UBE3A-ATS Adjustment Method

KR1020260124074APending Publication Date: 2026-08-14IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
KR1020267017785
Authority / Receiving Office
KR · KR
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-19
Filing Date
2024-11-08
Publication Date
2026-08-14

Smart Images

  • Figure PCT00021_ABST
    Figure PCT00021_ABST
Patent Text Reader

Abstract

A method of administering ION582 to reduce the amount or activity of UBE3A-ATS, i.e., the endogenous antisense transcript of ubiquitin protein ligase E3A (UBE3A), in a cell or subject, and a method of administering to increase the expression of paternal UBE3A and the amount of UBE3A protein in a cell or subject in certain cases are provided. In certain embodiments, the subject has Angelman syndrome (AS).
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] Sequence list

[0002] The present application is submitted together with a sequence list in electronic file format. The sequence list is provided as a file named BIOL0480SEQ.xml created on October 28, 2024, and has a size of 478 KB. The entirety of the information in the electronic file format of the sequence list is incorporated herein by reference.

[0003] field

[0004] A method of administering IONIS 1273062 / ION582 to reduce the amount or activity of UBE3A-ATS, i.e., the endogenous antisense transcript of ubiquitin protein ligase E3A (UBE3A), in cells or subjects, and a method of administering to increase the expression of paternal UBE3A and the amount of UBE3A protein in cells or subjects in specific cases are provided. Such a method is useful for improving at least one symptom or feature of a neurogenetic disorder such as Angelman syndrome. Such symptoms and features include developmental delay, ataxia, speech disorders, sleep problems, seizures, and EEG abnormalities. Background Technology

[0005] Angelman syndrome (AS) occurs in approximately 1 in 15,000 live births and is a developmental disorder caused by a deficiency of ubiquitin protein ligase E3A (UBE3A). Of the two copies of the UBE3A gene in neurons, the maternal gene is typically expressed, while the paternal gene is subject to genetic imprinting and silencing. Angelman syndrome is caused when a functional copy of the UBE3A gene is not inherited from the mother due to mutations, deletions, paternal monokinesis on chromosome 15, or imprinting defects. Literature [Buiting et al., "Angelman syndrome - insights into a rare neurogenetic disorder," Nature Rev. Neuro., Refer to 2016, 12:584-593.

[0006] Patients with Angelman syndrome experience developmental delays and speech disorders, and commonly experience sleep problems, seizures, and EEG abnormalities. The disorder is usually diagnosed within the first few years of life, and the diagnosis can be confirmed by genetic testing. However, treatments for Angelman syndrome remain limited and focus primarily on symptom management. See the literature [Williams, CA et al., Genet. Med., 12: 385-395, 2010].

[0007] Recently, topoisomerase inhibitors currently used in cancer treatment have been found to "unsilence" paternal UBE3A expression in both neuronal cell culture systems and mice. See literature [Huang, HS et al., Nature, 481: 185-189, 2012]. However, safety concerns exist because topoisomerase inhibitors are known to be nonspecific and can induce DNA damage such as single-strand and double-strand breaks.

[0008] Currently, there is a lack of acceptable options for treating neurogenetic disorders such as AS. Therefore, it is the objective of the present invention to provide a compound, method, or pharmaceutical composition for the treatment of such diseases.

[0009] A method of administering ION582 to reduce the amount or activity of UBE3A-ATS, i.e., the endogenous antisense transcript of ubiquitin protein ligase E3A (UBE3A), in a cell or subject, and a method of administering to increase the expression of paternal UBE3A and the amount of UBE3A protein in a cell or subject in certain cases are provided. In certain embodiments, the subject has Angelman syndrome (AS).

[0010] A method useful for improving at least one symptom or feature of a neurogenetic disorder such as Angelman syndrome is also provided. In certain embodiments, the symptom or feature includes developmental delay, ataxia, speech disorder, sleep problems, seizures, and / or EEG abnormalities. Brief explanation of the drawing

[0011] Various aspects of the present disclosure are specifically described in the appended claims. A better understanding of the features and advantages of the present disclosure can be obtained by referring to the following detailed description, which describes exemplary embodiments in which the principles of the present disclosure are utilized, and the accompanying drawings below. Figures 1a-1e show the improvements observed at the intermediate (40 mg ION582) and high (80 mg ION582) doses compared to the low dose (20 mg) in Bayley-4 assessments of cognition (Fig. 1a), receptive communication (Fig. 1b), expressive communication (Fig. 1c), gross motor skills (Fig. 1d), and fine motor skills (Fig. 1e) at 4 months, GSV, and growth scale values. Figures 2a and 2b show the improvement in receptive communication measured with Bayley-4 (Figure 2a) and Vineland-3 (Figure 2b) at 6 months in the combined medium and high dose groups of ION582 compared to the natural course (NH). GSV, growth scale values; SEM, mean standard error. Figure 3 shows the improvement in receptive communication measured by Bayley-4 in participants with deletion and mutant genotypes at 6 months in the group combining intermediate and high doses of ION582 compared to the natural course (NH). GSV, growth scale values; SEM, mean standard error. Figures 4a-4c show the improvement in expression communication observed in the group of medium and high doses of ION582 combined compared to the natural course (NH) as measured by Bayley-4 (Figure 4a), Vineland-3 (Figure 4b), and SAS-CGI-C (Figure 4c). Figures 5a-5b show the improvements observed in receptive communication (Figure 5a) and expressive communication (Figure 5b) measured with Bayley-4 and Vineland-3 in the group with the combined medium and high doses of ION582 at 6 months. Figure 6 shows the improvement in the ORCA scale of communication observed at 6 months in the group with the combined medium and high doses of ION582 compared to the natural course (NH). Figures 7a-7b show the correlation between the ORCA scale of communication and the Bayley-4 scale for changes in receptive communication (Figure 7a) and expressive communication (Figure 7b) in the group with combined medium and high doses of ION582 at 6 months. Figures 8a and 8b show the improvements observed across the cognitive scales of Bayley-4 (Figure 8a) and SAS-CGI-C (Figure 8b). GSV, growth scale value; SEM, mean standard error; SAS-CGI-C, change in Angelman syndrome symptoms—clinician's overall impression. Figures 9a–9c show the improvements in fine motor function observed in the combined medium and high dose groups of ION582 at 6 months, as measured by Bayley-4 (Figure 9a), Vineland-3 (Figure 9b), and SAS-CGI-C (Figure 9c). GSV, growth scale values; SEM, mean standard error; SAS-CGI-C, change in Angelman syndrome symptoms—clinical overall impression. Figures 10a–10c show the improvements in gross motor function observed in the combined medium and high dose groups of ION582 at 6 months, as measured by Bayley-4 (Figure 10a), Vineland-3 (Figure 10b), and SAS-CGI-C (Figure 10c). GSV, growth scale values; SEM, mean standard error; SAS-CGI-C, change in Angelman syndrome symptoms—clinical impression—change. Figure 11 shows clinically significant improvement in the participants regarding changes in overall AS symptoms in patients treated with ION582 (Figure 11). Specific details for implementing the invention

[0012] It should be understood that both the foregoing general description and the following detailed description are illustrative and descriptive, and are not limiting. In this document, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless otherwise stated. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is not limiting. Additionally, terms such as "element" or "component" encompass both elements and components containing a single unit and elements and components containing one or more subunits, unless specifically stated otherwise.

[0013] Section headings used herein are for organizational purposes only and are not to be construed as limiting the described subject matter. All literature or parts of literature cited in this application, including but not limited to patents, patent applications, papers, books, and professional literature, are expressed by reference thereto, as well as in their entirety, of the literature discussed herein.

[0014] definition

[0015] Unless otherwise specified, the nomenclature, procedures, and techniques used in connection with analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout the disclosure are incorporated herein by reference in their entirety.

[0016] Unless otherwise specified, the following terms have the following meanings:

[0017] As used herein, “2’-deoxyribonucleoside” means a nucleoside comprising a 2’-H(H)deoxyribosyl sugar moiety. In certain embodiments, the 2’-deoxyribonucleoside is a 2’-β-D-deoxyribonucleoside and comprises a 2’-β-D-deoxyribosyl sugar moiety having a β-D arrangement found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2’-deoxyribonucleoside may comprise a modified nucleobase or an RNA nucleobase (uracil).

[0018] As used herein, "2'-MOE" means a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of a ribosyl sugar moiety. A "2'-MOE sugar moiety" is a sugar moiety having a 2'-OCH2CH2OCH3 group instead of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, a 2'-MOE sugar moiety is a β-D batch. "MOE" means O-methoxyethyl.

[0019] As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0020] As used herein, "5-methylcytosine" means cytosine modified by a methyl group attached to the 5th position. 5-methylcytosine is a modified nucleobase.

[0021] As used herein, "about" means plus or minus 10% of the provided value.

[0022] As used herein, "administration" means providing a pharmaceutical preparation to a human subject.

[0023] As used herein, “improvement” in relation to treatment means improvement of at least one symptom or hallmark compared to the same symptom or hallmark in the absence of treatment. In certain embodiments, improvement is a reduction in the severity or frequency of a symptom or hallmark, or a delay in onset or slowing of progression in the severity or frequency of a symptom or hallmark.

[0024] As used herein, "dosage" refers to the amount of pharmaceutical preparation administered.

[0025] As used herein, "administration interval" refers to the approximate time between the administration of two consecutive doses. The interval may vary by a few days for patient convenience, scheduling, etc., and is still considered to be within the specified administration interval.

[0026] As used herein, the term “nucleoside linkage” refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, “modified nucleoside linkage” refers to any nucleoside linkage other than a phosphodiester nucleoside linkage. A “phosphorothioate nucleoside linkage” is a modified nucleoside linkage in which one of the non-crosslinked oxygen atoms of a phosphodiester nucleoside linkage is replaced with a sulfur atom.

[0027] As used herein, "loading dose" refers to the therapeutically effective amount of a pharmaceutical formulation administered during the initial administration phase until steady-state concentrations of the pharmaceutical formulation are achieved. "Initial loading dose" refers to the first loading dose administered. "Last loading dose" refers to the most recently administered loading dose immediately prior to the administration of the first maintenance dose.

[0028] As used herein, "maintenance dose" refers to the therapeutically effective amount of a pharmaceutical formulation administered during the administration phase after the steady-state concentration of the pharmaceutical formulation has been achieved.

[0029] As used herein, the terms "ION582" and "1273062" are interchangeable.

[0030] As used herein, “nucleobase” means an unmodified nucleobase or a modified nucleobase. An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G that can be paired with at least one unmodified nucleobase. “5-methylcytosine” is a modified nucleobase. As used herein, “nucleobase sequence” means a sequence of consecutive nucleosides within a target nucleic acid or oligonucleotide that is independent of (independent of) any sugar or nucleoside linkage modifications.

[0031] As used herein, "nucleoside" means a compound comprising a nucleobase and a sugar moiety. The nucleobase and the sugar moiety are each independently undeformed or modified. As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. "Linked nucleoside" is a nucleoside linked in a continuous sequence (i.e., no additional nucleoside is presented between the links). As used herein, "oligonucleotide" means a strand of nucleosides linked by nucleoside-to-nucleoside links, wherein each nucleoside and nucleoside link may be modified or undeformed. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or nucleoside link is modified.

[0032] As used herein, "pharmaceutical preparations" are oligomer compounds such as ION582 or modified oligonucleotides.

[0033] As used herein, “pharmaceuticalally acceptable diluent” means any substance suitable for use in administration to human subjects. In certain embodiments, the pharmaceutically acceptable diluent is sterile water, sterile saline, sterile buffered solution, or sterile artificial cerebrospinal fluid (aCSF).

[0034] As used herein, "pharmaceutically acceptable salt" means a physiologically and pharmaceutically acceptable salt of a compound. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound and does not impart undesirable toxic effects thereto.

[0035] As used herein, "potassium salt" refers to a salt of a modified oligonucleotide, wherein the cation of the salt is potassium.

[0036] As used herein, “RNA” means any RNA transcript, including an intrinsic antisense transcript that does not encode a protein (e.g., UBE3A-ATS), unless otherwise specified, and also includes precursor mRNA and mature mRNA.

[0037] As used herein, "sodium salt" means a salt of a modified oligonucleotide, where the cation of the salt is sodium.

[0038] As used herein, “subject” means a human or non-human animal. In certain embodiments, the subject is a human subject. “Subject requiring treatment” is a subject who will benefit from the administration of the modified oligonucleotide disclosed herein. In certain embodiments, the subject requiring treatment has Angelman syndrome.

[0039] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. "Unmodified sugar moiety" means a 2'-OH(H) β-D ribosyl moiety as found in RNA (“unmodified RNA sugar moiety”) or a 2'-H(H) β-D deoxyribosyl moiety as found in DNA (“unmodified DNA sugar moiety”). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. "Modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or a sugar substitute.

[0040] As used herein, “symptoms or characteristic signs” means any physical characteristics or test results indicating the presence or degree of a disease or disorder. In certain embodiments, symptoms are evident to the subject or to a medical professional examining or testing said subject. In certain embodiments, characteristic signs are evident during invasive diagnostic tests, including but not limited to post-mortem examinations. In certain embodiments, symptoms or characteristic signs are measured by EEG. In certain embodiments, symptoms or characteristic signs are developmental delay, ataxia, speech disorders, sleep problems, seizures, and EEG abnormalities.

[0041] As used herein, "therapeutic effective dose" refers to an amount of a pharmaceutical preparation that provides a therapeutic benefit to a human subject. For example, a therapeutic effective dose improves the symptoms or characteristic signs of a disease or disorder.

[0042] As used herein, “minimum concentration” means the concentration of an analyte (e.g., UBE3A protein) in a biological sample taken from a human subject immediately before receiving a subsequent dose, or the concentration of the analyte on the last day of study.

[0043] As used in this text, "week" means 7 days.

[0044] Specific embodiment

[0045] Embodiment 1. A method comprising administering a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure to a human subject:

[0046]

[0047] (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof.

[0048] Embodiment 2. A method according to Embodiment 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

[0049] Embodiment 3. A method comprising administering a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure to a human subject:

[0050]

[0051] (Sequence ID NO: 5).

[0052] Embodiment 4. A method comprising administering a therapeutically effective amount of a modified oligonucleotide consisting of 19-20 linked nucleosides to a human subject, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo Aes G es m C e It comprises at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein:

[0053] A = adenine nucleobase,

[0054] mC = 5-methylcytosine nucleobase,

[0055] G = guanine nucleobase,

[0056] T = thymine nucleobase,

[0057] e = 2'-MOE per moiety,

[0058] d = 2'-β-D-deoxyribosyl sugar moiety,

[0059] s = phosphorothioate internucleoside linkage, and

[0060] o = a link between phosphodiester nucleosides, method.

[0061] Embodiment 5. A method of any one of Embodiments 1-4, wherein the modified oligonucleotide is formulated into a pharmaceutical composition comprising a pharmaceutically acceptable diluent.

[0062] Embodiment 6. A method according to Embodiment 5, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF).

[0063] Embodiment 7. A method according to Embodiment 5, wherein the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).

[0064] Embodiment 8. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is any one of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg.

[0065] Embodiment 9. A method according to any one of Embodiments 1-8, wherein the therapeutically effective amount is any one of 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, and 25 mg.

[0066] Embodiment 10. A method according to any one of Embodiments 1-8, wherein the therapeutically effective amount is any one of 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, and 30 mg.

[0067] Embodiment 11. A method according to any one of Embodiments 1-8, wherein the therapeutically effective amount is any one of 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, and 50 mg.

[0068] Embodiment 12. A method according to any one of Embodiments 1-8, wherein the therapeutically effective amount is any one of 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, and 70 mg.

[0069] Embodiment 13. A method of any one of Embodiments 1-8, wherein the therapeutically effective amount is any one of 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, and 90 mg.

[0070] Embodiment 14. A method according to any one of Embodiments 1-8, wherein the therapeutically effective amount is any one of 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, 100 mg, 101 mg, 102 mg, 103 mg, 104 mg, 105 mg, 106 mg, 107 mg, 108 mg, 109 mg, and 110 mg.

[0071] Embodiment 15. As a method of any one of Embodiments 1-7, the therapeutically effective amount is 5 mg to 120 mg, 5 mg to 115 mg, 5 mg to 110 mg, 5 mg to 105 mg, 5 mg to 100 mg, 5 mg to 95 mg, 5 mg to 90 mg, 5 mg to 85 mg, 5 mg to 80 mg, 5 mg to 75 mg, 5 mg to 70 mg, 5 mg to 65 mg, 5 mg to 60 mg, 5 mg to 55 mg, 5 mg to 50 mg, 5 mg to 45 mg, 5 mg to 40 mg, 5 mg to 35 mg, 5 mg to 30 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 10 mg, 10 mg to 120 mg, 10 mg to 115 mg, 10 mg to 110 mg, 10 mg to 105 mg, 10 mg to 100 mg, 10 mg to 95 mg, 10 mg to 90 mg, 10 mg to 85 mg, 10 mg to 80 mg, 10 mg to 75 mg, 10 mg to 70 mg, 10 mg to 65 mg, 10 mg to 60 mg, 10 mg to 55 mg, 10 mg to 50 mg, 10 mg to 45 mg, 10 mg to 40 mg, 10 mg to 35 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 120 mg, 15 mg to 115 mg, 15 mg to 110 mg, 15 mg to 105 mg, 15 mg to 100 mg, 15 mg to 95 mg, 15 mg to 90 mg, 15 mg to 85 mg, 15 mg to 80 mg, 15 mg to 75 mg, 15 mg to 70 mg, 15 mg to 65 mg, 15 mg to 60 mg, 15 mg to 55 mg, 15 mg to 50 mg,15 mg to 45 mg, 15 mg to 40 mg, 15 mg to 35 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 120 mg, 20 mg to 115 mg, 20 mg to 110 mg, 20 mg to 105 mg, 20 mg to 100 mg, 20 mg to 95 mg, 20 mg to 90 mg, 20 mg to 85 mg, 20 mg to 80 mg, 20 mg to 75 mg, 20 mg to 70 mg, 20 mg to 65 mg, 20 mg to 60 mg, 20 mg to 55 mg, 20 mg to 50 mg, 20 mg to 45 mg, 20 mg to 40 mg, 20 mg to 35 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 120 mg, 25 mg to 115 mg, 25 mg to 110 mg, 25 mg to 105 mg, 25 mg to 100 mg, 25 mg to 95 mg, 25 mg to 90 mg, 25 mg to 85 mg, 25 mg to 80 mg, 25 mg to 75 mg, 25 mg to 70 mg, 25 mg to 65 mg, 25 mg to 60 mg, 25 mg to 55 mg, 25 mg to 50 mg, 25 mg to 45 mg, 25 mg to 40 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 120 mg, 30 mg to 115 mg, 30 mg to 110 mg, 30 mg to 105 mg, 30 mg to 100 mg, 30 mg to 95 mg, 30 mg to 90 mg, 30 mg to 85 mg, 30 mg to 80 mg, 30 mg to 75 mg, 30 mg to 70 mg, 30 mg to 65 mg, 30 mg to 60 mg, 30 mg to 55 mg, 30 mg to 50 mg, 30 mg to 45 mg,30 mg to 40 mg, 30 mg to 35 mg, 35 mg to 120 mg, 35 mg to 115 mg, 35 mg to 110 mg, 35 mg to 105 mg, 35 mg to 100 mg, 35 mg to 95 mg, 35 mg to 90 mg, 35 mg to 85 mg, 35 mg to 80 mg, 35 mg to 75 mg, 35 mg to 70 mg, 35 mg to 65 mg, 35 mg to 60 mg, 35 mg to 55 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 120 mg, 40 mg to 115 mg, 40 mg to 110 mg, 40 mg to 105 mg, 40 mg to 100 mg, 40 mg to 95 mg, 40 mg to 90 mg, 40 mg to 85 mg, 40 mg to 80 mg, 40 mg to 75 mg, 40 mg to 70 mg, 40 mg to 65 mg, 40 mg to 60 mg, 40 mg to 55 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 120 mg, 45 mg to 115 mg, 45 mg to 110 mg, 45 mg to 105 mg, 45 mg to 100 mg, 45 mg to 95 mg, 45 mg to 90 mg, 45 mg to 85 mg, 45 mg to 80 mg, 45 mg to 75 mg, 45 mg to 70 mg, 45 mg to 65 mg, 45 mg to 60 mg, 45 mg to 55 mg, 45 mg to 50 mg, 50 mg to 120 mg, 50 mg to 115 mg, 50 mg to 110 mg, 50 mg to 105 mg, 50 mg to 100 mg, 50 mg to 95 mg, 50 mg to 90 mg, 50 mg to 85 mg, 50 mg to 80 mg, 50 mg to 75 mg, 50 mg to 70 mg,50 mg to 65 mg, 50 mg to 60 mg, 50 mg to 120 mg, 55 mg to 115 mg, 55 mg to 110 mg, 55 mg to 105 mg, 55 mg to 100 mg, 55 mg to 95 mg, 55 mg to 90 mg, 55 mg to 85 mg, 55 mg to 80 mg, 55 mg to 75 mg, 55 mg to 70 mg, 55 mg to 65 mg, 55 mg to 60 mg, 60 mg to 120 mg, 60 mg to 115 mg, 60 mg to 110 mg, 60 mg to 105 mg, 60 mg to 100 mg, 60 mg to 95 mg, 60 mg to 90 mg, 60 mg to 85 mg, 60 mg to 80 mg, 60 mg to 75 mg, 60 mg to 70 mg, 65 mg to 120 mg, 65 mg to 115 mg, 65 mg to 110 mg, 65 mg to 105 mg, 65 mg to 100 mg, 65 mg to 95 mg, 65 mg to 90 mg, 65 mg to 85 mg, 65 mg to 80 mg, 65 mg to 75 mg, 65 mg to 70 mg, 70 mg to 120 mg, 70 mg to 115 mg, 70 mg to 110 mg, 70 mg to 105 mg, 70 mg to 100 mg, 70 mg to 95 mg, 70 mg to 90 mg, 70 mg to 85 mg, 70 mg to 80 mg, 75 mg to 120 mg, 75 mg to 115 mg, 75 mg to 110 mg, 75 mg to 105 mg, 75 mg to 100 mg, 75 mg to 95 mg, 75 mg to 90 mg, 75 mg to 85 mg, 75 mg to 80 mg, 80 mg to 120 mg, 80 mg to 115 mg, 80 mg to 110 mg, 80 mg to 105 mg, 80 mg to 100 mg,80 mg to 95 mg, 80 mg to 90 mg, 85 mg to 120 mg, 85 mg to 115 mg, 85 mg to 110 mg, 85 mg to 105 mg, 85 mg to 100 mg, 85 mg to 95 mg, 85 mg to 90 mg, 90 mg to 120 mg, 90 mg to 115 mg, 90 mg to 110 mg, 90 mg to 105 mg, 90 mg to 100 mg, 95 mg to 120 mg, 95 mg to 115 mg, 95 mg to 110 mg, 95 mg to 105 mg, 95 mg to 100 mg, 100 mg to 120 mg, 100 mg to 115 mg, 100 mg to 110 mg, 100 mg A method comprising any one of 105 mg, 105 mg to 120 mg, 105 mg to 115 mg, 105 mg to 110 mg, 110 mg to 120 mg, 110 mg to 115 mg, and 115 mg to 120 mg.

[0072] Embodiment 16. A method according to any one of Embodiments 1-7 or 15, wherein the therapeutically effective amount is 15 mg to 25 mg, 18 mg to 25 mg, 19 mg to 25 mg, 18 mg to 23 mg, 19 mg to 23 mg, 18 mg to 22 mg, 19 mg to 22 mg, 18 mg to 21 mg, or 19 mg to 21 mg.

[0073] Embodiment 17. A method according to any one of Embodiments 1-7 or 15, wherein the therapeutically effective amount is 35 mg to 45 mg, 38 mg to 45 mg, 39 mg to 45 mg, 38 mg to 43 mg, 39 mg to 43 mg, 38 mg to 42 mg, 39 mg to 42 mg, 38 mg to 41 mg, or 39 mg to 41 mg.

[0074] Embodiment 18. A method according to any one of Embodiments 1-7 or 15, wherein the therapeutically effective amount is any one of 55 mg to 65 mg, 58 mg to 65 mg, 59 mg to 65 mg, 58 mg to 63 mg, 59 mg to 63 mg, 58 mg to 62 mg, 59 mg to 62 mg, 58 mg to 61 mg, or 59 mg to 61 mg.

[0075] Embodiment 19. A method according to any one of Embodiments 1-7 or 15, wherein the therapeutically effective amount is any one of 75 mg to 85 mg, 78 mg to 85 mg, 79 mg to 85 mg, 78 mg to 83 mg, 79 mg to 83 mg, 78 mg to 82 mg, 79 mg to 82 mg, 78 mg to 81 mg, or 79 mg to 81 mg.

[0076] Embodiment 20. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is any one of less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

[0077] Embodiment 21. A method according to any one of Embodiments 1-7 or 20, wherein the therapeutically effective amount is any one of less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, and less than 10 mg.

[0078] Embodiment 22. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, and at least 145 mg.

[0079] Embodiment 23. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 5 mg.

[0080] Embodiment 24. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 10 mg.

[0081] Embodiment 25. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 20 mg.

[0082] Embodiment 26. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 30 mg.

[0083] Embodiment 27. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 40 mg.

[0084] Embodiment 28. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 50 mg.

[0085] Embodiment 29. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 60 mg.

[0086] Embodiment 30. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 70 mg.

[0087] Embodiment 31. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 80 mg.

[0088] Embodiment 32. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 90 mg.

[0089] Embodiment 33. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 100 mg.

[0090] Embodiment 34. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 110 mg.

[0091] Embodiment 35. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 120 mg.

[0092] Embodiment 36. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 4-6 mg.

[0093] Embodiment 37. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 9-11 mg.

[0094] Embodiment 38. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 19-21 mg.

[0095] Embodiment 39. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 29-31 mg.

[0096] Embodiment 40. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 39-41 mg.

[0097] Embodiment 41. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 48-52 mg.

[0098] Embodiment 42. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 58-62 mg.

[0099] Embodiment 43. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 68-72 mg.

[0100] Embodiment 44. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 78-82 mg.

[0101] Embodiment 45. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 88-92 mg.

[0102] Embodiment 46. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 98-102 mg.

[0103] Embodiment 47. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 108-112 mg.

[0104] Embodiment 48. A method according to any one of Embodiments 1-7, wherein the therapeutically effective amount is 118-122 mg.

[0105] Embodiment 49. A method according to any one of Embodiments 1-48, wherein the therapeutically effective amount is administered as a single dose.

[0106] Embodiment 50. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every 28 days.

[0107] Embodiment 51. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every 56 days.

[0108] Embodiment 52. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every 84 days.

[0109] Embodiment 53. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every 4 weeks, 8 weeks, 10 weeks, 12 weeks, 16 weeks, 18 weeks, 20 weeks, 24 weeks, 28 weeks, or 32 weeks.

[0110] Embodiment 54. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every 4 weeks.

[0111] Embodiment 55. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every 8 weeks.

[0112] Embodiment 56. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every 12 weeks.

[0113] Embodiment 57. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every 16 weeks.

[0114] Embodiment 58. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every 20 weeks.

[0115] Embodiment 59. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every 24 weeks.

[0116] Embodiment 60. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once a month.

[0117] Embodiment 61. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every two months.

[0118] Embodiment 62. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every four months.

[0119] Embodiment 63. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 once every 5 months.

[0120] Embodiment 64. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every 6 months.

[0121] Embodiment 65. A method of Embodiment 49, wherein the method comprises administering any one of the therapeutically effective doses of Embodiments 1-48 once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months, or once every 12 months.

[0122] Embodiment 66. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once every quarter.

[0123] Embodiment 67. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 three times a year.

[0124] Embodiment 68. A method of Embodiment 49, wherein the method comprises administering a dose of any one of the therapeutically effective doses of Embodiments 1-48 twice a year.

[0125] Embodiment 69. A method of Embodiment 49, wherein the method comprises administering one of the therapeutically effective doses of Embodiments 1-48 once a year.

[0126] Embodiment 70. The method of Embodiment 49, wherein the method comprises one of the therapeutically effective doses of Embodiments 1-48 once every 1 week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, once every 20 weeks, once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, and monthly A method comprising administering once, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months, or once a year.

[0127] Embodiment 71. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 4 weeks.

[0128] Embodiment 72. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0129] Embodiment 73. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 30 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0130] Embodiment 74. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0131] Embodiment 75. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0132] Embodiment 76. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0133] Embodiment 77. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0134] Embodiment 78. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0135] Embodiment 79. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 4 weeks.

[0136] Embodiment 80. A method of any one of Embodiments 1-70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 8 weeks.

[0137] Embodiment 81. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0138] Embodiment 82. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 30 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0139] Embodiment 83. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0140] Embodiment 84. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0141] Embodiment 85. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0142] Embodiment 86. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0143] Embodiment 87. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0144] Embodiment 88. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 8 weeks.

[0145] Embodiment 89. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 12 weeks.

[0146] Embodiment 90. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0147] Embodiment 91. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 30 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0148] Embodiment 92. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0149] Embodiment 93. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0150] Embodiment 94. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0151] Embodiment 95. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0152] Embodiment 96. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0153] Embodiment 97. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 12 weeks.

[0154] Embodiment 98. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every quarter.

[0155] Embodiment 99. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every quarter.

[0156] Embodiment 100. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every quarter.

[0157] Embodiment 101. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every quarter.

[0158] Embodiment 102. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every quarter.

[0159] Embodiment 103. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every quarter.

[0160] Embodiment 104. A method of any one of Embodiments 1-70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every quarter.

[0161] Embodiment 105. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every quarter.

[0162] Embodiment 106. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0163] Embodiment 107. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0164] Embodiment 108. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0165] Embodiment 109. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0166] Embodiment 110. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 12 to 13 weeks, once every quarter, or four times a year.

[0167] Embodiment 111. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. A method according to any one of embodiments 1-69, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0168] Embodiment 112. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 12 to 13 weeks, once every quarter, or four times a year.

[0169] Embodiment 113. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0170] Embodiment 114. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0171] Embodiment 115. A method according to any one of Embodiments 1-70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 12 to 13 weeks, once every quarter, or four times a year.

[0172] Embodiment 116. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0173] Embodiment 117. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 28 days.

[0174] Embodiment 118. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every 28 days.

[0175] Embodiment 119. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 30 mg of the modified oligonucleotide to a human subject once every 28 days.

[0176] Embodiment 120. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 28 days.

[0177] Embodiment 121. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every 28 days.

[0178] Embodiment 122. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 28 days.

[0179] Embodiment 123. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 28 days.

[0180] Embodiment 124. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject once every 28 days.

[0181] Embodiment 125. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 28 days.

[0182] Embodiment 126. A method according to any one of Embodiments 1-70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 56 days.

[0183] Embodiment 127. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every 56 days.

[0184] Embodiment 128. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 30 mg of the modified oligonucleotide to a human subject once every 56 days.

[0185] Embodiment 129. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 56 days.

[0186] Embodiment 130. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every 56 days.

[0187] Embodiment 131. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 56 days.

[0188] Embodiment 132. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 56 days.

[0189] Embodiment 133. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject once every 56 days.

[0190] Embodiment 134. A method according to any one of Embodiments 1-70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 56 days.

[0191] Embodiment 135. A method in which four doses of the modified oligonucleotide are administered as a method of any one of Embodiments 1-134.

[0192] Embodiment 136. A method in which three doses of the modified oligonucleotide are administered as a method of any one of Embodiments 1-134.

[0193] Embodiment 137. A method in which two doses of the modified oligonucleotide are administered as a method of any one of Embodiments 1-134.

[0194] Embodiment 138. A method of any one of Embodiments 1-134, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject in a total of three doses on day 1, day 29, and day 85, and then administering a maximum 40 mg dose in a maximum of five doses every 12 weeks.

[0195] Embodiment 139. A method of any one of Embodiments 1-70, wherein the method comprises administering a 40 mg dose of the modified oligonucleotide to a human subject on day 1, day 29, and day 85, and then administering a maximum 40 mg dose at a maximum of 5 times every 12 weeks.

[0196] Embodiment 140. A method of any one of Embodiments 1-70, wherein the method comprises administering a dose of 80 mg of the modified oligonucleotide to a human subject on day 1, day 29, and day 85, and then administering a dose of up to 80 mg at a maximum of 5 times every 12 weeks.

[0197] Embodiment 141. A method according to any one of Embodiments 1-70, wherein the modified oligonucleotide is administered to a human subject in a total monthly dose of 5 mg to 100 mg, 5 mg to 80 mg, 5 mg to 60 mg, 5 mg to 40 mg, 5 mg to 20 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 60 mg, 10 mg to 40 mg, 10 mg to 20 mg, 20 mg to 100 mg, 20 mg to 80 mg, 20 mg to 60 mg, 20 mg to 40 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 60 mg, or 80 mg to 100 mg.

[0198] Embodiment 142. As a method of any one of Embodiments 1-70, the modified oligonucleotide is in a total dose of 15 mg to 300 mg, 15 mg to 180 mg, 15 mg to 150 mg, 15 mg to 100 mg, 15 mg to 80 mg, 15 mg to 50 mg, 40 mg to 300 mg, 40 mg to 180 mg, 40 mg to 150 mg, 40 mg to 100 mg, 40 mg to 80 mg, 80 mg to 300 mg, 80 mg to 180 mg, 80 mg to 150 mg, 80 mg to 100 mg, 100 mg to 300 mg, 100 mg to 180 mg, 100 mg to 150 mg, or 150 mg to 300 mg per 3 months. A method administered to the above human subject.

[0199] Embodiment 143. As a method of any one of Embodiments 1-70, the modified oligonucleotide is, in a total dose per 4 months, 20 mg to 400 mg, 20 mg to 350 mg, 20 mg to 300 mg, 20 mg to 250 mg, 20 mg to 200 mg, 20 mg to 150 mg, 20 mg to 100 mg, 50 mg to 400 mg, 50 mg to 350 mg, 50 mg to 300 mg, 50 mg to 250 mg, 50 mg to 200 mg, 50 mg to 150 mg, 50 mg to 100 mg, 100 mg to 400 mg, 100 mg to 350 mg, 100 mg to 300 mg, 100 mg to 250 mg, 100 mg to A method of administering to a human subject in an amount of 200 mg, 100 mg to 150 mg, 200 mg to 400 mg, 200 mg to 350 mg, 200 mg to 300 mg, 200 mg to 250 mg, 300 mg to 400 mg, or 300 mg to 350 mg.

[0200] Embodiment 144. As a method of any one of Embodiments 1-70, the modified oligonucleotide is in a total dose per 6 months of 30 mg to 600 mg, 30 mg to 500 mg, 30 mg to 400 mg, 30 mg to 300 mg, 30 mg to 200 mg, 30 mg to 100 mg, 50 mg to 600 mg, 50 mg to 500 mg, 50 mg to 400 mg, 50 mg to 300 mg, 50 mg to 200 mg, 50 mg to 100 mg, 100 mg to 600 mg, 100 mg to 500 mg, 100 mg to 400 mg, 100 mg to 300 mg, 100 mg to 200 mg, 200 mg to 600 mg, 200 mg to A method of administering to a human subject in an amount of 500 mg, 200 mg to 400 mg, 200 mg to 300 mg, 300 mg to 600 mg, 300 mg to 500 mg, 300 mg to 400 mg, 400 mg to 600 mg, 400 mg to 500 mg, or 500 mg to 600 mg.

[0201] Embodiment 145. As a method of any one of Embodiments 1-70, the modified oligonucleotide is in an annual total dose of 60 mg to 1200 mg, 60 mg to 1100 mg, 60 mg to 1000 mg, 60 mg to 900 mg, 60 mg to 800 mg, 60 mg to 700 mg, 60 mg to 600 mg, 60 mg to 500 mg, 60 mg to 400 mg, 60 mg to 300 mg, 60 mg to 200 mg, 60 mg to 100 mg, 100 mg to 1200 mg, 100 mg to 1100 mg, 100 mg to 1000 mg, 100 mg to 900 mg, 100 mg to 800 mg, 100 mg to 700 mg, 100 mg to 600 mg, 100 mg to 500 mg, 100 mg to 400 mg, 100 mg to 300 mg, 100 mg to 200 mg, 200 mg to 1200 mg, 200 mg to 1100 mg, 200 mg to 1000 mg, 200 mg to 900 mg, 200 mg to 800 mg, 200 mg to 700 mg, 200 mg to 600 mg, 200 mg to 500 mg, 200 mg to 400 mg, 200 mg to 300 mg, 300 mg to 1200 mg, 300 mg to 1100 mg, 300 mg to 1000 mg, 300 mg to 900 mg, 300 mg to 800 mg, 300 mg to 700 mg, 300 mg to 600 mg, 300 mg to 500 mg, 300 mg to 400 mg, 400 mg to 1200 mg, 400 mg to 1100 mg, 400 mg to 1000 mg, 400 mg to 900 mg, 400 mg to 800 mg, 400 mg to 700 mg, 400 mg to 600 mg, 400 mg to 500 mg, 500 mg to 1200 mg,500 mg to 1100 mg, 500 mg to 1000 mg, 500 mg to 900 mg, 500 mg to 800 mg, 500 mg to 700 mg, 500 mg to 600 mg, 600 mg to 1200 mg, 600 mg to 1100 mg, 600 mg to 1000 mg, 600 mg to 900 mg, 600 mg to 800 mg, 600 mg to 700 mg, 700 mg to 1200 mg, 700 mg to 1100 mg, 700 mg to 1000 mg, 700 mg to 900 mg, 700 mg to 800 mg, 800 mg to 1200 mg, 800 mg to 1100 mg, 800 mg to A method of administering to the human subject in an amount of 1000 mg, 800 mg to 900 mg, 900 mg to 1200 mg, 900 mg to 1100 mg, 900 mg to 1000 mg, 1000 mg to 1200 mg, 1000 mg to 1100 mg, or 1100 mg to 1200 mg.

[0202] Embodiment 146. A method according to Embodiment 145, wherein the modified oligonucleotide is administered monthly, every two months, every three months, every four months, every six months, or once a year.

[0203] Embodiment 147. A method according to Embodiment 145, wherein each administration is performed at intervals independently selected from 2 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, and 6 months.

[0204] Embodiment 148. A method according to any one of embodiments 141-145, wherein the administration is performed at various administration intervals.

[0205] Embodiment 149. A method of any one of Embodiments 1-148, wherein the method comprises administering a loading dose of the modified oligonucleotide to the human subject.

[0206] Embodiment 150. A method of any one of Embodiments 1-148, wherein the method does not include administering a loading dose of the modified oligonucleotide to the human subject.

[0207] Embodiment 151. A method of any one of Embodiments 1-150, wherein the method comprises administering a maintenance dose of the modified oligonucleotide, optionally 1, 2, 3, 4, or 5 maintenance doses, to a human subject.

[0208] Embodiment 152. A method according to any one of Embodiments 1-151, wherein the dose is administered by intrathecal administration.

[0209] Embodiment 153. A method according to any one of Embodiments 1-152, wherein the dose is administered by bolus intrathecal administration.

[0210] Embodiment 154. A method in which the magnitude of delta waves in a human subject is reduced, as in any one of Embodiments 1-153.

[0211] Embodiment 155. A method according to any one of Embodiments 1-154, wherein the delta activity of the human subject is reduced compared to the delta activity of the subject before administration of the modified oligonucleotide.

[0212] Embodiment 156. A method according to any one of Embodiments 1-155, wherein the human subject has a faster frequency rhythm (theta) compared to the frequency rhythm of the subject prior to administration of the modified oligonucleotide.

[0213] Embodiment 157. A method according to any one of Embodiments 1-156, wherein the total Bayley score of the human subject is improved compared to the Bayley score of the subject before administration of the modified oligonucleotide.

[0214] Embodiment 158. A method according to any one of Embodiments 1-157, wherein the human subject is under 18 years of age, under 15 years of age, under 13 years of age, under 10 years of age, under 8 years of age, or under 5 years of age.

[0215] Embodiment 159. A method according to any one of Embodiments 1-157, wherein the human subject is 2 years of age or older and 5 years of age or younger, 4 years of age or older and 17 years of age or younger, or 1 year of age or older and 17 years of age or younger.

[0216] Embodiment 160. A method according to any one of Embodiments 1-157, wherein the human subject is 13 years of age or older, or 18 years of age or older.

[0217] Embodiment 161. A method according to any one of Embodiments 1-157, wherein the human subject is 18 to 50 years of age.

[0218] Embodiment 162. A method according to any one of Embodiments 1-157, wherein the human subject is 18 years of age or older.

[0219] Embodiment 163. A method according to any one of Embodiments 1-157, wherein the human subject is 17 years of age or younger.

[0220] Embodiment 164. A method in which a disease or disorder associated with UBE3A is improved in a human subject requiring treatment, as a method of any one of the aforementioned embodiments.

[0221] Embodiment 165. A method in which UBE3A-ATS RNA is reduced in a human subject requiring treatment, as a method of any one of the aforementioned embodiments.

[0222] Embodiment 166. A method in which UBE3A protein is increased as a method of any one of the aforementioned embodiments.

[0223] Embodiment 167. As a method of any one of Embodiments 1-166, the disease or disorder associated with UBE3A is a developmental disorder, method.

[0224] Embodiment 168. A method according to any one of Embodiments 1-167, wherein the disease or disorder associated with UBE3A is Angelman syndrome.

[0225] Embodiment 169. A method according to any one of Embodiments 1-168, wherein at least one symptom or characteristic sign of the disease or disorder associated with UBE3A is improved.

[0226] Embodiment 170. A method of any one of Embodiments 1-169, wherein at least one symptom or characteristic sign is selected from developmental delay, ataxia, cognitive impairment, fine and / or gross motor skill impairment, language impairment, receptive and / or expressive communication impairment, impairment of daily living skills, impaired socialization skills, sleep problems, seizures, and EEG abnormalities.

[0227] Embodiment 171. A method of Embodiment 169, wherein at least one symptom or characteristic sign is developmental delay, ataxia, speech disorder, sleep problem, seizure, or EEG abnormality.

[0228] Embodiment 172. A method for treating a patient with Angelman syndrome,

[0229] a) A step of evaluating the patient at a first time point regarding sleep, seizures, communication, motor function, and / or the ability to perform daily living activities;

[0230] b) A step of administering a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure to the human subject:

[0231]

[0232] (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof,

[0233] c) a step of re-evaluating the patient regarding sleep, seizures, communication, motor function, and / or the ability to perform daily living activities at a second time point after administering the modified oligonucleotide; and

[0234] d) a method comprising the step of increasing the amount of the next dose administered if there is no improvement or the improvement is insufficient between the evaluation at the first time point and the second time point.

[0235] Embodiment 173. Use of a modified oligonucleotide in the manufacture of a pharmaceutical product for treating Angelman syndrome, wherein the modified oligonucleotide is

[0236] a. Modified oligonucleotides according to the following chemical structures:

[0237]

[0238] (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof;

[0239] b. Modified oligonucleotides according to the following chemical structures:

[0240] (Sequence ID NO: 5), or

[0241] c. A modified oligonucleotide consisting of 19-20 linked nucleosides, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eoA es G es m C e A modified oligonucleotide comprising at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein:

[0242] A = adenine nucleobase,

[0243] m C=5-methylcytosine nucleobase,

[0244] G = guanine nucleobase,

[0245] T = thymine nucleobase,

[0246] e = 2'-MOE per moiety,

[0247] d = 2'-β-D-deoxyribosyl sugar moiety,

[0248] s = phosphorothioate internucleoside linkage, and

[0249] o = a link between phosphodiester nucleosides, and

[0250] The above treatment for Angelman syndrome involves administering a therapeutically effective amount of the modified oligonucleotide, wherein the therapeutically effective amount is 5-150 mg.

[0251] Embodiment 174. An use of Embodiment 173, wherein the therapeutically effective amount is any one of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg.

[0252] Embodiment 175. For the use of Embodiment 173, the therapeutically effective amount is 5 mg to 120 mg, 5 mg to 115 mg, 5 mg to 110 mg, 5 mg to 105 mg, 5 mg to 100 mg, 5 mg to 95 mg, 5 mg to 90 mg, 5 mg to 85 mg, 5 mg to 80 mg, 5 mg to 75 mg, 5 mg to 70 mg, 5 mg to 65 mg, 5 mg to 60 mg, 5 mg to 55 mg, 5 mg to 50 mg, 5 mg to 45 mg, 5 mg to 40 mg, 5 mg to 35 mg, 5 mg to 30 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 10 mg, 10 mg to 120 mg, 10 mg to 115 mg, 10 mg to 110 mg, 10 mg to 105 mg, 10 mg to 100 mg, 10 mg to 95 mg, 10 mg to 90 mg, 10 mg to 85 mg, 10 mg to 80 mg, 10 mg to 75 mg, 10 mg to 70 mg, 10 mg to 65 mg, 10 mg to 60 mg, 10 mg to 55 mg, 10 mg to 50 mg, 10 mg to 45 mg, 10 mg to 40 mg, 10 mg to 35 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 120 mg, 15 mg to 115 mg, 15 mg to 110 mg, 15 mg to 105 mg, 15 mg to 100 mg, 15 mg to 95 mg, 15 mg to 90 mg, 15 mg to 85 mg, 15 mg to 80 mg, 15 mg to 75 mg, 15 mg to 70 mg, 15 mg to 65 mg, 15 mg to 60 mg, 15 mg to 55 mg, 15 mg to 50 mg,15 mg to 45 mg, 15 mg to 40 mg, 15 mg to 35 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 120 mg, 20 mg to 115 mg, 20 mg to 110 mg, 20 mg to 105 mg, 20 mg to 100 mg, 20 mg to 95 mg, 20 mg to 90 mg, 20 mg to 85 mg, 20 mg to 80 mg, 20 mg to 75 mg, 20 mg to 70 mg, 20 mg to 65 mg, 20 mg to 60 mg, 20 mg to 55 mg, 20 mg to 50 mg, 20 mg to 45 mg, 20 mg to 40 mg, 20 mg to 35 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 120 mg, 25 mg to 115 mg, 25 mg to 110 mg, 25 mg to 105 mg, 25 mg to 100 mg, 25 mg to 95 mg, 25 mg to 90 mg, 25 mg to 85 mg, 25 mg to 80 mg, 25 mg to 75 mg, 25 mg to 70 mg, 25 mg to 65 mg, 25 mg to 60 mg, 25 mg to 55 mg, 25 mg to 50 mg, 25 mg to 45 mg, 25 mg to 40 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 120 mg, 30 mg to 115 mg, 30 mg to 110 mg, 30 mg to 105 mg, 30 mg to 100 mg, 30 mg to 95 mg, 30 mg to 90 mg, 30 mg to 85 mg, 30 mg to 80 mg, 30 mg to 75 mg, 30 mg to 70 mg, 30 mg to 65 mg, 30 mg to 60 mg, 30 mg to 55 mg, 30 mg to 50 mg, 30 mg to 45 mg,30 mg to 40 mg, 30 mg to 35 mg, 35 mg to 120 mg, 35 mg to 115 mg, 35 mg to 110 mg, 35 mg to 105 mg, 35 mg to 100 mg, 35 mg to 95 mg, 35 mg to 90 mg, 35 mg to 85 mg, 35 mg to 80 mg, 35 mg to 75 mg, 35 mg to 70 mg, 35 mg to 65 mg, 35 mg to 60 mg, 35 mg to 55 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 120 mg, 40 mg to 115 mg, 40 mg to 110 mg, 40 mg to 105 mg, 40 mg to 100 mg, 40 mg to 95 mg, 40 mg to 90 mg, 40 mg to 85 mg, 40 mg to 80 mg, 40 mg to 75 mg, 40 mg to 70 mg, 40 mg to 65 mg, 40 mg to 60 mg, 40 mg to 55 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 120 mg, 45 mg to 115 mg, 45 mg to 110 mg, 45 mg to 105 mg, 45 mg to 100 mg, 45 mg to 95 mg, 45 mg to 90 mg, 45 mg to 85 mg, 45 mg to 80 mg, 45 mg to 75 mg, 45 mg to 70 mg, 45 mg to 65 mg, 45 mg to 60 mg, 45 mg to 55 mg, 45 mg to 50 mg, 50 mg to 120 mg, 50 mg to 115 mg, 50 mg to 110 mg, 50 mg to 105 mg, 50 mg to 100 mg, 50 mg to 95 mg, 50 mg to 90 mg, 50 mg to 85 mg, 50 mg to 80 mg, 50 mg to 75 mg, 50 mg to 70 mg,50 mg to 65 mg, 50 mg to 60 mg, 50 mg to 120 mg, 55 mg to 115 mg, 55 mg to 110 mg, 55 mg to 105 mg, 55 mg to 100 mg, 55 mg to 95 mg, 55 mg to 90 mg, 55 mg to 85 mg, 55 mg to 80 mg, 55 mg to 75 mg, 55 mg to 70 mg, 55 mg to 65 mg, 55 mg to 60 mg, 60 mg to 120 mg, 60 mg to 115 mg, 60 mg to 110 mg, 60 mg to 105 mg, 60 mg to 100 mg, 60 mg to 95 mg, 60 mg to 90 mg, 60 mg to 85 mg, 60 mg to 80 mg, 60 mg to 75 mg, 60 mg to 70 mg, 65 mg to 120 mg, 65 mg to 115 mg, 65 mg to 110 mg, 65 mg to 105 mg, 65 mg to 100 mg, 65 mg to 95 mg, 65 mg to 90 mg, 65 mg to 85 mg, 65 mg to 80 mg, 65 mg to 75 mg, 65 mg to 70 mg, 70 mg to 120 mg, 70 mg to 115 mg, 70 mg to 110 mg, 70 mg to 105 mg, 70 mg to 100 mg, 70 mg to 95 mg, 70 mg to 90 mg, 70 mg to 85 mg, 70 mg to 80 mg, 75 mg to 120 mg, 75 mg to 115 mg, 75 mg to 110 mg, 75 mg to 105 mg, 75 mg to 100 mg, 75 mg to 95 mg, 75 mg to 90 mg, 75 mg to 85 mg, 75 mg to 80 mg, 80 mg to 120 mg, 80 mg to 115 mg, 80 mg to 110 mg, 80 mg to 105 mg, 80 mg to 100 mg,80 mg to 95 mg, 80 mg to 90 mg, 85 mg to 120 mg, 85 mg to 115 mg, 85 mg to 110 mg, 85 mg to 105 mg, 85 mg to 100 mg, 85 mg to 95 mg, 85 mg to 90 mg, 90 mg to 120 mg, 90 mg to 115 mg, 90 mg to 110 mg, 90 mg to 105 mg, 90 mg to 100 mg, 95 mg to 120 mg, 95 mg to 115 mg, 95 mg to 110 mg, 95 mg to 105 mg, 95 mg to 100 mg, 100 mg to 120 mg, 100 mg to 115 mg, 100 mg to 110 mg, 100 mg Uses of any one of 105 mg, 105 mg to 120 mg, 105 mg to 115 mg, 105 mg to 110 mg, 110 mg to 120 mg, 110 mg to 115 mg, and 115 mg to 120 mg.

[0253] Embodiment 176. Use of Embodiment 173, wherein the therapeutically effective amount is any one of 15 mg to 25 mg, 18 mg to 25 mg, 19 mg to 25 mg, 18 mg to 23 mg, 19 mg to 23 mg, 18 mg to 22 mg, 19 mg to 22 mg, 18 mg to 21 mg, or 19 mg to 21 mg.

[0254] Embodiment 177. Use of Embodiment 173, wherein the therapeutically effective amount is any one of 35 mg to 45 mg, 38 mg to 45 mg, 39 mg to 45 mg, 38 mg to 43 mg, 39 mg to 43 mg, 38 mg to 42 mg, 39 mg to 42 mg, 38 mg to 41 mg, or 39 mg to 41 mg.

[0255] Embodiment 178. Use of Embodiment 173, wherein the therapeutically effective amount is any one of 55 mg to 65 mg, 58 mg to 65 mg, 59 mg to 65 mg, 58 mg to 63 mg, 59 mg to 63 mg, 58 mg to 62 mg, 59 mg to 62 mg, 58 mg to 61 mg, or 59 mg to 61 mg.

[0256] Embodiment 179. Use of Embodiment 173, wherein the therapeutically effective amount is any one of 75 mg to 85 mg, 78 mg to 85 mg, 79 mg to 85 mg, 78 mg to 83 mg, 79 mg to 83 mg, 78 mg to 82 mg, 79 mg to 82 mg, 78 mg to 81 mg, or 79 mg to 81 mg.

[0257] Embodiment 180. An use of Embodiment 173, wherein the therapeutically effective amount is about 5 mg.

[0258] Embodiment 181. An use of Embodiment 173, wherein the therapeutically effective amount is about 10 mg.

[0259] Embodiment 182. An use of Embodiment 173, wherein the therapeutically effective amount is about 20 mg.

[0260] Embodiment 183. An use of Embodiment 173, wherein the therapeutically effective amount is about 30 mg.

[0261] Embodiment 184. An use of Embodiment 173, wherein the therapeutically effective amount is about 40 mg.

[0262] Embodiment 185. An use of Embodiment 173, wherein the therapeutically effective amount is about 50 mg.

[0263] Embodiment 186. An use of Embodiment 173, wherein the therapeutically effective amount is about 60 mg.

[0264] Embodiment 187. An use of Embodiment 173, wherein the therapeutically effective amount is about 70 mg.

[0265] Embodiment 188. An use of Embodiment 173, wherein the therapeutically effective amount is about 80 mg.

[0266] Embodiment 189. An use of Embodiment 173, wherein the therapeutically effective amount is about 90 mg.

[0267] Embodiment 190. An use of Embodiment 173, wherein the therapeutically effective amount is about 100 mg.

[0268] Embodiment 191. An use of Embodiment 173, wherein the therapeutically effective amount is about 110 mg.

[0269] Embodiment 192. An use of Embodiment 173, wherein the therapeutically effective amount is about 120 mg.

[0270] Embodiment 193. An use of Embodiment 173, wherein the therapeutically effective amount is 4-6 mg.

[0271] Embodiment 194. Use of Embodiment 173, wherein the therapeutically effective amount is 9-11 mg.

[0272] Embodiment 195. Use of Embodiment 173, wherein the therapeutically effective amount is 19-21 mg.

[0273] Embodiment 196. Use of Embodiment 173, wherein the therapeutically effective amount is 29-31 mg.

[0274] Embodiment 197. Use of Embodiment 173, wherein the therapeutically effective amount is 39-41 mg.

[0275] Embodiment 198. Use of Embodiment 173, wherein the therapeutically effective amount is 48-52 mg.

[0276] Embodiment 199. An use of Embodiment 173, wherein the therapeutically effective amount is 58-62 mg.

[0277] Embodiment 200. An use of Embodiment 173, wherein the therapeutically effective amount is 68-72 mg.

[0278] Embodiment 201. Use of Embodiment 173, wherein the therapeutically effective amount is 78-82 mg.

[0279] Embodiment 202. Use of Embodiment 173, wherein the therapeutically effective amount is 88-92 mg.

[0280] Embodiment 203. Use of Embodiment 173, wherein the therapeutically effective amount is 98-102 mg.

[0281] Embodiment 204. Use of Embodiment 173, wherein the therapeutically effective amount is 108-112 mg.

[0282] Embodiment 205. Use of Embodiment 173, wherein the therapeutically effective amount is 118-122 mg.

[0283] Embodiment 206. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 28 days.

[0284] Embodiment 207. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 56 days.

[0285] Embodiment 208. Use for any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 84 days.

[0286] Embodiment 209. For any one of Embodiments 173-205, the above-mentioned medicine is formulated for administration once every 4, 8, 10, 12, 16, 18, 20, 24, 28, or 32 weeks.

[0287] Embodiment 210. Use for any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 4 weeks.

[0288] Embodiment 211. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 8 weeks.

[0289] Embodiment 212. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 12 weeks.

[0290] Embodiment 213. Use for any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 16 weeks.

[0291] Embodiment 214. Use for any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 20 weeks.

[0292] Embodiment 215. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every 24 weeks.

[0293] Embodiment 216. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once a month.

[0294] Embodiment 217. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every two months.

[0295] Embodiment 218. Use for any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every four months.

[0296] Embodiment 219. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every five months.

[0297] Embodiment 220. Use for any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once every six months.

[0298] Embodiment 221. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration once per quarter.

[0299] Embodiment 222. Use of any one of Embodiments 173-205, wherein the above-mentioned medicine is formulated for administration three times a year.

[0300] Embodiment 223. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 4 weeks.

[0301] Embodiment 224. Use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 4 weeks.

[0302] Embodiment 225. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 4 weeks.

[0303] Embodiment 226. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 4 weeks.

[0304] Embodiment 227. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 8 weeks.

[0305] Embodiment 228. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 8 weeks.

[0306] Embodiment 229. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 8 weeks.

[0307] Embodiment 230. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 8 weeks.

[0308] Embodiment 231. Use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 12 weeks.

[0309] Embodiment 232. Use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 12 weeks.

[0310] Embodiment 233. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 12 weeks.

[0311] Embodiment 234. An use for any one of Embodiments 173-205, wherein the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the medicine is formulated for administration once every 12 weeks.

[0312] Embodiment 235. For any one of Embodiments 173-205, the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0313] Embodiment 236. For any one of Embodiments 173-205, the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0314] Embodiment 237. For any one of Embodiments 173-205, the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0315] Embodiment 238. For any one of Embodiments 173-205, the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year.

[0316] Embodiment 239. Use of any one of Embodiments 173-227, wherein the above-mentioned drug is formulated for intrathecal administration.

[0317] Embodiment 240. An use for any one of Embodiments 173-228, wherein the above-mentioned medicine is formulated for administration to a human subject under the age of 18, under the age of 15, under the age of 13, under the age of 10, under the age of 8, or under the age of 5.

[0318] Embodiment 241. An use of Embodiment 240, wherein the human subject is 2 years of age or older and 5 years of age or younger, 4 years of age or older and 17 years of age or younger, or 1 year of age or older and 17 years of age or younger.

[0319] Embodiment 242. An use of Embodiment 240, wherein the human subject is 13 years of age or older, or 18 years of age or older.

[0320] Embodiment 243. An use of Embodiment 240, wherein the human subject is 18 to 50 years of age.

[0321] Embodiment 244. An use of any one of Embodiments 1-146, wherein the human subject is 18 years of age or older.

[0322] Embodiment 245. An use of Embodiment 240, wherein the human subject is 17 years of age or younger.

[0323] Embodiment 246. Use of any one of Embodiments 173-245, wherein the modified oligonucleotide is formulated into a pharmaceutical composition comprising a pharmaceutically acceptable diluent.

[0324] Embodiment 247. An application of Embodiment 246 in which the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF).

[0325] Embodiment 248. An application of Embodiment 246 in which the pharmaceutically acceptable diluent is phosphate buffered saline (PBS).

[0326] Embodiment 249. A method for treating Angelman syndrome, comprising administering a therapeutically effective amount of a modified oligonucleotide to a human having Angelman syndrome, wherein the modified oligonucleotide is

[0327] a. Modified oligonucleotides according to the following chemical structures:

[0328]

[0329] (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof;

[0330] b. Modified oligonucleotides according to the following chemical structures:

[0331] (Sequence ID NO: 5), or

[0332] c. A modified oligonucleotide consisting of 19-20 linked nucleosides, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e A modified oligonucleotide comprising at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein:

[0333] A = adenine nucleobase,

[0334] m C=5-methylcytosine nucleobase,

[0335] G = guanine nucleobase,

[0336] T = thymine nucleobase,

[0337] e = 2'-MOE per moiety,

[0338] d = 2'-β-D-deoxyribosyl sugar moiety,

[0339] s = phosphorothioate internucleoside linkage, and

[0340] o = a link between phosphodiester nucleosides, and

[0341] A method in which the above therapeutic effective dose is 40 mg and the above therapeutic effective dose is administered once every quarter.

[0342] Embodiment 250. A method for treating Angelman syndrome, comprising administering a therapeutically effective amount of a modified oligonucleotide to a human having Angelman syndrome, wherein the modified oligonucleotide is

[0343] a) Modified oligonucleotides according to the following chemical structures:

[0344]

[0345] (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof;

[0346] b) Modified oligonucleotides according to the following chemical structures:

[0347] (Sequence ID NO: 5), or

[0348] c) A modified oligonucleotide consisting of 19-20 linked nucleosides, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo Teo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e A modified oligonucleotide comprising at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein:

[0349] A = adenine nucleobase,

[0350] m C=5-methylcytosine nucleobase,

[0351] G = guanine nucleobase,

[0352] T = thymine nucleobase,

[0353] e = 2'-MOE per moiety,

[0354] d = 2'-β-D-deoxyribosyl sugar moiety,

[0355] s = phosphorothioate internucleoside linkage, and

[0356] o = a link between phosphodiester nucleosides, and

[0357] A method in which the above therapeutic effective dose is 80 mg and the above therapeutic effective dose is administered once every quarter.

[0358] Embodiment 251. A method according to Embodiment 249 or 250, wherein at least one symptom or characteristic sign of Angelman syndrome is improved.

[0359] Embodiment 252. A method according to Embodiment 251, wherein at least one symptom or characteristic sign is selected from developmental delay, ataxia, cognitive impairment, fine and / or gross motor skill impairment, language impairment, receptive and / or expressive communication impairment, impairment of daily living skills, impaired socialization skills, sleep problems, seizures, and EEG abnormalities.

[0360] Embodiment 253. A method according to Embodiment 251, wherein the symptoms or characteristic signs are developmental delay, ataxia, speech disorder, sleep problems, seizures, or EEG abnormalities.

[0361] Embodiment 254. As a method of Embodiment 251, the at least one symptom or characteristic sign is a cognitive impairment.

[0362] Embodiment 255. A method of Embodiment 251, wherein at least one symptom or characteristic sign is fine motor ability.

[0363] Embodiment 256. A method of Embodiment 251, wherein at least one symptom or characteristic sign is gross motor ability.

[0364] Embodiment 257. A method of Embodiment 251, wherein at least one symptom or characteristic sign is receptive communication.

[0365] Embodiment 258. A method of Embodiment 251, wherein at least one symptom or characteristic sign is expressive communication.

[0366] Embodiment 259. As a method of Embodiment 251, the at least one symptom or characteristic sign is a person with impaired ability to perform daily activities.

[0367] Embodiment 260. As a method of Embodiment 251, the at least one symptom or characteristic sign is a person with impaired socialization ability.

[0368] Embodiment 261. A method of Embodiment 251, wherein at least one symptom or characteristic sign is a sleep problem.

[0369] UBE3A-ATS

[0370] In certain embodiments, the oligomer compound comprises or consists of a modified oligonucleotide, such as ION582, that is complementary to the target nucleic acid, wherein the target nucleic acid is UBE3A-ATS. In certain embodiments, the UBE3A-ATS nucleic acid has the sequence described in sequence ID NO: 1 (GENBANK access number: NC_000015.10_TRUNC_24821647_25441028), sequence ID NO: 2 (Ensemble gene ID ENSG00000224078), or sequence ID NO: 3 (cDNA of Ensemble transcript ENST00000554726.2 from Ensembl Release 110 (July 2023)).

[0371] In certain embodiments, an oligomer compound complementary to sequence ID NO: 1, sequence ID NO: 2, or sequence ID NO: 3 may decrease UBE3A-ATS in cells. In certain embodiments, an oligomer compound complementary to sequence ID NO: 1 may increase UBE3A RNA or protein in cells. In certain embodiments, an oligomer compound complementary to sequence ID NO: 1, sequence ID NO: 2, or sequence ID NO: 3 may increase paternal UBE3A RNA or protein in cells. In certain embodiments, the cell is within a subject. In certain embodiments, the oligomer compound consists of a modified oligonucleotide. In certain embodiments, an oligomer compound complementary to sequence ID NO: 1, sequence ID NO: 2, or sequence ID NO: 3 may improve one or more symptoms or characteristic signs of a neurogenetic disorder when administered to a subject. In certain embodiments, the neurogenetic disorder is AS. In certain embodiments, symptoms or characteristic signs are selected from developmental delay, ataxia, cognitive impairment, fine and / or gross motor skill impairment, language disorder, receptive and / or expressive communication disorder, impairment of daily living skills, impaired socialization skills, sleep problems, seizures, and EEG abnormalities. In certain embodiments, said symptoms or characteristic signs are selected from developmental delay, ataxia, language disorder, sleep problems, seizures, and EEG abnormalities.

[0372] Specific target nucleic acids within a specific tissue

[0373] In certain embodiments, the oligomer compound comprises or consists of a modified oligonucleotide, such as ION582, that is complementary to the target nucleic acid, wherein the target nucleic acid is expressed in pharmacologically relevant tissues. In certain embodiments, the pharmacologically relevant tissues are cells and tissues that constitute the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.

[0374] Compound number 1273062 / ION582

[0375] In a specific embodiment, compound number 1273062 is characterized as a 5-10-5 MOE linker of linked nucleosides having the nucleobase sequence (5' to 3' direction) of ACCATTTTGACCTTCTTAGC (sequence ID NO: 4), wherein nucleosides 1-5 and 16-20 (5' to 3' direction) are each 2'-MOE nucleosides and nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester nucleoside linkages and nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, The nucleoside linkages between 12 and 13, 13 and 14, 14 and 15, 15 and 16, 18 and 19, and 19 and 20 are phosphothioate nucleoside linkages, and each cytosine is 5-methylcytosine.

[0376] In certain embodiments, compound number 1273062 is represented by the following chemical notation: A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e (Sequence ID NO: 5), in the above formula:

[0377] A = adenine nucleobase,

[0378] m C=5-methylcytosine nucleobase,

[0379] G = guanine nucleobase,

[0380] T = thymine nucleobase,

[0381] e = 2'-MOE per moiety,

[0382] d = 2'-β-D-deoxyribosyl sugar moiety,

[0383] s = phosphorothioate internucleoside linkage, and

[0384] o = a link between phosphodiester nucleosides.

[0385] In certain embodiments, compound number 1273062 is represented by the following chemical structure:

[0386] (Sequence ID NO: 5).

[0387] Structure 11. Compound No. 1273062

[0388] In certain embodiments, the sodium salt of compound number 1273062 is represented by the following chemical structure:

[0389] (Sequence ID NO: 5).

[0390] Structure 12. Sodium salt of Compound No. 1273062

[0391] Compound 1273062 is described in WO 2020 / 205463, the full contents of which are incorporated herein by reference.

[0392] I. Specific pharmaceutical compositions

[0393] In certain embodiments, a method for administering a pharmaceutical composition comprising modified oligonucleotide 1273062 to a subject is described herein. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutical composition comprises or essentially consists of a sterile saline solution and modified oligonucleotide 1273062. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or essentially consists of sterile water and modified oligonucleotide 1273062. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or essentially consists of artificial cerebrospinal fluid (aCSF) and modified oligonucleotide 1273062. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade. In certain embodiments, the pharmaceutical composition comprises a certain concentration of modified oligonucleotide 1273062 in aCSF and is diluted with an aCSF diluent to achieve an intended clinical dose. In certain embodiments, 1273062 is formulated in aCSF at 30 mg / mL and is diluted with an aCSF diluent to achieve an intended clinical dose. In certain embodiments, 1273062 is formulated in aCSF at 20 mg / mL and is diluted with an aCSF diluent to achieve an intended clinical dose.

[0394] In certain embodiments, the pharmaceutical composition comprises one or more excipients and a modified oligonucleotide 1273062. In certain embodiments, the excipient is selected from water, salt solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0395] In certain embodiments, a pharmaceutical composition comprising modified oligonucleotide 1273062 comprises any pharmaceutically acceptable salt of modified oligonucleotide 1273062, an ester of modified oligonucleotide 1273062, or a salt of such ester. In certain embodiments, a pharmaceutical composition comprising modified oligonucleotide 1273062 may provide (directly or indirectly) a biologically active metabolite or a residue thereof when administered to a human subject. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of modified oligonucleotide 1273062, prodrugs of modified oligonucleotide 1273062, pharmaceutically acceptable salts of such prodrugs, and other biological equivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0396] In certain embodiments, the pharmaceutical composition comprises one or more lipid moieties and modified oligonucleotide 1273062. In certain embodiments, the lipid moieties are used to increase the distribution of 1273062 to specific cells or tissues. In such specific methods, modified oligonucleotide 1273062 is introduced into a pre-formed liposome or lipid complex made of a mixture of cationic lipids and neutral lipids. In certain methods, a DNA complex with a single- or multiple-cationic lipid is formed without the presence of neutral lipids.

[0397] In certain embodiments, the pharmaceutical composition disclosed herein includes a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0398] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver the modified oligonucleotides described herein to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0399] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Specific examples of such a co-solvent system include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a co-solvent system is used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is an absolute ethanol solution comprising 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of such a co-solvent system can be varied significantly without significantly altering solubility and toxicity properties. Additionally, the identity of the co-solvent components can be varied: for example, a different surfactant may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; Other biocompatible polymers (e.g., polyvinylpyrrolidone) can replace polyethylene glycol; and other sugars or polysaccharides can replace dextrose.

[0400] In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV)). In certain embodiments, administration by injection is intrathecal administration. In such certain embodiments, the pharmaceutical composition comprises a carrier and is formulated with an aqueous solution such as aCSF or water, or a physiologically compatible buffer such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components (e.g., components that aid in solubility or act as preservatives) are included. In certain embodiments, the injectable suspension is prepared using a suitable liquid carrier, suspending agent, etc. The specific injectable pharmaceutical composition is provided in a unit dosage form, e.g., an ampoule or a multi-dose container. Specific pharmaceutical compositions for injectable use are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulation agents such as suspending agents, stabilizers, and / or dispersants. Specific solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters such as ethyl oleates or triglycerides, and liposomes.

[0401] Under specific conditions, the modified oligonucleotide 1273062 acts as an acid. Although 1273062 is depicted or described in a protonated (free acid) form, or in an ionized form and in a form associated with a cation (salt), aqueous solutions of 1273062 exist in equilibrium between such forms. For example, the phosphate linkage of 1273062 in aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the term "1273062" is intended to include all such forms. Furthermore, 1273062 has multiple such linkages, each in equilibrium. Thus, 1273062 exists in solution as an ensemble of various forms at multiple locations, all in equilibrium. The term "1273062" is intended to include all such forms. The depicted structure necessarily represents a single form. Nevertheless, unless otherwise specified, such cities are intended to include likewise corresponding forms. In this document, structures describing the free acid of 1273062 following the term “or salt thereof” explicitly include all such forms that may be in a state of being fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.

[0402] In certain embodiments, 1273062 is in an aqueous solution with sodium. In certain embodiments, 1273062 is in an aqueous solution with potassium. In certain embodiments, 1273062 is in PBS. In certain embodiments, 1273062 is in water. In such specific embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve a desired pH.

[0403] Specific dosages are described herein. For clarity, the dosage of 1273062 in milligrams represents the mass of the free acid form of 1273062. As described above, in aqueous solution, the free acid is in equilibrium with its anionic and salt forms. However, for the purposes of dosage calculation, it is assumed that 1273062 exists as a solvent-free, sodium acetate-free, anhydrous free acid. For example, if 1273062 is in a solution containing sodium (e.g., saline solution), 1273062 is partially or completely deprotonated, and Na + It can exist in an associated form with ions. However, the mass of the proton is nevertheless included in the weight of the volume, and Na + The mass of the ions is not included in the weight of the dose. Thus, for example, a 10 mg dose of 1273062 is equivalent to the number of fully protonated molecules having a weight of 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium 1273062.

[0404] Specific dosage

[0405] In certain embodiments, a method for administering a therapeutically effective amount of modified oligonucleotide 1273062 to a subject is described herein. In certain embodiments, the therapeutically effective amount is 20 mg. In certain embodiments, the therapeutically effective amount is 40 mg. In certain embodiments, the therapeutically effective amount is 60 mg. In certain embodiments, the therapeutically effective amount is 80 mg.

[0406] In certain embodiments, a method of administering a therapeutically effective dose of modified oligonucleotide 1273062 to subjects aged 2 to 5 years is described herein. In certain embodiments, the therapeutically effective dose is 20 mg. In certain embodiments, the therapeutically effective dose is 40 mg. In certain embodiments, the therapeutically effective dose is 60 mg. In certain embodiments, the therapeutically effective dose is 80 mg.

[0407] In certain embodiments, a method of administering a therapeutically effective dose of modified oligonucleotide 1273062 to subjects aged 4 to 17 years is described herein. In certain embodiments, the therapeutically effective dose is 20 mg. In certain embodiments, the therapeutically effective dose is 40 mg. In certain embodiments, the therapeutically effective dose is 60 mg. In certain embodiments, the therapeutically effective dose is 80 mg.

[0408] In certain embodiments, a method of administering a therapeutically effective dose of modified oligonucleotide 1273062 to subjects aged 18 to 50 years is described herein. In certain embodiments, the therapeutically effective dose is 20 mg. In certain embodiments, the therapeutically effective dose is 40 mg. In certain embodiments, the therapeutically effective dose is 60 mg. In certain embodiments, the therapeutically effective dose is 80 mg.

[0409] In certain embodiments, a method for administering a therapeutically effective amount of modified oligonucleotide 1273062 to a subject is described herein. In certain embodiments, the therapeutically effective amount is 20 mg. In certain embodiments, the therapeutically effective amount is 40 mg. In certain embodiments, the therapeutically effective amount is 60 mg. In certain embodiments, the therapeutically effective amount is 80 mg.

[0410] In certain embodiments, a method of administering a therapeutically effective dose of modified oligonucleotide 1273062 to a subject over the age of 18 is described herein. In certain embodiments, the therapeutically effective dose is 20 mg. In certain embodiments, the therapeutically effective dose is 40 mg. In certain embodiments, the therapeutically effective dose is 60 mg. In certain embodiments, the therapeutically effective dose is 80 mg.

[0411] In certain embodiments, the therapeutically effective dose is any one of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg.

[0412] In certain embodiments, the therapeutically effective dose is any one of about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 70 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, about 100 mg, about 105 mg, about 110 mg, about 115 mg, about 120 mg, about 125 mg, about 130 mg, about 135 mg, about 140 mg, about 145 mg, or about 150 mg.

[0413] In certain embodiments, the therapeutically effective amount is 10 mg to 200 mg, 10 mg to 100 mg, 20 mg to 80 mg, 40 mg to 200 mg, 40 mg to 190 mg, 40 mg to 180 mg, 40 mg to 170 mg, 40 mg to 160 mg, 40 mg to 150 mg, 40 mg to 140 mg, 40 mg to 120 mg, 40 mg to 110 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 70 mg, 40 mg to 60 mg, 40 mg to 50 mg, 50 mg to 200 mg, 50 mg to 190 mg, 50 mg to 180 mg, 50 mg to 170 mg, 50 mg to 160 mg, 50 mg to 150 mg, 50 mg to 140 mg, 50 mg to 120 mg, 50 mg to 110 mg, 50 mg to 100 mg, 50 mg to 80 mg, 50 mg to 70 mg, 50 mg to 60 mg, 60 mg to 200 mg, 60 mg to 190 mg, 60 mg to 180 mg, 60 mg to 170 mg, 60 mg to 160 mg, 60 mg to 150 mg, 60 mg to 140 mg, 60 mg to 120 mg, 60 mg to 115 mg, 60 mg to 110 mg, 60 mg to 100 mg, 60 mg to 80 mg, 60 mg to 70 mg, 70 mg to 200 mg, 70 mg to 190 mg, 70 mg to 180 mg, 70 mg to 170 mg, 70 mg to 160 mg, 70 mg to 150 mg, 70 mg to 140 mg, 70 mg to 120 mg, 70 mg to 110 mg, 70 mg to 100 mg, 70 mg to 80 mg, 80 mg to 200 mg, 80 mg to 190 mg, 80 mg to 180 mg, 80 mg to 170 mg,80 mg to 160 mg, 80 mg to 150 mg, 80 mg to 140 mg, 80 mg to 120 mg, 80 mg to 110 mg, 80 mg to 100 mg, 80 mg to 90 mg, 90 mg to 200 mg, 90 mg to 190 mg, 90 mg to 180 mg, 90 mg to 170 mg, 90 mg to 160 mg, 90 mg to 150 mg, 90 mg to 140 mg, 90 mg to 120 mg, 90 mg to 110 mg, 90 mg to 100 mg, 100 mg to 200 mg, 100 mg to 190 mg, 100 mg to 180 mg, 100 mg to 170 mg, 100 mg to 160 mg, 100 mg to 150 mg, 100 mg to 140 mg, 100 mg to 120 mg, 100 mg to 110 mg, 110 mg to 200 mg, 110 mg to 190 mg, 110 mg to 180 mg, 110 mg to 170 mg, 110 mg to 160 mg, 110 mg to 150 mg, 110 mg to 140 mg, 110 mg to 130 mg, 110 mg to 120 mg, 120 mg to 200 mg, 120 mg to 190 mg, 120 mg to 180 mg, 120 mg to 170 mg, 120 mg to 160 mg, 120 mg to 150 mg, 120 mg to 140 mg, 120 mg to 130 mg, 130 mg to 200 mg, 130 mg to 190 mg, 130 mg to 180 mg, 130 mg to 170 mg, 130 mg to 160 mg, 130 mg to 150 mg, 130 mg to 140 mg, 140 mg to 200 mg, 140 mg to 190 mg, 140 mg to 180 mg, 140 mg to 170 mg, 140 mg to 160 mg, 140 mg to 150 mg,150 mg to 200 mg, 150 mg to 190 mg, 150 mg to 180 mg, 150 mg to 170 mg, 150 mg to 160 mg, 160 mg to 200 mg, 160 mg to 190 mg, 160 mg to 180 mg, 160 mg to 170 mg, 180 mg to 200 mg, 180 mg to 190 mg, 190 mg to 200 mg, 105 mg to 135 mg, 105 mg to 130 mg, 105 mg to 125 mg, 105 mg to 120 mg, 110 mg to 135 mg, 110 mg to 130 mg, 110 mg to 125 mg, 110 mg to 120 mg, 115 mg to 135 mg, 115 mg to 130 mg, 115 mg to 125 mg, 115 mg to 120 mg, 115 mg to 125 mg, 115 mg to 120 mg, 120 mg to 135 mg, 120 mg to 125 mg, 125 mg to 140 mg, 125 mg to 130 mg, 130 mg to 135 mg, 135 mg to 140 mg, 120 mg to 129 mg, 120 mg to 128 mg, 120 mg to 127 mg, 120 mg to 86 mg, 120 mg to 124 mg, 120 mg to 123 mg, 120 mg to 122 mg, 120 mg to 121 mg, 121 mg to 130 mg, 122 mg to 129 mg, 122 mg to 128 mg, 122 mg to 127 mg, 122 mg to 126 mg, 122 mg to 125 mg, 122 mg to 124 mg, 122 mg to 123 mg, 123 mg to 130 mg, 123 mg to 129 mg, 123 mg to 128 mg, 123 mg to 127 mg, 123 mg to 126 mg, 123 mg to 125 mg, 123 mg to 124 mg,It is any one of 124 mg to 130 mg, 124 mg to 129 mg, 124 mg to 128 mg, 124 mg to 127 mg, 124 mg to 126 mg, 124 mg to 125 mg, 125 mg to 129 mg, 125 mg to 128 mg, 125 mg to 127 mg, 125 mg to 126 mg, 126 mg to 130 mg, 126 mg to 129 mg, 126 mg to 128 mg, 126 mg to 127 mg, 127 mg to 130 mg, 127 mg to 129 mg, 127 mg to 128 mg, 128 mg to 130 mg, 128 mg to 129 mg, and 129 mg to 130 mg.

[0414] In certain embodiments, the therapeutically effective dose is any one of less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg.

[0415] In certain embodiments, the therapeutically effective dose is any one of less than about 150 mg, less than about 145 mg, less than about 140 mg, less than about 135 mg, less than about 130 mg, less than about 125 mg, less than about 120 mg, less than about 115 mg, less than about 110 mg, less than about 105 mg, less than about 100 mg, less than about 95 mg, less than about 90 mg, less than about 85 mg, less than about 80 mg, less than about 75 mg, less than about 70 mg, less than about 65 mg, less than about 60 mg, less than about 55 mg, less than about 50 mg, less than about 45 mg, less than about 40 mg, less than about 35 mg, less than about 30 mg, less than about 25 mg, less than about 20 mg, less than about 15 mg, less than about 10 mg, and less than about 5 mg.

[0416] In certain embodiments, the therapeutically effective dose is any one of at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, at least 145 mg, and at least 150 mg.

[0417] In certain embodiments, the therapeutically effective dose is at least about 5 mg, at least about 10 mg, at least about 15 mg, at least about 20 mg, at least about 25 mg, at least about 30 mg, at least about 35 mg, at least about 40 mg, at least about 45 mg, at least about 50 mg, at least about 55 mg, at least about 60 mg, at least about 65 mg, at least about 70 mg, at least about 75 mg, at least about 80 mg, at least about 85 mg, at least about 90 mg, at least about 95 mg, at least about 100 mg, at least about 105 mg, at least about 115 mg, at least about 120 mg, at least about 125 mg, at least about 130 mg, at least about 135 mg, at least about 140 mg, at least about 145 mg, or at least about 150 mg, at least about 155 mg, at least about 160 mg, at least about 165 mg, at least about It is any one of 170 mg, at least about 175 mg, at least about 180 mg, at least about 185 mg, at least about 190 mg, at least about 195 mg, and at least about 200 mg.

[0418] In certain embodiments, the therapeutically effective dose is 4-6 mg. In certain embodiments, the therapeutically effective dose is 9-11 mg. In certain embodiments, the therapeutically effective dose is 19-21 mg. In certain embodiments, the therapeutically effective dose is 29-31 mg. In certain embodiments, the therapeutically effective dose is 39-41 mg. In certain embodiments, the therapeutically effective dose is 48-52 mg. In certain embodiments, the therapeutically effective dose is 58-62 mg. In certain embodiments, the therapeutically effective dose is 68-72 mg. In certain embodiments, the therapeutically effective dose is 78-82 mg. In certain embodiments, the therapeutically effective dose is 88-92 mg. In certain embodiments, the therapeutically effective dose is 98-102 mg. In certain embodiments, the therapeutically effective dose is 108-112 mg. In certain embodiments, the therapeutically effective dose is 118-122 mg.

[0419] Specific administration interval

[0420] In certain embodiments, a method of administering a therapeutically effective amount of modified oligonucleotide 1273062 to a subject one or more times is described herein. Those skilled in the art will recognize that the intervals may vary by days or weeks; that is, the monthly interval may not be exactly one month, but may include administrations that vary by days for each administration. Likewise, the quarterly administration interval represents four administrations per year and includes an administration schedule that may vary by days or one week, rather than exactly three months.

[0421] In certain embodiments, the method provides a therapeutically effective amount at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or It includes administering 50 times. In certain embodiments, the method includes administering a therapeutically effective dose once every 4 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 6 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 8 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 12 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 16 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 20 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 24 weeks. In certain embodiments, the method includes administering a therapeutically effective dose once every 6 months. In certain embodiments, the method includes administering a therapeutically effective dose monthly. In certain embodiments, the method includes administering a therapeutically effective dose once every 2 months. In certain embodiments, the method includes administering a therapeutically effective dose once every 3 months. In certain embodiments, the method includes administering a therapeutically effective dose once every quarter. In certain embodiments, the method comprises administering a therapeutically effective dose twice a year. In certain embodiments, the method comprises administering a therapeutically effective dose once a year. In certain embodiments, the method comprises administering a therapeutically effective dose once every two years.

[0422] In certain embodiments, the method comprises administering a therapeutically effective dose approximately every 1 week, approximately every 2 weeks, approximately every 3 weeks, approximately every 4 weeks, approximately every 5 weeks, approximately every 6 weeks, approximately every 7 weeks, approximately every 8 weeks, approximately every 9 weeks, approximately every 10 weeks, approximately every 11 weeks, approximately every 12 weeks, approximately every 13 weeks, approximately every 14 weeks, approximately every 15 weeks, approximately every 16 weeks, approximately every 17 weeks, approximately every 18 weeks, approximately every 19 weeks, approximately every 20 weeks, approximately every 21 weeks, approximately every 22 weeks, approximately every 23 weeks, approximately every 24 weeks, or approximately every 6 months. In certain embodiments, the method comprises administering a therapeutically effective dose approximately every month. In certain embodiments, the method comprises administering a therapeutically effective dose once approximately every 2 months. In certain embodiments, the method comprises administering a therapeutically effective dose once approximately every 3 months. In certain embodiments, the method comprises administering a therapeutically effective dose approximately once every quarter. In certain embodiments, the method comprises administering a therapeutically effective dose approximately twice a year. In certain embodiments, the method comprises administering a therapeutically effective dose approximately once a year. In certain embodiments, the method comprises administering a therapeutically effective dose approximately once every two years.

[0423] In certain embodiments, the method comprises administering a therapeutically effective amount for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months.

[0424] Loading and maintenance capacity

[0425] In certain embodiments, the therapeutically effective dose is administered as a loading dose and / or a maintenance dose. In certain embodiments, the method comprises administering a loading dose one or more times, followed by administering a maintenance dose one or more times. In certain embodiments, the method comprises administering a loading dose once every approximately 4 weeks, followed by administering a maintenance dose once every approximately 4 weeks, once every approximately 8 weeks, once every approximately 12 weeks, once every approximately 16 weeks, once every approximately 20 weeks, once every approximately 24 weeks, or once every approximately 6 months. In certain embodiments, the method comprises administering a loading dose once every approximately 4 weeks, followed by administering a maintenance dose once every approximately 6 months. In certain embodiments, the method comprises administering a loading dose once every approximately 12 weeks, followed by administering a maintenance dose once every approximately 6 months.

[0426] In certain embodiments, the method comprises administering at least 2, at least 3, at least 4, at least 5, or at least 6 loading doses. In certain embodiments, the method comprises administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 loading doses. In certain embodiments, the method comprises administering a loading dose once every approximately 1 week, every approximately 2 weeks, every approximately 3 weeks, every approximately 4 weeks, every approximately 5 weeks, every approximately 6 weeks, every approximately 7 weeks, every approximately 8 weeks, every approximately 9 weeks, every approximately 10 weeks, every approximately 11 weeks, or every approximately 12 weeks. In certain embodiments, the method comprises administering an initial loading dose and administering a second loading dose about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, or about 12 weeks after administering the initial loading dose.

[0427] In certain embodiments, the method comprises administering at least 2, at least 3, at least 4, at least 5, or at least 6 maintenance doses. In certain embodiments, the method comprises administering 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 maintenance doses. In some cases, the method includes administering a maintenance dose once every about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, or about 6 months. In certain embodiments, the method comprises administering a first maintenance dose and administering a second maintenance dose about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, about 24 weeks, or about 6 months after administering the first maintenance dose.

[0428] In certain embodiments, the method comprises administering a first maintenance dose or doses after about 1 week, about 2 weeks, about 3 weeks, about 4 weeks, about 5 weeks, about 6 weeks, about 7 weeks, about 8 weeks, about 9 weeks, about 10 weeks, about 11 weeks, about 12 weeks, about 13 weeks, about 14 weeks, about 15 weeks, about 16 weeks, about 17 weeks, about 18 weeks, about 19 weeks, about 20 weeks, about 21 weeks, about 22 weeks, about 23 weeks, or about 24 weeks after administering the last loading dose.

[0429] Specific total dosage

[0430] In certain embodiments, a method of administering a total dose of modified oligonucleotide 1273062 to a subject is described herein. As used herein, “total dose” refers to the calculated total amount of modified oligonucleotide per unit time. For example, a total dose of 100 mg per month includes a method of administering 100 mg over one month in individual doses of less than 100 mg (e.g., 25 mg per week or 50 mg every two weeks), a method of administering a single dose of 100 mg per month, or a method of administering a dose greater than 100 mg at a frequency of less than once a month (e.g., a single dose of 200 mg every two months, or 300 mg every three months, etc.).

[0431] In some embodiments, the modified oligonucleotide is administered to human subjects in a total monthly dose of 5 mg to 100 mg, 5 mg to 80 mg, 5 mg to 60 mg, 5 mg to 40 mg, 5 mg to 20 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 60 mg, 10 mg to 40 mg, 10 mg to 20 mg, 20 mg to 100 mg, 20 mg to 80 mg, 20 mg to 60 mg, 20 mg to 40 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 60 mg, or 80 mg to 100 mg. In such specific embodiments, the dose is administered once a month, once every quarter, once every six months, or once a year.

[0432] In some embodiments, the modified oligonucleotide is administered to human subjects in a total dose of 15 mg to 300 mg, 15 mg to 180 mg, 15 mg to 150 mg, 15 mg to 100 mg, 15 mg to 80 mg, 15 mg to 50 mg, 40 mg to 300 mg, 40 mg to 180 mg, 40 mg to 150 mg, 40 mg to 100 mg, 40 mg to 80 mg, 80 mg to 300 mg, 80 mg to 180 mg, 80 mg to 150 mg, 80 mg to 100 mg, 100 mg to 300 mg, 100 mg to 180 mg, 100 mg to 150 mg, or 150 mg to 300 mg. In such specific embodiments, the dose is administered once a month, once every quarter, once every six months, or once a year.

[0433] In some embodiments, the modified oligonucleotide is a total dose per 4 months of 20 mg to 400 mg, 20 mg to 350 mg, 20 mg to 300 mg, 20 mg to 250 mg, 20 mg to 200 mg, 20 mg to 150 mg, 20 mg to 100 mg, 50 mg to 400 mg, 50 mg to 350 mg, 50 mg to 300 mg, 50 mg to 250 mg, 50 mg to 200 mg, 50 mg to 150 mg, 50 mg to 100 mg, 100 mg to 400 mg, 100 mg to 350 mg, 100 mg to 300 mg, 100 mg to 250 mg, 100 mg to 200 mg, 100 mg to 150 mg, and 200 mg. It is administered to human subjects in amounts of up to 400 mg, 200 mg to 350 mg, 200 mg to 300 mg, 200 mg to 250 mg, 300 mg to 400 mg, or 300 mg to 350 mg. In such specific embodiments, the dose is administered once a month, once every quarter, once every six months, or once a year.

[0434] In some embodiments, the modified oligonucleotide is a total dose of 30 mg to 600 mg, 30 mg to 500 mg, 30 mg to 400 mg, 30 mg to 300 mg, 30 mg to 200 mg, 30 mg to 100 mg, 50 mg to 600 mg, 50 mg to 500 mg, 50 mg to 400 mg, 50 mg to 300 mg, 50 mg to 200 mg, 50 mg to 100 mg, 100 mg to 600 mg, 100 mg to 500 mg, 100 mg to 400 mg, 100 mg to 300 mg, 100 mg to 200 mg, 200 mg to 600 mg, 200 mg to 500 mg, 200 mg to 400 mg, It is administered to human subjects in amounts of 200 mg to 300 mg, 300 mg to 600 mg, 300 mg to 500 mg, 300 mg to 400 mg, 400 mg to 600 mg, 400 mg to 500 mg, or 500 mg to 600 mg. In such specific embodiments, the dose is administered once a month, once every quarter, once every six months, or once a year.

[0435] In some embodiments, the modified oligonucleotide is present in an annual total dose of 60 mg to 1200 mg, 60 mg to 1100 mg, 60 mg to 1000 mg, 60 mg to 900 mg, 60 mg to 800 mg, 60 mg to 700 mg, 60 mg to 600 mg, 60 mg to 500 mg, 60 mg to 400 mg, 60 mg to 300 mg, 60 mg to 200 mg, 60 mg to 100 mg, 100 mg to 1200 mg, 100 mg to 1100 mg, 100 mg to 1000 mg, 100 mg to 900 mg, 100 mg to 800 mg, 100 mg to 700 mg, 100 mg to 600 mg, 100 mg to 500 mg, 100 mg to 400 mg, 100 mg to 300 mg, 100 mg to 200 mg, 200 mg to 1200 mg, 200 mg to 1100 mg, 200 mg to 1000 mg, 200 mg to 900 mg, 200 mg to 800 mg, 200 mg to 700 mg, 200 mg to 600 mg, 200 mg to 500 mg, 200 mg to 400 mg, 200 mg to 300 mg, 300 mg to 1200 mg, 300 mg to 1100 mg, 300 mg to 1000 mg, 300 mg to 900 mg, 300 mg to 800 mg, 300 mg to 700 mg, 300 mg to 600 mg, 300 mg to 500 mg, 300 mg to 400 mg, 400 mg to 1200 mg, 400 mg to 1100 mg, 400 mg to 1000 mg, 400 mg to 900 mg, 400 mg to 800 mg, 400 mg to 700 mg, 400 mg to 600 mg, 400 mg to 500 mg, 500 mg to 1200 mg, 500 mg to 1100 mg, 500 mg to 1000 mg,500 mg to 900 mg, 500 mg to 800 mg, 500 mg to 700 mg, 500 mg to 600 mg, 600 mg to 1200 mg, 600 mg to 1100 mg, 600 mg to 1000 mg, 600 mg to 900 mg, 600 mg to 800 mg, 600 mg to 700 mg, 700 mg to 1200 mg, 700 mg to 1100 mg, 700 mg to 1000 mg, 700 mg to 900 mg, 700 mg to 800 mg, 800 mg to 1200 mg, 800 mg to 1100 mg, 800 mg to 1000 mg, 800 mg to 900 mg, 900 mg to It is administered to human subjects in amounts of 1200 mg, 900 mg to 1100 mg, 900 mg to 1000 mg, 1000 mg to 1200 mg, 1000 mg to 1100 mg, or 1100 mg to 1200 mg. In such specific embodiments, the dose is administered once a month, once every quarter, once every six months, or once a year.

[0436] In any one of the above embodiments, the total dose may be administered as a single dose of the total dose, or as more than one separate dose that together constitutes the total dose. In any one of the above embodiments, administration is performed at various intervals.

[0437] Clinical evaluation methods

[0438] In some embodiments, patients are evaluated using the Bayley Scales of Infant and Toddler Development®, Fourth Edition (BSID-IV). The BSID-IV is the most widely used scale for infant and toddler development in clinical and research practice. The BSID has since been widely used worldwide to assess infant development. The BSID was standardized on 1,700 infants, toddlers, and preschoolers aged 1 to 42 months. Normative scores derived from the BSID-IV are used in clinical practice to detect infants with developmental delays and to evaluate developmental progress and the impact of therapeutic interventions. Additionally, T-scores and percentiles generated for developmental achievement enable direct clinical comparisons regarding the stabilization or improvement of decline compared to normally developing children. The Bayley scales are considered to broadly encompass the skills demonstrated by AS patients regarding developmental abilities. The BSID consists of a core battery of five scales. Sixteen standardized sub-domain scores and the following five standardized domain scores are generated: Cognitive, Language, Motor, Social-Emotional, and Adaptive Behavior. Standardized scores range from 1 to 19. Higher scores indicate a higher level of development. Total raw scores are also available on the record forms for the Cognitive, Communication (Receptive and Expressive), and Motor (Fine and Gross Motor Skills) subtests. The Social-Emotional and Adaptive Behavior scales will not be administered in this study. For each subtest, this is the sum of the total number of items scored by the child (i.e., a maximum of 2 points per item).

[0439] In some embodiments, the patient is evaluated using an electroencephalogram (EEG). Abnormal EEG activity is observed in AS patients, particularly in slow 1-4 Hz "delta" rhythms and 8-12 Hz "alpha" rhythms, hypersynchronization, seizures, and reduced sleep spindle frequency and duration.

[0440] In some embodiments, the patient is evaluated by the Angelman syndrome symptom-clinician impression-change (SAS-CGI-Change). The SAS-CGI-Change is a scale evaluated by a clinician that assesses the clinician's impression of a change in the patient's condition (in this case, AS (no other pathological conditions or comorbidities)) relative to baseline, and considers the severity, frequency, and impact on daily activities in specific functional domains, including cognition, expressive communication, gross motor skills, fine motor skills, daily living skills, sleep, and behavior. The SAS-CGI-Change utilizes a 7-point response scale ranging from "very much improved" (1) to "very much worsened" (7). The clinician judges the change from baseline based on the aggregate of available information (e.g., insights from the patient and / or caregiver, information collected during the completion of other assessments).

[0441] In some embodiments, the patient is evaluated using the Vineland Adaptive Behavior Scales (3rd edition) (Vineland-3). Vineland-3 is a tool that measures communication, daily living skills, socialization, and maladaptive behaviors. A comprehensive interview format (i.e., a semi-structured interview) is administered to the patient's caregiver: an investigator or designated person asks the caregiver open-ended questions regarding the patient's activities and behaviors. Standardized domain scores are calculated for the individual domains of socialization, communication, daily living skills, and motor skills. An adaptive behavior composite score is also generated. The standardized scores for the domains and composite score range from 20 to 160, with higher scores indicating better functioning.

[0442] In some embodiments, patients are evaluated using the Observer Reported Communication Competence (ORCA) scale. The ORCA scale is a questionnaire designed to assess the communication abilities of individuals with neurodevelopmental disorders that significantly affect communication. The ORCA scale was originally designed for AS patients aged 2 years and older. Designed to observe the patient's overall communication ability from the perspective of the primary caregiver, the scale consists of 84 questions containing 70 behavioral items within 22 concepts. This assessment takes into account the heterogeneity of communication styles and evaluates an individual's unique communication methods. The total ORCA score reflects the primary caregiver's assessment of the patient's ability to perform behaviors frequently and consistently, representing the patient's total communication ability.

[0443] Example 1: Phase 1-2a Human Clinical Trial of Compound ION582 for the Treatment of Angelman Syndrome - MAD Study (HALOS, Part 1)

[0444] Compound ION582 was formulated for administration as a sterile solution of the compound in aCSF at a concentration of 20 mg / mL. ION582 is provided in a 6 mL clear glass vial with a 5 mL fill volume. Compound ION582 was evaluated in a randomized Phase 1-2a Multiple Increased Dose (MAD) trial, in which the compound was administered intrathecally into the cerebrospinal fluid of patients with Angelman syndrome (AS) via lumbar puncture. Participants included at least 51 males and females aged 2–34 years exhibiting both UBE3A deletion and UBE3A mutation phenotypes. All patients had a confirmed genetic diagnosis of Angelman syndrome accompanied by the characteristic phenotype of seizures, motor deficits, little to no speech ability, and reduced sleep.

[0445] Patients were enrolled in three escalating dose levels across seven cohorts to evaluate treatment at various ION582 dose levels and age groups. ION582 was administered three times during the treatment period on days 1, 29, and 85. Subjects ranged in age from 2 to 50 years and were assigned to the following seven cohorts:

[0446] Cohort A: 20 mg ION582 (patients aged 4 to 17 years);

[0447] Cohort B: 40 mg ION582 (patients aged 4 to 17 years);

[0448] Cohort C: 80 mg ION582 (patients aged 4 to 17 years);

[0449] Cohort D1: 20 mg ION582 (patients aged 2 to 5 years);

[0450] Cohort D2: 40 mg ION582 (patients aged 2 to 5 years);

[0451] Cohort D3: 80 mg ION582 (patients aged 2 to 5 years); and

[0452] Cohort E: 80 mg ION582 (patients aged 18 to 50 years).

[0453] Patients were evaluated during a follow-up period after 12 weeks of treatment, visiting the study center on days 113 and 169 of the study.

[0454] 98% of enrolled participants completed Part 1 MAD. The placement of the patient group is described in the table below:

[0455] Low dose (20mg) (n=11) Medium dose (40mg) (n=13) High dose (80mg) (n=27) Average age at screening, years (minimum, maximum) 5.7(2.1, 11) 7.6(4.4,17.5) 12.1(2.7, 34.3) Genotype, n (%) · Mutation · Deletion 1 (9)10 (91) 3 (23)10 (77) 4 (15)23 (85) Treatment completed, n (%) 11 (100) 12 (92) 27 (100) Discontinuation of treatment, n 0 1 * 0

[0456] Determined to be unrelated to the study drug

[0457] Compound ION582 was confirmed to be well tolerated at all dose levels. No safety trends of concern were observed by the independent safety monitoring committee that continuously reviewed all data. The majority of reported adverse events (AEs) were consistent with the patient's medical history, diagnosis of Angelman syndrome, and / or findings related to lumbar puncture. No trends were observed in safety laboratory tests, including CSF (cell count, protein, glucose), blood, or urine. There were no reports of lower limb weakness, ataxia, or radiculopathy.

[0458] Events in >10% of participants Event(n) Participants (n) Participants (%, N = 51) having fever 13 10 19.6% puke 11 10 19.6% Upper respiratory tract infection 10 9 17.6%

[0459] Day 113 Evaluation (4 weeks after last MAD administration)

[0460] Electroencephalogram (EEG) patterns were recorded and interpreted during the MAD study. Twenty electrodes were attached to the scalp of the subjects while they were awake to assess brain function. EEG is generally used to detect brain activity associated with seizures or to identify evidence of brain damage caused by tumors or strokes. Patients with autosomal seizures (AS) are known to have increased slow-wave (delta) activity in the brain compared to control groups, and the magnitude of delta waves predicts the clinical severity of AS patients. For example, reduced delta waves would indicate improved brain function. Approximately 70% of the subjects showed a decrease in slow-wave delta activity compared to baseline at one month after the last dose. This reduced delta activity suggested that EEG activity had improved in these subjects. Additionally, a decrease in delta wave magnitude was also observed. Furthermore, more than 80% of the subjects showed an increase in faster-frequency rhythms (theta) compared to baseline at one month after the last dose, which also suggested that EEG activity had improved.

[0461] Assessments of functional outcomes were also performed. Clinical evaluators administered the Angelman Syndrome Symptoms-Clinical Improvement-Change (SAS-CGI-C), which involved a subjective assessment of clinical function using a 7-point scale measuring nine major functional domains, including cognitive impairment, expressive communication, fine motor skills, gross motor skills, maladaptive behaviors, activities of daily living, seizures, sleep, and overall AS. The majority of patients demonstrated some degree of improvement in overall function as assessed by clinicians on the SAS-CGI-C scale. Additionally, the Bayley Scale for Infant Development-4 (Bayley-4) was measured. This is a direct assessment of clinical function measuring general cognitive function, gross motor skills, fine motor skills, and expressive and receptive language. The majority of patients also demonstrated some degree of improvement in total Bayley scores beyond those observed in natural course studies conducted over the same period. In the Bayley-4 evaluation at 4 months, greater improvement was observed in the medium dose (40 mg ION582) and high dose (80 mg ION582) compared to the low dose (20 mg) (Figs. 1a-1e). There was an imbalance in the number of participants by age and genotype between dose groups; the number of individuals by age and genotype in each dose group is provided above.

[0462] Day 169 evaluation (12 weeks after last MAD administration; approximately 6 months from first administration)

[0463] Study participants were evaluated at 169 days (12 weeks after the last dose of the MAD study; approximately 6 months from the first dose). This 6-month evaluation allowed for comparison with data collected from a long-term NIH-sponsored natural course study that follows patients with Angelman syndrome over several years to characterize the natural course of the disorder (“natural course”), which shows minimal change over 12 months. Analyses of the Bayley-4, Vineland-3, ORCA, and SAS-CGI-C scales, respectively, for the intermediate (40 mg ION582) and high (80 mg ION582) groups were aggregated; this aggregation increased the sample size and enabled more robust comparisons with age- and genotype-matched natural course data. The low (20 mg ION582) group demonstrated minimal safety and efficacy and was not evaluated at the 6-month mark.

[0464] Improvements in receptive communication, i.e., the ability to receive and understand information, as measured by Bayley-4 (Fig. 2a) and Vineland-3 (Fig. 2b) were observed in the ION582 medium and high dose combined group at 6 months relative to the natural course. Similar improvements in receptive communication, as measured by Bayley-4 (Fig. 3), were observed in participants with deletion and mutant genotypes in the ION582 medium and high dose combined group at 6 months relative to the natural course.

[0465] Compared to the natural course, improvements were observed in expressive communication—that is, the ability to express one's needs, thoughts, and feelings—measured by Bayley-4 (Fig. 4a), Vineland-3 (Fig. 4b), and SAS-CGI-C (Fig. 4c) in the ION582 medium and high-dose combined groups. Improvements in expressive communication on the Bayley-4 and Vineland-3 scales exceeded the natural course, while the SAS-CGI-C, which was not compared to the natural course, showed clinically significant changes, with a change of ≥1 point out of a maximum improvement of 3 points being considered clinically significant.

[0466] Consistent improvements in the Bayley-4 and Vineland-3 scales of receptive communication (Fig. 5a) and expressive communication (Fig. 5b) were observed in the ION582 medium and high-dose integration groups at the 6-month mark.

[0467] Clinically significant improvement in the ORCA scale of communication was observed in the ION582 medium-dose and high-dose combined groups at the 6-month mark compared to the natural course (Fig. 6). The ORCA T-score range was 25.8–83.8 (standardized, mean=50, SD=10). An improvement of 3.6 points was achieved with ION582 at the 6-month treatment point, and an improvement of ≥2 points is considered clinically significant. The improvement with ION582 at the 6-month mark exceeds the natural course.

[0468] The ORCA scale of communication correlates well with the improvements observed in Bayley-4 regarding changes in receptive communication (Fig. 7a) and expressive communication (Fig. 7b) in the ION582 medium and high-dose integration groups at the 6-month time point.

[0469] Improvements were observed across the cognitive scales of Bayley-4, and cognitive improvement on ION582 was found to exceed the natural course (Fig. 8a). In SAS-CGI-C, which was not compared to the natural course (Fig. 8b), a clinically significant change was observed, where a change of ≥1 point out of a maximum improvement of 3 points was considered clinically significant.

[0470] Improvements in fine motor function as measured by Bayley-4 (Fig. 9a), Vineland-3 (Fig. 9b), and SAS-CGI-C (Fig. 9c) were observed in the ION582 medium and high dose combined groups at the 6-month mark, and the improvement of ION582 exceeded the natural course in Bayley-4 and Vineland-3, while directional improvement was observed in SAS-CGI-C.

[0471] Improvements in gross motor function as measured by Bayley-4 (Fig. 10a), Vineland-3 (Fig. 10b), and SAS-CGI-C (Fig. 10c) were observed in the ION582 medium-dose and high-dose combined groups at the 6-month mark, and the improvement of ION582 exceeded the natural course in Bayley-4 and Vineland-3, while clinically significant changes in ION582 were observed in SAS-CGI-C.

[0472] Clinically significant improvement in overall AS symptom change was observed in the majority of participants in patients treated with ION582 (Fig. 11). 97% of patients showed improvement in overall AS symptom change with SAS-CGI-C, and almost all patients showed a change of ≥1 in overall symptom severity at 6 months. As shown in the table below, clinically significant improvement was observed in the majority of study participants in the ION582 medium-dose and high-dose combined groups at 6 months in all areas evaluated with AS-specific SAS-CGI-C.

[0473] Participants who showed an improvement of ≥1 point on SAS-CGI-Change between baseline and 6 months General symptoms of Angelman syndrome cognitive impairment gross motor skills Expressive communication fine motor skills sleep problems Impairment of daily living activities Maladaptive behavior seizure 97% 85% 74% 69% 64% 59% 62% 56% 18%

[0474] Improvement exceeding the natural course (NH) was observed in the majority of participants in the ION582 medium and high-dose integration groups at the 6-month mark in all areas evaluated at Vineland-3, as shown in the table below.

[0475] Participants who showed improvement exceeding NH on Vineland-3 between baseline and 6 months Communication athletic ability Daily living skills socialization Receptive communication Expressive communication Large muscle exercises fine motor skills individual local community home interpersonal relationships Play and leisure Coping ability 90% 84% 53% 63% 74% 79% 82% 79% 87% 63%

[0476] The majority of participants in the intermediate and high-dose groups showed benefit in almost all areas evaluated in the HALOS study at the 6-month mark. Refer to the summary in the table below.

[0477] Participants who showed improvement in the areas evaluated at the 6-month mark Bayley-4 1 Vineland-3 1 ORCA 2,3 SAS-CGI-C 4,5 recognition 67% Not in evaluation Not in evaluation 85% Receptive communication 67% 90% 60% Not in evaluation Expressive communication 69% 84% 69% Large muscle exercises 46% 53% Not in evaluation 74% fine motor skills 72% 63% Not in evaluation 64% Daily living skills Not evaluated in the HALOS study 74-82% 6 Not in evaluation 62% socialization Not evaluated in the HALOS study 63-87% 7 Not in evaluation Not in evaluation sleep Not in evaluation Not in evaluation Not in evaluation 59% action Not evaluated in the HALOS study Not evaluated in the HALOS study Not in evaluation 56%

[0478] 1. Improvement beyond the natural course. 2. Improvement on ORCA exceeding the proposed minimum clinically significant difference ≥2. 3. ORCA T-score range: 25.8–83.8 (standardized, mean=50, SD=10). 4. Improvement on SAS-CGI-C exceeding the proposed minimum clinically significant difference ≥1. 5. SAS-CGI-C response range: Very worsened–Very improved. 6. Range across three subdomains (Individual, Community, and Home). 7. Range across three subdomains (Coping, Interpersonal, and Play and Leisure).

[0479] In the HALOS study, consistent benefits were observed with ION582 treatment in patients with AS. Good safety and tolerability were demonstrated at all dose levels. A statistically significant dose-dependent reduction in EEG delta power was observed in children, which correlated with cognitive improvement. Evidence of clinical improvement across major functional areas was observed, with 97% of participants showing clinically significant improvement in overall Angelman syndrome symptoms in SAS-CGI-C (in the intermediate and high-dose groups, a change of ≥1 point out of 3 maximum improvement points was considered clinically significant); improvements in communication, cognitive, and motor functions beyond the natural course in Bayley-4, Vineland-3, and ORCA; and consistent benefits were observed across all ages and genotypes.

[0480] Example 2: Phase 1-2a Human Clinical Trial of ION582 for the Treatment of Angelman Syndrome - LTE Study (HALOS, Part 2)

[0481] The randomized long-term extension (LTE) portion of the Phase 1-2a study will be performed to evaluate the safety and tolerability of intrathecal bolus (ITB) administration of ION582 over a longer period in patients with Angelman syndrome (AS).

[0482] This 49-week Long-Term Extension (LTE) study will be conducted at multiple centers and will consist of patients who completed the study described in Example 1 above, including a 12-week follow-up period after treatment. Patients will receive up to five ION582 intrathecal bolus (ITB) injections over 49 weeks during the LTE treatment period. Administrations will be given every 12 weeks on Day 1, Day 85, Day 169, Day 253, and Day 337. Dose levels will be assigned based on the patient-enrolled cohort and safety and tolerability data generated from the study described in Example 1 above. There will be up to two administration groups:

[0483] Group 1: Cohorts A, B, D1, D2: Max 40 mg ION582 ITB injection

[0484] Group 2: Cohorts C, D3, and E: Up to 80 mg ION582 ITB injection

[0485] After the LTE treatment period, patients will enter a 32-week follow-up period. Patients will return to the study center for a visit on study day 421 and a final visit on study day 561.

[0486] The safety and tolerability of ION582 in patients with Angelman syndrome (AS) will be evaluated based on the incidence and severity of treatment-to-terror events (TEAEs) and serious adverse events (SAEs), changes in vital signs, and changes in clinical test results. Pharmacokinetics (PK) in cerebrospinal fluid (CSF), plasma, and urine for elevated dose levels of multiple IT bolus administrations of ION582 in AS patients will also be evaluated. The effects of ION582 on AS biomarkers and clinical characteristics, including motor, speech, cognitive function, sleep, and electroencephalogram (EEG) patterns, in AS patients will also be evaluated.

Claims

Claim 1 Modified oligonucleotides according to the following chemical structures: A method comprising administering a therapeutically effective amount of (sequence ID NO: 5), or a pharmaceutically acceptable salt thereof, to a human subject. Claim 2 The method according to claim 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt. Claim 3 A method comprising administering a therapeutically effective amount of a modified oligonucleotide according to the following chemical structure to a human subject: (Sequence ID NO: 5). Claim 4 A method comprising administering a therapeutically effective amount of a modified oligonucleotide consisting of 19-20 linked nucleosides to a human subject, wherein said modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e A method comprising at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = linkage between phosphothioate nucleosides, and o = linkage between phosphodiester nucleosides. Claim 5 A method according to any one of claims 1 to 4, wherein the modified oligonucleotide is formulated into a pharmaceutical composition comprising a pharmaceutically acceptable diluent. Claim 6 In paragraph 5, the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF), method. Claim 7 In paragraph 5, the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS), method. Claim 8 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is any one of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg. Claim 9 A method according to any one of claims 1 to 8, wherein the therapeutically effective amount is any one of 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, and 25 mg. Claim 10 A method according to any one of claims 1 to 8, wherein the therapeutically effective amount is any one of 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 21 mg, 22 mg, 23 mg, 24 mg, 25 mg, 26 mg, 27 mg, 28 mg, 29 mg, and 30 mg. Claim 11 A method according to any one of claims 1 to 8, wherein the therapeutically effective amount is any one of 31 mg, 32 mg, 33 mg, 34 mg, 35 mg, 36 mg, 37 mg, 38 mg, 39 mg, 40 mg, 41 mg, 42 mg, 43 mg, 44 mg, 45 mg, 46 mg, 47 mg, 48 mg, 49 mg, and 50 mg. Claim 12 A method according to any one of claims 1 to 8, wherein the therapeutically effective amount is any one of 51 mg, 52 mg, 53 mg, 54 mg, 55 mg, 56 mg, 57 mg, 58 mg, 59 mg, 60 mg, 61 mg, 62 mg, 63 mg, 64 mg, 65 mg, 66 mg, 67 mg, 68 mg, 69 mg, and 70 mg. Claim 13 A method according to any one of claims 1 to 8, wherein the therapeutically effective amount is any one of 71 mg, 72 mg, 73 mg, 74 mg, 75 mg, 76 mg, 77 mg, 78 mg, 79 mg, 80 mg, 81 mg, 82 mg, 83 mg, 84 mg, 85 mg, 86 mg, 87 mg, 88 mg, 89 mg, and 90 mg. Claim 14 A method according to any one of claims 1 to 8, wherein the therapeutically effective amount is any one of 91 mg, 92 mg, 93 mg, 94 mg, 95 mg, 96 mg, 97 mg, 98 mg, 99 mg, 100 mg, 101 mg, 102 mg, 103 mg, 104 mg, 105 mg, 106 mg, 107 mg, 108 mg, 109 mg, and 110 mg. Claim 15 In any one of claims 1 to 7, the therapeutically effective amount is 5 mg to 120 mg, 5 mg to 115 mg, 5 mg to 110 mg, 5 mg to 105 mg, 5 mg to 100 mg, 5 mg to 95 mg, 5 mg to 90 mg, 5 mg to 85 mg, 5 mg to 80 mg, 5 mg to 75 mg, 5 mg to 70 mg, 5 mg to 65 mg, 5 mg to 60 mg, 5 mg to 55 mg, 5 mg to 50 mg, 5 mg to 45 mg, 5 mg to 40 mg, 5 mg to 35 mg, 5 mg to 30 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 10 mg, 10 mg to 120 mg, 10 mg to 115 mg, 10 mg to 110 mg, 10 mg to 105 mg, 10 mg to 100 mg, 10 mg to 95 mg, 10 mg to 90 mg, 10 mg to 85 mg, 10 mg to 80 mg, 10 mg to 75 mg, 10 mg to 70 mg, 10 mg to 65 mg, 10 mg to 60 mg, 10 mg to 55 mg, 10 mg to 50 mg, 10 mg to 45 mg, 10 mg to 40 mg, 10 mg to 35 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 120 mg, 15 mg to 115 mg, 15 mg to 110 mg, 15 mg to 105 mg, 15 mg to 100 mg, 15 mg to 95 mg, 15 mg to 90 mg, 15 mg to 85 mg, 15 mg to 80 mg, 15 mg to 75 mg, 15 mg to 70 mg, 15 mg to 65 mg, 15 mg to 60 mg, 15 mg to 55 mg, 15 mg to 50 mg,15 mg to 45 mg, 15 mg to 40 mg, 15 mg to 35 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 120 mg, 20 mg to 115 mg, 20 mg to 110 mg, 20 mg to 105 mg, 20 mg to 100 mg, 20 mg to 95 mg, 20 mg to 90 mg, 20 mg to 85 mg, 20 mg to 80 mg, 20 mg to 75 mg, 20 mg to 70 mg, 20 mg to 65 mg, 20 mg to 60 mg, 20 mg to 55 mg, 20 mg to 50 mg, 20 mg to 45 mg, 20 mg to 40 mg, 20 mg to 35 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 120 mg, 25 mg to 115 mg, 25 mg to 110 mg, 25 mg to 105 mg, 25 mg to 100 mg, 25 mg to 95 mg, 25 mg to 90 mg, 25 mg to 85 mg, 25 mg to 80 mg, 25 mg to 75 mg, 25 mg to 70 mg, 25 mg to 65 mg, 25 mg to 60 mg, 25 mg to 55 mg, 25 mg to 50 mg, 25 mg to 45 mg, 25 mg to 40 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 120 mg, 30 mg to 115 mg, 30 mg to 110 mg, 30 mg to 105 mg, 30 mg to 100 mg, 30 mg to 95 mg, 30 mg to 90 mg, 30 mg to 85 mg, 30 mg to 80 mg, 30 mg to 75 mg, 30 mg to 70 mg, 30 mg to 65 mg, 30 mg to 60 mg, 30 mg to 55 mg, 30 mg to 50 mg, 30 mg to 45 mg,30 mg to 40 mg, 30 mg to 35 mg, 35 mg to 120 mg, 35 mg to 115 mg, 35 mg to 110 mg, 35 mg to 105 mg, 35 mg to 100 mg, 35 mg to 95 mg, 35 mg to 90 mg, 35 mg to 85 mg, 35 mg to 80 mg, 35 mg to 75 mg, 35 mg to 70 mg, 35 mg to 65 mg, 35 mg to 60 mg, 35 mg to 55 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 120 mg, 40 mg to 115 mg, 40 mg to 110 mg, 40 mg to 105 mg, 40 mg to 100 mg, 40 mg to 95 mg, 40 mg to 90 mg, 40 mg to 85 mg, 40 mg to 80 mg, 40 mg to 75 mg, 40 mg to 70 mg, 40 mg to 65 mg, 40 mg to 60 mg, 40 mg to 55 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 120 mg, 45 mg to 115 mg, 45 mg to 110 mg, 45 mg to 105 mg, 45 mg to 100 mg, 45 mg to 95 mg, 45 mg to 90 mg, 45 mg to 85 mg, 45 mg to 80 mg, 45 mg to 75 mg, 45 mg to 70 mg, 45 mg to 65 mg, 45 mg to 60 mg, 45 mg to 55 mg, 45 mg to 50 mg, 50 mg to 120 mg, 50 mg to 115 mg, 50 mg to 110 mg, 50 mg to 105 mg, 50 mg to 100 mg, 50 mg to 95 mg, 50 mg to 90 mg, 50 mg to 85 mg, 50 mg to 80 mg, 50 mg to 75 mg, 50 mg to 70 mg,50 mg to 65 mg, 50 mg to 60 mg, 50 mg to 120 mg, 55 mg to 115 mg, 55 mg to 110 mg, 55 mg to 105 mg, 55 mg to 100 mg, 55 mg to 95 mg, 55 mg to 90 mg, 55 mg to 85 mg, 55 mg to 80 mg, 55 mg to 75 mg, 55 mg to 70 mg, 55 mg to 65 mg, 55 mg to 60 mg, 60 mg to 120 mg, 60 mg to 115 mg, 60 mg to 110 mg, 60 mg to 105 mg, 60 mg to 100 mg, 60 mg to 95 mg, 60 mg to 90 mg, 60 mg to 85 mg, 60 mg to 80 mg, 60 mg to 75 mg, 60 mg to 70 mg, 65 mg to 120 mg, 65 mg to 115 mg, 65 mg to 110 mg, 65 mg to 105 mg, 65 mg to 100 mg, 65 mg to 95 mg, 65 mg to 90 mg, 65 mg to 85 mg, 65 mg to 80 mg, 65 mg to 75 mg, 65 mg to 70 mg, 70 mg to 120 mg, 70 mg to 115 mg, 70 mg to 110 mg, 70 mg to 105 mg, 70 mg to 100 mg, 70 mg to 95 mg, 70 mg to 90 mg, 70 mg to 85 mg, 70 mg to 80 mg, 75 mg to 120 mg, 75 mg to 115 mg, 75 mg to 110 mg, 75 mg to 105 mg, 75 mg to 100 mg, 75 mg to 95 mg, 75 mg to 90 mg, 75 mg to 85 mg, 75 mg to 80 mg, 80 mg to 120 mg, 80 mg to 115 mg, 80 mg to 110 mg, 80 mg to 105 mg, 80 mg to 100 mg,80 mg to 95 mg, 80 mg to 90 mg, 85 mg to 120 mg, 85 mg to 115 mg, 85 mg to 110 mg, 85 mg to 105 mg, 85 mg to 100 mg, 85 mg to 95 mg, 85 mg to 90 mg, 90 mg to 120 mg, 90 mg to 115 mg, 90 mg to 110 mg, 90 mg to 105 mg, 90 mg to 100 mg, 95 mg to 120 mg, 95 mg to 115 mg, 95 mg to 110 mg, 95 mg to 105 mg, 95 mg to 100 mg, 100 mg to 120 mg, 100 mg to 115 mg, 100 mg to 110 mg, 100 mg A method comprising any one of 105 mg, 105 mg to 120 mg, 105 mg to 115 mg, 105 mg to 110 mg, 110 mg to 120 mg, 110 mg to 115 mg, and 115 mg to 120 mg. Claim 16 A method according to any one of claims 1 to 7 and 15, wherein the therapeutically effective amount is any one of 15 mg to 25 mg, 18 mg to 25 mg, 19 mg to 25 mg, 18 mg to 23 mg, 19 mg to 23 mg, 18 mg to 22 mg, 19 mg to 22 mg, 18 mg to 21 mg, or 19 mg to 21 mg. Claim 17 A method according to any one of claims 1 to 7 and 15, wherein the therapeutically effective amount is any one of 35 mg to 45 mg, 38 mg to 45 mg, 39 mg to 45 mg, 38 mg to 43 mg, 39 mg to 43 mg, 38 mg to 42 mg, 39 mg to 42 mg, 38 mg to 41 mg, or 39 mg to 41 mg. Claim 18 A method according to any one of claims 1 to 7 and 15, wherein the therapeutically effective amount is any one of 55 mg to 65 mg, 58 mg to 65 mg, 59 mg to 65 mg, 58 mg to 63 mg, 59 mg to 63 mg, 58 mg to 62 mg, 59 mg to 62 mg, 58 mg to 61 mg, or 59 mg to 61 mg. Claim 19 A method according to any one of claims 1 to 7 and 15, wherein the therapeutically effective amount is any one of 75 mg to 85 mg, 78 mg to 85 mg, 79 mg to 85 mg, 78 mg to 83 mg, 79 mg to 83 mg, 78 mg to 82 mg, 79 mg to 82 mg, 78 mg to 81 mg, or 79 mg to 81 mg. Claim 20 A method according to any one of claims 1 to 7, wherein the therapeutic effective amount is any one of less than 150 mg, less than 145 mg, less than 140 mg, less than 135 mg, less than 130 mg, less than 125 mg, less than 120 mg, less than 115 mg, less than 110 mg, less than 105 mg, less than 100 mg, less than 95 mg, less than 90 mg, less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, less than 10 mg, and less than 5 mg. Claim 21 A method according to any one of claims 1 to 7 and 20, wherein the therapeutic effective amount is any one of less than 85 mg, less than 80 mg, less than 75 mg, less than 70 mg, less than 65 mg, less than 60 mg, less than 55 mg, less than 50 mg, less than 45 mg, less than 40 mg, less than 35 mg, less than 30 mg, less than 25 mg, less than 20 mg, less than 15 mg, and less than 10 mg. Claim 22 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is at least 5 mg, at least 10 mg, at least 15 mg, at least 20 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 40 mg, at least 45 mg, at least 50 mg, at least 55 mg, at least 60 mg, at least 65 mg, at least 70 mg, at least 75 mg, at least 80 mg, at least 85 mg, at least 90 mg, at least 95 mg, at least about 100 mg, at least 105 mg, at least 115 mg, at least 120 mg, at least 125 mg, at least 130 mg, at least 135 mg, at least 140 mg, and at least 145 mg. Claim 23 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 5 mg. Claim 24 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 10 mg. Claim 25 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 20 mg. Claim 26 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 30 mg. Claim 27 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 40 mg. Claim 28 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 50 mg. Claim 29 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 60 mg. Claim 30 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 70 mg. Claim 31 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 80 mg. Claim 32 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 90 mg. Claim 33 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 100 mg. Claim 34 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 110 mg. Claim 35 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 120 mg. Claim 36 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 4-6 mg. Claim 37 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 9-11 mg. Claim 38 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 19-21 mg. Claim 39 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 29-31 mg. Claim 40 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 39-41 mg. Claim 41 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 48-52 mg. Claim 42 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 58-62 mg. Claim 43 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 68-72 mg. Claim 44 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 78-82 mg. Claim 45 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 88-92 mg. Claim 46 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 98-102 mg. Claim 47 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 108-112 mg. Claim 48 A method according to any one of claims 1 to 7, wherein the therapeutically effective amount is 118-122 mg. Claim 49 A method according to any one of claims 1 to 48, wherein the therapeutically effective amount is administered as a single dose. Claim 50 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 28 days. Claim 51 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 56 days. Claim 52 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 84 days. Claim 53 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 4 weeks, 8 weeks, 10 weeks, 12 weeks, 16 weeks, 18 weeks, 20 weeks, 24 weeks, 28 weeks, or 32 weeks. Claim 54 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 4 weeks. Claim 55 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 8 weeks. Claim 56 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 12 weeks. Claim 57 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 16 weeks. Claim 58 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 20 weeks. Claim 59 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 24 weeks. Claim 60 In claim 49, the method comprises administering one of the therapeutically effective doses according to any one of claims 1 to 48 once a month. Claim 61 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every two months. Claim 62 In claim 49, the method comprises administering a dose of any one of the therapeutically effective doses according to any one of claims 1 to 48 once every four months. Claim 63 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 5 months. Claim 64 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every six months. Claim 65 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months, or once every 12 months. Claim 66 In claim 49, the method comprises administering one of the therapeutically effective doses according to any one of claims 1 to 48 once every quarter. Claim 67 In claim 49, the method comprises administering any one of the therapeutically effective doses according to any one of claims 1 to 48 three times a year. Claim 68 In claim 49, the method comprises administering a dose of any one of the therapeutically effective doses according to any one of claims 1 to 48 twice a year. Claim 69 In claim 49, the method comprises administering one of the therapeutically effective doses according to any one of claims 1 to 48 once a year. Claim 70 In claim 49, the above method comprises any one of the therapeutically effective doses according to any one of claims 1 to 48 once every week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, once every 12 weeks, once every 13 weeks, once every 14 weeks, once every 15 weeks, once every 16 weeks, once every 17 weeks, once every 18 weeks, once every 19 weeks, once every 20 weeks, once every 21 weeks, once every 22 weeks, once every 23 weeks, once every 24 weeks, once a month, and every 2 months A method comprising administering once, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 7 months, once every 8 months, once every 9 months, once every 10 months, once every 11 months, or once a year. Claim 71 A method according to any one of claims 1 to 70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 72 A method according to any one of claims 1 to 70, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 73 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 74 A method according to any one of claims 1 to 70, wherein the method comprises administering a 40 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 75 A method according to any one of claims 1 to 70, wherein the method comprises administering a 50 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 76 A method according to any one of claims 1 to 70, wherein the method comprises administering a 60 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 77 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 4 weeks. Claim 78 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 4 weeks. Claim 79 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 4 weeks. Claim 80 A method according to any one of claims 1 to 70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 8 weeks. Claim 81 A method according to any one of claims 1 to 70, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject once every 8 weeks. Claim 82 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every 8 weeks. Claim 83 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 8 weeks. Claim 84 A method according to any one of claims 1 to 70, wherein the method comprises administering a 50 mg dose of the modified oligonucleotide to a human subject once every 8 weeks. Claim 85 A method according to any one of claims 1 to 70, wherein the method comprises administering a 60 mg dose of the modified oligonucleotide to a human subject once every 8 weeks. Claim 86 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 8 weeks. Claim 87 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 8 weeks. Claim 88 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 8 weeks. Claim 89 A method according to any one of claims 1 to 70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 12 weeks. Claim 90 A method according to any one of claims 1 to 70, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject once every 12 weeks. Claim 91 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every 12 weeks. Claim 92 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 12 weeks. Claim 93 A method according to any one of claims 1 to 70, wherein the method comprises administering a 50 mg dose of the modified oligonucleotide to a human subject once every 12 weeks. Claim 94 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 12 weeks. Claim 95 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 12 weeks. Claim 96 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 12 weeks. Claim 97 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 12 weeks. Claim 98 A method according to any one of claims 1 to 70, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject once every quarter. Claim 99 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every quarter. Claim 100 A method according to any one of claims 1 to 70, wherein the method comprises administering a 40 mg dose of the modified oligonucleotide to a human subject once every quarter. Claim 101 A method according to any one of claims 1 to 70, wherein the method comprises administering a 50 mg dose of the modified oligonucleotide to a human subject once every quarter. Claim 102 A method according to any one of claims 1 to 70, wherein the method comprises administering a 60 mg dose of the modified oligonucleotide to a human subject once every quarter. Claim 103 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every quarter. Claim 104 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every quarter. Claim 105 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to the human subject once every quarter. Claim 106 A method according to any one of claims 1 to 70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 107 A method according to any one of claims 1 to 70, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 108 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 109 A method according to any one of claims 1 to 70, wherein the method comprises administering a 40 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 110 A method according to any one of claims 1 to 70, wherein the method comprises administering a 40 mg dose of the modified oligonucleotide to a human subject once every 12 to 13 weeks, once every quarter, or four times a year. Claim 111 A method according to any one of claims 1 to 70, wherein the method comprises administering a 50 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. A method according to any one of claims 1 to 69, wherein the method comprises administering a 60 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 112 A method according to any one of claims 1 to 70, wherein the method comprises administering a 60 mg dose of the modified oligonucleotide to a human subject once every 12 to 13 weeks, once every quarter, or four times a year. Claim 113 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 114 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 115 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 12 to 13 weeks, once every quarter, or four times a year. Claim 116 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 117 A method according to any one of claims 1 to 70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 28 days. Claim 118 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 20 mg of the modified oligonucleotide to a human subject once every 28 days. Claim 119 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every 28 days. Claim 120 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 28 days. Claim 121 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 50 mg of the modified oligonucleotide to a human subject once every 28 days. Claim 122 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 28 days. Claim 123 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 28 days. Claim 124 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 28 days. Claim 125 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 28 days. Claim 126 A method according to any one of claims 1 to 70, wherein the method comprises administering a 10 mg dose of the modified oligonucleotide to a human subject once every 56 days. Claim 127 A method according to any one of claims 1 to 70, wherein the method comprises administering a 20 mg dose of the modified oligonucleotide to a human subject once every 56 days. Claim 128 A method according to any one of claims 1 to 70, wherein the method comprises administering a 30 mg dose of the modified oligonucleotide to a human subject once every 56 days. Claim 129 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 40 mg of the modified oligonucleotide to a human subject once every 56 days. Claim 130 A method according to any one of claims 1 to 70, wherein the method comprises administering a 50 mg dose of the modified oligonucleotide to a human subject once every 56 days. Claim 131 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 60 mg of the modified oligonucleotide to a human subject once every 56 days. Claim 132 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 70 mg of the modified oligonucleotide to a human subject once every 56 days. Claim 133 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject once every 56 days. Claim 134 A method according to any one of claims 1 to 70, wherein the method comprises administering a dose of 90 mg of the modified oligonucleotide to a human subject once every 56 days. Claim 135 A method according to any one of claims 1 to 134, wherein four doses of the modified oligonucleotide are administered. Claim 136 A method according to any one of claims 1 to 134, wherein three doses of the modified oligonucleotide are administered. Claim 137 A method according to any one of claims 1 to 134, wherein two doses of the modified oligonucleotide are administered. Claim 138 A method according to any one of claims 1 to 134, comprising administering a 20 mg dose of the modified oligonucleotide to a human subject in a total of three doses on day 1, day 29, and day 85, followed by administering a maximum 40 mg dose in a maximum of five doses every 12 weeks. Claim 139 A method according to any one of claims 1 to 70, wherein the method comprises administering a 40 mg dose of the modified oligonucleotide to a human subject on day 1, day 29, and day 85, and then administering a maximum 40 mg dose at a maximum of 5 times every 12 weeks. Claim 140 A method according to any one of claims 1 to 70, wherein the method comprises administering an 80 mg dose of the modified oligonucleotide to a human subject on day 1, day 29, and day 85, and then administering a maximum 80 mg dose at a maximum of 5 times every 12 weeks. Claim 141 A method according to any one of claims 1 to 70, wherein the modified oligonucleotide is administered to a human subject in a total monthly dose of 5 mg to 100 mg, 5 mg to 80 mg, 5 mg to 60 mg, 5 mg to 40 mg, 5 mg to 20 mg, 10 mg to 100 mg, 10 mg to 80 mg, 10 mg to 60 mg, 10 mg to 40 mg, 10 mg to 20 mg, 20 mg to 100 mg, 20 mg to 80 mg, 20 mg to 60 mg, 20 mg to 40 mg, 40 mg to 100 mg, 40 mg to 80 mg, 40 mg to 60 mg, or 80 mg to 100 mg. Claim 142 In any one of claims 1 to 70, the modified oligonucleotide is administered to the human subject in a total dose of 15 mg to 300 mg, 15 mg to 180 mg, 15 mg to 150 mg, 15 mg to 100 mg, 15 mg to 80 mg, 15 mg to 50 mg, 40 mg to 300 mg, 40 mg to 180 mg, 40 mg to 150 mg, 40 mg to 100 mg, 40 mg to 80 mg, 80 mg to 300 mg, 80 mg to 180 mg, 80 mg to 150 mg, 80 mg to 100 mg, 100 mg to 300 mg, 100 mg to 180 mg, 100 mg to 150 mg, or 150 mg to 300 mg per 3 months. method. Claim 143 In any one of claims 1 to 70, the modified oligonucleotide is a total dose per 4 months of 20 mg to 400 mg, 20 mg to 350 mg, 20 mg to 300 mg, 20 mg to 250 mg, 20 mg to 200 mg, 20 mg to 150 mg, 20 mg to 100 mg, 50 mg to 400 mg, 50 mg to 350 mg, 50 mg to 300 mg, 50 mg to 250 mg, 50 mg to 200 mg, 50 mg to 150 mg, 50 mg to 100 mg, 100 mg to 400 mg, 100 mg to 350 mg, 100 mg to 300 mg, 100 mg to 250 mg, 100 mg to 200 mg, and 100 mg. A method of administering to a human subject in an amount of 150 mg, 200 mg to 400 mg, 200 mg to 350 mg, 200 mg to 300 mg, 200 mg to 250 mg, 300 mg to 400 mg, or 300 mg to 350 mg. Claim 144 In any one of claims 1 to 70, the modified oligonucleotide is a total dose of 30 mg to 600 mg, 30 mg to 500 mg, 30 mg to 400 mg, 30 mg to 300 mg, 30 mg to 200 mg, 30 mg to 100 mg, 50 mg to 600 mg, 50 mg to 500 mg, 50 mg to 400 mg, 50 mg to 300 mg, 50 mg to 200 mg, 50 mg to 100 mg, 100 mg to 600 mg, 100 mg to 500 mg, 100 mg to 400 mg, 100 mg to 300 mg, 100 mg to 200 mg, 200 mg to 600 mg, 200 mg to 500 mg, A method of administering to a human subject in an amount of 200 mg to 400 mg, 200 mg to 300 mg, 300 mg to 600 mg, 300 mg to 500 mg, 300 mg to 400 mg, 400 mg to 600 mg, 400 mg to 500 mg, or 500 mg to 600 mg. Claim 145 In any one of claims 1 to 70, the modified oligonucleotide is in an annual total dose of 60 mg to 1200 mg, 60 mg to 1100 mg, 60 mg to 1000 mg, 60 mg to 900 mg, 60 mg to 800 mg, 60 mg to 700 mg, 60 mg to 600 mg, 60 mg to 500 mg, 60 mg to 400 mg, 60 mg to 300 mg, 60 mg to 200 mg, 60 mg to 100 mg, 100 mg to 1200 mg, 100 mg to 1100 mg, 100 mg to 1000 mg, 100 mg to 900 mg, 100 mg to 800 mg, 100 mg to 700 mg, 100 mg to 600 mg, 100 mg to 500 mg, 100 mg to 400 mg, 100 mg to 300 mg, 100 mg to 200 mg, 200 mg to 1200 mg, 200 mg to 1100 mg, 200 mg to 1000 mg, 200 mg to 900 mg, 200 mg to 800 mg, 200 mg to 700 mg, 200 mg to 600 mg, 200 mg to 500 mg, 200 mg to 400 mg, 200 mg to 300 mg, 300 mg to 1200 mg, 300 mg to 1100 mg, 300 mg to 1000 mg, 300 mg to 900 mg, 300 mg to 800 mg, 300 mg to 700 mg, 300 mg to 600 mg, 300 mg to 500 mg, 300 mg to 400 mg, 400 mg to 1200 mg, 400 mg to 1100 mg, 400 mg to 1000 mg, 400 mg to 900 mg, 400 mg to 800 mg, 400 mg to 700 mg, 400 mg to 600 mg, 400 mg to 500 mg, 500 mg to 1200 mg, 500 mg to 1100 mg,500 mg to 1000 mg, 500 mg to 900 mg, 500 mg to 800 mg, 500 mg to 700 mg, 500 mg to 600 mg, 600 mg to 1200 mg, 600 mg to 1100 mg, 600 mg to 1000 mg, 600 mg to 900 mg, 600 mg to 800 mg, 600 mg to 700 mg, 700 mg to 1200 mg, 700 mg to 1100 mg, 700 mg to 1000 mg, 700 mg to 900 mg, 700 mg to 800 mg, 800 mg to 1200 mg, 800 mg to 1100 mg, 800 mg to 1000 mg, 800 mg to A method of administering to the human subject in an amount of 900 mg, 900 mg to 1200 mg, 900 mg to 1100 mg, 900 mg to 1000 mg, 1000 mg to 1200 mg, 1000 mg to 1100 mg, or 1100 mg to 1200 mg. Claim 146 In paragraph 145, the modified oligonucleotide is administered monthly, every two months, every three months, every four months, every six months, or once a year. Claim 147 In paragraph 145, the method wherein each administration is performed at intervals independently selected from 2 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, and 6 months. Claim 148 A method according to any one of claims 141 to 145, wherein the administration is carried out at various administration intervals. Claim 149 A method according to any one of claims 1 to 148, wherein the method comprises administering a loading dose of the modified oligonucleotide to the human subject. Claim 150 A method according to any one of claims 1 to 148, wherein the method does not include administering a loading dose of the modified oligonucleotide to the human subject. Claim 151 A method according to any one of claims 1 to 150, wherein the method comprises administering a maintenance dose of the modified oligonucleotide, optionally 1, 2, 3, 4, or 5 maintenance doses, to a human subject. Claim 152 A method according to any one of claims 1 to 151, wherein the dose is administered by intrathecal administration. Claim 153 A method according to any one of claims 1 to 152, wherein the dose is administered by bolus intrathecal administration. Claim 154 A method in which the magnitude of delta waves in the human subject is reduced in any one of claims 1 to 153. Claim 155 A method according to any one of claims 1 to 154, wherein the delta activity of the human subject is reduced compared to the delta activity of the subject before administration of the modified oligonucleotide. Claim 156 A method according to any one of claims 1 to 155, wherein the human subject has a faster frequency rhythm (theta) compared to the frequency rhythm of the subject before administration of the modified oligonucleotide. Claim 157 A method according to any one of claims 1 to 156, wherein the human subject’s total Bayley score is improved compared to the subject’s Bayley score before administration of the modified oligonucleotide. Claim 158 A method according to any one of claims 1 to 157, wherein the human subject is under 18 years of age, under 15 years of age, under 13 years of age, under 10 years of age, under 8 years of age, or under 5 years of age. Claim 159 A method according to any one of claims 1 to 157, wherein the human subject is 2 years of age or older and 5 years of age or younger, 4 years of age or older and 17 years of age or younger, or 1 year of age or older and 17 years of age or younger. Claim 160 A method according to any one of claims 1 to 157, wherein the human subject is 13 years of age or older, or 18 years of age or older. Claim 161 A method according to any one of claims 1 to 157, wherein the human subject is 18 to 50 years of age. Claim 162 A method according to any one of claims 1 to 157, wherein the human subject is 18 years of age or older. Claim 163 A method according to any one of claims 1 to 157, wherein the human subject is 17 years of age or younger. Claim 164 A method according to any one of claims 1 to 163, wherein a disease or disorder associated with UBE3A in a human subject requiring treatment is improved. Claim 165 A method according to any one of claims 1 to 164, wherein UBE3A-ATS RNA is reduced in the human subject requiring treatment. Claim 166 A method in which the UBE3A protein is increased in any one of claims 1 to 165. Claim 167 In any one of paragraphs 1 to 166, the disease or disorder associated with UBE3A is a developmental disability, method. Claim 168 A method according to any one of claims 1 to 167, wherein the disease or disorder associated with UBE3A is Angelman syndrome. Claim 169 A method according to any one of claims 1 to 168, wherein at least one symptom or characteristic sign of the disease or disorder associated with UBE3A is improved. Claim 170 A method according to any one of claims 1 to 169, wherein at least one symptom or characteristic sign is selected from developmental delay, ataxia, cognitive impairment, fine and / or gross motor skill impairment, language impairment, receptive and / or expressive communication impairment, impairment of daily living skills, impaired socialization skills, sleep problems, seizures, and EEG abnormalities. Claim 171 In paragraph 169, the method wherein at least one of the above symptoms or characteristic signs is developmental delay, ataxia, speech disorder, sleep problem, seizure, or EEG abnormality. Claim 172 A method for treating a patient with Angelman syndrome, comprising: a. evaluating said patient regarding sleep, seizures, communication, motor function, and / or ability to perform activities of daily living at a first time point; b. a modified oligonucleotide according to the following chemical structure: A method comprising: administering a therapeutically effective amount of (sequence ID NO: 5), or a pharmaceutically acceptable salt thereof, to the human subject; c) re-evaluating the patient for sleep, seizures, communication, motor function, and / or ability to perform daily living activities at a second time point after administration of the modified oligonucleotide; and d) increasing the amount of the next dose administered if there is no improvement or insufficient improvement between the first time point and the second time point evaluation. Claim 173 As for the use of a modified oligonucleotide in the manufacture of a drug for treating Angelman syndrome, said modified oligonucleotide is a. a modified oligonucleotide according to the following chemical structure: (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof; b. Modified oligonucleotide according to the following chemical structure: (Sequence ID NO: 5), or c. A modified oligonucleotide consisting of 19-20 linked nucleosides, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e A modified oligonucleotide comprising at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein in the formula: A = adenine nucleobase, m C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = linkage between phosphothioate nucleosides, and o = linkage between phosphodiester nucleosides, wherein the treatment of the Angelman syndrome comprises administering a therapeutically effective amount of the modified oligonucleotide, and the therapeutically effective amount is 5-150 mg. Claim 174 In paragraph 173, the therapeutically effective amount is any one of 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 105 mg, 110 mg, 115 mg, 120 mg, 125 mg, 130 mg, 135 mg, 140 mg, 145 mg, or 150 mg. Claim 175 In paragraph 173, the above therapeutic effective amount is 5 mg to 120 mg, 5 mg to 115 mg, 5 mg to 110 mg, 5 mg to 105 mg, 5 mg to 100 mg, 5 mg to 95 mg, 5 mg to 90 mg, 5 mg to 85 mg, 5 mg to 80 mg, 5 mg to 75 mg, 5 mg to 70 mg, 5 mg to 65 mg, 5 mg to 60 mg, 5 mg to 55 mg, 5 mg to 50 mg, 5 mg to 45 mg, 5 mg to 40 mg, 5 mg to 35 mg, 5 mg to 30 mg, 5 mg to 25 mg, 5 mg to 20 mg, 5 mg to 15 mg, 5 mg to 10 mg, 10 mg to 120 mg, 10 mg to 115 mg, 10 mg to 110 mg, 10 mg to 105 mg, 10 mg to 100 mg, 10 mg to 95 mg, 10 mg to 90 mg, 10 mg to 85 mg, 10 mg to 80 mg, 10 mg to 75 mg, 10 mg to 70 mg, 10 mg to 65 mg, 10 mg to 60 mg, 10 mg to 55 mg, 10 mg to 50 mg, 10 mg to 45 mg, 10 mg to 40 mg, 10 mg to 35 mg, 10 mg to 30 mg, 10 mg to 25 mg, 10 mg to 20 mg, 10 mg to 15 mg, 15 mg to 120 mg, 15 mg to 115 mg, 15 mg to 110 mg, 15 mg to 105 mg, 15 mg to 100 mg, 15 mg to 95 mg, 15 mg to 90 mg, 15 mg to 85 mg, 15 mg to 80 mg, 15 mg to 75 mg, 15 mg to 70 mg, 15 mg to 65 mg, 15 mg to 60 mg, 15 mg to 55 mg, 15 mg to 50 mg, 15 mg to 45 mg,15 mg to 40 mg, 15 mg to 35 mg, 15 mg to 30 mg, 15 mg to 25 mg, 15 mg to 20 mg, 20 mg to 120 mg, 20 mg to 115 mg, 20 mg to 110 mg, 20 mg to 105 mg, 20 mg to 100 mg, 20 mg to 95 mg, 20 mg to 90 mg, 20 mg to 85 mg, 20 mg to 80 mg, 20 mg to 75 mg, 20 mg to 70 mg, 20 mg to 65 mg, 20 mg to 60 mg, 20 mg to 55 mg, 20 mg to 50 mg, 20 mg to 45 mg, 20 mg to 40 mg, 20 mg to 35 mg, 20 mg to 30 mg, 20 mg to 25 mg, 25 mg to 120 mg, 25 mg to 115 mg, 25 mg to 110 mg, 25 mg to 105 mg, 25 mg to 100 mg, 25 mg to 95 mg, 25 mg to 90 mg, 25 mg to 85 mg, 25 mg to 80 mg, 25 mg to 75 mg, 25 mg to 70 mg, 25 mg to 65 mg, 25 mg to 60 mg, 25 mg to 55 mg, 25 mg to 50 mg, 25 mg to 45 mg, 25 mg to 40 mg, 25 mg to 35 mg, 25 mg to 30 mg, 30 mg to 120 mg, 30 mg to 115 mg, 30 mg to 110 mg, 30 mg to 105 mg, 30 mg to 100 mg, 30 mg to 95 mg, 30 mg to 90 mg, 30 mg to 85 mg, 30 mg to 80 mg, 30 mg to 75 mg, 30 mg to 70 mg, 30 mg to 65 mg, 30 mg to 60 mg, 30 mg to 55 mg, 30 mg to 50 mg, 30 mg to 45 mg, 30 mg to 40 mg,30 mg to 35 mg, 35 mg to 120 mg, 35 mg to 115 mg, 35 mg to 110 mg, 35 mg to 105 mg, 35 mg to 100 mg, 35 mg to 95 mg, 35 mg to 90 mg, 35 mg to 85 mg, 35 mg to 80 mg, 35 mg to 75 mg, 35 mg to 70 mg, 35 mg to 65 mg, 35 mg to 60 mg, 35 mg to 55 mg, 35 mg to 50 mg, 35 mg to 45 mg, 35 mg to 40 mg, 40 mg to 120 mg, 40 mg to 115 mg, 40 mg to 110 mg, 40 mg to 105 mg, 40 mg to 100 mg, 40 mg to 95 mg, 40 mg to 90 mg, 40 mg to 85 mg, 40 mg to 80 mg, 40 mg to 75 mg, 40 mg to 70 mg, 40 mg to 65 mg, 40 mg to 60 mg, 40 mg to 55 mg, 40 mg to 50 mg, 40 mg to 45 mg, 45 mg to 120 mg, 45 mg to 115 mg, 45 mg to 110 mg, 45 mg to 105 mg, 45 mg to 100 mg, 45 mg to 95 mg, 45 mg to 90 mg, 45 mg to 85 mg, 45 mg to 80 mg, 45 mg to 75 mg, 45 mg to 70 mg, 45 mg to 65 mg, 45 mg to 60 mg, 45 mg to 55 mg, 45 mg to 50 mg, 50 mg to 120 mg, 50 mg to 115 mg, 50 mg to 110 mg, 50 mg to 105 mg, 50 mg to 100 mg, 50 mg to 95 mg, 50 mg to 90 mg, 50 mg to 85 mg, 50 mg to 80 mg, 50 mg to 75 mg, 50 mg to 70 mg, 50 mg to 65 mg,50 mg to 60 mg, 50 mg to 120 mg, 55 mg to 115 mg, 55 mg to 110 mg, 55 mg to 105 mg, 55 mg to 100 mg, 55 mg to 95 mg, 55 mg to 90 mg, 55 mg to 85 mg, 55 mg to 80 mg, 55 mg to 75 mg, 55 mg to 70 mg, 55 mg to 65 mg, 55 mg to 60 mg, 60 mg to 120 mg, 60 mg to 115 mg, 60 mg to 110 mg, 60 mg to 105 mg, 60 mg to 100 mg, 60 mg to 95 mg, 60 mg to 90 mg, 60 mg to 85 mg, 60 mg to 80 mg, 60 mg to 75 mg, 60 mg to 70 mg, 65 mg to 120 mg, 65 mg to 115 mg, 65 mg to 110 mg, 65 mg to 105 mg, 65 mg to 100 mg, 65 mg to 95 mg, 65 mg to 90 mg, 65 mg to 85 mg, 65 mg to 80 mg, 65 mg to 75 mg, 65 mg to 70 mg, 70 mg to 120 mg, 70 mg to 115 mg, 70 mg to 110 mg, 70 mg to 105 mg, 70 mg to 100 mg, 70 mg to 95 mg, 70 mg to 90 mg, 70 mg to 85 mg, 70 mg to 80 mg, 75 mg to 120 mg, 75 mg to 115 mg, 75 mg to 110 mg, 75 mg to 105 mg, 75 mg to 100 mg, 75 mg to 95 mg, 75 mg to 90 mg, 75 mg to 85 mg, 75 mg to 80 mg, 80 mg to 120 mg, 80 mg to 115 mg, 80 mg to 110 mg, 80 mg to 105 mg, 80 mg to 100 mg, 80 mg to 95 mg,80 mg to 90 mg, 85 mg to 120 mg, 85 mg to 115 mg, 85 mg to 110 mg, 85 mg to 105 mg, 85 mg to 100 mg, 85 mg to 95 mg, 85 mg to 90 mg, 90 mg to 120 mg, 90 mg to 115 mg, 90 mg to 110 mg, 90 mg to 105 mg, 90 mg to 100 mg, 95 mg to 120 mg, 95 mg to 115 mg, 95 mg to 110 mg, 95 mg to 105 mg, 95 mg to 100 mg, 100 mg to 120 mg, 100 mg to 115 mg, 100 mg to 110 mg, 100 mg to 105 mg, Use, any one of 105 mg to 120 mg, 105 mg to 115 mg, 105 mg to 110 mg, 110 mg to 120 mg, 110 mg to 115 mg, and 115 mg to 120 mg. Claim 176 In paragraph 173, the therapeutically effective amount is any one of 15 mg to 25 mg, 18 mg to 25 mg, 19 mg to 25 mg, 18 mg to 23 mg, 19 mg to 23 mg, 18 mg to 22 mg, 19 mg to 22 mg, 18 mg to 21 mg, or 19 mg to 21 mg. Claim 177 In paragraph 173, the therapeutically effective amount is any one of 35 mg to 45 mg, 38 mg to 45 mg, 39 mg to 45 mg, 38 mg to 43 mg, 39 mg to 43 mg, 38 mg to 42 mg, 39 mg to 42 mg, 38 mg to 41 mg, or 39 mg to 41 mg. Claim 178 In paragraph 173, the therapeutically effective amount is any one of 55 mg to 65 mg, 58 mg to 65 mg, 59 mg to 65 mg, 58 mg to 63 mg, 59 mg to 63 mg, 58 mg to 62 mg, 59 mg to 62 mg, 58 mg to 61 mg, or 59 mg to 61 mg. Claim 179 In paragraph 173, the therapeutically effective amount is any one of 75 mg to 85 mg, 78 mg to 85 mg, 79 mg to 85 mg, 78 mg to 83 mg, 79 mg to 83 mg, 78 mg to 82 mg, 79 mg to 82 mg, 78 mg to 81 mg, or 79 mg to 81 mg. Claim 180 In paragraph 173, the therapeutically effective amount is about 5 mg. Claim 181 In paragraph 173, the therapeutically effective amount is about 10 mg. Claim 182 In paragraph 173, the therapeutically effective amount is about 20 mg. Claim 183 In paragraph 173, the therapeutically effective amount is about 30 mg. Claim 184 In paragraph 173, the therapeutically effective amount is about 40 mg. Claim 185 In paragraph 173, the therapeutically effective amount is about 50 mg. Claim 186 In paragraph 173, the therapeutically effective amount is about 60 mg. Claim 187 In paragraph 173, the therapeutically effective amount is about 70 mg. Claim 188 In paragraph 173, the therapeutically effective amount is about 80 mg. Claim 189 In paragraph 173, the therapeutically effective amount is about 90 mg. Claim 190 In paragraph 173, the therapeutically effective amount is about 100 mg. Claim 191 In paragraph 173, the therapeutically effective amount is about 110 mg. Claim 192 In paragraph 173, the therapeutically effective amount is about 120 mg. Claim 193 In paragraph 173, the therapeutically effective amount is 4-6 mg. Claim 194 In paragraph 173, the therapeutically effective amount is 9-11 mg. Claim 195 In paragraph 173, the therapeutically effective amount is 19-21 mg. Claim 196 In paragraph 173, the therapeutically effective dose is 29-31 mg. Claim 197 In paragraph 173, the therapeutically effective amount is 39-41 mg. Claim 198 In paragraph 173, the therapeutically effective dose is 48-52 mg. Claim 199 In paragraph 173, the therapeutically effective dose is 58-62 mg. Claim 200 In paragraph 173, the therapeutically effective dose is 68-72 mg. Claim 201 In paragraph 173, the therapeutically effective dose is 78-82 mg. Claim 202 In paragraph 173, the therapeutically effective dose is 88-92 mg. Claim 203 In paragraph 173, the therapeutically effective dose is 98-102 mg. Claim 204 In paragraph 173, the therapeutically effective dose is 108-112 mg. Claim 205 In paragraph 173, the therapeutically effective dose is 118-122 mg. Claim 206 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every 28 days. Claim 207 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every 56 days. Claim 208 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every 84 days. Claim 209 In any one of claims 173 to 205, the above-mentioned medicine is used for a formulation to be administered once every 4, 8, 10, 12, 16, 18, 20, 24, 28, or 32 weeks. Claim 210 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every four weeks. Claim 211 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every 8 weeks. Claim 212 In any one of paragraphs 173 to 205, the use of the medicine is to be formulated for administration once every 12 weeks. Claim 213 In any one of paragraphs 173 to 205, the use of the medicine is to be formulated for administration once every 16 weeks. Claim 214 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every 20 weeks. Claim 215 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every 24 weeks. Claim 216 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once a month. Claim 217 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every two months. Claim 218 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every four months. Claim 219 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every five months. Claim 220 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every six months. Claim 221 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration once every quarter. Claim 222 In any one of paragraphs 173 to 205, the use of the above medicine is to be formulated for administration three times a year. Claim 223 In any one of claims 173 to 205, the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 4 weeks. Claim 224 In any one of claims 173 to 205, the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 4 weeks. Claim 225 In any one of claims 173 to 205, the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 4 weeks. Claim 226 In any one of claims 173 to 205, the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 4 weeks. Claim 227 In any one of claims 173 to 205, the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 8 weeks. Claim 228 In any one of claims 173 to 205, the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 8 weeks. Claim 229 In any one of claims 173 to 205, the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 8 weeks. Claim 230 In any one of claims 173 to 205, the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 8 weeks. Claim 231 In any one of claims 173 to 205, the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 12 weeks. Claim 232 In any one of claims 173 to 205, the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 12 weeks. Claim 233 In any one of claims 173 to 205, the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 12 weeks. Claim 234 In any one of claims 173 to 205, the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the use is for the medicine to be formulated for administration once every 12 weeks. Claim 235 In any one of claims 173 to 205, the therapeutically effective amount is 20 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 236 In any one of claims 173 to 205, the therapeutically effective amount is 40 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 237 In any one of claims 173 to 205, the therapeutically effective amount is 60 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 238 In any one of claims 173 to 205, the therapeutically effective amount is 80 mg of the modified oligonucleotide, and the medicine is formulated for administration once a month, once every 2 months, once every 3 months, once every 4 months, once every 5 months, once every 6 months, once every 8 months, once every quarter, three times a year, twice a year, once a year, three times a year, or four times a year. Claim 239 In any one of paragraphs 173 to 227, the above-mentioned medicine is used for formulation for intrathecal administration. Claim 240 In any one of paragraphs 173 to 228, the said medicine is used for administration to human subjects under the age of 18, under 15, under 13, under 10, under 8, or under 5. Claim 241 In paragraph 240, the human subject is for use as being 2 years of age or older and 5 years of age or younger, 4 years of age or older and 17 years of age or younger, or 1 year of age or older and 17 years of age or younger. Claim 242 In paragraph 240, the human subject is 13 years of age or older, or 18 years of age or older. Claim 243 In paragraph 240, the human subject is for use as a person aged 18 to 50 years. Claim 244 In any one of paragraphs 1 to 146, the human subject is 18 years of age or older. Claim 245 In paragraph 240, the above human subject is 17 years of age or younger. Claim 246 In any one of claims 173 to 245, the modified oligonucleotide is used to be formulated into a pharmaceutical composition comprising a pharmaceutically acceptable diluent. Claim 247 In paragraph 246, the above pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) for use. Claim 248 In paragraph 246, the above pharmaceutically acceptable diluent is phosphate-buffered saline (PBS) for use. Claim 249 A method for treating Angelman syndrome comprises administering a therapeutically effective amount of a modified oligonucleotide to a human having Angelman syndrome, wherein the modified oligonucleotide is a. a modified oligonucleotide according to the following chemical structure: (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof; b. Modified oligonucleotide according to the following chemical structure: (Sequence ID NO: 5), or c. A modified oligonucleotide consisting of 19-20 linked nucleosides, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e It comprises at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein: A = adenine nucleobase, m A modified oligonucleotide comprising C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = linkage between phosphothioate nucleosides, and o = linkage between phosphodiester nucleosides, wherein the therapeutically effective dose is 40 mg and the therapeutically effective dose is administered once every quarter. Claim 250 A method for treating Angelman syndrome comprises administering a therapeutically effective amount of a modified oligonucleotide to a human having Angelman syndrome, wherein the modified oligonucleotide is a) a modified oligonucleotide according to the following chemical structure: (Sequence ID NO: 5), or a pharmaceutically acceptable salt thereof; b) a modified oligonucleotide according to the following chemical structure: (Sequence ID NO: 5), or c) a modified oligonucleotide consisting of 19-20 linked nucleosides, wherein the modified oligonucleotide is in the following chemical notation (5' to 3' direction): A es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e It comprises at least 19 consecutive nucleosides of (sequence ID NO: 5), wherein: A = adenine nucleobase, m A modified oligonucleotide comprising C = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = linkage between phosphothioate nucleosides, and o = linkage between phosphodiester nucleosides, wherein the therapeutically effective dose is 80 mg and the therapeutically effective dose is administered once every quarter. Claim 251 A method according to paragraph 249 or 250 in which at least one symptom or characteristic sign of Angelman syndrome is improved. Claim 252 In paragraph 251, the method wherein at least one symptom or characteristic sign is selected from developmental delay, ataxia, cognitive impairment, fine and / or gross motor impairment, language impairment, receptive and / or expressive communication impairment, impairment of daily living skills, impaired socialization skills, sleep problems, seizures, and EEG abnormalities. Claim 253 In paragraph 251, the above symptoms or characteristic signs are developmental delay, ataxia, speech disorder, sleep problems, seizures, or EEG abnormalities. Claim 254 In paragraph 251, the above at least one symptom or characteristic sign is a cognitive impairment, method. Claim 255 In paragraph 251, the above at least one symptom or characteristic sign is a disorder of fine motor skills, method. Claim 256 In paragraph 251, the above at least one symptom or characteristic sign is a disorder of gross motor skills, method. Claim 257 In paragraph 251, the above at least one symptom or characteristic sign is a receptive communication disorder, method. Claim 258 In paragraph 251, the above at least one symptom or characteristic sign is a method of expressive communication disorder. Claim 259 In paragraph 251, the above at least one symptom or characteristic sign is a person with impaired ability to perform daily activities, method. Claim 260 In paragraph 251, the above at least one symptom or characteristic sign is a person with impaired socialization ability. Claim 261 In paragraph 251, the method wherein at least one of the above symptoms or characteristic signs is a sleep problem.