Novel Targets, Regulatory Molecules, and Applications for the Treatment of Metabolism-Related Fatty Liver Disease

KR1020260124136APending Publication Date: 2026-08-14상하이 펜토젠 바이오테크놀로지 컴퍼니 리미티드
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
KR1020267022068
Authority / Receiving Office
KR · KR
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-22
Filing Date
2024-12-23
Publication Date
2026-08-14

Smart Images

  • Figure PCT00001_ABST
    Figure PCT00001_ABST
Patent Text Reader

Abstract

The present invention provides a novel target, a regulatory molecule thereof, and an application for the treatment of metabolism-related fatty liver disease. The present invention identifies, for the first time, a novel target gene closely associated with the alleviation or treatment of metabolism-related fatty liver disease and signaling pathways related to its upstream and downstream regulation. The present invention discloses a novel mechanism for regulating metabolism-related fatty liver disease involving said signaling pathways. The present invention also discloses a desirable remission / treatment drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technology Field

[0001] The present invention claims priority to a Chinese patent application filed on December 22, 2023, with application number CN 202311790463.8, all of which are incorporated by reference into the present invention.

[0002] The present invention belongs to the field of biomedical science, and more specifically, the present invention relates to a novel target for the treatment of metabolism-related fatty liver disease, a regulatory molecule thereof, and its application. Background Technology

[0003] Liver disease can lead to conditions such as alcohol-associated liver disease (ALD) and nonalcoholic fatty liver disease (NAFLD). These liver diseases can further induce liver tumors.

[0004] Fatty liver refers to a condition in which fat accumulates excessively within liver cells due to various causes. Fatty liver generally occurs frequently in patients with lipid metabolism disorders in liver cells caused by various factors. Symptoms include right upper abdominal distension, loss of appetite, general weakness, lethargy, and nausea, and in severe cases, jaundice may even occur.

[0005] Nonalcoholic fatty liver disease (NAFLD) is characterized primarily by hepatic steatosis and is the most common cause of chronic liver disease. It causes many chronic liver conditions such as liver fibrosis, cirrhosis, and liver failure, and is also a risk factor for primary liver cancer. As a type of NAFLD, liver tumors caused by non-alcoholic steatohepatitis (NASH) are on the rise.

[0006] Non-alcoholic fatty liver disease is qualitatively different from simple fat accumulation in adipose tissue or in other organs or tissues. The liver is a critical site for lipid synthesis and metabolism in the body, whereas adipose tissue is more focused on storing excess lipids. The liver can perform lipid neosynthesis and breakdown in response to systemic lipid balance. After synthesizing excess free fatty acids into triglycerides, the liver transfers them to other tissues, such as adipose tissue, for storage. Dysfunction of liver lipid metabolism is a significant contributing factor to the development of metabolic diseases in the body (obesity, diabetes, hyperlipidemia, etc.).

[0007] Over the past few decades, changes in lifestyle and dietary habits have fueled the prevalence of obesity and NAFLD. Currently, the increase in the number of NAFLD patients is alarming. As liver diseases such as NAFLD emerge as major health issues, there is an urgent need in this field for more in-depth research analysis and the exploration of effective pharmacological interventions. Elucidating the mechanisms of onset and progression of liver diseases like NAFLD and identifying potential therapeutic targets are urgent tasks.

[0008] The object of the present invention is to provide a novel target, a regulatory molecule, and an application for the treatment of metabolism-associated fatty liver disease (MAFLD).

[0009] In one aspect of the present invention, the use of a downregulator of the TKT or TKT-containing (insulin-)InsR-C / EBPα-TKT signaling pathway is provided for the preparation of a pharmaceutical composition for the alleviation or treatment of metabolism-related fatty liver disease.

[0010] In another preferred example, the InsR-C / EBPα-TKT signaling pathway comprises a TKT gene / protein, a C / EBPα gene / protein, and an InsR gene / protein; preferably further comprises upstream and downstream regulatory genes / proteins or chemical molecules thereof.

[0011] In another preferred example, the downmodulator comprises a TKT downmodulator, a C / EBPα-TKT interaction (mutual regulation; preferably including TKT transcriptional regulation by C / EBP) downmodulator, and an InsR-C / EBPα interaction (mutual regulation) downmodulator.

[0012] In another preferred example, the TKT downregulator comprises, but is not limited to, a reagent for silencing, knockdown, or knockout of the TKT gene, or a reagent for inhibiting TKT protein activity; more preferably, it comprises an interfering molecule that specifically interferes with TKT gene expression (e.g., siRNA, shRNA, miRNA, antisense nucleotide, etc.), a CRISPR gene editing reagent for the TKT gene, a homologous recombination reagent, or a site-specific mutagenic reagent, wherein the reagent induces a loss-of-function mutation of TKT.

[0013] In another preferred example, the C / EBPα-TKT interaction downregulator comprises, but is not limited to, a reagent for weakening the binding of C / EBPα to a TKT promoter, a reagent for silencing, knockdown, or knockout of the C / EBPα gene, and a reagent for inhibiting C / EBPα protein activity; more preferably, it comprises a reagent for reducing the level of C / EBPα protein phosphorylation, an interfering molecule that specifically interferes with C / EBPα gene expression (e.g., siRNA, shRNA, miRNA, antisense nucleotide, etc.), a CRISPR gene editing reagent for the C / EBPα gene, a homologous recombination reagent, or a site-specific mutagenic reagent, wherein the reagent induces a loss-of-function mutation of C / EBPα.

[0014] In another preferred example, the InsR-C / EBPα interaction downregulator comprises, but is not limited to, a reagent for silencing, knockdown, or knockout of the InsR gene, a reagent for inhibiting InsR protein activity, or a reagent for weakening the binding of insulin to InsR; more preferably, it comprises an interfering molecule that specifically interferes with InsR gene expression (e.g., siRNA, shRNA, miRNA, antisense nucleotide, etc.), a CRISPR gene editing reagent for the InsR gene, a homologous recombination reagent, or a site-specific mutagenic reagent, wherein the reagent induces a loss-of-function mutation of InsR.

[0015] In another preferred example, the mutual regulation includes regulation at the transcriptional level.

[0016] In another preferred example, the downregulator is a TKT gene silencing interference reagent; preferably, the interference reagent is siRNA; preferably, the siRNA is siRNA in which the nucleotide sequence (a sense strand, with a protection base at the 3' end of the corresponding antisense strand) is represented by any one of SEQ ID NOs 1 to 50, SEQ ID NOs 53 to 167; more preferably, the siRNA is siRNA in which the nucleotide sequence is represented by any one of SEQ ID NO 37 (1115), SEQ ID NO 25 (773), SEQ ID NO 50 (siTKT16), SEQ ID NO 49, SEQ ID NO 61, SEQ ID NO 63, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 78, SEQ ID NO 88, or SEQ ID NO 130.

[0017] In another preferred example, the downregulator is a homologous recombinant reagent for the knockdown or knockout of the TKT gene, which causes gene coding to terminate.

[0018] In another preferred example, the downregulator is a homologous recombinant reagent for knockdown or knockout of the InsR gene, which causes gene coding to terminate.

[0019] In another preferred example, the siRNA forms an siRNA formulation for hepatocyte-targeted delivery; preferably, the siRNA is linked to a target ligand that binds to an asialoglycoprotein receptor (ASGPR) (covalent bond, conjugate formation).

[0020] In another preferred example, the target ligand comprises N-acetylgalactosamine (GalNAc), N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, or N-isobutyrylgalactosamine.

[0021] In another preferred example, the metabolism-related fatty liver disease includes non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH).

[0022] In another preferred example, the down-modulator of the TKT or TKT-containing (insulin-)InsR-C / EBPα-TKT signaling pathway increases inosine levels, improves mitochondrial function, further improves liver lipid metabolism, and alleviates or treats metabolism-related fatty liver disease; preferably, the down-modulator blocks the entry of inosine-derived R5P into glycolysis, promotes inosine synthesis of glucose-derived R5P, increases intracellular inosine levels, further promotes the inosine-PKA-CREB pathway, improves mitochondrial function, improves liver lipid metabolism, and alleviates or treats metabolism-related fatty liver disease; preferably, after promoting the inosine-PKA-CREB pathway, further includes improving mitochondrial function by activating the PKA-CREB-ChoKb axis and increasing phosphatidylcholine (PC) synthesis; preferably, the increase in phosphatidylcholine (PC) synthesis is mediated by the CDP-choline pathway.

[0023] In another preferred example, the above metabolism-related fatty liver disease is a metabolism-related fatty liver disease in which TKT is highly expressed in the liver (cells).

[0024] In another preferred example, the “high expression” is “high expression” in a statistical sense, for example, patients with “metabolism-related fatty liver disease with high TKT expression” have significantly higher expression levels of 10% or 20% or more, preferably 30% or 50% or more, more preferably 80% or 100% or more compared to the average TKT expression level of a healthy population (or a population of sufficient size in a statistical sense).

[0025] In another aspect of the present invention, an siRNA or siRNA preparation for alleviating or treating a metabolism-related fatty liver disease is provided, wherein the siRNA comprises an siRNA whose nucleotide sequence is represented by any one of SEQ ID NOs 1 to 50, SEQ ID NOs 53 to 167; preferably, the siRNA is an siRNA whose nucleotide sequence is represented by any one of SEQ ID NO 37 (No. 1115), SEQ ID NO 25 (No. 773), SEQ ID NO 50 (siTKT16), SEQ ID NO 49 (siTKT10), SEQ ID NO 61, SEQ ID NO 63, SEQ ID NO 73, SEQ ID NO 74, SEQ ID NO 78, SEQ ID NO 88, or SEQ ID NO 130.

[0026] In another preferred example, the siRNA preparation is a stable siRNA preparation for hepatocyte targeted delivery.

[0027] In another preferred example, the siRNA is linked to a target ligand that binds to an asialoglycoprotein receptor (ASGPR) (covalent bond, conjugate formation); the target ligand comprises N-acetylgalactosamine (GalNAc), N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, or N-isobutyrylgalactosamine.

[0028] In the above siRNA, the nucleosides of the sense strand and the antisense strand undergo modifications including those selected from the group consisting of 2'-methoxy modifications and 2'-fluoro modifications; or, between adjacent nucleosides or between a nucleoside and a target ligand, are connected by phosphorothioate diester groups.

[0029] In another preferred example, in the sense strand of the siRNA, the first and second nucleosides and the second and third nucleosides from the 5' end are connected by a phosphorothioate diester; in the corresponding antisense strand of the siRNA (containing two protection bases at the 3' end), the first and second nucleosides and the second and third nucleosides from the 3' end are connected by a phosphorothioate diester.

[0030] In another preferred example, in the sense strand of the siRNA, the 1st, 2nd, 3rd, 4th, 6th, 10th to 19th nucleosides from the 5' end are 2'-methoxy group modifications; and in the corresponding antisense strand of the siRNA (containing two protective bases at the 3' end), the 1st, 3rd, 4th, 5th, 7th, 10th to 13th, 15th, 17th to 21st nucleosides from the 5' end are 2'-methoxy group modifications.

[0031] In another preferred example, in the sense strand of the siRNA, the 5th, 7th, 8th, and 9th nucleosides from the 5' end are 2'-fluoro modified, and in the corresponding antisense strand of the siRNA (containing two protection bases at the 3' end), the 2nd, 6th, 8th, 9th, 14th, and 16th nucleosides are 2'-fluoro modified.

[0032] In another aspect of the present invention, a pharmaceutical composition or drug kit for the alleviation or treatment of a metabolism-related fatty liver disease is provided, comprising a siRNA or siRNA preparation for the alleviation or treatment of said metabolism-related fatty liver disease, and a pharmaceutically acceptable carrier or excipient.

[0033] In another aspect of the present invention, the use of the InsR-C / EBPα-TKT signaling pathway is provided for screening substances for the alleviation or treatment of metabolism-related fatty liver disease.

[0034] In another preferred example, the InsR-C / EBPα-TKT signaling pathway is a signaling pathway within hepatocytes.

[0035] In another aspect of the present invention, a method for screening substances for alleviating or treating metabolic-related fatty liver disease is provided, the method comprising: (1) contacting a candidate substance with a system containing the InsR-C / EBPα-TKT signaling pathway; (2) screening substances that downregulate the InsR-C / EBPα-TKT signaling pathway, wherein the substance is a substance (including potential substances) useful for alleviating or treating metabolic-related fatty liver disease; and the downregulation includes TKT downregulation, C / EBPα-TKT interaction downregulation, and (insulin / )InsR-C / EBPα interaction downregulation.

[0036] In another preferred example, step (1) includes the step of adding a candidate substance to a system containing an InsR-C / EBPα-TKT signaling pathway.

[0037] In another preferred example, step (2) detects a change in each protein or its coding gene in the InsR-C / EBPα-TKT signaling pathway and compares it with a control, wherein the control is a system containing the InsR-C / EBPα-TKT signaling pathway without the addition of the candidate substance; if the candidate substance downregulates TKT, downregulates the C / EBPα-TKT interaction, or downregulates the (insulin / )InsR-C / EBPα interaction, the candidate substance is a substance useful for the alleviation or treatment of metabolism-related fatty liver disease.

[0038] In another preferred example, the system containing the InsR-C / EBPα-TKT signaling pathway is selected from a cell (culture) system, a cell organelle (culture) system, a tissue (culture) system, or an animal system.

[0039] In another preferred example, the down-regulation may also be called inhibition, and is inhibition or down-regulation in a statistical sense, for example, inhibition or down-regulation of 10% or 20% or more compared to the control group or baseline, preferably inhibition or down-regulation of 40% or 50% or more, more preferably inhibition or down-regulation of 80% or 100% or more.

[0040] In another preferred example, the candidate substance includes, but is not limited to, regulatory molecules designed for the InsR-C / EBPα-TKT signaling pathway, or its pathway proteins, or its upstream or downstream proteins or genes (e.g., upregulators, interfering molecules, nucleic acid inhibitors, binding molecules (e.g., antibodies or ligands), etc.), CRISPR constructs, small molecule compounds, and compounds from a compound library.

[0041] In another aspect of the present invention, the use of liver TKT protein or its coding gene in the preparation of a diagnostic reagent is provided, said diagnostic reagent is used for the diagnosis or prognosis of metabolism-related fatty liver disease; preferably, said diagnosis or prognosis includes determining the occurrence or progression of metabolism-related fatty liver disease based on the expression status of liver TKT protein, or determining whether it is suitable for application to a treatment plan involving treatment with “TKT or a down-regulator of the (insulin / )InsR-C / EBPα-TKT signaling pathway”; and if the TKT protein is highly expressed, said treatment plan is applied.

[0042] In another aspect of the present invention, the use of a reagent that specifically recognizes a TKT protein or its coding gene is provided, said reagent is used in the manufacture of a diagnostic reagent or diagnostic reagent kit for the diagnosis or prognosis of a metabolism-related fatty liver disease; preferably, said diagnosis or prognosis includes determining the occurrence or progression of the metabolism-related fatty liver disease based on the expression status of the TKT protein, or determining whether it is suitable for application to a treatment plan involving treatment with “TKT or a down-regulator of the (insulin / )InsR-C / EBPα-TKT signaling pathway”; and if the TKT protein is highly expressed, said treatment plan is applied.

[0043] In another preferred example, the diagnostic reagent comprises a primer that specifically amplifies the coding gene of a TKT protein; a probe that specifically recognizes the coding gene of a TKT protein or a transcript thereof; or an antibody that specifically targets a TKT protein.

[0044] In another aspect of the present invention, a reagent kit for the diagnosis or prognosis of metabolism-related fatty liver disease is provided, said reagent kit includes a diagnostic reagent for detecting the expression status or expression amount of a TKT protein or its coding gene.

[0045] In another preferred example, the reagent kit further includes a nucleic acid extraction reagent, a polymerase chain reaction reagent, a Western blot reagent, and / or an ELISA reagent.

[0046] Other aspects of the present invention will be apparent to those skilled in the art from the disclosures in this text. Brief explanation of the drawing

[0047] Fig. 1: Analysis of TKT expression characteristics in liver tissue. (A) Differential metabolic pathway enrichment between healthy population and NAFLD patients. (B) Volcanic blot of changes in liver protein levels in a healthy population and NAFLD patients. (CE) Expression levels of liver non-oxidative pentose phosphate pathway (PPP) metabolic enzymes (C), TKT protein (D), and mRNA (E) in healthy populations and NAFLD patients (n=4 in C and D, n=8 in E). (F) H&E, Oil Red O, and TKT immunohistochemical staining of a healthy population and NAFLD patients (n=4). (GI) After feeding wild-type mice a normal diet (NCD) or a high-fat diet (HFD) for 90 days, the expression levels (G) of liver non-oxidative pentose phosphate pathway (PPP) metabolic enzymes, TKT protein quantification (H), and mRNA (I) levels (n=5 in NCD, n=6 in HFD). (J) H&E, Oil Red O, and TKT immunohistochemical staining of liver tissue after feeding wild-type mice a normal diet (NCD) or a high-fat diet (HFD) for 90 days (n=5 in NCD, n=6 in HFD). (K) Expression levels of liver TKT protein (n=4) 10 weeks after injecting wild-type mice with AAV-Flag-TKT adenovirus via the tail vein. (L) Oil Red O staining of liver tissue (n=4) after injecting wild-type mice with AAV-Flag-TKT adenovirus via the tail vein and feeding them a high-fat diet for 10 weeks. (M) Serum and liver TG levels (n=4) after injecting wild-type mice with AAV-Flag-TKT adenovirus via the tail vein and feeding them a high-fat diet for 10 weeks. For all data, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. Two-sided t-tests are applied to D, E, H, I, and M. Figure 2: Supplementary analysis of TKT expression characteristics in liver tissue (A) Clinical sample information corresponding to experimental liver tissue. HS (Hepatic Steatosis): Hepatic Steatosis. (B) Liver fluorescence image (n=3) 10 weeks after injecting wild-type mice with AAV-Flag-TKT adenovirus via the tail vein. (C and D) H&E staining of liver tissue, serum and liver TC levels, and serum ALT and AST levels (n=4) after injecting wild-type mice with AAV-Flag-TKT adenovirus via the tail vein and feeding a high-fat diet for 10 weeks. (E and F) H&E, Oil Red, and Sirius Red staining of liver tissue, serum and liver TG and TC levels, and serum ALT and AST levels (n=4) after injecting wild-type mice with AAV-Flag-TKT adenovirus via the tail vein and feeding them the MCD diet for 4 weeks. For all data, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. Two-sided t-tests are applied in D and F. Fig. 3: Effect of hepatocyte-specific TKT knockout on disease progression. (AI) Phenotypic analysis of wild-type and liver-specific TKT deletion mice after feeding a high-fat diet for 90 days: (A) Nuclear magnetic resonance imaging of liver lipid content, (B) liver appearance, (C) H&E and Oil Red O staining, (D) serum TG levels, (E) serum TC levels, (F) serum ALT levels, (G) serum AST levels, (H) liver TG and (I) liver TC levels (n=5-8). (JR) Phenotypic analysis after feeding wild-type and liver-specific TKT-deficient mice the MCD diet for 4 weeks: (J) H&E staining, (K) Oil Red O staining, (L) mRNA levels of lipid production-related genes, (M) Immunohistochemical staining of F4 / 80 and (N) CD45, (O) mRNA levels of inflammation-related genes, (P) Sirius Red staining, (Q) Immunohistochemical staining of α-smooth muscle actin (α-SMA), and (R) mRNA expression levels of TGFβ (n=3-4). (S) Strategy for constructing liver-specific TKT gene knockout mice. For all data, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. Two-sided t-tests are applied to D, E, F, G, H, I, L, O, and R. Fig. 4: Effect of hepatic TKT regulation on disease progression. (AD) (A) change in body weight, (B) body conformation image, (C) body weight and (D) liver weight (n=4) after feeding wild-type and liver-specific TKT deletion mice a high-fat diet for 90 days. (E and F) Hepatic pathological features after feeding wild-type and liver-specific TKT deletion mice the MCD diet for 28 days: (E) Sirius Red staining and (F) TUNEL staining (n=4). (GN) TKTfl / fl Alb cre Phenotypic analysis after feeding mice a high-fat diet for 10 weeks following tail vein injection of AAV-Flag-TKT adenovirus: (G) H&E staining, (H) Oil Red O staining, (I) serum TG, (J) liver TG, (K) serum TC, (L) liver TC, (M) serum AST, and (N) serum ALT levels (n=3 in the control group, n=4 in the AAV-Flag-TKT group). (OU) TKT fl / fl Alb cre Phenotypic analysis after feeding mice the MCD diet for 3 weeks following tail vein injection of AAV-Flag-TKT adenovirus: (O) H&E staining, Oil Red and Sirius Red staining, and (P) serum TC, (Q) liver TC, (R) serum TG, (S) liver TG, (T) serum AST and (U) serum ALT levels (n=4). For all data, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. Two-sided t-tests are applied to C, D, I, J, K, L, M, N, P, Q, R, S, T, and U. Fig. 5: GalNAc-siRNA targeting liver TKT and its action. (A) GalNAc-siTKT injection strategy for NAFL treatment. After feeding wild-type male mice 8 weeks of age a high-fat diet for 90 days, a dorsal subcutaneous injection of 10 mg / kg of GalNAc-siTKT was administered. Five repeated injections were given on days 90+0, 3, 7, 14, and 21, and analysis was performed on day 120. (B) Expression levels of TKT protein in the liver of NAFL mice after GalNAc-siTKT treatment (n=5). (CI) Phenotypic analysis of NAFL mice after GalNAc-siTKT treatment: (C) H&E, Oil Red O staining, (D) serum TG, (E) liver TG, (F) serum TC, (G) liver TC, (H) serum ALT and (I) AST levels (n=5). (J) GalNAc-siTKT injection strategy for NASH treatment. 8-week-old wild-type male mice were injected dorsally with a dose of 10 mg / kg of GalNAc-siTKT while on an MCD diet, followed by 5 repeated injections on days 0, 3, 7, 14, and 21, and phenotypic analysis was performed on day 30. (K) Levels of TKT protein expression in the liver after GalNAc-siTKT interventional treatment in NASH mice (n=2 for NC, n=4 for siTKT). Phenotypic analysis of (LU) NASH mice after GalNAc-siTKT intervention treatment: (L) H&E, Oil Red O, Sirius Red staining, and (M) serum TG, (N) liver TG, (O) serum TC, (P) liver TC, (Q) serum ALT and (R) AST levels, (S) mRNA levels of lipid production-related genes, (T) mRNA levels of inflammation-related genes and (U) mRNA levels of fibrosis-related genes (n=4). For all data, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. Two-sided t-tests are applied to D, E, F, G, H, I, M, N, O, P, Q, R, S, T, and U. Fig. 6: GalNAc-siRNA specifically targets in mice to reduce liver TKT protein levels. (A and B) (A) protein and (B) mRNA levels of TKT after treating mouse primary hepatocytes with uncoated GalNAc-siTKT. (CH) TKT protein expression levels in (C) liver, (D) lung, (E) heart, (F) kidney, (G) spleen, and (H) adipose tissue 72 hours after subcutaneous injection of 10 mg / kg GalNAc-siTKT in wild-type mice. For all data, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. A two-sided t-test is applied in B. Fig. 7: Screening and effect analysis of homologous sequences in humans, mice, and monkeys. (A) Detection of mouse primary hepatocyte knockdown effects by a total of 49 siRNAs on human, mouse, and monkey homologous regions of the TKT gene. (BC) Detection of liver TKT knockdown effect 7 days after subcutaneous injection of GalNAc-siTKT 773 and 1115 in wild-type mice: (B) mRNA levels and (C) protein levels. (D) Changes in blood drug concentration after injecting GalNAc-siTKT1115 into wild-type mice. Fig. 8: Elevated liver TKT levels due to hyperinsulinemia. (A) Serum insulin levels after feeding wild-type mice a normal diet or a high-fat diet for 90 days (NCD group n=5, HFD group n=4). (BD) After treating wild-type mouse primary hepatocytes with 10 nM insulin, (B) TKT mRNA levels, (C) TKT, pC / EBPα, and C / EBPα protein levels, and (D) relative quantification of TKT protein (n=4). (E) Binding ability of pC / EBPα and C / EBPα to the TKT promoter after treating wild-type mouse primary hepatocytes with 10 nM insulin (n=3). (FH) After treating primary hepatocytes of liver-specific insulin receptor knockout mice with 10 nM insulin, (F) TKT mRNA levels, (G) TKT, pC / EBPα, C / EBPα protein levels, and (H) relative quantification of TKT protein (n=3). (IM) Liver-specific insulin receptor knockout mice fed a normal diet or a high-fat diet for 90 days, liver (I) TKT protein and (J) mRNA levels, liver tissue (K) H&E staining, (L) Oil Red O and (M) Sirius Red staining (n=3-4). Fig. 9: Significant accumulation of R5P and inosine in TKT-deficient hepatocytes. (A and B) (A) Principal Component Analysis (PCA) and (B) KEGG Metabolic Pathway Enrichment Analysis (n=5) of differential metabolites in primary hepatocytes of wild-type and liver-specific TKT deletion mice. (C) Heatmap of differential metabolites in the purine metabolic pathway (n=5). (D) 13C labeled inosine ( 13 C5-inosine structure diagram. (E) Primary hepatocytes from wild-type and liver-specific TKT-deficient mice at 5.6 mM 13 Metabolic flow analysis after incubation for 6 hours in a medium containing C5-inosine (n=3). (F) Isotope labeling levels of R5P, G6P / F6P, and S7P in primary hepatocytes of wild-type and liver-specific TKT deletion mice (n=3). (G) Primary hepatocytes from wild-type and liver-specific TKT-deficient mice at 15 mM 1,2 13 Analysis of Gluose and G6P / F6P labeling status after incubation in a medium containing C2-glucose for 30 minutes, analysis of Sed7P, R5P, and R1P labeling status after 6 hours, and analysis of inosine labeling status after 48 hours (n=3). (H and I) Labeling status of R5P, G6P / F6P, and S7P in primary hepatocytes of wild-type and liver-specific TKT-deleted mice (n=3). Fig. 10: TKT deletion enhances mitochondrial function through the inosine-PKA-CREB pathway. (A) Expression levels of p-PKA substrates, p-CREB, CREB, UCP1, and TKT in primary hepatocytes of wild-type and liver-specific TKT-deficient mice (n=3). (BF) Analysis of mitochondrial morphology and number in liver tissue of wild-type and liver-specific TKT deletion mice: (B) low-magnification electron microscopy image, (C) high-magnification electron microscopy image, (D) mitochondrial density, (E) mitochondrial diameter, and (F) mitochondrial surface area (n=3 in B and C, n=10 in D, n=120 in E and F). (GJ) Analysis of primary hepatocyte mitochondrial function in wild-type and liver-specific TKT deletion mice: (G) mitochondrial membrane potential, (H) ATP, (I) mitochondrial ROS (mtROS), (J) OCR levels (n=10-12 in J, K, and L, n=3 in M). (K and L) wild-type mouse primary hepatocytes after treatment with 10 nM insulin, (K) inosine and (L) OCR levels (n=6). (M) Inosine levels (n=4-6) after treatment of primary hepatocytes of wild-type, liver-specific TKT deletion and liver-specific insulin receptor deletion mice with 10 nM insulin. Fig. 11: TKT deletion enhances mitochondrial function through the inosine-PKA-CREB pathway. (A) Expression levels of p-PKA substrate, p-CREB, CREB, and UCP1 proteins (n=3) 6 hours after treating wild-type mouse primary hepatocytes with 56 μM inosine. (BD) (B) mitochondrial DNA (mtDNA) content, (C) protein and (D) mRNA expression levels of mitochondrial genes in primary hepatocytes of wild-type and liver-specific TKT deletion mice (n=4 in B and D, n=3 in C). (E) Immunofluorescence staining of TOM20 protein in liver tissue of wild-type and liver-specific TKT deletion mice (n=3). (F) Western blot analysis of p-PKA substrates and TKT proteins 6 hours after treating wild-type mouse primary hepatocytes with 56 μM inosine and 10 μM H89. (G and H) Analysis of (G) OCR, (H) ATP, and remaining respiratory capacity 6 hours after treatment with 56 μM inosine in primary hepatocytes of wild-type and liver-specific TKT-deleted mice (n=3). (I) Changes in OCR after 6 hours of treatment of wild-type mouse primary hepatocytes with 56 μM inosine and 10 μM H89 (n=3). All data: *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001. Data are expressed as mean ± SEM. Two-sided t-tests are applied in B and D. Fig. 12: Inosine upregulates PC synthesis by activating the PKA-CREB-ChoKb axis in hepatocytes. (A) Feature gene correlation matrix heatmap. Each row or each column corresponds to a module number and a feature gene containing the TKT protein. Red and blue represent positive and negative correlations, respectively. Modules 1, 3, and 7 showed Pearson correlation coefficients > 0.72 and p < 0.01. (BD) Diagram of the top 10 lipid network diagrams with the highest connectivity among (B) Module 1, (C) Module 3, and (D) Module 7. Changes in the module characteristic gene (ME) within the liver of NAFLD and healthy controls in (B) Module 1, (C) Module 3, and (D) Module 7. The upper and lower lines of the box plot represent the maximum and minimum values ​​based on the Tukey test, and the middle line represents the median. (E) Levels of six lipids in NAFLD and healthy human livers in modules 1, 3, and 7 (n=24). (F) Schematic diagram of the phosphatidylcholine synthesis pathway. (G and H) Levels of (G) phosphatidylcholine (PC) and (H) CDP-choline pathway metabolites in primary hepatocytes of wild-type and liver-specific TKT-deficient mice (n=6 in G, n=4 in H). (I and J) Levels of (I) PC and (J) OCR in primary hepatocytes (n=4 in I, n=3 in J) after feeding wild-type and liver-specific TKT deletion mice a low-choline diet (choline content 20% of the NCD diet) for 3 weeks. (K) Relative levels of CDP-choline pathway metabolites (n=3) 6 hours after treating wild-type mouse primary hepatocytes with 56 μM inosine. (L and M) mRNA and (M) protein levels of (L) ChoK in primary hepatocytes of wild-type and liver-specific TKT-deficient mice (L=4,M=2). (N) Relative levels of CDP-choline pathway metabolites 6 hours after treating wild-type mouse primary hepatocytes with 56 μM inosine and 10 μM H89 (N=3). FIG. 13: Target gene of the present invention and signaling pathways related to its upstream and downstream regulation. Fig. 14: TKT deletion increases phosphatidylcholine synthesis, thereby improving hepatocyte mitochondrial function. (A) Protein levels of PGC1a, NRF2, and DRP1 in TKT-deficient hepatocytes. (B) Lipidomic results of mitochondria in TKT-deficient hepatocytes. (CF) Levels of choline, phosphatidylcholine, CDP-choline, and PC in liver tissue of low-choline diet and normal diet mice. (GJ) Levels of hepatocyte mitochondrial membrane potential, ATP, mitochondrial ROS, and OCR in low-choline diet and normal diet mice. (KP) Levels of (K) choline, (L) PC, and (M) CDP-choline, hepatocyte (N) ATP, (O) mitochondrial membrane potential, and (P) mitochondrial ROS after feeding a low-choline diet to primary hepatocytes of wild-type and liver-specific TKT-deficient mice. Fig. 15: Modified sense strand and antisense strand prepared by considering the sense strand of siRNA according to Table 2 and its antisense strand together. Fig. 16: Modified base; here, base represents a nucleobase. Specific details for implementing the invention

[0048] The present invention identifies, for the first time, a novel target gene closely associated with the alleviation or treatment of metabolism-related fatty liver disease and signaling pathways related to its upstream and downstream regulation. The present invention discloses a novel mechanism for regulating metabolism-related fatty liver disease involving said signaling pathways. The present invention also discloses a desirable alleviating / therapeutic drug.

[0049] Transketolase (TKT) or TKT-containing insulin / InsR-C / EBPα-TKT signaling pathway and its regulation

[0050] As used in the present invention, the “(signal transmission) path” and the “(signal) path” can be used interchangeably.

[0051] As used in the present invention, the “(signal transduction) pathway” refers to a signaling system formed by mutual constraints or interactions between a series of genes or proteins or their metabolites (synthetic products or processed products), and includes interactions between pathway proteins and other elements or organelles within the cell, and sometimes includes the joint participation of upstream and downstream genes or proteins, and generally results in the occurrence of some cellular events. The insulin / InsR-C / EBPα-TKT signal transduction pathway mainly comprises TKT genes / proteins, C / EBPα genes / proteins, and InsR genes / proteins; preferably further comprises upstream and downstream regulatory genes / proteins or chemical molecules thereof.

[0052] The nucleotide sequence of the TKT gene is denoted, for example, Gene ID: 7086 (human origin), Gene ID: 21881 (mouse origin); and its protein amino acid sequence is denoted, for example, NCBI Reference Sequence: NP_001055.1 (human origin) or NCBI Reference Sequence: NP_033414.1 (mouse origin).

[0053] The nucleotide sequence of the C / EBP gene is denoted, for example, Gene ID: 1050 (human origin), Gene ID: 12606 (mouse origin); and its protein amino acid sequence is denoted, for example, NCBI Reference Sequence: NP_004355.2 (human origin), NCBI Reference Sequence: NP_031704.2 (mouse origin).

[0054] The nucleotide sequence of the InsR gene is denoted, for example, Gene ID: 3643 (human origin), Gene ID: 16337 (mouse origin); and its protein amino acid sequence is denoted, for example, NCBI Reference Sequence: NP_000199.2 (human origin), NCBI Reference Sequence: NP_034698.2 (mouse origin).

[0055] Unless otherwise specified in the present invention, protein / gene information of some upstream and downstream signaling pathways associated with the insulin / InsR-C / EBPα-TKT signaling pathway is known in the art.

[0056] A series of additional regulatory pathways exist downstream of the insulin / InsR-C / EBPα-TKT signaling pathway within hepatocytes. By downregulating the TKT or TKT-containing insulin / InsR-C / EBPα-TKT signaling pathway, the following can be further achieved: reducing inosine levels, improving mitochondrial function, further improving hepatic lipid metabolism, and alleviating or treating metabolism-related fatty liver disease. More specifically, after downregulating the TKT or TKT-containing insulin / InsR-C / EBPα-TKT signaling pathway, the entry of inosine-derived R5P into glycolysis is blocked, inosine synthesis from glucose-derived R5P is promoted, and intracellular inosine levels are increased; Furthermore, it can promote the inosine-PKA-CREB pathway, activate the PKA-CREB-ChoKb axis, increase phosphatidylcholine (PC) synthesis, improve mitochondrial function, improve liver lipid metabolism, and alleviate or treat metabolism-related fatty liver disease; preferably, the increase in phosphatidylcholine (PC) synthesis is mediated by the CDP-choline pathway.

[0057] As used in the present invention, unless otherwise specified, the discussed target gene / protein and associated signaling pathway are located within the liver (cell).

[0058] When used as a target for artificial regulation or when constructing an artificial screening system, the above proteins or coding genes may exist in their natural form, for example, by being purified and isolated from mammals; they may also be manufactured in a recombinant manner, for example, by producing recombinant proteins according to general genetic recombination techniques. Furthermore, any modified forms that do not affect the biological activity of these proteins may be used, for example, derivatives or variants whose functions have not been altered.

[0059] The above protein (polypeptide) includes variant forms thereof and comprises, but is not limited to, deletion, insertion, and / or substitution of several amino acids (typically 1 to 50, preferably 1 to 30, more preferably 1 to 20, more preferably 1 to 10, even more preferably 1 to 8, 1 to 5), and addition or deletion of one or more amino acids (typically up to 20, preferably up to 10, more preferably up to 5) at the C-terminus and / or N-terminus. Any protein having the same function as the above protein having high homology with the above protein (e.g., homology with the polypeptide sequence is 70% or more; preferably homology is 80% or more; more preferably homology is 90% or more, e.g., homology is 95%, 98%, or 99%) is also included in the present invention. The present invention further comprises a mutant form of protein or a protein cleavage, provided that said mutant protein or cleavage basically retains the function of the full-length protein.

[0060] The sequence of the above gene also includes degenerate sequences. The polynucleotides (genes) of the coding proteins may be natural genes or their degenerate sequences.

[0061] As used in the present invention, the “downward regulation (agent)” and “inhibition (agent)” may be used interchangeably and also include blocking (agent), antagonism (agent), etc.

[0062] The inventors have discovered that metabolism-related fatty liver disease can be alleviated or treated through the downregulation of TKT, C / EBPα-TKT interactions, and insulin / InsR-C / EBPα interactions in the above signaling pathway. Therefore, drugs applicable to targeted regulation can be screened or designed through these modes of action.

[0063] It should be understood that after the function of the insulin / InsR-C / EBPα-TKT signaling pathway (preferably including its upstream and downstream proteins or genes) is determined, the insulin / InsR-C / EBPα-TKT signaling pathway can be regulated using various methods well known to those skilled in the art. For example, the expression of pathway proteins can be regulated or deleted using various methods well known to those skilled in the art.

[0064] The present invention provides a method for downregulating the insulin / InsR-C / EBPα-TKT signaling pathway, the method comprising the step of implementing downregulation by performing a targeted mutation, gene editing, or gene recombination on the TKT, C / EBPα, or InsR gene within the insulin / InsR-C / EBPα-TKT signaling pathway.

[0065] In a more specific and feasible manner, a method for downregulating the expression of TKT, C / EBPα, or InsR genes is provided, said method comprising the step of transfecting a cell with an interfering molecule that interferes with the expression of TKT, C / EBPα, or InsR genes, or introducing the molecule into the cell by treating the cell through a suitable route (e.g., designing a membrane-permeable functional domain to provide membrane-permeable capability). RNA interference technology is a technique for silencing gene expression. The principle of RNA interference technology is that a relatively long double-stranded RNA is cleaved by the specific nuclease Dicer to be processed into a small interfering RNA of 21–23 nt consisting of a sense strand and an antisense strand. Subsequently, the small interfering RNA forms an RNA-induced silencing complex (RISC) and unwinds into a single strand. The antisense strand induces the silencing complex to specifically bind to a target mRNA through base pairing, thereby degrading the mRNA.

[0066] In another embodiment of the present invention, target genes are knocked down, knocked out, or downregulated by performing gene editing using a CRISPR / Cas system. Since suitable sgRNA target sites lead to higher gene editing efficiency, suitable target sites must be designed and identified before initiating gene editing. After designing specific target sites, further in vitro cell activity screening is required to obtain effective target sites for subsequent experiments. Using the above method, TKT, C / EBPα, or InsR genes can be converted into loss-of-function cleavages or mutants.

[0067] Controlling reagents and pharmaceutical compositions

[0068] As a preferred mode of the present invention, a downregulator is provided that downregulates the expression or activity of TKT, downregulates the C / EBPα-TKT interaction, or downregulates the insulin / InsR-C / EBPα interaction. The downregulator refers to a substance that reduces the activity of TKT, C / EBPα, or InsR, reduces stability, downregulates expression, reduces the level of activation (e.g., reduces phosphorylation levels), reduces the effective duration of action, and inhibits transcription and translation thereof. All such substances may be used in the present invention and are potentially useful substances for the alleviation or treatment of metabolism-related fatty liver disease. These may be compounds, chemical small molecules, or biomolecules. The biomolecules may be at the nucleic acid level (including DNA and RNA) or at the protein level.

[0069] As used in the present invention, the “metabolism-related fatty liver disease” includes fatty liver.

[0070] As used in the present invention, the “metabolism-related fatty liver disease” includes two different indications: non-alcoholic fatty liver disease and non-alcoholic steatohepatitis.

[0071] In the present invention, the downregulator may be a nucleic acid inhibitor, a protein inhibitor, an antibody, a ligand, a compound, a nuclease, a nucleic acid binding molecule, etc., and the prerequisite is that it must be able to downregulate the expression of TKT, C / EBPα, or InsR, inhibit their activity or function, inhibit C / EBPα-TKT interactions, or inhibit insulin / InsR-C / EBPα interactions. The nucleic acid inhibitor comprises an shRNA, antisense nucleic acid, small interfering RNA, microRNA, or a construct capable of expressing or forming said shRNA, antisense nucleic acid, small interfering RNA, or microRNA, which targets the coding gene of TKT, C / EBPα, or InsR or its transcript for inhibition or silencing.

[0072] For example, the downregulator is an interfering RNA molecule or antisense nucleotide that specifically interferes with TKT, C / EBPα, or InsR or their upstream gene expression; or a homologous recombination, target mutation, or gene editing reagent that specifically targets TKT, C / EBPα, or InsR or their upstream genes.

[0073] In one preferred manner of the present invention, the down-regulator is an interfering molecule that specifically interferes with TKT expression. Short hairpin RNA (shRNA) is an RNA sequence that forms a sharp curve structure and can silence genes through RNA interference. The interfering molecule that specifically interferes with the expression of TKT, C / EBPα, or InsR genes may be an shRNA molecule for TKT, C / EBPα, or InsR genes, or an siRNA molecule for TKT, C / EBPα, or InsR genes.

[0074] The inventors have performed in-depth experimental verification regarding the target TKT, and said experimental verification includes verification at the cellular and animal levels. Based on this, the inventors optimized and obtained a series of siRNA reagents exhibiting excellent effects. The siRNA is an siRNA in which the nucleotide sequence is represented by any one of SEQ ID NOs. 1 to 50 or SEQ ID NOs. 53 to 167; more preferably, the siRNA is an siRNA (siTKT10) in which the nucleotide sequence is represented by any one of SEQ ID NO. 37 (No. 1115), SEQ ID NO. 25 (No. 773), SEQ ID NO. 50 (siTKT16), SEQ ID NO. 49, SEQ ID NO. 61, SEQ ID NO. 63, SEQ ID NO. 73, SEQ ID NO. 74, SEQ ID NO. 78, SEQ ID NO. 88, or SEQ ID NO. 130. The siRNA is usable in many species, possesses highly ideal target-modulating action, is free from non-specific regulation, and has high clinical application value.

[0075] Considering that the disease targeted by the present invention is liver disease, in a preferred manner, the siRNA is prepared as a stable siRNA preparation for targeted delivery to liver cells.

[0076] In a particularly preferred embodiment, the siRNA undergoes fluoro and methoxy modifications and then covalently binds to N-acetylgalactosamine (GalNAc) to form a conjugate.

[0077] As another selectable mode of the present invention, the downregulator is an inhibitor targeting mutations, gene editing, or gene recombination of TKT, C / EBPα, or InsR. As a more specific exemplary mode, TKT, C / EBPα, or InsR is converted into a mutant thereof through any one of the methods described above so that it no longer functions.

[0078] The present invention also provides a pharmaceutical composition for the alleviation or treatment of metabolism-related fatty liver disease, said pharmaceutical composition comprising an effective amount of a downregulator according to the present invention.

[0079] As used in the text, the term “effective amount” or “effective dose” means an amount that can produce function or activity in humans and / or animals and is acceptable to humans and / or animals.

[0080] As used in the text, “pharmaceuticalally acceptable” ingredients refer to substances applied to humans and / or mammals without excessive side effects (e.g., toxicity, irritation, and allergic reactions), i.e., substances having a reasonable benefit-risk ratio. The term “pharmaceuticalally acceptable carrier” refers to a carrier used for administering a therapeutic agent and includes various excipients and diluents.

[0081] The present invention also provides a medicine kit for the alleviation or treatment of metabolism-related fatty liver disease, said medicine kit comprising an effective amount of a downregulator according to the present invention. More preferably, said medicine kit includes instructions for use to guide a clinician in using the drug in a correct and reasonable manner.

[0082] For convenience of administration, the downregulator is manufactured in the form of a unit formulation and placed in a reagent kit. “Unit formulation” refers to a formulation of the drug prepared for a single dose for the convenience of drug use, and includes, but is not limited to, various liquids (e.g., injectables), solids (e.g., tablets), capsules, and sustained-release formulations. In addition, the downregulator may be contained independently in different containers or mixed and used as needed.

[0083] In a specific embodiment of the present invention, a method of administration to animals (e.g., mice) is presented. However, it should be understood that converting the dosage for animals (e.g., mice) to the dosage applicable to humans is readily conceivable by those skilled in the art and can be calculated, for example, according to the Meeh-Rubner formula: Meeh-Rubner formula: A=k´(W 2 / 3 ) / 10,000. In the formula, A is the body surface area, and m 2 Calculated as follows; W is body weight, calculated in g; K is a constant, varying by animal species, e.g., mouse and rat 9.1, guinea pig 9.8, rabbit 10.1, cat 9.9, dog 11.2, monkey 11.8, human 10.6, etc., but is not limited thereto. It should be understood that the dosage may vary depending on the drug and clinical situation, based on the evaluation of a skilled pharmacist.

[0084] InsR-C / EBPα-TKT signaling pathway-based drug screening

[0085] Based on the inventors' novel findings, research on the (insulin / )InsR-C / EBPα-TKT signaling pathway has various applications, which include screening substances that regulate said signaling pathway for the alleviation or treatment of metabolism-related fatty liver disease. Here, said regulation includes TKT downregulation, C / EBPα-TKT interaction downregulation, insulin / InsR-C / EBPα interaction downregulation, etc.

[0086] The present invention provides a screening method for downregulators that regulate the InsR-C / EBPα-TKT signaling pathway. The method involves adding a candidate substance to be screened to a system containing the InsR-C / EBPα-TKT signaling pathway and screening by observing changes or interactions of each protein or gene within the InsR-C / EBPα-TKT signaling pathway. If the candidate substance exhibits actions such as TKT downregulation, downregulation of the C / EBPα-TKT interaction, or downregulation of the insulin / InsR-C / EBPα interaction, the candidate substance is a useful substance for the alleviation or treatment of metabolism-related fatty liver disease.

[0087] As used in the text, the above “inhibition,” “downregulation,” etc. all refer to “inhibition” or “downregulation” having a statistical meaning. That is, significant “inhibition” or “downregulation.” Compared to the protein activity, protein expression, protein binding, or degree of methylation of the control group, the degree of significant “inhibition” or “downregulation” is 10%, 20%, 30%, 40%, 50% or more; more preferably 60%, 70%, 80% or more.

[0088] The system comprising the InsR-C / EBPα-TKT signaling pathway is selected from a cell system (or cell culture system), an organelle system (or organelle culture system), a solution system, an animal system, or a tissue system (or tissue culture system). Preferably, the system comprising the InsR-C / EBPα-TKT signaling pathway is a hepatocyte (or cell culture).

[0089] As a preferred mode of the present invention, the method further comprises the step of performing additional cell experiments and / or animal experiments on the acquired potential substances to further select and determine from the candidate substances a substance useful for the alleviation or treatment of metabolism-related fatty liver disease.

[0090] During screening, various techniques well known in this field can be used to determine the changes and interactions of proteins or their coding genes.

[0091] The transcription or expression status of genes within a system can be identified using various general techniques. These techniques include, but are not limited to, oligonucleotide hybridization techniques (e.g., probes), polymerase chain reaction (PCR), and polyacrylamide gel electrophoresis. For the detection of protein-protein interactions and the intensity of such interactions, various techniques well known to those skilled in the art, such as co-immunoprecipitation, GST precipitation, phage display, or yeast protein hybridization, may be used. Nuclear localization of proteins is also a technique well known in the art.

[0092] The substances pre-screened through the method described above can form a screening library, thereby enabling people to screen for substances that are ultimately useful for the alleviation or treatment of metabolism-related fatty liver disease.

[0093] The present invention also provides a potential substance obtainable using the screening method above, which can be used for the alleviation or treatment of metabolism-related fatty liver disease.

[0094] The present invention also provides a method for manufacturing a drug for the alleviation or treatment of metabolic-related fatty liver disease (particularly for the alleviation or treatment of metabolic-related fatty liver disease), wherein the method comprises the step of synthesizing and / or purifying a substance useful for the alleviation or treatment of metabolic-related fatty liver disease obtained through the aforementioned screening and using it as a drug for the alleviation or treatment of metabolic-related fatty liver disease.

[0095] As described below in the present invention, a substance useful for the alleviation or treatment of acquired metabolism-related fatty liver disease can be used in the preparation of a pharmaceutical composition.

[0096] Methods for screening substances acting on a target by targeting a protein, a gene, or a specific region thereof are well known in the art, and all such methods can be used in the present invention. The candidate substances may be selected from peptides, polymerized peptides, peptide mimics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, organic small molecules, inorganic small molecules, and nucleic acid sequences. Those skilled in the art clearly know how to select an applicable screening method depending on the type of substance to be screened.

[0097] Application of diagnosis or prognosis evaluation

[0098] In this invention, it was discovered that the upregulation of TKT in the liver is a common characteristic of human and mouse NAFLD, that the upregulation of TKT promotes the progression of mouse NAFLD, and that the upregulation of TKT promotes non-alcoholic steatohepatitis (NASH) and the involvement of TKT in a novel signaling pathway: the insulin / InsR-C / EBPα-TKT signaling pathway. Therefore, TKT and the signaling pathways involved can be used as molecular markers to guide the diagnosis or prognosis (including drug use guidelines) of metabolism-related fatty liver disease for the following purposes: (i) classification of the disease and differential diagnosis; (ii) evaluation of therapeutic drugs, drug efficacy, and prognosis for relevant populations, and selection of appropriate treatment methods. For example, a population with abnormal (increased) TKT gene expression can be isolated to perform more targeted treatment.

[0099] By determining the expression or activity status of TKT or pathway genes / proteins of signaling pathways involved therein in the sample to be evaluated, the disease prognosis of the subject who provided the sample can be predicted, and an appropriate drug can be selected to administer treatment. Typically, a threshold for TKT expression can be established, and if TKT expression is higher than the established threshold, treatment using TKT inhibition is considered. The threshold can be easily determined by a person skilled in the art; for example, a threshold above the TKT expression level can be obtained after comparing and analyzing the typical TKT expression status of patients with metabolic fatty liver disease with that of healthy individuals.

[0100] Accordingly, the present invention provides a use for TKT or pathway genes / proteins of signaling pathways involved therein, and is used in the manufacture of reagents or reagent kits for the prognostic evaluation of metabolism-related fatty liver disease. Various techniques known in the art can be used to detect the presence and expression status of the corresponding genes or proteins, and all such techniques are included in the present invention. For example, existing techniques such as Southern blot, Western blot, DNA sequencing, and PCR can be used, and these methods can be combined. The present invention also provides a reagent for detecting the presence and expression status of genes or proteins within an analyte. Preferably, when performing gene-level detection, the presence of a target gene can be determined using specific amplification primers or specific recognition probes; and when performing protein-level detection, the expression status of a target protein can be determined using antibodies or ligands that specifically bind to the protein.

[0101] The above reagent kit may further include various reagents necessary for DNA extraction, PCR, hybridization, color development, etc., and includes, but is not limited to, extractants, amplification solutions, hybridization solutions, enzymes, control solutions, colorimetric solutions, washing solutions, etc. Additionally, the above reagent kit may further include an instruction manual and / or nucleic acid sequencing software, etc.

[0102] The present invention is further described below by combining specific examples. It should be understood that these examples are intended to illustrate the invention and not to limit the scope of the invention. In the following examples, experimental methods for which specific conditions are not specified are typically performed under general conditions, such as those described in J. Sambrook et al., *Molecular Cloning: Laboratory Manuals*, 3rd ed., Science Press, or under conditions recommended by the manufacturer.

[0103] Example 1. Characteristics of TKT expression in liver tissue

[0104] Liver samples were obtained from patients with non-alcoholic fatty liver disease (NAFLD) or healthy liver transplant donors, and the sample source information is as shown in Figure 2A. Based on the clinicopathological diagnosis, they were classified into the NAFLD group (HS) and healthy control group (Control).

[0105] Metabolomics analysis showed that the pentose phosphate pathway (PPP) in NAFLD liver was significantly altered compared to the control group (Fig. 1A).

[0106] According to additional proteomic analysis of PPP and glycolysis enzymes, the non-oxidative PPP metabolic enzyme TKT showed the most significant difference between NAFLD liver and control group (Fig. 1B).

[0107] Western blot and quantitative PCR analyses were performed on the expression status of the non-oxidative PPP metabolic enzyme TKT. The results showed that TKT was significantly upregulated in NAFLD livers (Fig. 1C-E).

[0108] Immunohistochemical (IHC) analysis was performed on a randomly selected group of human liver samples (n=6), and the results showed that TKT staining was darker in the NAFLD group than in the healthy control group (Fig. 1F).

[0109] Additionally, NAFLD was induced in wild-type mice by feeding them a high-fat diet (HFD). Here, the HFD group mice were fed a high-fat diet daily and allowed to eat freely, while the control NCD group mice were fed a normal diet daily and allowed to eat freely. This simulated the onset and progression of NAFLD in human patients, and lipid accumulation in the mice liver and TKT upregulation were observed after 3 months (Fig. 1G-J).

[0110] Therefore, these findings suggest that the upregulation of intrahepatic TKT is a common characteristic of human and mouse NAFLD.

[0111] Example 2. Upregulation of TKT promotes progression of mouse NAFLD

[0112] 1. Upregulation of intrahepatic TKT promotes non-alcoholic fatty liver (NAFL)

[0113] To investigate whether the upregulation of TKT promotes the progression of NAFLD, an adenovirus (adeno-associated virus, AAV)-mediated gene overexpression system was established to overexpress TKT in mouse livers.

[0114] When AAV-Flag-TKT was injected into the tail vein of mice, the level of TKT in the liver significantly increased (Fig. 1K and Fig. 2B).

[0115] After feeding mice HFD for 10 weeks, mice injected with AAV-Flag-TKT showed more severe hepatic steatosis (Fig. 1L and Fig. 2C) and higher liver and serum triglyceride levels (Fig. 1M).

[0116] Hepatic TKT overexpression also increased blood total cholesterol (TC), serum alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels in mice (Fig. 2D).

[0117] These results suggest that the upregulation of TKT in the liver promotes non-alcoholic fatty liver (NAFL) induced by a high-fat diet.

[0118] 2. Upregulation of intrahepatic TKT promotes non-alcoholic steatohepatitis (NASH).

[0119] Methionine and choline deficiency (MCD) diets are commonly used to induce mouse NASH, which is a progressive form of NAFLD. Mice were fed the MCD diet daily (free intake), and various indicators were observed in the AAV-Flag-TKT injection group and the control group (AAV-ctrl).

[0120] According to the results, after 4 weeks of MCD diet, mice injected with AAV-Flag-TKT showed more severe hepatocyte ballooning, lipid accumulation, inflammation, and fibrosis compared to the control group (Fig. 2E), along with elevated levels of liver triglycerides (TG) and total cholesterol (TC), and serum aspartate aminotransferase (AST) (Fig. 2F), suggesting that animals injected with AAV-Flag-TKT showed more pronounced NASH progression compared to the control group.

[0121] Therefore, the upregulation of intrahepatic TKT significantly accelerates the progression of NAFL and NASH.

[0122] Example 3. Hepatocyte-specific TKT knockout improves mouse NAFLD

[0123] 1. Downregulation of intrahepatic TKT improves non-alcoholic fatty liver (NAFL)

[0124] To investigate whether TKT is important for the progression of NAFLD, hepatocyte-specific TKT-deficient mouse breeds (TKT flox / flox Alb cre , abbreviated as TKT fl / fl Alb cre ) was constructed.

[0125] TKT flox / flox Alb cre Construction of mice: The mouse breed is C57BL / 6, and TKT was created by inserting LoxP regions between exons 1 and 2, and between exons 2 and 3 of the mouse TKT gene. flox / flox A mouse breed was obtained (Fig. 3S), and then this breed was crossed with AlbCre mice to obtain TKT flox / flox Alb cre I got a mouse.

[0126] TKT + / + Alb cre Mouse construction: Wild-type C57BL / 6 mice were crossed with AlbCre mice to form TKT + / + Alb cre I got a mouse.

[0127] Under normal diet (NCD) conditions, TKT flox / flox Alb cre The mouse exhibited normal liver morphology and function. TKT flox / flox Alb cre and TKT + / + Alb cre Mice were fed a high-fat diet (HFD) for 90 days. Obesity TKT + / + Alb cre Compared to a mouse, TKT flox / flox Alb cre The mice had a slower rate of body weight gain (Fig. 4A). After feeding HFD for 90 days, compared to control mice, TKT flox / flox Alb cre The mice had lower body weight and liver weight (Fig. 4B-D).

[0128] TKT supplied with HFD flox / flox Alb cre Mice exhibited milder hepatic steatosis compared to the control group, which was confirmed by magnetic resonance imaging (MRI), liver external images, H&E, and Oil Red O staining results (Fig. 3A-C).

[0129] Also, TKT flox / flox Alb creLiver triglyceride (TG) levels, serum triglycerides (TG), total cholesterol (TC), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in mice were all lower than in the control group (Fig. 3D-H), while liver total cholesterol showed no change (Fig. 3I).

[0130] Therefore, mouse hepatocyte-specific TKT deletion can significantly improve HFD-induced mouse NAFL.

[0131] 2. Downregulation of intrahepatic TKT alleviates non-alcoholic steatohepatitis (NASH).

[0132] We investigated whether hepatocyte-specific TKT knockout could alleviate NASH induced by the MCD diet. Mice were fed the MCD diet, and TKT-deficient mice (TKT flox / flox Alb cre ) and control mice (TKT + / + Alb cre The progression of the disease of ) was observed.

[0133] After 4 weeks of MCD diet, intrahepatic TKT deletion mice (TKT flox / flox Alb cre Hepatic lipid accumulation was significantly reduced (Fig. 3J, K), and there was no change in the mRNA level of the lipid synthesis enzyme gene (Fig. 3L).

[0134] TKT flox / flox Alb cre Mice had significantly less infiltration of inflammatory cells into the liver compared to the control group (Fig. 3M, N), and inflammation-related genes were downregulated (Fig. 3O).

[0135] The MCD diet induced severe fibrosis in the liver of the control group, which was confirmed by Sirius Red staining and Masson staining, and intrahepatic TKT knockout alleviated this condition (Figs. 3P and 4E).

[0136] In addition, TKT deletion also reduced hepatocyte necrosis associated with NASH progression (Fig. 4F).

[0137] Therefore, TKT deficiency in hepatocytes can improve NAFL and NASH in mice.

[0138] 3. The role of intrahepatic TKT in NAFLD progression

[0139] To further demonstrate that TKT is a driving factor of NAFLD, TKT was used with an adenovirus overexpression system flox / flox Alb cre TKT was re-expressed in the livers of mice. Liver-specific TKT-deficient mice (TKT flox / flox Alb cre After establishing HFD-induced NAFL and MCD-induced NASH models in ), the adenoviruses AAV-Flag-TKT and AAV-Ctrl were injected into the tail vein, respectively.

[0140] During the HFD administration process, the re-expression of TKT in the liver promoted hepatic lipid accumulation (Fig. 4G, H) and increased serum and hepatic triglycerides, total cholesterol levels, and serum ALT and AST levels (Fig. 4I-N).

[0141] Consistent with this, the re-expression of TKT in the liver reversed MCD-induced hepatic lipid accumulation and fibrosis, and upregulated hepatic triglyceride and cholesterol levels, as well as serum ALT and AST levels (Fig. 4P-U).

[0142] In summary, it can be seen that the upregulation of intrahepatic TKT is a necessary and sufficient condition for the progression of mouse NAFLD.

[0143] Example 4. Analysis of the regulatory action of TKT in the liver and the regulatory pathways involved.

[0144] 1. Insulin-InsR signaling drives TKT upregulation and lipid accumulation in NAFLD progression

[0145] The inventors investigated the mechanism of TKT upregulation in NAFLD livers, as NAFLD is typically associated with hyperinsulinemia and insulin resistance. When mice were fed HFD, an increase in serum insulin levels was observed (Fig. 8A). In insulin-treated primary hepatocytes, the increase in TKT mRNA and protein levels reached a peak at 40 minutes and then gradually decreased (Figs. 8B-D), accompanied by fluctuations in the levels of the phosphorylated transcription factor CCAAT / enhanced binding protein a (C / EBPα) (Fig. 8C). Analysis suggests that C / EBPα is a candidate transcription factor for the TKT gene promoter.

[0146] Through chromatin immunoprecipitation (ChIP), it was demonstrated that insulin enhances the binding ability of phosphorylated C / EBPα via InsR and the 643-795 bp region upstream of the TKT promoter (Fig. 8E).

[0147] To further investigate the role of the insulin receptor (InsR) in insulin-induced TKT expression, a mouse breed (InsR flox / flox Alb cre ) was manufactured, and InsR in hepatocytes was specifically removed.

[0148] InsR flox / flox Alb cre Mouse construction: Purchased from The Jackson Laboratory.

[0149] InsR flox / flox Alb cre Primary hepatocytes did not show changes in TKT and phosphorylated C / EBPα induced by insulin stimulation (Figs. 8F-H), suggesting that insulin promotes TKT expression through InsR. Subsequently, InsR via HFD flox / flox Alb cre As a result of rearing mice, HFD not only did not increase liver TKT mRNA and protein levels (Fig. 8I, J), but InsR - / -It did not induce significant lipid accumulation or fibrosis in the livers of mice (Fig. 2K-M).

[0150] Therefore, during the progression of NAFLD, insulin-InsR signaling drives TKT upregulation and lipid accumulation.

[0151] 2. Significantly increased accumulation of R5P and inosine in TKT-deficient hepatocytes

[0152] TKT flox / flox Alb cre and TKT + / + Alb cre Primary hepatocytes were isolated from mice and metabolomics analysis was performed, and PCA results showed a significant difference between the two groups (Fig. 9A).

[0153] Through metabolic pathway enrichment, it was discovered that TKT deficiency significantly altered the purine metabolic pathway and also altered the PPP (Fig. 9B). TKT deficiency upregulated nucleoside levels, e.g., inosine, adenosine, deoxyadenosine, and particularly inosine levels (Fig. 9C). Inosine is reported to not only provide ribose as an alternative carbon source for central carbon metabolism via the PPP, but also to promote mitochondrial function in adipose tissue as an extracellular signal through the cAMP-PKA-UCP1 pathway.

[0154] Next, we investigated how TKT deficiency regulates hepatic inosine metabolism. 13 C5] TKT using inosine flox / flox Alb cre and TKT + / + Alb cre Mouse primary hepatocytes were cultured, and ribosman 13 It contains C and was used for metabolic flow analysis.

[0155] As a result, [ 13It was demonstrated that [C5]-labeled inosine can be uptaken by primary hepatocytes without interference from TKT deletion (Fig. 9D, inosine). TKT deficiency blocked carbon transfer between R5P, S7P, and F6P, increasing the relative abundance of inosine-derived R5P (Fig. 9F) and decreasing the relative abundance of F6P and S7P (Fig. 9F). An increase in R5P levels can reduce the isotopic labeling efficiency of R1P and R5P by inhibiting the degradation rate of PNP enzymes (Fig. 9E). These results suggest that hepatocyte TKT deficiency inhibits the entry of inosine-derived pentoses into central carbon metabolism by blocking non-oxidative PPP.

[0156] In hepatocytes, glucose is metabolized via PPP to produce R5P, which is used for the resynthesis of IMP, and IMP is dephosphorylated to produce inosine. Next, we investigated how TKT deficiency affects glucose-derived inosine synthesis. [1, 2- 13 C2] TKT as glucose flox / flox Alb cre and TKT + / + Alb cre Glucose metabolic flow analysis was performed on primary hepatocytes treated with the TKT. Considering the two reactions catalyzed by TKT, TKT deletion inhibited carbon transfer between F6P and X5P, increasing the relative abundance and isotope labeling efficiency of F6P (Figs. 9G and 9H), but decreasing the relative abundance and isotope labeling efficiency of S7P (Fig. 9I). Additionally, the major isotope labeling form of R5P shifted from M+2 to M+1 (Fig. 9I), suggesting that compensatory oxidative PPP can generate R5P at higher abundances (Fig. 9H). Collectively, the accumulation of R5P in TKT-deficient hepatocytes provided more pentose sugars for inosine synthesis, thereby elevating inosine levels (Fig. 9C).

[0157] In summary, hepatocyte TKT deficiency not only blocks the entry of inosine-derived R5P into glycolysis but also promotes the synthesis of inosine from glucose-derived R5P, ultimately increasing intracellular inosine levels.

[0158] 3. TKT deletion enhances mitochondrial function through the promotion of the inosine-PKA-CREB pathway.

[0159] Inosine is reported to promote energy consumption in adipose tissue through the PKA-CREB-UCP1 pathway.

[0160] Next, the inventors investigated the action of inosine in hepatocytes. When wild-type primary hepatocytes were treated with inosine, inosine activated the PKA-CREB signaling pathway but did not increase UCP1 protein expression (Fig. 11A). Interestingly, TKT flox / flox Alb cre Increased activity of the PKA-CREB axis was observed in hepatocytes, which was consistent with inosine accumulation due to TKT deletion (Fig. 10A). The inventors further investigated whether TKT deletion affects the mitochondrial morphology and function of hepatocytes.

[0161] TKT-deficient hepatocytes had higher mitochondrial DNA content (Fig. 11B) and higher mRNA and protein levels of mitochondrial genes such as ATP6, Mt-Co1 / 2 / 3, Mt-Nd1 / 2 / 3 / 4 / 5 / 6, Cytb, Ndufa12, and Tom20 (Figs. 11C-E). Transmission electron microscopy of liver tissue showed that TKT deficiency increased mitochondrial density, diameter, and surface area (Figs. 10B-F). TKT-deficient hepatocytes exhibited higher mitochondrial membrane potential, ATP production capacity, and mitochondrial ROS levels (Fig. 10g-1). Seahorse experiments showed that the oxygen consumption rate (OCR) of TKT-deficient hepatocytes increased (Fig. 10J).

[0162] The inventors discovered that inosine treatment promotes mitochondrial activity in hepatocytes, and that the effect is more pronounced in TKT-deficient hepatocytes. After the addition of inosine, the OCR levels, ATP production capacity, and respiration reserve capacity of TKT-knockout hepatocytes were significantly upregulated (Fig. 11G, H). Thus, TKT deficiency promotes mitochondrial activity and sensitivity to inosine stimulation in hepatocytes, and improves liver lipid metabolism.

[0163] To determine whether inosine enhances hepatic mitochondrial function via the PKA-CREB pathway, hepatocytes were treated with the PKA inhibitor H89. As expected, H89 TKT flox / flox Alb cre and TKT + / + Alb cre It effectively reduced phosphorylated PKA substrate levels in primary hepatocytes (Fig. 11F). Importantly, inosine could not upregulate mitochondrial function in primary hepatocytes treated with H89 (Fig. 11I).

[0164] Hyperinsulinemia is reported to interfere with mitochondrial function. The inventors discovered that insulin reduces intracellular inosine levels (Fig. 10K) and inhibits mitochondrial activity in WT primary hepatocytes (Fig. 10L). To investigate whether InsR and TKT play a significant role in the insulin-induced reduction of inosine, InsR flox / flox Alb cre , TKT flox / flox Alb cre Primary hepatocytes were isolated from mice and control mice, and it was found that insulin did not affect inosine levels in InsR or TKT-deficient hepatocytes (Fig. 10M).

[0165] 4. TKT deficiency promotes hepatocyte mitochondrial function through increased phosphatidylcholine (PC) synthesis.

[0166] To study the regulatory mechanisms of mitochondrial morphological and functional changes caused by TKT deficiency in hepatocytes, the inventors TKT flox / floxAlb cre and TKT + / + Alb cre The levels of PGC1a, NRF2, and DRP1 were compared in primary hepatocytes, and these genes regulate mitochondrial fission and fusion. However, TKT deletion did not alter the levels of PGC1a, NRF2, and DRP1 in hepatocytes (Fig. 14A).

[0167] It has been reported that changes in cellular lipid composition can affect mitochondrial morphology and function. Therefore, lipidomics analysis was performed on human liver samples (n=48) to identify candidate lipids that may be altered by TKT deletion and affect mitochondrial function. Approximately 700 lipids were identified into 10 classes. All lipids were divided into 15 modules using weighted gene co-expression network analysis (WGCNA) (Fig. 12A), and the correlations between these modules and TKT protein levels were analyzed. Three lipid modules showed a negative correlation with TKT protein levels, with Pearson correlation coefficients > 0.8 and p-values ​​< 0.01 (Fig. 12A).

[0168] Through the analysis of the central lipids of these three modules, six lipids were identified, including PC, sphingomyelin (SM), n-acylethanolamine (NAE), ceramide (Cer), TG, and diacylglycerol (DG) (Figs. 12B-D). PC is the most abundant phospholipid in the mitochondrial membrane and is also the lipid most significantly downregulated in NAFLD patients (Fig. 12e).

[0169] Furthermore, TKT deletion in mouse hepatocytes upregulated PC (Fig. 12G). Intracellular PC synthesis occurs via the phosphatidylethanolamine (PE) methylation pathway or the CDP-choline pathway (Fig. 12F), and PC is crucial for mitochondrial function. According to the inventors' lipidomics studies, mitochondrial PC levels, rather than PE levels, were upregulated in TKT-deficient hepatocytes (Fig. 14B), suggesting that the PE methylation pathway, which relies on PE supply, was not disrupted. The CDP-choline pathway, the primary pathway for intracellular PC synthesis, generated 60–70% of the total intracellular PC amount. In addition to PC, TKT flox / flox Alb cre In primary hepatocytes, the levels of CDP-choline pathway metabolites, including choline, phosphatidylcholine, and CDP-choline, were all upregulated (Fig. 12H), suggesting that TKT deficiency promotes the CDP-choline pathway to improve mitochondrial PC levels.

[0170] To investigate whether intracellular PC levels are critical to mitochondrial function in mouse hepatocytes, the inventors reduced dietary choline intake by 80% to limit PC biosynthesis. After 3 weeks of the low-choline diet, hepatic choline, phosphatidylcholine, CDP-choline, and PC levels were all reduced compared to the normal diet group (Figs. 14C-F). Importantly, low choline intake impaired mitochondrial membrane potential, ATP production capacity, mitochondrial ROS, and OCR levels in hepatocytes (Figs. 14G-J). Furthermore, the choline-restricted diet [affected] TKT flox / flox Alb cre and TKT + / + Alb cre Differences in CDP-choline pathway metabolite levels (Fig. 12I and Fig. 14K-M) and mitochondrial activity (Fig. 12J and Fig. 14N-P) between primary hepatocytes were eliminated.

[0171] The above results suggest that liver TKT deficiency increases intracellular PC synthesis, thereby enhancing mitochondrial activity and improving liver lipid metabolism.

[0172] 5. Inosine stimulates PC synthesis by activating the PKA-CREB-ChoKb axis in hepatocytes.

[0173] Next, we investigated whether inosine regulates PC synthesis in hepatocytes and how it does so. Inosine upregulated the levels of CDP-choline pathway metabolites in WT primary hepatocytes (Fig. 12K). Choline kinase is a key enzyme of the CDP-choline pathway that catalyzes the first step of the CDP-choline pathway. Compared to the control group, TKT flox / flox Alb cre The mRNA and protein levels of ChoKb in primary hepatocytes increased (Fig. 12L, M).

[0174] Predicting potential transcription factors of ChoKb using PROMO revealed that CREB can regulate the transcriptional activity of ChoKb. Importantly, the PKA inhibitor H89 eliminated inosine-induced CDP-choline pathway activity (Fig. 12N).

[0175] These data suggest that the accumulation of inosine in TKT-deficient mouse hepatocytes activates the PKA-CREB-ChoKb pathway, promoting intracellular PC synthesis and mitochondrial function and improving liver lipid metabolism.

[0176] In summary, a high-fat diet can induce hyperinsulinemia and reduce inosine levels in hepatocytes by promoting TKT expression through the insulin receptor (InsR)-transcription factor CCAAT / enhanced binding protein α (C / EBPα) pathway. On the other hand, TKT deletion promotes hepatic inosine levels, and the accumulation of inosine activates the PKA-CREB-ChoKb pathway, promoting intracellular PC synthesis and mitochondrial function (Fig. 13).

[0177] Example 5. Development and function of GalNAc-siRNA targeting liver TKT

[0178] 1. Development of GalNAc-siRNA and Hepatocyte TKT Regulation

[0179] Methods such as targeted knockout require genome modification and pre-embryonic processing, so they lack practicality in terms of clinical treatment. To explore the potential of targeting liver TKT for NAFLD treatment, the inventors performed screening and research analysis to obtain two siRNA reagents.

[0180] siTKT10 sequence:

[0181] Sense: CCGUGGACAUUGCUAACAUTT (Sequence No. 49);

[0182] Antisense: AUGUUAGCAAUGUCCACGGTT (Sequence No. 51).

[0183] siTKT16 sequence:

[0184] Sense: GCUGCAGAGAGUCUAAAGATT (Sequence No. 50);

[0185] Antisense: UCUUUAGACUCUCUGCAGCTT (Sequence No. 52).

[0186] siNC sequence: irrelevant sequence.

[0187] The 3' end of the siRNA sense strand was covalently bonded with N-acetylgalactosamine (GalNAc), and the preparation method used was a solid-phase bonding synthesis method using a CPG carrier.

[0188] The GalNAc group is specifically recognized by the receptor ASGPR on the liver cell membrane, allowing the siRNA double strand to be introduced into the cell together; thus, the covalently bonded product enables the targeted delivery of siRNA to liver cells. Two GalNAc conjugates of siTKT, GalNAc siTKT10 and GalNAc siTKT16, were obtained, and GalNAc siNC was prepared as a control.

[0189] GalNAc conjugates of two siTKTs can effectively knock down TKTs in mouse primary hepatocytes without lipid nanoparticle (LNP) coating (Fig. 6A, B).

[0190] The inventors conducted in vivo experiments with mice using GalNAc-siTKT16, and subcutaneously injected GalNAc-siTKT16 was able to reduce TKT protein levels in the liver but did not affect other tissues (Fig. 6C-H).

[0191] The structure of GalNAc-siTKT16 is as follows:

[0192] AS (Antisense):

[0193] UmCfUmUmUmAfGmAmCmUmCmUmCmUfGmCfAmGmCmAmGmCmCm;

[0194] SS (Sense):

[0195] CmUmGmCmUmGmCfAmGfAfGfAmGmUmCmUmAmAmAmGmAm-L96.

[0196] Therefore, GalNAc-siRNA targeting liver TKT exhibits distinct TKT downregulation and excellent specific regulatory activity, thus possessing the ability to effectively improve NAFL and NASH.

[0197] 2. Action of GalNAc-siTKT on NAFL

[0198] The therapeutic effect of GalNAc-siTKT on NAFL was investigated at the animal level. After supplying HFD to mice for 90 days, GalNAc-siTKT was injected subcutaneously once each on days 3, 7, 14, and 21 (Fig. 5A), and analysis was performed on day 30.

[0199] According to the results, GalNAc-siTKT was found to significantly reduce TKT levels in the liver (Fig. 5B), reduce liver lipid accumulation (Fig. 5C), reduce serum and liver triglyceride and total cholesterol levels (Figs. 5D-G), and reduce serum ALT and AST levels (Figs. 5H, I).

[0200] 3. Therapeutic effects of GalNAc-siTKT on NASH

[0201] The preventive potential of GalNAc-siTKT against MCD-induced mouse NASH was further investigated. GalNAc-siTKT (10 mg / kg) was administered once subcutaneously at the onset of MCD, followed by one injection each on days 3, 7, 14, and 21 (Fig. 5J).

[0202] On day 30, GalNAc-siTKT was shown to reduce intrahepatic TKT levels (Fig. 5K), alleviate hepatic steatosis, and improve liver fibrosis (Fig. 5L). GalNAc-siTKT intervention also reduced serum and hepatic triglycerides, total cholesterol levels (Fig. 5M-P), and serum ALT and AST levels (Fig. 5Q, R).

[0203] In addition, GalNAc-siTKT treatment reduced the levels of genes related to inflammation and fibrosis but did not affect fatty acid synthesis genes (Fig. 5S-U).

[0204] In summary, GalNAc-siTKT specifically targets intracellular TKTs to significantly improve NAFL and NASH, and provides a therapeutic strategy for the treatment of human NAFLD.

[0205] Example 6. Screening and Effect Analysis of Human, Mouse, and Monkey Homologous Sequences

[0206] To obtain siTKT sequences with optimal knockdown effects, the inventors performed whole-sequence screening and experimental analysis on human, mouse, and monkey homologous regions of the TKT gene; simultaneously, other gene sequences within the whole genome were also considered to exclude non-specific responses. Approximately 48 siRNAs were obtained through primary screening from a large number of candidate siRNAs (Table 1).

[0207] number Sense (5-3) Sequence number number Sense (5-3) Sequence number 52 GCUCCAUCCAGGCCACCACUU 1 780 GCCAACAGCCAUCAUUGCCUU 26 214 GAGAUCAUGGCUGUCCUCUUU 2 784 ACAGCCAUCAUUGCCAAGAUU 27 279 CAAUGACCGCUUUGUGCUCUU 3 785 CAGCCAUCAUUGCCAAGACUU 28 281 AUGACCGCUUUGUGCUCUCUU 4 787 GCCAUCAUUGCCAAGACCUUU 29 302 AGGGCCAUGCAGCUCCCAUUU 5 791 UCAUUGCCAAGACCUUCAAUU 30 327 CGCGGUCUGGGCUGAAGCUUU 6 794 UUGCCAAGACCUUCAAGGGUU 31 360 GGCGGAGCUGCUGAACCUGUU 7 800 AGACCUUCAAGGGCCGAGGUU 32 366 GCUGCUGAACCUGAGGAAGUU 8 803 CCUUCAAGGGCCGAGGGAUUU 33 375 ACCUGAGGAAGAUCAGCUCUU 9 1020 GAUAGCCACCCGCAAGGCCUU 34 435 UGUGGCCACUGGCUCCCUGUU 10 1059 GCUGGGCCAUGCCAGUGACUU 35 510 GGCCAGCUACCGAGUCUAUUU 11 1110 UUCCACCUUCUCGGAGAUCUU 36 519 CCGAGUCUAUUGCUUGCUGUU 12 1115 CCUUCUCGGAGAUCUUCAAUU 37 523 GUCUAUUGCUUGCUGGGAGUU 13 1292 UCUCCGAGAGCAACAUCAAUU 38 528 UUGCUUGCUGGGAGACGGGUU 14 1478 UCUGCUUCAUCCGGACCAGUU 39 666 GCACCAGAUGGACAUCUACUU 15 1526 ACAAUGAGGACUUCCAGGUUU 40 669 CCAGAUGGACAUCUACCAGUU 16 1542 GGUCGGACAAGCCAAGGUGUU 41 672 GAUGGACAUCUACCAGAAGUU 17 1549 CAAGCCAAGGUGGUCCUGAUU 42 719 UCAUCGUGGAUGGACACAGUU 18 1551 AGCCAAGGUGGUCCUGAAGUU 43 722 UCGUGGAUGGACACAGCGUUU 19 1552 GCCAAGGUGGUCCUGAAGAUU 44 729 UGGACACAGCGUGGAGGAGUU 20 1556 AGGUGGUCCUGAAGAGCAAUU 45 733 CACAGCGUGGAGGAGCUGUUU 21 1557 GGUGGUCCUGAAGAGCAAGUU 46 735 CAGCGUGGAGGAGCUGUGCUU 22 1737 GGGCAGGAUCCUCACCGUGUU 47 737 GCGUGGAGGAGCUGUGCAAUU 23 1741 GGAUCCUCACCGUGGAGGAUU 48 768 GGCCAAGCACCAGCCAACAUU 24 773 AGCACCAGCCAACAGCCAUUU 25

[0208] As a result of comparing mRNA and protein knockdown effects in mouse primary hepatocytes and human LO2 cell lines, sequences 773 and 1115 were selected as exhibiting the best knockdown effect (Fig. 7A).

[0209] GalNAc-siTKT 773 and GalNAc-siTKT 1115 were obtained by modifying the 773 sequence (Sequence No. 25) and the 1115 sequence (Sequence No. 37) of GalNAc, and were used in in vivo experiments in mice. GalNAc-siTKT 773 and GalNAc-siTKT 1115 were dissolved in PBS and injected subcutaneously into the dorsal side of mice at a dose of 10 mg / kg.

[0210] After feeding mice on a normal diet for 7 days, they were euthanized and their liver tissues were extracted to detect TKT expression levels. The results showed that the in vivo knockdown effect of the 1115 sequence was superior to that of the 773 sequence (Figs. 7B and C).

[0211] Subsequently, pharmacokinetic studies were performed on 1115 in mice. According to the experimental results, after subcutaneous injection of GalNAc-siTKT at doses of 5 mg / kg and 10 mg / kg, respectively, the blood drug concentration in mice reached a peak at approximately 60 minutes, and the half-life of the drug in the body was found to be approximately 4 hours (Fig. 7D).

[0212] Therefore, human, mouse, and monkey homologous sequences GalNAc-siTKT 773 and GalNAc-siTKT 1115 exhibit excellent knockdown effects in vivo and in vitro.

[0213] 실시예 7. 녹다운 효과를 갖는 siTKT 서열의 추가 개발

[0214] 1. siTKT

[0215] Based on an in-depth analysis of the TKT sequence, the inventors expanded the scale of sequence manufacturing to obtain a series of siRNAs, as shown in Table 2.

[0216] 이중 가닥 번호 서열번호 센스 5'-3' 서열번호 안티센스 5'-3' PPP24001 53 GCUCCAUCCAGGCCACCAC 168 GUGGUGGCCUGGAUGGAGCUU PPP24002 54 GCCGCAGAGATCATGGCTG 169 CAGCCATGATCTCTGCGGCGC PPP24003 55 CCGCAGAGAUCAUGGCUGU 170 ACAGCCAUGAUCUCUGCGGU PPP24004 56 CGCAGAGATCATGGCTGTC 171 GACAGCCATGATCTCTGCGGC PPP24005 57 GCAGAGATCATGGCTGTCC 172 GGACAGCCATGATCTCTGCGG PPP24006 58 CAGAGATCATGGCTGTCCT 173 GATGACAGCCATGATCTCTGCG PPP24007 59 AGAGATCATGGCTGTCCTC 174 GAGGACAGCCATGATCTCTGC PPP24008 60 GAGATCATGGCTGTCCTCT 175 AGAGGACAGCCATGATCTCTG PPP24009 61 GAUCAUGGCUGUCCUCUU 176 AAAGAGGACAGCCAUGAUCUU PPP24010 62 CATGGCTGTCCTCTTTTTC 177 GAAAAAGAGGACAGCCATGAT PPP24011 63 ATGGCTGTCCTCTTTTTCC 178 GGAAAAAGAGGACAGCCATGA PPP24012 64 UGGCUGUCCUCUUUCCA 179 UGGAAAAAGAGGACAGCCAUU PPP24013 65 GGCTGTCCTCTTTTTCCAC 180 GTGGAAAAAGAGGACAGCCAT PPP24014 66 GCTGTCCTCTTTTTCCACA 181 TGTGGAAAAAAGGACAGCCA PPP24015 67 CACCAUGCGCUACAAGUCC 182 GGACUUGUAGCGCAUGGUGUU PPP24016 68 CAUGCAGCUCCCAUCCUCU 183 AGAGGAUGGGAGCUGCAUGGC PPP24017 69 GTCCCGAAACAAGCTTTCA 184 TGAAAGCTTGTTTCGGGACCG PPP24018 70 GCAGCACCAGATGGACATC 185 GATGTCCATCTGGTGCTGCAG PPP24019 71 GCACCAGATGGACATCTAC 186 GTAGATGTCCATCTGGTGCTG PPP24020 72 GCCAACAGCCATCATTGCC 187 GGCAATGATGGCTGTTGGCTG PPP24021 73 CCAACAGCCATCATTGCCA 188 TGGCAATGATGGCTGTTGGCT PPP24022 74 CAACAGCCAUCAUUGCCAA 189 UUGGCAAUGAUGGCUGUUGUU PPP24023 75 AACAGCCATCATTGCCAAG 190 CTTGGCAATGATGGCTGTTGG PPP24024 76 ACAGCCATCATTGCCAAGA 191 TCTTGGCAATGATGGCTGTTG PPP24025 77 GCCAUCAUUGCCAAGACCU 192 AGGUCUUGGCAAUGAUGGCUU PPP24026 78 CCAUCAUUGCCAAGACCUU 193 AAGGUCUUGGCAAUGAUGGCU PPP24027 79 CAGCCAGAUCCAGAGCAAA 194 UUUGCUCUGGAUCUGGCUGUU PPP24028 80 ACACCAAAAATTCCACCTT 195 AAGGTGGAATTTTTGGTGTCC PPP24029 81 CACCAAAAAUUCCACCUUC 196 GAAGGUGGAAUUUUUGGUGUU PPP24030 82 ACCAAAAATTCCACCTTCT 197 AGAAGGTGGAATTTTTGGTGT PPP24031 83 CCAAAAATTCCACCTTCTC 198 GAGAAGGTGGAATTTTTGGTG PPP24032 84 AUUCCACCUUCUCGGAGAU 199 AUCUCCGAGAAGGUGGAAUUU PPP24033 85 UCCACCUUCUCGGAGAUCU 200 AGAUCUCCGAGAAGGUGGAAU PPP24034 86 CACCTTCTCGGAGATCTTC 201 GAAGATCTCCGAGAAGGTGGA PPP24035 87 ACCTTCTCGGAGATCTTCA 202 TGAAGATCTCCGAGAAGGTGG PPP24036 88 CCUUCUCGGAGAUCUUCAA 203 UUGAAGAUCUCCGAGAAGGUU PPP24037 89 CUUCUCGGAGAUCUUCAAA 204 UUUGAAGAUCUCCGAGAAGGU PPP24038 90 TTCTCGGAGATCTTCAAAA 205 TTTTGAAGATCTCCGAGAAGG PPP24039 91 TCTCGGAGATCTTCAAAAA 206 TTTTTGAAGATCTCCGAGAAG PPP24040 92 CAUCGAGUGCUACAUUGCU 207 AGCAAUGUAGCACUCGAUGAA PPP24041 93 ATCGAGTGCTACATTGCTG 208 CAGCAATGTAGCACTCGATGA PPP24042 94 TCGAGTGCTACATTGCTGA 209 TCAGCAATGTAGCACTCGATG PPP24043 95 TGAGCAGAACATGGTGAGC 210 GCTCACCATGTTCTGCTCAGC PPP24044 96 GAGCAGAACATGGTGAGCA 211 TGCTCACCATGTTCTGCTCAG PPP24045 97 AGCAGAACAUGGUGAGCAU 212 AUGCUCACCAUGUUCUGCUUU PPP24046 98 GCAGAACATGGTGAGCATC 213 GATGCTCACCATGTTCTGCTC PPP24047 99 TCTGCAGCACTTTTGCAGC 214 GCTGCAAAAGTGCTGCAGAAG PPP24048 100 CAGCACTTTTGCAGCCTTC 215 GAAGGCTGCAAAAGTGCTGCA PPP24049 101 AGCACTTTTGCAGCCTTCT 216 AGAAGGCTGCAAAAGTGCTGC PPP24050 102 GCACUUUUGCAGCCCUUCUU 217 AAGAAGGCUGCAAAAGUGCUU PPP24051 103 CACTTTTGCAGCCTTCTTC 218 GAAGAAGGCTGCAAAAGTGCT PPP24052 104 ACUUUUGCAGCCCUUCUUCA 219 UGAAGAAGGCUGCAAAAGUGC PPP24053 105 CTTTTGCAGCCTTCTTCAC 220 GTGAAGAAGGCTGCAAAAGTG PPP24054 106 TTTTGCAGCCTTCTCTCACG 221 CGTGAAGAAGGCTGCAAAAGT PPP24055 107 GGCCTTTGACCAGATTCGC 222 GCGAATCTGGTCAAAGGCCCG PPP24056 108 GCCTTTGACCAGATTCGCA 223 TGCGAATCTGGTCAAAGGCCC PPP24057 109 CCUUUGACCAGAUUCGCAU 224 AUGCGAAUCUGGUCAAAGGUU PPP24058 110 CTTTGACCAGATTCGCATG 225 CATGCGAATCTGGTCAAAGGC PPP24059 111 CGCCATTCCGAGAGCAAC 226 GTTGCTCTCGGAGATGGCGGC PPP24060 112 GCCATCTCCGAGAGCAACA 227 TGTTGCTCTCGGAGATGGCGG PPP24061 113 CCAUCUCCGAGAGCAACAU 228 AUGUUGCUCUCGGAGAUGGCG PPP24062 114 CATCTCCGAGAGCAACATC 229 GATGTTGCTCTCGGAGATGGC PPP24063 115 ATCTCCGAGAGCAACATCA 230 TGATGTTGCTCTCGGAGATGG PPP24064 116 UCUCCGAGAGCAACAUCAA 231 UUGAUGUUGCUCUCGGAGAUU PPP24065 117 CTCCGAGAGCAACATCAAC 232 GTTGATGTTGCTCTCGGAGAT PPP24066 118 TCCGAGAGCAACATCAACC 233 GGTTGATGTTGCTCTCGGAGA PPP24067 119 CCGAGAGCAACAUCAACCU 234 AGGUUGAUGUUGCUCUCGGAG PPP24068 120 AGAGCAACATCAACCTCTG 235 CAGAGGTTGATGTTGCTCTCG PPP24069 121 CCACTGCGGCGTTTCCATC 236 GATGGAAACGCCGCAGTGGGGA PPP24070 122 CCTAGAAGATCTGGCTATG 237 CATAGCCAGATCTTCTAGGGC PPP24071 123 CUAGAAGAUCUGGCUAUGU 238 ACAUAGCCAGAUCUUCUAGG PPP24072 124 TAGAAGATCTGGCTATGTT 239 AACATAGCCAGATCTTCTAGG PPP24073 125 AGAAGATCTGGCTATGTTTT 240 AAACATAGCCAGATCTTCTAG PPP24074 126 TTCGGTCAGTCCCCACATC 241 GATGTGGGGACTGACCGAAAC PPP24075 127 TCGGTCAGTCCCCACATCA 242 TGATGTGGGGGACTGACCGAAA PPP24076 128 CGGUCAGUCCCCACAUCAA 243 UUGAGUGGGGACUGACCGAA PPP24077 129 GGTCAGTCCCCACATCAAC 244 GTTGATGTGGGGACTGACCGA PPP24078 130 GTCAGTCCCCACATCAACT 245 AGTTGATGTGGGGACTGACCG PPP24079 131 TCAGTCCCCACATCAACTG 246 CAGTTGATGTGGGGACTGACC PPP24080 132 CAGUCCCCACAUCAACUGU 247 ACAGUUGAGUGGGGACUGAC PPP24081 133 GUCCCCACAUCAACUGUCU 248 AGACAGUUGAGUGGGGACUU PPP24082 134 CCCCACAUCAACUGUCUUUU 249 AAAGACAGUUGAGUGGGGGAC PPP24083 135 CCCACATCAACTGTCTTTT 250 AAAAGACAGTTGATGTGGGGA PPP24084 136 CCACAUCAACUGUCUUUUA 251 UAAAAGACAGUUGAUGUGGGG PPP24085 137 CACATCAACTGTCTTTTAC 252 GTAAAAGACAGTTGATGTGGG PPP24086 138 ACATCAACTGTCTTTTACC 253 GGTAAAAGACAGTTGATGTGG PPP24087 139 CAUCAACUGUCUUUUACCC 254 GGGUAAAAGACAGUUGAUGUU PPP24088 140 TACAGAGAAGGCAGTGGAA 255 TTCCACTGCCTTCTCTGTAGC PPP24089 141 AGAAAATGCCATCATCTAT 256 ATAGATGATGGCATTTTCTGG PPP24090 142 GCCAAGGUGGUCCUGAAGA 257 UCUUCAGGACCACCUUGGCUU PPP24091 143 AGGUGGUCCUGAAGAGCAA 258 UUGCUCUUCAGGACCACCUUU PPP24092 144 GGUCCUGAAGAGCAAGGAU 259 AUCCUUGCUCUUCAGGACCAC PPP24093 145 ACTGCTGAAGAAAGAAAAG 260 CTTTTCTTTCTTCAGCAGTTC PPP24094 146 CCCTGGACAGAAAACTCAT 261 ATGAGTTTTCTGTCCAGGGGC PPP24095 147 CCUGGACAGAAAACUCAUU 262 AAUGAGUUUUCUGUCCAGGGG PPP24096 148 CTGGACAGAAAACTCATTC 263 GAATGAGTTTTCTGTCCAGGG PPP24097 149 TGGACAGAAAACTCATTCT 264 AGAATGAGTTTTCTGTCCAGG PPP24098 150 CACCGTGGAGGACCATTAT 265 ATAATGGTCCTCCACGGTGAG PPP24099 151 CCGUGGAGGACCAUUAUUA 266 UAAUAAUGGUCCUCCACGGUU PPP24100 152 TGGAGGACCATTATTATGA 267 TCATAATAATGGTCCTCCACG PPP24101 153 GCTGAGCTGCTGAAGATGT 268 ACATCTTCAGCAGCTCAGCCG PPP24102 154 GGGTCTATACATTCCTGAG 269 CTCAGGAATGTATAGACCCCC PPP24103 155 GAUUCUGGGAAAGGUGCUC 270 GAGCACCUUUCCCAGAAUCUU PPP24104 156 TCTGGGAAAGGTGCTCAAA 271 TTTGAGCACCTTTCCCAGAAT PPP24105 157 CTGGGAAAGGTGCTCAAAG 272 CTTTGAGCACCTTTCCCAGAA PPP24106 158 UGGGAAAGGUGCUCAAAGA 273 UCUUUGAGCACCUUUCCCAUU PPP24107 159 GGAAAGGUGCUCAAAGAUG 274 CAUCUUUGAGCACCUUUCCUU PPP24108 160 GAAAGGUGCUCAAAGAUGU 275 ACAUCUUUGAGCACCUUUCUU PPP24109 161 AAAGGTGCTCAAAGATGTA 276 TACATCTTTGAGCACCTTTCC PPP24110 162 AAGGUGCUCAAAGAUGUAC 277 GUACAUCUUUGAGCACCUUUU PPP24111 163 AGGUGCUCAAAGAUGUACU 278 AGUACAUCUUUGAGCACCUUU PPP24112 164 GGUGCUCAAAGAUGUACUG 279 CAGUACAUCUUUGAGCACCUU PPP24113 165 GTGCTCAAAGATGTACTGA 280 TCAGTACATCTTTGAGCACCT PPP24114 166 AAAGATGTACTGAGAGGAG 281 CTCCTCTCAGTACATCTTTGA PPP24115 167 TGAGAGGAGGGGTAAATAT 282 ATATTTACCCCTCCTCTCAGT

[0217] According to the sense strand and antisense strand of the siRNA in Table 2, the inventors prepared modified sense strands and antisense strands using the method described above, as shown in FIG. 15.

[0218] The modifications of each nucleoside are explained as follows.

[0219] The letter m indicates that the nucleoside adjacent to the left of the letter m is a nucleoside modified by a 2'-methoxy group (Fig. 16);

[0220] The letter f indicates that the nucleoside adjacent to the left of the letter f is a 2'-fluoro-modified nucleoside (Fig. 16);

[0221] The letter s indicates that two nucleosides adjacent to the left and right of the letter s, or nucleosides connected thereto, are connected to the GalNAc and phosphorothioate diester group.

[0222] 2. Inhibitory action of modified siTKT on the target gene TKT

[0223] 24 hours prior to transfection, Hep3B cells were seeded into 96-well plates with approximately 20,000 cells per well and 100 μL of medium. For transfection, samples were transfected using Lipofectamine RNAiMAX (Invitrogen, 13778150) in accordance with the product instructions, and the final single-concentration transfection concentration was 2.5 nM. 24 hours after treatment, total cell RNA was extracted using a high-throughput cell RNA extraction kit (FG0417-L / FG0418-XL, magnetic bead method), and human HQP mRNA levels were measured by performing RNA reverse transcription (ThermoFisher, AK16225) and real-time fluorescence quantitative PCR (ThermoFisher, A25778), and human HQP mRNA levels were corrected according to HPRT internal reference gene levels.

[0224] The inhibition of target gene TKT mRNA expression levels by modified sequences was evaluated using a single concentration of HEP3B cells; as shown in Table 3, sequences with significantly superior TKT mRNA knockdown effects were screened by combining the sequence characteristics of the target TKT mRNA, and at a concentration of 2.5 nM, a number of sequences were able to reduce the target gene TKT mRNA expression levels to 0.1 or less, and as low as 0.03.

[0225] The inhibitory effect on the target gene TKT mRNA expression level was evaluated through multiple concentration assessments by selecting multiple sequences and combining the inhibition efficiencies at single concentrations of the sequences shown in Table 3. Here, IC 50 The value corresponds to the concentration of siRNA used when the residual percentage of TKT mRNA expression is 50%, and the maximum inhibition ratio corresponds to the maximum value that can inhibit TKT mRNA expression at multiple concentrations.

[0226] double strand number Residual value (average value) of target gene TKTmRNA expression level 2.5 nM MPPP24001 0.17 MPPP24002 0.08 MPPP24003 0.13 MPPP24004 0.09 MPPP24005 0.18 MPPP24006 0.07 MPPP24007 0.08 MPPP24008 0.42 MPPP24009 0.06 MPPP24010 0.53 MPPP24011 0.05 MPPP24012 0.11 MPPP24013 0.06 MPPP24014 0.07 MPPP24015 0.18 MPPP24016 0.04 MPPP24017 0.03 MPPP24018 0.08 MPPP24019 0.07 MPPP24020 0.70 MPPP24021 0.07 MPPP24022 0.05 MPPP24023 0.82 MPPP24024 0.33 MPPP24025 0.60 MPPP24026 0.16 MPPP24027 0.06 MPPP24028 0.03 MPPP24029 0.13 MPPP24030 0.03 MPPP24031 0.06 MPPP24032 0.18 MPPP24033 0.17 MPPP24034 0.10 MPPP24035 0.04 MPPP24036 0.07 MPPP24037 0.29 MPPP24038 0.05 MPPP24039 0.02 MPPP24040 0.08 MPPP24041 0.06 MPPP24042 0.05 MPPP24043 0.03 MPPP24044 0.15 MPPP24045 0.11 MPPP24046 0.06 MPPP24047 0.09 MPPP24048 0.09 MPPP24049 0.05 MPPP24050 0.08 MPPP24051 0.07 MPPP24052 0.08 MPPP24053 0.07 MPPP24054 0.12 MPPP24055 0.07 MPPP24056 0.04 MPPP24057 0.09 MPPP24058 0.06 MPPP24059 0.12 MPPP24060 0.13 MPPP24061 0.10 MPPP24062 0.06 MPPP24063 0.14 MPPP24064 0.13 MPPP24065 0.05 MPPP24066 0.07 MPPP24067 0.06 MPPP24068 0.05 MPPP24069 0.04 MPPP24070 0.08 MPPP24071 0.08 MPPP24072 0.04 MPPP24073 0.05 MPPP24074 0.09 MPPP24075 0.34 MPPP24076 0.06 MPPP24077 0.14 MPPP24078 0.04 MPPP24079 0.10 MPPP24080 0.15 MPPP24081 0.26 MPPP24082 0.58 MPPP24083 0.03 MPPP24084 0.08 MPPP24085 0.03 MPPP24086 0.03 MPPP24087 0.19 MPPP24088 0.05 MPPP24089 0.04 MPPP24090 1.12 MPPP24091 0.16 MPPP24092 0.29 MPPP24093 0.04 MPPP24094 0.04 MPPP24095 0.09 MPPP24096 0.07 MPPP24097 0.05 MPPP24098 0.08 MPPP24099 0.10 MPPP24100 0.05 MPPP24101 0.05 MPPP24102 0.06 MPPP24103 0.32 MPPP24104 0.05 MPPP24105 0.09 MPPP24106 0.09 MPPP24107 0.21 MPPP24108 0.08 MPPP24109 0.06 MPPP24110 0.06 MPPP24111 0.05 MPPP24112 0.05 MPPP24113 0.08 MPPP24114 0.09 MPPP24115 0.07 1115 서열 0.33

[0227] 24 hours prior to transfection, Hep3B cells were seeded into 96-well plates with approximately 20,000 cells per well and 100 μL of medium. For transfection, samples were transfected using Lipofectamine RNAiMAX (Invitrogen, 13778150) as per the product instructions; the final concentrations of the multiple concentration sample transfection gradient were 5, 1, 0.2, 0.04, 0.008, 0.0016, and 0.00032 nM. After 24 hours of treatment, total cell RNA was extracted using a high-throughput cell RNA extraction kit (FG0417-L / FG0418-XL, magnetic bead method), RNA reverse transcription (ThermoFisher, AK16225) and real-time fluorescence quantitative PCR (ThermoFisher, A25778) were performed to measure the mRNA levels of human HQP, and the mRNA levels of human HQP were corrected according to the HPRT internal reference gene levels.

[0228] After treatment with the aforementioned different concentrations of siRNA, the corresponding TKT mRNA residual values ​​were non-linearly fitted to the ICs of different sequences 50 Calculate the value and maximum inhibition ratio, where IC 50 represents the siRNA concentration corresponding when the residual percentage of TKT mRNA expression is 50%, and the maximum inhibition ratio represents the maximum value capable of inhibiting TKT mRNA expression at multiple concentrations. Here, HEP3B IC 50 The results of inhibition of target gene TKT mRNA expression levels by modified sequences in cell multiplex concentration screening for values ​​are shown in Table 4.

[0229] The results of inhibition of target gene TKT mRNA expression levels by modified sequences in HEP3B cell multiplex screening are shown in Table 4.

[0230] 이중 가닥 번호 IC 50 (nM) 최대 억제 비율(100%) MPPP24001 0.208 87.86 MPPP24007 0.101 92.58 MPPP24009 0.008 95.56 MPPP24011 0.008 96.23 MPPP24016 0.025 94.97 MPPP24017 0.021 94.95 MPPP24018 0.158 92.42 MPPP24019 0.045 92.95 MPPP24021 0.074 93.44 MPPP24022 0.095 94.65 MPPP24026 0.128 94.78 MPPP24027 0.087 92.98 MPPP24028 0.067 96.30 MPPP24030 0.036 96.02 MPPP24031 0.128 91.94 MPPP24035 0.127 93.69 MPPP24036 0.008 96.84 MPPP24038 0.099 92.22 MPPP24039 0.032 96.14 MPPP24040 0.051 95.71 MPPP24043 0.026 95.38 MPPP24045 0.044 96.63 MPPP24052 0.023 92.02 MPPP24055 0.135 90.62 MPPP24056 0.109 93.04 MPPP24058 0.067 93.71 MPPP24061 0.040 95.56 MPPP24062 0.033 92.24 MPPP24067 0.238 95.74 MPPP24068 0.039 95.69 MPPP24069 0.018 95.80 MPPP24072 0.021 95.52 MPPP24078 0.006 96.83 MPPP24085 0.013 96.59 MPPP24088 0.057 94.96 MPPP24089 0.033 97.09 MPPP24091 0.179 94.55 MPPP24093 0.054 95.09 MPPP24094 0.024 96.76 MPPP24098 0.208 90.82 MPPP24099 0.061 94.09 MPPP24100 0.113 94.46 MPPP24101 0.055 95.15 MPPP24102 0.453 84.75 MPPP24104 0.012 93.54 MPPP24112 0.084 91.56 MPPP24114 0.381 84.19 MPPP24115 0.088 88.69

[0231] According to the foregoing, the inventors further derived dominant sequence regions and dominant inhibition analysis results suitable for siTKT design, which include the following:

[0232] Double strand numbers PPP24074 to PPP24087, wherein PPP24078 is relatively more preferred; and corresponding modified sequences and binding molecules.

[0233] Double strand numbers PPP24002 to PPP24014, wherein PPP24009 and PPP24011 are relatively more preferred; and corresponding modified sequences and binding molecules.

[0234] Double strand numbers PPP24032 to PPP24039, wherein PPP24036 is relatively more preferred; and corresponding modified sequences and binding molecules.

[0235] Double strand numbers PPP24020 to PPP24026, wherein relatively more preferred are PPP24021, PPP24022, and PPP24026; and corresponding modified sequences and binding molecules.

[0236] The above-described embodiments have illustrated only a few embodiments of the present invention, and while the description is relatively specific and detailed, it should not be understood as limiting the scope of the patent of the present invention. It should be noted that those skilled in the art may make various modifications and improvements without departing from the spirit of the present invention, and all of these fall within the scope of protection of the present invention. Accordingly, the scope of protection of the patent of the present invention is based on the appended claims.

Claims

Claim 1 Use of a downregulator of the transketolase (TKT) or TKT-containing insulin receptor (InsR)-CCAAT enhancer binding protein α (C / EBPα)-TKT signaling pathway for the preparation of a pharmaceutical composition for the alleviation or treatment of metabolism-related fatty liver disease. Claim 2 In claim 1, the downregulator comprises one selected from a TKT downregulator, a C / EBPα-TKT interaction downregulator, and an InsR-C / EBPα interaction downregulator; preferably, the TKT downregulator comprises a reagent for silencing, knockdown, or knockout of a TKT gene, or a reagent for inhibiting TKT protein activity; more preferably, the downregulator comprises an interfering molecule that specifically interferes with TKT gene expression, a CRISPR gene editing reagent for a TKT gene, a homologous recombination reagent, or a site-specific mutagenic reagent, wherein the reagent induces a loss-of-function mutation of TKT; preferably, the C / EBPα-TKT interaction downregulator comprises a reagent that weakens the binding of C / EBPα to a TKT promoter, a reagent for silencing, knockdown, or knockout of a C / EBPα gene, or a reagent for inhibiting C / EBPα protein activity; More preferably, the use is characterized by comprising a reagent that reduces the level of C / EBPα protein phosphorylation, an interfering molecule that specifically interferes with C / EBPα gene expression, a CRISPR gene editing reagent for the C / EBPα gene, a homologous recombination reagent, or a site-specific mutagenic reagent, wherein the reagent induces a loss-of-function mutation of C / EBPα; preferably, the InsR-C / EBPα interaction downregulator comprises a reagent for silencing, knockdown, or knockout of the InsR gene, a reagent that inhibits InsR protein activity, or a reagent that weakens the binding of insulin to InsR; more preferably, the use is characterized by comprising an interfering molecule that specifically interferes with InsR gene expression, a CRISPR gene editing reagent for the InsR gene, a homologous recombination reagent, or a site-specific mutagenic reagent, wherein the reagent induces a loss-of-function mutation of InsR. Claim 3 In claim 2, the downregulator is a TKT gene silencing interference reagent; preferably, the interference reagent is siRNA; preferably, the siRNA is siRNA in which the nucleotide sequence is represented by any one of SEQ ID NOs 1 to 50, SEQ ID NOs 53 to 167; more preferably, the siRNA is siRNA in which the nucleotide sequence is represented by any one of SEQ ID NOs 37, SEQ ID NOs 25, SEQ ID NOs 50, SEQ ID NOs 49, SEQ ID NOs 61, SEQ ID NOs 63, SEQ ID NOs 73, SEQ ID NOs 74, SEQ ID NOs 78, SEQ ID NOs 88, or SEQ ID NOs 130; or the downregulator is a homologous recombinant reagent for knockdown or knockout of a TKT gene that causes gene coding to terminate; or the downregulator is a homologous recombinant reagent for knockdown or knockout of an InsR gene that causes gene coding to terminate. Claim 4 The use according to claim 2, wherein the siRNA forms an siRNA preparation for hepatocyte target delivery; preferably, the siRNA is linked to a target ligand that binds to an asialoglycoprotein receptor; and the target ligand comprises N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, or N-isobutyrylgalactosamine. Claim 5 The use according to claim 1, wherein the metabolism-related fatty liver disease includes non-alcoholic fatty liver disease and non-alcoholic steatohepatitis; or the down-regulator of the TKT or TKT-containing InsR-C / EBPα-TKT signaling pathway increases inosine levels, improves mitochondrial function, further improves liver lipid metabolism, and alleviates or treats metabolism-related fatty liver disease; preferably, the down-regulator blocks the entry of inosine-derived R5P into glycolysis, promotes inosine synthesis of glucose-derived R5P, increases intracellular inosine levels, improves mitochondrial function, improves liver lipid metabolism, and alleviates or treats metabolism-related fatty liver disease; preferably, the increase in phosphatidylcholine synthesis is mediated by the CDP-choline pathway. Claim 6 An siRNA or siRNA preparation for the alleviation or treatment of metabolism-related fatty liver disease, wherein the siRNA comprises an siRNA in which the nucleotide sequence is represented by any one of SEQ ID NOs 1 to 50, SEQ ID NOs 53 to 167; preferably, the siRNA or siRNA preparation is an siRNA in which the nucleotide sequence is represented by any one of SEQ ID NOs 37, SEQ ID NOs 25, SEQ ID NOs 50, SEQ ID NOs 49, SEQ ID NOs 61, SEQ ID NOs 63, SEQ ID NOs 73, SEQ ID NOs 74, SEQ ID NOs 78, SEQ ID NOs 88, or SEQ ID NOs 130. Claim 7 In claim 6, the siRNA preparation is a stable siRNA preparation for hepatocyte targeted delivery; preferably, the siRNA is linked to a target ligand that binds to an asialoglyphic protein receptor; and the target ligand comprises N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, or N-isobutyrylgalactosamine. Claim 8 An siRNA or siRNA preparation according to claim 6 or 7, wherein in the siRNA, the nucleosides of the sense strand and the antisense strand undergo modifications including those selected from the group consisting of 2'-methoxy modifications and 2'-fluoro modifications; or, between adjacent nucleosides or between a nucleoside and a target ligand, are connected by phosphorothioate diester groups. Claim 9 In claim 8, in the sense strand of the siRNA, the first and second nucleosides and the second and third nucleosides from the 5' end are connected by a phosphorothioate diester group; in the corresponding antisense strand of the siRNA, the first and second nucleosides and the second and third nucleosides from the 3' end are connected by a phosphorothioate diester group; preferably, in the sense strand of the siRNA, the 1st, 2nd, 3rd, 4th, 6th, 10th to 19th nucleosides from the 5' end are 2'-methoxy group modified; An siRNA or siRNA preparation characterized in that, in the corresponding antisense strand of the siRNA, the 1st, 3rd, 4th, 5th, 7th, 10th-13th, 15th, 17th to 21st nucleosides from the 5' end are 2'-methoxy group modified; preferably, in the sense strand of the siRNA, the 5th, 7th, 8th, and 9th nucleosides from the 5' end are 2'-fluoro modified, and in the corresponding antisense strand of the siRNA, the 2nd, 6th, 8th, 9th, 14th, and 16th nucleosides are 2'-fluoro modified. Claim 10 A pharmaceutical composition or drug kit for the alleviation or treatment of metabolism-related fatty liver disease, comprising a siRNA or siRNA preparation for the alleviation or treatment of metabolism-related fatty liver disease according to any one of claims 6 to 8, and a pharmaceutically acceptable carrier or excipient. Claim 11 Use of the InsR-C / EBPα-TKT signaling pathway for screening substances for the alleviation or treatment of metabolism-related fatty liver disease. Claim 12 A method for screening substances for the alleviation or treatment of metabolic-related fatty liver disease, comprising: (1) contacting a candidate substance with a system containing the InsR-C / EBPα-TKT signaling pathway; (2) screening substances that downregulate the InsR-C / EBPα-TKT signaling pathway, wherein the substance is a substance useful for the alleviation or treatment of metabolic-related fatty liver disease; and wherein the downregulation includes TKT downregulation, C / EBPα-TKT interaction downregulation, and insulin / InsR-C / EBPα interaction downregulation. Claim 13 In claim 12, step (1) comprises adding a candidate substance to a system containing an InsR-C / EBPα-TKT signaling pathway; step (2) detects a change in each protein or its coding gene in the InsR-C / EBPα-TKT signaling pathway and compares it with a control group, wherein the control group is a system containing an InsR-C / EBPα-TKT signaling pathway without adding the candidate substance; and if the candidate substance downregulates TKT, downregulates C / EBPα-TKT interaction, or downregulates insulin / InsR-C / EBPα interaction, the candidate substance is a substance useful for alleviating or treating metabolic fatty liver disease. Claim 14 In the manufacture of a diagnostic reagent, the use of liver TKT protein or its coding gene, said diagnostic reagent is used for the diagnosis or prognosis of metabolism-related fatty liver disease; preferably, said diagnosis or prognosis includes determining the occurrence or progression of metabolism-related fatty liver disease based on the expression status of liver TKT protein, or determining whether it is suitable for application to a treatment plan involving treatment with "TKT or a downregulator of the TKT-containing InsR-C / EBPα-TKT signaling pathway"; and if the TKT protein is highly expressed, said treatment plan is applied.