essential for expressing the coding sequence operabably linked in a specific host organism. In the present invention, the term vector may be used interchangeably with expression vector.
[0031] In the present invention, the vector may use other forms of expression vectors that provide equivalent functions, such as a Virus-Like Particle (VLP), a Lentiviral vector, an Adeno-Associated Virus (AAV) vector, an Adenoviral vector, a Herpesvirus vector, a Retroviral vector, a Vaccinia virus vector, a Poxvirus vector, or a Herpes simplex virus vector, and preferably, a Virus-Like Particle (VLP) may be used.
[0032] In addition, the present invention may provide a CRISPR / Cas9 complex for inhibiting NUTM1 gene expression, comprising the guide RNA vector; and a Cas9 nuclease.
[0033] In the present invention, the term “Cas9” refers to “CRISPR-Cas9,” and CRISPR-Cas9 is a third-generation gene scissors that recognizes, cuts, and edits specific nucleotide sequences to be used, and is useful for performing operations to insert specific genes at target sites in the genome or stop the activity of specific genes simply, quickly, and efficiently.
[0034] In the present invention, the Cas9 protein refers to an essential protein element in the CRISPR / Cas system, and when it forms a complex with two RNAs called crRNA and tracrRNA, it forms an active endonuclease or nickase.
[0035] Cas9 protein or genetic information may be obtained from known databases such as GenBank of the NCBI (National Center for Biotechnology Information), but is not limited thereto. Additionally, depending on the purpose, a person skilled in the art may appropriately attach additional domains to the Cas9 protein.
[0036] In the present invention, the Cas9 protein may include not only wild-type Cas9 but also all variants of Cas9 as long as they have the function of a nuclease for gene editing. In the present invention, the origin of the Cas9 protein is not limited, and as a non-limiting example, Streptococcus pyogenes ( Streptococcus pyogenes ), Streptococcus thermophilus( Streptococcus thermophilus ), Streptococcus genus ( Streptococcus sp.), Streptomyces pristinespiralis ( Streptomyces pristinaespiralis ), Streptomyces viridochromogenes ( Streptomyces viridochromogenes ), Streptosporangium roseum( Streptosporangium roseum ), Streptosporangium roseum( Streptosporangium roseum ), Campylobacter jejuni( Campylobacter jejuni ), Staphylococcus auricularis( Staphylococcus auricularis It may be derived from a bacterial species selected from the group consisting of ), and a person skilled in the art may appropriately select and use it. In one embodiment of the present invention, Streptococcus pyogenes ( Streptococcus pyogenes ) derived Cas9 protein( sp Cas9) was used, but is not limited thereto.
[0037] The term “inhibition of gene expression” used in the present invention refers to any act that reduces gene expression, and specifically, it can be achieved by introducing gene knock-out, knock-down, or mutations such as deletion, duplication, inversion, or replacement into the gene DNA sequence.
[0038] The present invention induces a modification in the target nucleic acid sequence by bringing the CRISPR / Cas9 complex, comprising the guide RNA and Cas9 protein targeting the NUTM1 gene described above, into contact with the target nucleic acid encoding the NUTM1 gene, wherein the modification may be a deletion, insertion, substitution, or insertion and deletion (indel) of at least one nucleotide relative to the wild-type NUTM1 gene sequence; or a cleavage of the target nucleic acid.
[0039] Transduction of the above guide RNA and Cas9 protein into cells may be performed by directly introducing a pre-assembled complex of guide RNA and Cas9 protein (ribonucleic acid protein) into immune cells by conventional methods (e.g., electroporation, lipofection, etc.), or by introducing a DNA molecule encoding the guide RNA and a gene encoding the Cas9 protein (DNA or mRNA) (or a gene having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence homology therewith) into cells contained in a single vector or separate vectors (e.g., plasmids, viral vectors, etc.), or through mRNA delivery. In one embodiment of the present invention, the nucleic acid encoding the Cas9 protein is contained in a virus-like particle (VLP).
[0040] The above Cas9 protein, guide RNA, ribonucleoprotein (RNP) containing the same, or a vector containing a nucleic acid encoding one or more of these genes can be delivered into a living organism or into a cell through a suitable method selected from various methods known in the art, such as electroporation, lipofection, viral vectors, nanoparticles, as well as PTD (Protein translocation domain) fusion protein methods.
[0041] In addition, the NUTM1 inhibitor of the present invention is characterized by increasing the expression level or activity of one or more tumor-specific antigens selected from the group consisting of Trop2 (Trophoblast cell surface antigen 2), epidermal growth factor receptor (EGFR), vascular endothelial growth factor receptor (VEGFR), CD20, CD38, RNAK-L, BTK, Bcr-abl, PDGFR / FGFR series, MEK / RAF, HER2 / Neu, ubiquitin, JAK, MAP2K, ALK, PARP, tumor growth factor β receptor (TGFβ Receptor), Proteasome, Bcl-2, C-Met, VR1, VR2, VR3, c-kit, AXL, RET, Braf, DNA methyltransferase (DNMT), CDK4 / 6, and STING, and preferably, the level or activity of Trop2 It can be increased.
[0042] In addition, the above tumor-specific antigen-targeted anticancer agent is a targeted anticancer agent that targets one or more tumor-specific antigens selected from the group consisting of Trop2, EGFR, VEGFR, CD20, CD38, RNAK-L, BTK, Bcr-abl, PDGFR / FGFR series, MEK / RAF, HER2 / Neu, ubiquitin, JAK, MAP2K, ALK, PARP, TGFβ Receptor, Proteasome, Bcl-2, C-Met, VR1, VR2, VR3, c-kit, AXL, RET, Braf, DNMT, CDK4 / 6, and STING, and preferably targets Trop2.
[0043] In this regard, it has been established that the guide RNA according to the present invention specifically binds to the NUTM1 gene, causing gene editing to occur in the NUTM1 gene via the CRISPR / Cas system, and ultimately inhibits the expression of the BRD4-NUTM1 fusion gene, thereby inhibiting the proliferation of NUT cancer cells and exhibiting anticancer effects such as apoptosis (see KR 10-2731972 B1). However, interestingly, in the present invention, when the NUTM1 expression level is inhibited by a NUTM1 inhibitor, although the expression level of tumor-specific antigens should decrease with cancer cell death according to the technical concept known in the art, conversely, it was discovered for the first time that Trop2, a tumor-specific antigen, increases according to the degree of differentiation of NUT carcinoma.
[0044] In other words, the present invention confirmed an increase in Trop2 expression in NUT carcinomas when NUTM1 gene expression was suppressed by NUTM1 gene editing, and furthermore, through the analysis of data from NUT carcinoma patients, it was discovered for the first time that a high degree of differentiation in NUT carcinomas and TROP2-positive patients are associated with a relatively good prognosis. Therefore, the feature of the present invention is that excellent cancer prevention or treatment activity is exhibited as a synergistic complementary effect occurs through the combination of a NUTM1 inhibitor and a TROP2-targeted anticancer agent.
[0045] Accordingly, the present invention establishes a strategy to recommend TROP2 targeted therapy to NUT cancer patients with high differentiation and TROP2 positivity, and to induce differentiation and TROP2 expression through NUTM1 gene editing to enable subsequent TROP2 targeted therapy to NUT cancer patients with low differentiation and TROP2 positivity. Through the strategy described above, it has been proven that excellent desired effects are achieved by administering a Trop2-targeted anticancer agent, which is a therapeutic agent targeting Trop2.
[0046] In the present invention, the anticancer agent may be characterized as being a Trop2-targeted anticancer agent, although any anticancer agent having an effect of treating cancer may be used without limitation. The Trop2-targeted anticancer agent may be any anticancer agent known in the art that targets Trop2, provided that the objective of the present invention is achieved. Preferably, it may be one or more selected from the group consisting of anti-Trop2 antibodies that specifically bind to Trop2 proteins, anti-Trop2 antibody-drug conjugates (ADCs), anti-Trop2 antibody-cytokine fusion proteins (ACFPs, immunocytokines), peptides, peptide mimics, substrate analogs, aptamers, and compounds. For example, the Trop2-targeted anticancer agent may be sacituzumab, sacituzumab-IFN-β mutein fusion protein, sacituzumab-govitecan (Trodelvy). It may be one or more selected from the group consisting of datopotamab deruxtecan (DS-1062), ESG-401, SKB-264, DAC-02 and BAT-8003, but is not limited thereto.
[0047] In one embodiment of the present invention, as the Trop2-targeted anticancer agent, sacituzumab, an anti-Trop2 antibody that specifically binds to the Trop2 protein, Sacituzumab-IFN-β mutein fusion protein, an ACFP, and Sacituzumab acituzumab Govitecan, an ADC, were used.
[0048] In the present invention, the term "prevention" refers to any act of suppressing cancer or delaying the onset of cancer by administering the above-mentioned pharmaceutical composition. The term "treatment" refers to any act of improving or beneficially altering the symptoms of cancer by administering the above-mentioned pharmaceutical composition.
[0049] In the present invention, the cancer is characterized as being a BRD4-NUTM1 positive solid tumor, and primarily includes squamous cell carcinoma or NUT carcinoma in upper tissues of the body such as the thymus, trachea, and lungs, and preferably may be lung cancer, thymic cancer, renal cancer, or NUT carcinoma. The NUT carcinoma is not limited to a specific tissue and may occur in any tissue.
[0050] In addition, according to a preferred embodiment of the present invention, the NUT carcinoma may be in an undifferentiated or differentiated state.
[0051] In the present invention, the pharmaceutical composition may be used in a method for preventing or treating cancer, and specifically, the method for preventing or treating cancer may include the step of administering it to an individual who has developed cancer or is expected to develop cancer.
[0052] The term "administration" in the present invention means introducing the composition to an individual by an appropriate method.
[0053] The composition of the present invention may be administered to a patient who is a target individual in a pharmaceutically effective amount, and the patient who is to be administered may be a mammal, preferably a human, monkey, or rodent (mouse, rat), and in particular may be any mammal, e.g., a human, who has a disease or symptom associated with BRD4-NUTM1 fusion gene expression, or who has a BRD4-NUTM1 fusion gene and requires suppression of BRD4-NUTM1 and / or NUTM1 expression.
[0054] The above “pharmaceutical effective dose” refers to an amount capable of producing a desired effect, i.e., a gene editing effect, at the application site, and can be prescribed in various ways depending on factors such as formulation method, mode of administration, patient's age, weight, sex, pathological condition, time of administration, route of administration, elimination rate, and response responsiveness.
[0055] The composition of the present invention may be prepared by including one or more pharmaceutically acceptable carriers in addition to the active ingredients described above. The pharmaceutically acceptable carrier must be compatible with the active ingredients of the present invention and may be used as a mixture of saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as needed. Additionally, diluents, dispersants, surfactants, binders, and lubricants may be added to formulate the composition into an injectable formulation such as an aqueous solution, suspension, or emulsion. Furthermore, the composition may be preferably formulated according to each disease or component by appropriate methods in the art or by methods disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton, PA).
[0056] The content and method of administration of active ingredients, etc. included in the composition of the present invention can be determined by a person skilled in the art based on the symptoms of a typical patient and the severity of the disease. In addition, it can be formulated in various forms such as powders, tablets, capsules, liquids, injections, ointments, and syrups, and may be provided in unit-dose or multi-dose containers, such as sealed ampoules and bottles.
[0057] The composition of the present invention may be administered orally or parenterally. The routes of administration of the composition according to the present invention are not limited to these, but may include, for example, oral, intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual, or topical administration. The dosage of the composition according to the present invention varies depending on the patient's body weight, age, gender, health status, diet, time of administration, method of administration, excretion rate, or severity of the disease, and can be easily determined by a person skilled in the art. In addition, the composition of the present invention can be formulated into a suitable dosage form using known techniques for clinical administration.
[0058] The present invention provides a pharmaceutical composition for the prevention or treatment of cancer comprising a NUTM1 inhibitor administered together with an effective amount of a tumor-specific antigen-targeted anticancer agent.
[0059] In one embodiment of the present invention, the tumor-specific antigen-targeted anticancer agent may be administered simultaneously with the NUTM1 inhibitor, or administered individually or sequentially, and the effective amount may vary depending on the formulation method of the pharmaceutical composition, the method of administration, the time of administration and / or the route of administration, etc., and a person skilled in the art can easily determine and prescribe an effective dosage for the intended treatment.
[0061] In addition, according to another aspect of the present invention, the present invention provides a pharmaceutical composition for enhancing the responsiveness of a tumor-specific antigen-targeted anticancer drug comprising a NUTM1 inhibitor as an active ingredient. That is, when administered together to cancer cells, the responsiveness to the tumor-specific antigen-targeted anticancer drug is enhanced, thereby allowing for a reduction in the dosage of the anticancer drug used and improving the side effects of the anticancer drug.
[0063] In addition, according to another aspect of the present invention, the present invention provides a tumor-specific antigen-targeted anticancer agent adjuvant composition comprising the aforementioned NUTM1 inhibitor as an active ingredient.
[0064] In the present invention, "adjuvant for anticancer agents" refers to a preparation that can be used adjuvantly to enhance the effect of anticancer treatments commonly used in the industry. The composition may be in the form of a pharmaceutical composition or a food composition.
[0065] In other words, the present invention refers to a formulation that can improve, enhance, or increase the anticancer effect by enhancing the responsiveness (sensitivity) of an anticancer drug through co-administration when an anticancer drug is administered.
[0066] The adjuvant of the present invention may be administered simultaneously, separately, or sequentially with an anticancer agent. The order of administration of the anticancer adjuvant according to the invention—that is, which of the anticancer agent and the anticancer adjuvant is administered at what point in time, simultaneously, individually, or sequentially—may be determined by a physician or expert. Such an order of administration may vary depending on many factors. The anticancer adjuvant may be administered in combination with a known compound having the effect of preventing, improving, or treating cancer. In this regard, it may be administered simultaneously or sequentially with the known compound.
[0067] The anticancer adjuvant composition according to the present invention can maximize therapeutic effects and reduce side effects by increasing sensitivity to targeted anticancer agents by using a NUTM1 inhibitor in combination, and can also maximize anticancer effects by simultaneously blocking multiple cancer pathways by using a CRISPR / Cas system that includes various growth factors (e.g., VEGF, EGF, PDGF, etc.), growth factor receptors and downstream signaling proteins, viral oncogenes, and guide RNA that inhibits the expression of anticancer drug resistance genes.
[0069] In addition, according to another aspect of the present invention, the present invention provides a food composition for preventing or improving cancer, comprising the aforementioned NUTM1 inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients; or a health functional food comprising the same.
[0070] In the present invention, the term "food" refers to a natural product or processed product containing one or more nutrients, preferably a product that has undergone a certain degree of processing to become edible, and includes, in the conventional sense, food, food additives, health functional foods, and beverages.
[0071] The food composition of the present invention may be used as a health functional food. The term "health functional food" refers to a food manufactured and processed using raw materials or ingredients having functional properties useful to the human body in accordance with the Health Functional Foods Act, and the term "functionality" refers to consuming the food for the purpose of obtaining useful effects for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.
[0072] The food composition of the present invention may include conventional food additives, and unless otherwise specified, suitability as a "food additive" is determined in accordance with the specifications and standards for the relevant item, in accordance with the general provisions and general test methods of the food additive code approved by the Ministry of Food and Drug Safety.
[0073] In addition, the composition of the present invention can be used as a food additive for health supplements for the prevention or improvement of cancer. Foods to which the composition of the present invention can be added include various types of food, such as beverages, chewing gum, tea, vitamin complexes, and health supplements, and can be used in the form of pills, powders, granules, infusions, tablets, capsules, or beverages.
[0074] In the present invention, the food refers to a food having bio-regulatory functions such as the prevention and improvement of cancer, biological defense, immunity, and recovery after illness, and must be harmless to the human body when consumed over a long period.
[0075] When the food composition of the present invention is a food additive, the active ingredient may be added as is or used together with other foods or food ingredients, and may be used appropriately according to conventional methods. The amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing food or beverages, the active ingredient of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, relative to the raw material. However, in the case of long-term consumption for the purpose of health and hygiene or health control, the amount may be less than the above range, and since there are no issues regarding safety, the active ingredient may be used in an amount greater than the above range.
[0076] There are no specific restrictions on the types of the above-mentioned foods. Examples of foods to which the above-mentioned substance may be added include meat, sausage, bread, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and include all health functional foods in the conventional sense.
[0077] The health functional food composition according to the present invention may be in various forms, such as a health drink. When the health functional food composition of the present invention is in the form of a health drink, it may include various flavoring agents or natural carbohydrates as additional ingredients, similar to conventional beverages. The aforementioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and natural sweeteners such as dextrin and cyclodextrin, or synthetic sweeteners such as saccharin and aspartame. The proportion of the natural carbohydrates is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g, per 100 ml of the composition of the present invention.
[0078] In addition to the above, the food composition or health functional food composition of the present invention may include various nutritional agents, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. Furthermore, the composition of the present invention may include fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not critical, it is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.
[0080] In addition, according to another aspect of the present invention, the present invention provides an anticancer feed composition or an animal feed additive comprising the above-described NUTM1 inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients.
[0081] The feed composition or feed additive of the present invention includes the active ingredient of the present invention described above and exhibits an anticancer effect; therefore, when used as a feed additive, it can contribute to enhancing the health of target livestock.
[0082] The feed composition or additive of the present invention may use the active ingredients of the present invention in their original form, or additionally add known carriers, stabilizers, etc., such as cereals and by-products permitted for livestock, and, if necessary, may add organic acids such as citric acid, fumaric acid, adipic acid, lactic acid, malic acid, or phosphates such as sodium phosphate, potassium phosphate, acidic pyrophosphate, or polyphosphate (polymerized phosphate), or natural antioxidants such as polyphenol, catechin, alpha-tocopherol, rosemary extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, or phytic acid, as well as antibiotics, antimicrobial agents, and other additives. The form thereof may be in a suitable state such as powder, granules, pellets, or suspension, and the feed composition or additive may be supplied to livestock, etc., either alone or mixed with feed.
[0083] Since the composition of the present invention utilizes the active ingredients of the present invention described above, redundant details are omitted to avoid excessive complexity in this specification.
[0085] In addition, according to another aspect of the present invention, the present invention provides a method for providing information necessary for diagnosing a patient showing a response to a tumor-specific antigen-targeted anticancer agent in a patient with NUT carcinoma, comprising the step of measuring the expression level of the NUTM1 gene or its protein in a tumor tissue sample separated in vitro from a patient with NUT carcinoma.
[0086] For example, the above method of the present invention is a method for providing information to determine the response to a therapeutic agent targeting TROP2 for patients with NUT carcinoma whose TROP2 expression is increased by treatment with a CRISPR / Cas system containing NUTM1-targeting gRNA, and means a method for providing information such as whether resistance to the TROP2-targeted anticancer drug is not exhibited, whether the progression of the cancer is effectively inhibited, or whether cancer cells can be killed, and is not limited thereto as long as it is a method that can obtain information related to the cancer treatment effect of the TROP2-targeted anticancer drug from a biological sample.
[0087] To avoid excessive complexity in this specification, the method of the present invention omits descriptions that are redundant therewith. Effects of the invention
[0088] The NUTM1 inhibitor according to the present invention enhances responsiveness to targeted anticancer drugs, thereby increasing the anticancer effect when administered in combination with targeted anticancer drugs. Therefore, the present invention can increase the treatment hit rate of targeted anticancer drugs for cancer patients, and thus can present new possibilities for treatment strategies using the same. Brief explanation of the drawing
[0089] Figure 1 is a schematic diagram of the treatment strategy for NUTM1-expressing NUT carcinoma according to the present invention, illustrating the process of editing the NUTM1 gene in NUT carcinoma cells expressing a NUTM1 fusion gene using a CRISPR / Cas9 system to induce the expression of the TROP2 protein, and then treating the cells with an anti-Trop2 antibody-targeted anticancer agent. The anti-Trop2 antibody-targeted anticancer agent binds to NUT carcinoma cells expressing TROP2 to induce direct cytotoxic effects or inhibit the growth of cancer cells through an immunomodulatory mechanism. In particular, cancer cell-specific cytotoxicity and antibody-dependent cellular cytotoxicity (ADCC) effects induced by the targeted anticancer agent can be expected. Figure 2 shows the results of cell shape changes and differential expression gene analysis caused by NUTM1 gene editing. Figure 3 shows increased Trop2 expression in NUTM1-edited NUT carcinoma cell lines. Figure 4 shows the antitumor synergistic effects of ACFP (sacituzumab-IFN-β mutein fusion protein), ADC (sacituzumab Govitecan), and NUTM1 inhibitor targeting Trop2 in NUT carcinoma cell lines. Figure 5 shows Trop2 expression in patient tissue according to NC differentiation degree. Specific details for implementing the invention
[0090] The present invention will be explained in detail below through examples. However, the following examples are merely illustrative of the present invention, and the scope of the present invention is not limited to the following examples.
[0092] <Example 1> Design of a single guide RNA for a CRISRP-Cas9 system targeting NUTM1
[0093] In order to suppress the expression of the BRD4-NUTM1 fusion oncogene as disclosed in Korean Registered Patent No. 10-2731972, the inventors designed sgRNAs that target exon 3 of the NUTM1 gene (Genbank Accession number NM_001284292.2) and the p300 binding region (p300 binding region; NUTM1 gene exon 6, 8) on the NUTM1 gene as breakpoints, i.e., target sites, of the BRD4-NUTM1 fusion gene known as the causative gene of NUT carcinoma, thereby securing a total of 12 candidate sequences of sgRNAs for targeting the NUTM1 gene (Table 1). Among these, sg E3-2 (E3-2) (Sequence No. 2), sg E3-9 (E3-9) (Sequence No. 9), and E6C (used by mixing sg E6 (Sequence No. 10) and sg E8-1v2 (Sequence No. 12) in the form of eVLP in a 1:1 ratio) were selected and used in the following examples, as they were proven to be able to efficiently cleave the target DNA sequence and inhibit the function of the NUTM1 gene and exhibited excellent DNA cleavage efficiency.
[0094]
[0095] <Example 2> Production of eVLP (Engineered virus-like particles)
[0096] Cas9-eVLP was produced by transient transfection of Lenti-X 293T cells (632180, Clontech). Lenti-X 293T cells were 1×10⁶ in a 150 mm dish in 20 ml of DMEM medium (SH30243.01, Hyclone) supplemented with 10% FBS (16000-044, Gibco) (v / v). 7Canine cells were inoculated and cultured. After 24 hours, VSV-G (800 ng; 12259, Addgene), gag-pol (6750 ng; 35614, Addgene), gag-Cas9 (2250 ng; 181752, Addgene), and each sgRNA selected in <Example 1> (8800 ng) were prepared by mixing them with Polyethylenimine (120 μg; 23966-100, Polyscience Inc.) and Opti-MEM medium (8 ml; 31985-070, Thermo Fisher Scientific). After removing 6 ml from the DMEM medium being cultured, the prepared Opti-MEM mixture was added to perform transfection. After 24 hours, the culture medium was completely removed and replaced with fresh DMEM medium. Forty-eight hours after transfection, the supernatant was collected and centrifuged at 500g for 5 minutes to remove cellular debris. The supernatant was then filtered using a 0.45 μm CA filter (S6555-FMOSK, Sartorius), and 5× PEG-it Virus Precipitation Solution (System Biosciences, LV825A-1) was added to precipitate the eVLPs, followed by overnight incubation at 4°C. The next day, the supernatant was centrifuged at 1,500g for 30 minutes at 4°C to pellet the eVLPs. The pellets were then resuspended in a 1X HIV-safe Manager (LGV-1022B, Lugen SCI) for concentration. The concentrated eVLPs were stored at -80°C and thawed on ice immediately before use. To maintain consistency between experiments, all eVLPs used in cell culture studies were concentrated using this standardized method. This concentration process is approximately 6–6.5 × 10 8 Provides a yield of eVLPs / μl.
[0097] To compare the NUTM1 editing effect, the CCR5 (CC chemokine receptor type 5) gene was selected as a control, and eVLPs were constructed in the same manner using sgRNA targeting CCR5 (Sequence: GGTGACAAGTGTGATCACTTGGG (Sequence No. 13), PAM: TGG).
[0099] <Example 3> Editing of NUT cell lines using the CRISPR / Cas9 system
[0100] The effect of inhibiting NUT protein expression through the CRISPR-Cas9 system was confirmed using NUT carcinoma cell lines expressing NUT proteins, namely HCC2429, 10-15, or JCM1. HCC2429 cells were cultured in RPMI1640 (SH30027.01, Hyclone) medium, and 10-15 and JCM cells were cultured in Dulbecco's modified Eagle's medium (DMEM, SH30243.01, Hyclone) medium supplemented with 10 mg / ml antibiotics (penicillin and streptomycin, P / S, Gibco) and 10% fetal bovine serum (FBS, Life Technologies) in an incubator at 37°C under 5% CO2 conditions.
[0101] NUT carcinoma cell lines were cultured in suitable plates according to the experimental purpose, and the following day, each cell line was transfected using the respective Cas9-eVLP prepared in Example 2. At this time, Cas9-eVLP containing sg E6 and Cas9-eVLP containing sg E8-1v2 were mixed in a 1:1 ratio and transfected simultaneously (hereinafter referred to as sg E6C or E6C). After 24 hours, the medium was replaced with fresh medium, and after 72 hours, cover glass or cells were obtained according to the purpose. For H&E staining and immunofluorescence experiments, NUT carcinoma cell lines were cultured in 12-well plates containing cover glass, and cover glass was finally obtained. On the other hand, for other experiments requiring NUT carcinoma cell lines edited with NUTM1, cells were cultured in 24-well plates, and cells were finally obtained.
[0103] <Example 4> H&E Dyeing
[0104] The cover glass obtained in <Example 3> was fixed with 4% paraformaldehyde for 10 minutes. Afterward, the cover glass was washed three times with PBS, and staining was performed in the following order: one wash with water for 10 seconds, three washes with hematoxylin for 10 seconds, two washes with water for 10 seconds, one washes with eosin solution for 10 seconds, two washes with 90% ethanol for 10 seconds, three washes with 100% ethanol for 10 seconds, and three washes with xylene for 10 seconds. Subsequently, one drop each of xylene and Canada balsam was applied to the slide, and the cover glass was placed facing downward. After the staining was complete, the slide was dried and scanned using an Aperio Scanscope AT2 (Leica Biosystems).
[0106] <Example 5> Analysis of Differentially Expressed Genes
[0107] Differential expression gene analysis using transcriptome sequencing data of NUT carcinoma cell lines was performed using a publicly available analysis tool and visualized. Differences in the expression of each gene were compared using adjusted P-values and logFCs, and it can be interpreted that the greater the variance shown in the graph, the more pronounced the difference in expression values.
[0109] <Example 6> Quantitative PCR (qPCR)
[0110] qRT-PCR analysis was performed to confirm the increase in TACSTD2 expression levels in HCC2429 and JCM1 cell lines. Specifically, RNA was extracted and quantified using the RNeasy mini kit (Qiagen #74106) according to the manufacturer's instructions using the transfected cells obtained in <Example 3>. cDNA was synthesized using SuperScript™ IV Reverse Transcriptase (Thermo Fisher Scientific, 18090200) with 1 μg of total RNA. qRT-PCR was performed in 384-well plates using 2x SYBR Green Master Mix (Applied Biosystems, #4368702) with a PRISM® 7900HT Fast Real-Time PCR System (Applied Biosystems) or a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems). Gene expression was normalized to the housekeeping gene GUSB (glucuronidase beta). All experiments were repeated three times for each sample, and statistical analysis was performed using the t-test.
[0112] <Example 7> Western blot assay
[0113] Intracellular protein expression levels were confirmed by western blot assay. Specifically, cells obtained in <Example 3> were lysed in RIPA buffer (Thermo Fisher) containing a proteolytic inhibitor, centrifuged at 13,000 rpm at 4°C for 25 minutes to obtain the supernatant, and the protein amount was quantified using BSA or Bradford assay. The protein lysate was fractionated on an SDS-PAGE gel and transferred to a PVDF membrane (Millipore), after which it was blotted using NUTM1 (C52B1) antibody (1 / 500 dilution; Cell Signaling Technologies #3625), TACSTD2 antibody (1 / 2000 dilution; Atlas Antibodies #HPA055067), and Beta Actin (C4) antibody (Santa Cruz Biotechnology, sc-47778).
[0115] <Example 8> Flow cytometry
[0116] Flow cytometry was performed to analyze Trop2 expression in NUT carcinoma cells that underwent NUTM1 target editing. Specifically, the cells obtained in <Example 3> were suspended using Accutase (Thermo Fisher Scientific, 00-4555-56). After centrifugation, the suspended cells were resuspended in FACS buffer (containing 1% FBS in PBS solution) to prepare a concentration of 2-3×10^6 / mL. The prepared cells were incubated with PE anti-human TACSTD2 (TROP2) antibody (Biolegend, 363804) in a solution containing 1% FBS in PBS for 1 hour at 4°C. Afterward, the cells were washed twice, transferred to FACS tubes (Falcon, #352235) for analysis, and flow cytometry was performed using a BD FACS Lyric instrument.
[0118] <Example 9> Genome Editing Rate Analysis
[0119] To determine the intracellular indel frequency induced by the CRISPR-Cas9 system, genomic DNA was extracted from cells obtained in <Example 3> using a DNA mini kit (Qiagen, #51306) according to the manufacturer's instructions. To confirm the indel frequency on the target region DNA, the target genomic region was amplified by PCR using Accupower Hotstart PCR premix (Bioneer, #K5051-1), and a portion of the PCR amplicon was purified using a PCR purification kit (Qiagen, 28106) and used for Sanger sequencing. Analysis of the Sanger sequencing sequences was performed using a publicly available analysis tool.
[0121] <Example 10> Immunofluorescence Analysis
[0122] The cover glass obtained in <Example 3> was fixed with 4% paraformaldehyde at a depth of 2-3 mm for 15 minutes at room temperature. Afterward, it was washed three times with PBS for 5 minutes each. The cover glass was treated with Blocking Buffer [5% Skim Milk (232100, BD) in 1X TBST (T2007-100-74, BIOSESANG)] for 60 minutes to block non-specific binding. After removing the Blocking Buffer, the diluted primary antibodies (NUT antibody (Cell Signaling Technology, 3625S), TACSTD2 (TROP2) antibody (Thermo Fisher Scientific, 53-6024-82)) were incubated overnight at 4°C. The following day, the samples were washed three times with PBS for 5 minutes each, and the fluorescently stained secondary antibody (Thermo Fisher Scientific, A-11070 or A-11011) was diluted in antibody dilution buffer and incubated for 1–2 hours in the dark. After incubation, the samples were washed again three times with PBS for 5 minutes each while being kept in the dark. Digital images were captured using an LSM 700 or LSM 780 ZEISS laser scanning confocal microscope (Carl Zeiss). Image data were processed using integrated LSM software.
[0124] <Example 11> Cytotoxicity Analysis
[0125] Cytotoxicity analyses were performed according to the drugs. Cell lines 293FT (Invitrogen, R70007) or HCC2429 were used, and 500 to 5,000 cells per well were seeded in 100 μl of medium in 96-well plates, depending on the characteristics of the cell line. The drugs administered were Sacituzumab (in-house, ABION), IFN-β mutein (ABION), Sacituzumab-IFN-β mutein fusion protein (ABION), and Control mAbs (TROP2 non-target antibody, anti-botulinum toxin antibody, in-house, ABION), with 10 depending on the type -6 ~ 10 3 Treatments were performed at nM concentrations, and after 72 to 120 hours, the culture medium in each well was replaced with a mixture of 10 μL of Ez-Cytox (DoGenBio #EZ-3000) and 90 μL of fresh medium. Plates were incubated for 2 to 4 hours in a humidified 37°C incubator containing 5% CO2, and SpectraMax ® Absorbance was measured at 450 nm using a 96-well plate reader (Molecular Devices). Based on the measured values, IC was analyzed using a published analysis tool. 50 The value was calculated.
[0127] <Example 12> Cell proliferation analysis
[0128] The NUTM1-edited cells obtained in <Example 3> were placed in a 96-well plate at a rate of 3 × 10⁶ per well. 3After seeding cells one-to-one, representative Trop2-targeted anticancer agents were administered. Cells were cultured for 72 hours using serially diluted 10-fold Trop2 antibodies (Sacituzumab) or Sacituzumab-IFN-β mutein fusion protein (ABION), and Control mAb-IFN-β mutein fusion protein (ABION) utilizing a non-Trop2 antibody. Subsequently, the culture medium in each well was replaced with a mixture of 10 μL of Ez-Cytox (DoGenBio #EZ-3000) and 90 μL of fresh medium, and the cells were incubated in an incubator for 3 hours. The change in cell proliferation rate was calculated by measuring the absorbance at 450 nm.
[0130] <Example 13> Analysis of Antibody-Dependent Cytotoxicity Response
[0131] Antibody-dependent cytotoxicity tests against the Trop2-targeted anticancer agent treated in <Example 12> were performed on the NUTM1-edited HCC2429 cell line obtained in <Example 3> using NK-92MI-CD16a cells stably expressing CD16a as effector cells. HCC2429 cells were seeded into 96-well plates at a density of 2×10^4 per well and cultured overnight, followed by additional incubation for 4 hours with 2×10^4 effector cells and various concentrations of drugs. HCC2429 cell lysis was calculated by measuring lactate dehydrogenase release using the CytoTox 96® Non-Radioactive Cytotoxicity Assay Kit (G1780, Promega).
[0133] <Experimental Example 1> Effects of NUTM1 Gene Editing
[0134] The inventors observed that when differentiation of NUT carcinoma cell lines was induced through NUTM1 gene editing using a CRISPR / Cas9 system containing NUTM1-target sgRNAs in NUT carcinoma cell lines, growth inhibition was observed in the cells, but it did not lead to apoptosis, and differentiation into squamous type cells occurred (Fig. 2a). That is, as shown in the schematic diagram of Fig. 2a, it demonstrates that upon NUTM1 gene editing, characteristic changes appear in NUT carcinoma cell lines, such as an increase in cell size and cytoplasmic volume, and differentiation into flattened squamous cells.
[0135] As a specific experimental result, compared to the control group with edited CCR5 gene in various NUT carcinoma cell lines (HCC2429, 10-15, JCM1), it was confirmed that the cells in the comparison group, denoted as sg E3-2 (SEQ No. 2), sg E3-9 (SEQ No. 9), and E6C (using a mixture of sg E6 (SEQ No. 10) and sg E8-1v2 (SEQ No. 12) in the form of eVLP in a 1:1 ratio), differentiated into squamous cell-like morphology (Fig. 2b).
[0136] In addition, differentially expressed genes were visualized using a Volcano plot through transcriptome analysis of the control group (CCR5 edited-NUT cell line) and NUTM1 edited-NUT cell line. Interestingly, the results confirmed that the expression of the TROP2 protein encoded by the TACSTD2 gene increased in the NUTM1 edited-NUT cell line during this process (Fig. 2c).
[0137] Accordingly, an analysis of the relationship between cancer cell differentiation and TROP2 protein expression in NC patient tissues revealed a positive correlation between the two variables, and for the first time, it was discovered that high NC cell differentiation and TROP2-positive patients are associated with a relatively good prognosis.
[0139] <Experimental Example 2> Confirmation of Increased Trop2 Expression in NUTM1-Edited NUT Carcinoma Cell Lines by NUTM1 Gene Editing
[0140] The inventors verified the increase in Trop2 expression caused by NUTM1 gene editing using qPCR and Western blot. As a result, as shown in Figure 3a, TACSTD2 mRNA expression was significantly increased by approximately 20-fold in HCC2429 cells and approximately 13-fold in JCM1 cells compared to the CCR5 control group. Western blot analysis confirmed that NUTM1 gene editing was successful in each experimental group, and consequently, Trop2 protein expression increased.
[0141] In addition, the proportion of cell lines with increased Trop2 expression was verified by flow cytometry. As a result, as shown in Figure 3b, Trop2 expression was increased in 7.8% of cells in the CCR5 control group, but in the experimental groups sg E3-2 (sequence number 2), sg E3-9 (sequence number 9), and E6C (using a 1:1 mixture of sg E6 (sequence number 10) and sg E8-1v2 (sequence number 12) in the form of eVLP), the proportion of cells showing Trop2 expression increased significantly to 54%, 42%, and 30.8%, respectively.
[0142] In addition, to confirm the intracellular indel frequency induced by CRISPR-Cas9, the ratio of InDel on the NUTM1 gene and the ratio of Trop2 expression in transfected NUT carcinoma cell lines were compared. As shown in Figure 3c, it was confirmed that the amount of Trop2 expression increased in almost all NUT carcinoma cell lines in which the NUTM1 gene was edited.
[0143] In addition, the decrease in NUTM1 expression and the increase in Trop2 expression were confirmed using immunofluorescence imaging. As a result, as shown in Figure 3d, NUTM1 gene editing induced the loss of the characteristic nuclear Speckled pattern of NUT carcinomas and increased TROP2 expression at the cell membrane. In particular, green fluorescence confirmed that TROP2 expression increased most significantly in the sg E3-2 (sequence number 2) experimental group.
[0145] <Experimental Example 3> Confirmation of Antitumor Synergistic Effects of Trop2-Targeting ACFP or ADC and NUTM1 Inhibitor in NUT Carcinoma Cells
[0146] Based on the results of Experimental Examples 1 and 2 above, the inventors established a strategy to 1) recommend a TROP2 targeted therapy to patients with high differentiation of NUT cells and TROP2 positivity, and 2) induce differentiation of cancer cells and TROP2 expression through NUTM1 gene editing to enable subsequent TROP2 targeted therapy to patients with low differentiation of NUT cells and TROP2 positivity.
[0147] In addition, the inventors evaluated the efficacy of sacituzumab-IFN-β mutein fusion protein (ACFP) and sacituzumab govitecan (ADC), which are representative drugs that can be used by binding to a Trop2-antibody (sacituzumab) as a targeted therapy strategy.
[0148] At this time, HCC2429 NUT carcinoma cell lines expressing the BRD4-NUTM1 fusion gene were used as a positive control, and 293FT cells were used as a negative control that do not express the BRD4-NUTM1 fusion gene.
[0149] As a result, as shown in Fig. 4a, IFN-β mutein exhibited NUT carcinoma-specific cytotoxicity, reducing the viability of HCC2429, a cell line expressing the BRD4-NUTM1 fusion gene, while no cytotoxicity was observed in normal cells (293FT). Additionally, as shown in Fig. 4b, when treated with Sacituzumab-IFN-β mutein fusion protein (ACFP, provided by Abion), which is IFN-β mutein conjugated with a Trop2 antibody (Sacituzumab), the same NUT carcinoma cell-specific cytotoxicity was observed.
[0150] Accordingly, the inventors treated each cell in which the NUTM1 gene was edited using a CRISPR / Cas9 system containing NUTM1-target sgRNAs (E3-2, E3-9) with either Sacituzumab or Sacituzumab-IFN-β mutein fusion protein (ACFP).
[0151] As a result, as shown in Figure 4c, when HCC2429 cells (labeled E3-2, E3-9) with increased Trop2 protein expression due to NUTM1 editing were treated with Sacituzumab-IFN-β mutein fusion protein (ACFP), a decrease in the viability of HCC2429 cells was observed. In other words, a synergistic antitumor effect between NUTM1 gene editing and the Trop2-targeted anticancer agent was confirmed. Parental HCC2429 cell lines with edited CCR5 genes or no gene editing were used as controls.
[0152] In addition, as shown in Figure 4d, when NK-92MI-CD16a cells were co-treated with Sacituzumab or Sacituzumab-IFN-β mutein fusion protein (ACFP) in NUTM1-edited cells (sg E3-2 treatment group), it was confirmed that the antibody-dependent cytotoxicity (ADCC) effect by NK cell lines was significantly increased compared to the control group, Parental and CCR5. For the control group, Parental HCC2429 cell lines with edited CCR5 genes or no gene editing were used.
[0153] In addition, as shown in Figure 4e, when HCC2429 cells (sg E3-2 treatment group) with increased Trop2 protein expression by editing NUTM1 were treated with the ADC sacituzumab govitecan (Trodelvy), it was confirmed that drug responsiveness increased compared to the control group, Parental and CCR5. For the control group, Parental HCC2429 cell lines with edited CCR5 genes or no gene editing were used.
[0155] <Experimental Example 4> Confirmation of Trop2 Expression Levels in Patient Tissues According to NC Differentiation Degree
[0156] In order to analyze the relationship between the differentiation degree of NUT cells and TROP2 protein expression in NC patient tissues, the inventors classified NC patients according to their histological differentiation degree and then matched the HE images obtained by the methods described in <Example 4> and <Example 10> with the TROP2 IHC (Immunohistochemistry) images (Fig. 5a).
[0157] As a result, as shown in Figure 5b, it was discovered that there is a positive correlation between the two variables of differentiation of NUT cells and TROP2 protein expression, and statistical calculations confirmed that the Spearman's rank correlation coefficient (ρ) value was 0.664, proving that the two variables show a high positive correlation (p-value = 0.001).
[0158] In addition, as shown in Figure 5c, the overall survival of NC patients according to differentiation was analyzed using a Kaplan-Meier survival analysis (Kaplan-Meier estimate) graph, and it was confirmed that the higher the differentiation of NUT cells, the better the prognosis of the patients (p-value = 0.0096).
[0159] In addition, as shown in Figure 5d, the overall survival of NC patients according to TROP2 protein expression was analyzed using a Kaplan-Meier survival analysis graph, and a tendency for TROP2-positive patients to have a better prognosis compared to TROP2-negative patients was confirmed (p-value = 0.18).
[0161] In summary, the inventors discovered that when differentiation of NUT cells was induced in NC cell lines through NUTM1 gene editing using NUTM1-target sgRNAs and the CRISPR / Cas9 system, the expression level of Trop2 increased. Furthermore, by analyzing the relationship between the degree of differentiation of NUT cells and TROP2 protein expression in NC patient tissues, they found a positive correlation between the two variables and identified for the first time that patients with a high degree of differentiation of NUT cells and TROP2 positivity are associated with a relatively good prognosis.
[0162] Based on this, the present invention demonstrates the characteristics and treatment strategies of NC carcinomas according to the differentiation degree of NUT cells described above, as shown in FIG. 5e; that is, it proves that favorable therapeutic effects can be achieved when a TROP2-targeted therapeutic agent is applied to TROP2-positive patients with a high degree of NUT cell differentiation. Furthermore, for TROP2-negative patients, conventional BET inhibitors targeting the mechanism of NC can be considered, but their practical use is limited due to high side effects. Accordingly, following the strategy of the present invention, TROP2-targeted therapy becomes possible for patients with a low degree of NUT cell differentiation by inducing NUT cell differentiation and TROP2 expression through NUTM1 gene editing, thereby causing the NUT carcinoma to respond (sensitize) to the drug. This is an effective and novel drug treatment method that realizes personalized medicine, effectively improves patient survival rates through targeted therapy, and contributes to improving the patient's quality of life by reducing unnecessary anticancer treatments.
[0164] Foregoing, specific parts of the present invention have been described in detail. It will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the invention. Accordingly, the actual scope of the invention is defined by the appended claims and their equivalents.
Claims
Claim 1 A pharmaceutical composition for the prevention or treatment of cancer comprising a NUTM1 (NUT midline carcinoma family member 1) inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients. Claim 2 A composition according to claim 1, wherein the NUTM1 inhibitor is one or more selected from the group consisting of a CRISPR / Cas system including a guide RNA that targets the NUTM1 gene, an antisense oligonucleotide, a small interference RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), and a ribozyme. Claim 3 A composition according to claim 2, wherein the guide RNA targeting the NUTM1 gene is a guide RNA composed of a nucleotide sequence selected from the group consisting of SEQ ID NOs 1 to 12. Claim 4 A composition according to claim 1, wherein the NUTM1 inhibitor is one or more selected from the group consisting of compounds, peptides, peptide mimics, substrate analogs, aptamers, and antibodies that specifically bind to NUT proteins. Claim 5 A composition according to claim 1, wherein the NUTM1 inhibitor increases the expression level or activity of one or more tumor-specific antigens selected from the group consisting of Trop2 (Trophoblast cell surface antigen 2), epidermal growth factor receptor (EGFR), vascular growth factor receptor (VEGFR), CD20, CD38, RNAK-L, BTK, Bcr-abl, PDGFR / FGFR series, MEK / RAF, HER2 / Neu, ubiquitin, JAK, MAP2K, ALK, PARP, tumor growth factor β receptor (TGFβ Receptor), Proteasome, Bcl-2, C-Met, VR1, VR2, VR3, c-kit, AXL, RET, Braf, DNA methyltransferase (DNMT), CDK4 / 6, and STING. Claim 6 A composition according to claim 1, wherein the tumor-specific antigen-targeted anticancer agent is a targeted anticancer agent that targets one or more tumor-specific antigens selected from the group consisting of Trop2 (Trophoblast cell surface antigen 2), epidermal growth factor receptor (EGFR), vascular growth factor receptor (VEGFR), CD20, CD38, RNAK-L, BTK, Bcr-abl, PDGFR / FGFR series, MEK / RAF, HER2 / Neu, ubiquitin, JAK, MAP2K, ALK, PARP, tumor growth factor β receptor (TGFβ Receptor), Proteasome, Bcl-2, C-Met, VR1, VR2, VR3, c-kit, AXL, RET, Braf, DNA methyltransferase (DNMT), CDK4 / 6, and STING. Claim 7 A composition according to claim 6, wherein the targeted anticancer agent targeting the above-mentioned Trop2 tumor-specific antigen is one or more selected from the group consisting of an anti-Trop2 antibody that specifically binds to a Trop2 protein, an anti-Trop2 antibody-drug conjugate (ADC), an anti-Trop2 antibody-cytokine fusion protein (ACFP), a peptide, a peptide mimic, a substrate analog, an aptamer, and a compound. Claim 8 A composition according to claim 6, wherein the targeted anticancer agent targeting the above-mentioned Trop2 tumor-specific antigen is one or more selected from the group consisting of sacituzumab, sacituzumab-IFN-β mutein fusion protein, sacituzumab-govitecan (Trodelvy), datopotamab deruxtecan (DS-1062), ESG-401, SKB-264, DAC-02, and BAT-8003. Claim 9 A composition according to claim 1, characterized in that the cancer is a BRD4-NUTM1 positive cancer. Claim 10 A composition according to claim 9, characterized in that the cancer is one or more selected from the group consisting of NUT carcinoma, lung cancer, thymic cancer, and kidney cancer. Claim 11 A composition according to claim 10, characterized in that the above-mentioned NUT carcinoma is in an undifferentiated or differentiated state. Claim 12 A pharmaceutical composition for enhancing the responsiveness of a tumor-specific antigen-targeted anticancer drug, comprising a NUTM1 inhibitor as an active ingredient. Claim 13 A tumor-specific antigen-targeted anticancer adjuvant composition comprising a NUTM1 inhibitor as an active ingredient. Claim 14 A composition according to claim 12 or 13, characterized in that the composition is used individually, sequentially, or simultaneously with a tumor-specific antigen-targeted anticancer agent. Claim 15 A health functional food for preventing or improving cancer, containing a NUTM1 inhibitor and a tumor-specific antigen-targeted anticancer agent as active ingredients. Claim 16 A method for providing information necessary for the diagnosis of a patient showing a response to a tumor-specific antigen-targeted anticancer drug in a patient with NUT carcinoma, comprising the step of measuring the expression level of the NUTM1 gene or its protein in a tumor tissue sample isolated in vitro from a patient with NUT carcinoma.