Composition for preventing, improving or treating atopic dermatitis containing Rhododendron tomentosum Harmaja extract as an active ingredient

Abstract

The present invention relates to a composition for preventing, improving, or treating atopic dermatitis comprising a white tea extract as an active ingredient. The white tea extract of the present invention inhibits the expression of TARC and RANTES and inhibits the production of IL-5, IL-6, TNF-α and IL-1β, and IgE, thereby having a preventive, improving, or therapeutic effect on atopic dermatitis, and can be applied in various ways such as food compositions, health functional foods, pharmaceutical compositions, quasi-drug compositions, and feed compositions.

Description

Technology Field

[0001] The present invention relates to a composition for preventing, improving, or treating atopic dermatitis comprising a white tea extract as an active ingredient. Background Technology

[0003] Atopic dermatitis (AD) is a type of autoimmune disease and a chronic inflammatory skin condition associated with hypersensitivity to environmental stimuli. While it generally appears during infancy and childhood, it can persist into adolescence and adulthood. With a global prevalence of approximately 20%, atopic dermatitis is one of the most common allergic diseases among infants and toddlers in Korea, affecting about 80% of infants and toddlers. Since atopic dermatitis manifests as a complex set of clinical symptoms resulting from the interaction of genetic and environmental factors, its cause cannot be explained by a single factor. However, major causes are considered to include environmental factors such as environmental pollution (e.g., exhaust fumes), increased use of food additives, and an increase in allergens (e.g., house dust mites) due to rising indoor temperatures, as well as genetic predisposition, immunological reactions, abnormalities in the skin barrier, and family history. The occurrence of atopic dermatitis in childhood may lead to a progression to respiratory allergic diseases such as asthma or rhinitis (allergic march), and the symptoms of atopic dermatitis change due to various factors, and depending on specific factors, the severity may worsen or become difficult to treat, and the treatment situation also greatly affects the course.

[0004] In mild cases of atopic dermatitis, the use of moisturizers to address dryness and impaired skin barrier function while preventing inflammation is sufficient; however, in severe cases, steroids are used to suppress inflammation. Since the long-term and extensive use of steroids can lead to side effects, it is crucial to apply different treatment strategies, such as appropriately selecting medications based on the severity of the condition. As the majority of atopic dermatitis patients are children and adolescents, the development of safe treatments free from toxicity and side effects is critical. Although research is being conducted to overcome these limitations, the development of effective treatments remains insufficient. Prior art literature

[0006] Republic of Korea Published Patent: No. 10-2013-0060951 The problem to be solved

[0007] The present invention aims to solve the aforementioned problem and other related problems.

[0008] One exemplary objective of the present invention is to provide a food composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0009] One exemplary objective of the present invention is to provide a health functional food for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0010] One exemplary objective of the present invention is to provide a pharmaceutical composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0011] One exemplary objective of the present invention is to provide a quasi-drug composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0012] One exemplary objective of the present invention is to provide a feed composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0014] The technical problems to be solved according to the technical concept of the invention disclosed in this specification are not limited to those for solving the problems mentioned above, and other unmentioned problems will be clearly understood by a person skilled in the art from the description below. means of solving the problem

[0016] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.

[0017] As one embodiment for achieving the above objective, the present invention provides a food composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0018] In the present invention, the above 'Baeksancha ( Ledum palustre var. diversipilosum It is a plant that grows under the forests of high mountains, reaching a height of 15 to 70 cm. Its leaves are alternate, long elliptical or lanceolate, 2 to 7 cm in length and 4 to 12 mm in width, and are dark green and wrinkled.

[0019] In the present invention, the white tea may be used as is without damaging its original form, or it may be used after performing a pretreatment process considering the process speed and process (manufacturing) efficiency intended by those skilled in the art. The pretreatment process may include, for example, conventional steps such as sorting, washing, cutting, pulverizing, and drying.

[0020] In the present invention, the extraction is not particularly limited and can be performed according to methods commonly used in the relevant technical field. Non-limiting examples of the extraction method include hot water extraction, cold maceration extraction, solvent extraction, steam distillation, elution, pressing, ultrasonic extraction, filtration, and reflux extraction, and these may be performed individually or in combination of two or more methods.

[0021] The extract of the present invention is obtained by extracting Baeksan tea using a suitable solvent, and may include, for example, a crude extract, an extract soluble in a polar solvent, or an extract soluble in a non-polar solvent. The type of extraction solvent used to prepare the extract is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the extraction solvent may include water; alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propanol, isopropanol, butanol, propyl alcohol, butyl alcohol; polyhydric alcohols such as glycerin, butylene glycol, propylene glycol; hydrocarbon solvents such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether, dichloromethane; or mixtures thereof, and, for example, may be a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or a mixture thereof. More specifically, the extract of the present invention may be extracted using a 30 to 70% ethanol solvent, and preferably, may be extracted using a 50% ethanol solvent.

[0022] In the present invention, the extract may be one or more extracts selected from the group consisting of seeds, fruits, roots, shoots, stems, and leaves of Baeksan tea, and preferably may be extracted from the leaves of Baeksan tea.

[0023] In the present invention, the term "active ingredient" refers to a component that exhibits the desired activity alone, or can exhibit activity together with a carrier that is inactive itself.

[0024] The term "prevention" in this invention refers to any act of administering the composition of this invention to an individual to suppress or delay atopic dermatitis.

[0025] The term 'improvement' in this invention refers to any act of using the composition of this invention to improve or benefit the condition of atopic dermatitis.

[0026] The composition of the present invention may be characterized by inhibiting the production of one or more selected from the group consisting of interleukin-5 (IL-5), interleukin-6 (IL-6), TNF-α, and interleukin-1β (IL-1β).

[0027] The aforementioned 'Interleukin-5 (IL-5)' is a cytokine that promotes the growth, differentiation, and activation of eosinophils. In patients with atopic dermatitis, IL-5 is oversecreted, leading to an increase in eosinophil levels. Consequently, eosinophils are deposited in skin tissues, causing inflammatory responses and tissue damage. The aforementioned 'Interleukin-6 (IL-6)' is a cytokine that regulates acute inflammatory responses, playing a role in activating B cells and inducing antibody production. In patients with atopic dermatitis, IL-6 levels rise, inducing acute inflammatory responses. The aforementioned TNF-α is a cytokine that induces the secretion of other inflammatory mediators. In patients with atopic dermatitis, it is oversecreted, damaging the skin barrier and causing skin lesion aggravation and itching. The aforementioned Interleukin-1β (IL-1β) is a cytokine that is activated in the early stages of inflammatory responses. In patients with atopic dermatitis, it exacerbates the onset and persistence of skin inflammation, as well as itching and skin damage. The above cytokines serve as indicators of the severity of atopic dermatitis, and in order to improve atopic dermatitis, it is necessary to inhibit the above cytokines, and the composition of the present invention has the characteristic of inhibiting the above cytokines.

[0028] Specifically, in one embodiment, in an experiment in which spleen taken from a mouse model sensitized with ovalbumin (OVA) was unicellularly cultured and then treated with OVA and the Baeksan tea extract of the present invention, the amount of IL-5 secreted was measured using an IL-5 ELISA set kit. As a result, it was confirmed that IL-5 secretion was significantly increased in cells stimulated with OVA, whereas IL-5 secretion was significantly decreased in cells simultaneously treated with the Baeksan tea extract.

[0029] In another embodiment, 6-week-old male BALB / c mice (20–23 g) were used to induce disease in the ear region by applying 20 μL of 0.5% (w / v) DNFB dissolved in an acetone / olive oil solution (acetone:olive oil = 1:3) to the surface of the ear. Starting 3 days later, 20 μL of 0.3% (w / v) DNFB was applied to the surface of the ear at 3-day intervals for 4 cycles of induction. Subsequently, the collected ear tissue was quantified, 500 μL of T-PER (Tissue Protein Extraction Reagent, Thermo Scientific, 78510) and an equal amount of 1.4 mm zirconium oxide beads (Prevellys, P000927-LYSK0-A) were added, and the tissue was ground 8 times for 30 seconds at a frequency of 30.0 rpm using a TissueLyser II (Qiagen). The ground ear Tissue Protein Extraction Reagent (T-PER) containing tissue was centrifuged at 10,000 rpm for 10 minutes to collect the supernatant, and a cytokine measurement experiment was conducted using this as a protein sample for measuring cytokines in ear tissue. When the amount of IL-6 secreted was measured using the IL-6 BD OptEIA™ MOUSE ELISA (enzyme-linked immunosorbent assay) kit, it was confirmed that IL-6 secretion was significantly reduced in the experimental group treated with Baeksancha extract after inducing atopic dermatitis compared to the atopic dermatitis-induced group not treated with Baeksancha extract.

[0030] In addition, in another embodiment, when the mRNA expression levels of IL-6, TNF-α, and IL-1β, which are inflammatory cytokines associated with the infiltration and activation of inflammatory cells in ear tissue in atopic dermatitis, were measured using the protein sample, it was confirmed that the mRNA expression levels of IL-6, TNF-α, and IL-1β were significantly reduced in the experimental group treated with Baeksancha extract after the induction of atopic dermatitis compared to the atopic dermatitis-induced group untreated with Baeksancha extract.

[0031] The composition of the present invention may be characterized by inhibiting the production of IgE (immunoglobulin E).

[0032] The above-mentioned IgE (immunoglobulin E) is an antibody that plays an important role in allergic reactions, binding to mast cells to cause the release of inflammatory mediators such as histamine. In patients with atopic dermatitis, serum IgE levels rise, causing itching and allergic inflammatory reactions. Serum IgE levels serve as an indicator of the severity of atopic dermatitis, and inhibition of IgE is necessary for the improvement of atopic dermatitis; the composition of the present invention has the characteristic of inhibiting IgE.

[0033] Specifically, in one embodiment, 6-week-old male BALB / c mice (20–23 g) were orally administered daily for 2 weeks starting from the time of sensitization with DNFB (2,4-dinitrofluorobenzene) to induce atopic dermatitis, and an experiment was conducted to treat with Baeksancha extract. Subsequently, blood was collected by orbital blood sampling during mouse necropsy, and serum was separated by centrifugation at 3000 rpm for 15 minutes to measure the IgE concentration in the serum. As a result, it was confirmed that compared to the atopic dermatitis-induced group not treated with Baeksancha extract, the experimental group treated with Baeksancha extract after the induction of atopic dermatitis showed a decrease in IgE secretion.

[0034] The composition of the present invention may be characterized by inhibiting the expression of one or more selected from the group consisting of TARC and RANTES.

[0035] The above 'TARC' means 'thymus and activation-regulated chemokine (CCL17)', and the above 'RANTES' means 'regulated upon activation, normal T cell expressed and secreted chemokine (CCL5)'.

[0036] Atopic dermatitis is a disease that occurs when the balance of the Th1 / Th2 immune response is disrupted. The aforementioned Th1 / Th2 immune response refers to an immune response regulated by cytokines produced by Th1 and Th2 cells, which are helper T cells. If the balance of the Th1 / Th2 immune response is skewed toward Th1, resistance to infection increases; however, if it is skewed toward Th2, resistance to infection decreases, and conversely, allergies increase. TARC induces the migration of Th2 cells into skin lesions, thereby intensifying the inflammatory response and worsening the skin lesions. RANTE promotes the migration of Th2 cells and eosinophils, thereby intensifying the inflammatory response. Consequently, the balance of the Th1 / Th2 immune response is disrupted, leading to the progression or worsening of atopic dermatitis. Therefore, the overexpression of TARC and RANTES serves as an indicator of the severity of atopic dermatitis. To improve atopic dermatitis, it is necessary to suppress the overexpression of TARC and RANTES, and the composition of the present invention has an effect of inhibiting the expression of TARC and RANTES.

[0037] Specifically, in one embodiment, DH-82 canine macrophages were cultured at 37°C and 5% CO2 using Eagle's minimum essential medium (EMEM, ATCC, 30-2003) containing 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (PS), and then TARC mRNA expression was measured in a cell model in which inflammation was induced with lipopolysaccharide (LPS). Although TARC expression increased in the inflammation-induced cells, it was confirmed that TARC expression significantly decreased in the experimental group treated with the Baeksan tea extract of the present invention after inflammation induction, thereby confirming that the composition of the present invention has an effect on improving atopic dermatitis.

[0038] In another embodiment, canine epidermal keratinocytes (CPEK) derived from dogs were cultured in canine epithelial proliferation medium (CELLNTEC, CnT-09) at 37°C and 5% CO2 conditions, and then the mRNA expression of RANTES was measured in a cell model in which inflammation was induced with lipopolysaccharide (LPS) and TNF-α (tumor necrosis factor-α, recombinant canine TNF-α protein, 1507-CT-025). Although the expression level of RANTES increased in inflammation-induced cells, it was confirmed that the expression level of RANTES significantly decreased in the experimental group treated with the Baeksan tea extract of the present invention after inflammation induction, thereby confirming that the composition of the present invention has an effect on improving atopic dermatitis. Furthermore, given that the effect was confirmed using a canine epithelial keratinocyte model derived from dogs, it was found that the composition has an effect on enhancing skin immunity or improving atopic dermatitis in companion animals as well as humans.

[0039] The 'food composition' of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives, and animal feed, and is intended for consumption by humans or animals, including livestock. Food compositions of the above types can be prepared in various forms according to conventional methods known in the art.

[0040] The above-mentioned type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods are not limited to but can be manufactured by adding the above-mentioned active ingredient to beverages (including alcoholic beverages), fruits and their processed foods (canned fruit, bottled fruit, jam, marmalade, etc.), fish, meat and its processed foods (ham, sausage, corned beef, etc.), breads and noodles (udon, buckwheat noodles, ramen, spaghetti, macaroni, etc.), fruit juices, various drinks, cookies, malt syrup, dairy products (butter, cheese, etc.), edible vegetable oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (miso, soy sauce, sauces, etc.).

[0041] In addition, the above active ingredients may be added to capsules, tablets, pills, etc. as nutritional supplements. In addition, as health functional foods, although not limited thereto, they may be manufactured in the form of tea, juice, and drink, for example, and consumed by liquefying, granulating, encapsulating, and pulverizing so that they can be consumed as health beverages.

[0042] In addition to the above, the health food of the present invention may contain various nutritional supplements, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents.

[0043] As another embodiment for achieving the above objective, the present invention provides a health functional food for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0044] The above 'Baeksancha', 'extraction', 'active ingredient', 'prevention', or 'improvement' are as previously stated.

[0045] The "health functional food" of the present invention refers to a food manufactured and processed using raw materials or ingredients having functional properties useful to the human body. The term "functional properties" means obtaining effects useful for health purposes, such as regulating nutrients or physiological actions regarding the structure and function of the human body.

[0046] The health functional food of the present invention can be manufactured by methods commonly used in the industry, and can be manufactured by adding raw materials and ingredients commonly added in the industry during manufacturing.

[0047] In addition, the formulation of the above-mentioned health functional food may also be manufactured without limitation as long as it is a formulation recognized as a health functional food. Non-limiting examples of the above-mentioned formulation may be one or more formulations selected from the group consisting of health functional food preparations such as tablets, capsules, pills, granules, liquids, powders, flakes, pastes, syrups, gels, jellies, and bars, as well as beverages, gums, and candies, but are not particularly limited thereto.

[0048] As another embodiment for achieving the above objective, the present invention provides a pharmaceutical composition for preventing or treating atopic dermatitis comprising a white tea extract as an active ingredient.

[0049] The above 'Baeksancha', 'extract', 'active ingredient', or 'prevention' are as previously stated.

[0050] The term "treatment" in the present invention refers to any act of administering the pharmaceutical composition of the present invention to an individual to improve, alleviate, or benefit the severity of symptoms of atopic dermatitis.

[0051] The 'pharmaceutical composition' of the present invention may further include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. The carrier for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, etc.

[0052] In addition, the carrier for parenteral administration may include water, suitable oil, saline solution, aqueous glucose and glycol, etc. Additionally, it may further include stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

[0053] The pharmaceutical composition of the present invention may be administered to mammals, including humans, by any method. For example, it may be administered orally or parenterally, and parenteral administration methods may be intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal administration, although not limited thereto.

[0054] The pharmaceutical composition of the present invention may be formulated into an oral or parenteral administration formulation according to the administration route described above. When formulating, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, extenders, binders, adjuvants (e.g., aluminum hydroxide), suspenders, thickeners, wetting agents, disintegrants or surfactants, diluents or excipients.

[0055] Solid dosage forms for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, or capsules, and such solid dosage forms may be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol, maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose, or gelatin. For example, a tablet or a sugar-coated tablet may be obtained by combining an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and processing it into a granular mixture.

[0056] In addition to simple excipients, lubricants such as magnesium striate talc are also used. Liquid formulations for oral administration include suspensions, oral liquids, emulsions, or syrups, and may contain various excipients, such as humectants, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents like water or liquid paraffin. Furthermore, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and may additionally contain anticoagulants, lubricants, humectants, flavorings, emulsifiers, and preservatives.

[0057] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of an injectable, a transdermal agent, and a nasal inhalant with a suitable parenteral carrier according to methods known in the art. The injectable must be sterile and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for the injectable may include, but are not limited to, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils, as solvents or dispersion media. More preferably, suitable carriers may include Hanks' solution, Ringer's solution, PBS containing triethanolamine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injectable from microbial contamination, various antimicrobial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. In addition, the above-mentioned injectable may additionally contain an isotonic agent, such as sugar or sodium chloride, in most cases.

[0058] Transdermal formulations include forms such as ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. Here, 'transdermal administration' means administering a pharmaceutical composition topically to the skin so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

[0059] In the case of inhalation formulations, the composition used according to the present invention can be conveniently delivered in the form of an aerosol spray from a pressurized pack or atomizer using a suitable propellant, e.g., dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of pressurized aerosols, the dosage unit can be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges used in inhalers or blowers can be formulated to contain the compound and a powder mixture of a suitable powder base, such as lactose or starch. Formulations for parenteral administration are described in the literature, which is a prescription generally known in all pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0060] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

[0061] As another embodiment for achieving the above objective, the present invention provides a quasi-drug composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0062] The above 'Baeksancha', 'extraction', 'active ingredient', 'prevention', or 'improvement' are as previously stated.

[0063] The term "quasi-drug" of the present invention refers to articles used for the purpose of diagnosing, treating, alleviating, managing, or preventing diseases in humans or animals, excluding those that are not instruments, machines, or devices, and articles used for the purpose of having a pharmacological effect on the structure and function of humans or animals, excluding those that are not instruments, machines, or devices. One embodiment may include, but is not limited to, an oral formulation. The formulation method, dosage, method of use, and components of the quasi-drug may be appropriately selected from the ordinary technology known in the technical field.

[0064] The quasi-drug composition of the present invention may further include, in addition to the above components, a pharmaceutically acceptable carrier, excipient, or diluent as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, extenders, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc.

[0065] As another embodiment for achieving the above objective, the present invention provides a feed composition for preventing or improving atopic dermatitis comprising a white tea extract as an active ingredient.

[0066] The above 'Baeksancha', 'extraction', 'active ingredient', 'prevention', or 'improvement' are as previously stated.

[0067] The "feed" of the present invention may be manufactured in various forms known in the art, such as any natural or artificial prescribed food, single meal, etc., or as an ingredient of said single meal, for animals to eat, consume, and digest; specifically, it may include, but is not limited to, concentrated feed, roughage, feed additives, feed aids, pet nutritional supplements, or special feeds.

[0068] Concentrated feeds include, but are not limited to, seed grains such as wheat, oats, and corn; bran, which is a byproduct obtained by refining grains and includes rice bran, wheat bran, and barley bran; oilseed meal, which is a byproduct obtained by extracting oil from soybeans, rapeseed, sesame, flaxseed, and coconut; residues such as residual starch, which is the main component of starch residue remaining after removing starch from sweet potatoes and potatoes; fish meal, fish residue; fish soluble, which is a concentrated fresh liquid obtained from fish; meat meal; blood meal; feather meal; skim milk powder; dried whey, which is the residue obtained when making cheese from milk or casein from skim milk; yeast, Chlorella, and seaweed. Roughage includes raw grass feeds such as wild grass, pasture grass, and green cuts; root vegetables such as feed turnips, feed beets, and a type of turnip called lutea bearger; silage, which is a stored feed made by filling a silo with raw grass, green cut crops, and grains and fermenting them with lactic acid; hay made by cutting and drying wild grass and pasture grass; straw of livestock breeding crops; and leaves of legumes, but is not limited thereto. Special feeds include mineral feeds such as oyster shells and rock salt; urea feeds such as urea or its derivatives such as diuretic isobutane; feed additives, which are substances added in trace amounts to compound feed to supplement components that are prone to being deficient when only natural feed ingredients are mixed, or to improve the shelf life of the feed; and dietary supplements, but are not limited thereto.

[0069] The feed composition of the present invention may further include components added to conventional feed. Examples of components added to such feed may include cereal powder, meat powder, and legumes. In the above, the cereal powder may be one or more selected from rice flour, wheat flour, barley flour, and corn flour. In the above, the meat powder may be a powdered meat powder obtained by selecting one or more selected from chicken, beef, pork, and ostrich meat. In the above, the legumes may be one or more selected from soybeans, kidney beans, peas, and black beans.

[0070] The 'feed composition' of the present invention may include one or more selected from nutrients and minerals in addition to the cereal powder, meat powder, and legumes, which are components added to conventional feeds mentioned above, in order to increase the nutritional value of the feed, and may include one or more selected from antifungal agents, antioxidants, anticoagulants, emulsifiers, and binders to prevent deterioration of feed quality.

[0071] The feed composition for preventing or improving atopic dermatitis according to the present invention can be prepared by adding a white tea extract within an appropriate effective concentration range according to various feed manufacturing methods known in the art.

[0072] The feed composition according to the present invention is not particularly limited to any individual intended for the prevention or improvement of atopic dermatitis, and can be applied to any of them. For example, it can be applied to any individual, such as non-human animals like monkeys, dogs, cats, rabbits, guinea pigs, rats, mice, cattle, sheep, pigs, goats, birds, and fish. Effects of the invention

[0074] The white tea extract of the present invention inhibits the expression of TARC and RANTES and inhibits the production of IL-5, IL-6, TNF-α and IL-1β, and IgE, thereby having a preventive, improving, or therapeutic effect on atopic dermatitis, and can be applied in various ways such as food compositions, health functional foods, pharmaceutical compositions, quasi-drug compositions, and feed compositions. Brief explanation of the drawing

[0076] Figure 1 shows the results of measuring TARC mRNA expression levels in canine macrophages. Figure 2 shows the results of measuring the expression level of RANTES mRNA in CPEK cells. Figure 3 shows the results of measuring the amount of IL-5 secreted for each treatment group. Figure 4 shows the entire process of inducing atopic dermatitis using a mouse. Figure 5 shows the results of ear thickness measurements over time after DNFB application in each treatment group. Figure 6 shows the disease severity scores for each treatment group. Figure 7 shows the results of measuring the amount of IL-6 secreted in ear tissue for each treatment group. Figure 8 shows the results of measuring IL-6 expression levels in ear tissue for each treatment group. Figure 9 shows the results of measuring the amount of TNF-α expression in ear tissue for each treatment group. Figure 10 shows the results of measuring the amount of IL-1β expression in ear tissue for each treatment group. Figure 11 shows the results of measuring the amount of IgE secreted in the blood for each treatment group. Figure 12 shows the results of measuring the mouse lymph node dLN area for each treatment group. Figure 13 shows the results of ear tissue H&E staining and microscopic analysis for each treatment group. Figure 14 shows the results of measuring ear tissue thickness for each treatment group. Specific details for implementing the invention

[0077] The present invention will be explained in more detail below through the following examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0079] Example 1. Method for preparing Baeksan tea extract

[0080] Baeksan tea was purchased from the market and used. The Baeksan tea leaves were ground into powder for extraction. Twenty times the volume of the Baeksan tea powder was mixed with 50% ethanol (EtOH), and the mixture was extracted at 50°C for 6 hours using an extractor (Heating Mantles For Extraction Apparatus With Stirring, mtop, Korea). The extract was filtered using Whatman No. 1 filter paper, then concentrated at 50°C using a rotary vacuum evaporator (NN series, Eyela, Tokyo, Japan) to remove all solvent, and subsequently freeze-dried for 3 to 4 days. The freeze-dried Baeksan tea extract was then dissolved in DMSO (Dimethyl Sulfoxide) and used in the experiment.

[0082] Example 2. Experiment to Confirm Immunomodulatory Effects of White Mountain Tea Extract

[0083] 2.1. Establishment of a Model for Evaluating Immunomodulatory Effects

[0084] To confirm the immunomodulatory and anti-inflammatory effects of the Baeksan tea extract prepared by the method of Example 1, an evaluation model using DH-82 canine macrophages was constructed. DH-82 canine macrophages were cultured at 37°C under 5% CO2 conditions using Eagle's Minimum Essential Medium (EMEM, ATCC, 30-2003) containing 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (PS). Cells with a passage number of less than 20 were used. To construct a lipopolysaccharide (LPS)-induced cellular inflammation model, DH-82 canine macrophages were placed in a 12-well plate at a rate of 2 x 10⁻¹⁰ 5 Cells were inoculated at a concentration of 1 / mL, and after 48 hours, 1 μg / mL of LPS was administered for 48 hours. To confirm the efficacy of the Baeksan tea extract, Baeksan tea extract was administered simultaneously with LPS at a concentration of 100 μg / mL for 48 hours. The establishment of an inflammation model was confirmed by examining the mRNA expression levels of the thymus and activation-regulated chemokine (TARC / CCL17) in the obtained cells.

[0085] Additionally, to confirm the immunomodulatory and anti-inflammatory effects of the Baeksan tea extract prepared by the method of Example 1, an evaluation model was established using a canine epidermal keratinocyte (CPEK) cell line. CPEK cells were cultured in canine epithelial proliferation medium (CELLNTEC, CnT-09) at 37°C under 5% CO2 conditions. Cells with a passage number of less than 10 were used. To establish a cellular inflammation model induced by LPS and TNF-α (tumor necrosis factor-α, recombinant canine TNF-α protein, 1507-CT-025), CPEK cells were placed in a 12-well plate at a rate of 2 x 10 5 Cells were inoculated at a concentration of 10 μg / mL LPS and 10 ng / mL TNF-α (recombinant canine TNF-alpha protein, 1507-CT-025) for 48 hours after inoculation, and after 48 hours, the cells were treated with 10 μg / mL LPS and 10 ng / mL TNF-α (recombinant canine TNF-alpha protein, 1507-CT-025). The establishment of an inflammation model was confirmed by checking the mRNA expression levels of RANTES / CCL5, a chemokine regulated upon activation and expressed and secreted by normal T cells, which are biomarkers related to inflammation, immunity, and atopic dermatitis, in the obtained cells.

[0086] Total RNA was extracted using the AccuPrep® Universal RNA Extraction Kit (Bioneer, Daejeon, Korea) according to the manufacturer's instructions. cDNA was synthesized from the extracted RNA using the ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). RT-PCR cycles were performed at 37°C for 15 minutes, 50°C for 5 minutes, and 98°C for 5 minutes according to the manufacturer's instructions. qRT-PCR was performed with a volume of 20 μL by mixing 10 μL of Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA), 0.1 μg of cDNA, and 1 μM of each primer (Table 1). Thermal cycling was performed using a StepOne Real-Time PCR system (Applied Biosystems), starting with initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 15 seconds at 95°C and 30 seconds at 60°C. Relative gene expression levels were standardized to the housekeeping gene β-actin. 2 -ΔΔCT The relative change in gene expression calculated using the method was expressed as a multiple change compared to the control sample.

[0087] gene primer Sequence (5' → 3') Sequence number TARC F GCCATCGTGTTTGTAACT 1 R CTCCCTTCCAGGTTCTTTGT 2 RANTES F CAGTCGTCTTTGTCACCCGA 3 R TGTACTCCCGCACCCATTTC 4 β-actin F TTCCGCTGCCCAGAGGCTCT 5 R GCTCAGGGGGTGCGATGATCTTG 6

[0088] 2.2. Confirmation of Immunomodulatory Effects of White Mountain Tea Extract

[0089] As shown in Example 2.1, to confirm the efficacy of the Baeksan tea extract, canine macrophages were treated with Baeksan tea extract at a concentration of 100 μg / mL simultaneously with LPS for 48 hours. As a result, it was confirmed that the expression level of TARC mRNA in LPS-stimulated DH-82 canine macrophages significantly increased, whereas the expression level of TARC significantly decreased when Baeksan tea extract was simultaneously treated (Fig. 1).

[0090] In addition, to confirm the efficacy of the Baeksan tea extract as in Example 2.1, CPEK cells were treated with Baeksan tea extract at a concentration of 100 μg / mL simultaneously with LPS and TNF-α for 48 hours. As a result, it was confirmed that the expression of RANTES mRNA in CPEK cells stimulated by LPS and TNF-α significantly increased, whereas the expression of RANTES significantly decreased when Baeksan tea extract was simultaneously treated (Fig. 2). Therefore, Baeksan tea was determined to be a material capable of regulating immunity through anti-inflammatory responses.

[0092] Example 3. Experiment evaluating the efficacy of Baeksancha extract using splenocytes of OVA-sensitized mice

[0093] 3.1. Establishment of OVA Sensitized Mouse Model System and Splenocyte Culture

[0094] As the spleen is an important organ for the immune system, experiments were conducted to measure immune activity by unicellularizing and culturing spleens taken from mice. Compared to measuring the activity of a single cell in a cell line, using splenocytes allows for the representation of an immune response relatively similar to the in vivo environment, as it utilizes a biological organ where complex immune reactions occur.

[0095] 5-week-old female BALB / c mice were purchased from Orient Bio (Gyeonggi, Korea) and acclimatized for one week in an environment with 23±2℃, 50±5% relative humidity, a 12-hour light-dark cycle, and free access to food and water. To induce hypersensitivity in the mice, egg white protein (ovalbumin: OVA) was mixed with the adjuvant Alum adjuvant (77161, Thermo) and administered intraperitoneally once a week at a final concentration of OVA 10 µg / head and Alum 1 mg / head. Intraperitoneal administration was performed twice at once a week, and subsequently, mice that had completed sensitization were sacrificed, and their spleens were harvested and used in the experiment.

[0096] The above spleen was unicellularized and used in the experiment. For cell culture, RPMI 1640 medium containing 10% FBS (Fetal bovine serum), 100 unit / ml penicillin, and 100 mg / ml streptomycin was used. After unicellularization, the excised spleen was treated with RBC (Red blood cell lysing buffer, Sigma) to count the cells. The counted cells were stored in 48-well cell culture plates at a final concentration of 5×10 6 OVA was added at a concentration of 80 μg / well to achieve a cell / well ratio. The white tea extract was incubated for 72 hours at 37°C under conditions providing 5% carbon dioxide (CO2), with a final concentration of 50 or 100 μg / mL. The culture supernatant after 72 hours of incubation was collected and used for ELISA measurement.

[0098] 3.2. Confirmation of Immunomodulatory Activity of Baeksan Tea Extract through Cytokine Measurement

[0099] The culture supernatant cultured for 2 hours as described in Example 3.1 was recovered, and an experiment was conducted using BD’s mouse IL-5 ELISA set kit according to the manufacturer’s instructions.

[0100] As a result, it was confirmed that IL-5 secretion significantly increased in cells stimulated by OVA, whereas IL-5 secretion significantly decreased in cells simultaneously treated with Baeksan tea extract. In addition, it was found that the higher the concentration of the Baeksan tea extract applied, the greater the IL-5 inhibitory effect, confirming that the hypersensitivity immunosuppressive effect of Baeksan tea extract is concentration-dependent (Fig. 3).

[0102] Example 4. Experiment to confirm the therapeutic effect of Baeksancha extract on atopic dermatitis using an atopic dermatitis mouse model

[0103] 4.1. Establishment of an Efficacy Evaluation Model for Atopic Dermatitis

[0104] Six-week-old male BALB / c mice (20–23 g) were purchased from Orient Bio (Gyeonggi, Korea) and acclimatized for one week in groups of four per cage in an environment with a temperature of 23±2℃, relative humidity of 50±5%, a 12-hour light-dark cycle, and free access to food and water. The mice were divided into a naive group (n=8), an atopic dermatitis-induced group (AD) (n=8), and an atopic dermatitis-induced and Baeksan tea extract-treated group (n=8), and body weight changes were measured once or twice a week.

[0105] For the oral administration method, the atopic dermatitis induction group (AD) and the group treated with the atopic dermatitis induction and Baeksan tea extract prepared by the method of Example 1 were administered orally every day for 2 weeks starting from the time of sensitization with DNFB (2,4-dinitrofluorobenzene) to induce atopic dermatitis (AD). The Naive and AD groups were administered PBS (Phosphate-buffered saline), while the Baeksan tea extract treatment group was administered Baeksan tea extract at a concentration of 200 mg / kg.

[0106] In addition, to induce disease in the ear, sensitization was performed by applying 20 μL of 0.5% (w / v) DNFB dissolved in an acetone / olive oil solution (acetone:olive oil = 1:3) to the surface of the ear, and starting from 3 days later, 20 μL of 0.3% (w / v) DNFB was applied to the surface of the ear at 3-day intervals to induce the disease four times. After a total of 20 days had elapsed, the animals were sacrificed (Fig. 4).

[0107] Subsequently, the data were analyzed using GraphPad Prism version 10.0 (GraphPad Software, USA), and statistical significance was confirmed through ANOVA and Dunnett's post hoc test (* < 0.05, ** < 0.01, *** < 0.001).

[0109] 4.2. Measurement of Ear Thickness and Disease Severity of Atopic Dermatitis-like Skin Lesions

[0110] The skin thickness and clinical score of the ear in which dermatitis was induced during the experimental period of Example 4.1 were measured the day after the application of DNFB. Ear thickness was measured in mm using a digital micrometer (HANDO), and the clinical symptoms of each mouse were rated as 0 (no symptoms), 1 (mild), 2 (moderate), and 3 (severe) based on the degree of erythema, edema, keratinization, and hemorrhage on the ear surface. The score of each individual was expressed as the average value between groups to indicate the severity of the disease over time.

[0111] It was confirmed that an increase in ear thickness was observed in the AD group compared to the Naive group starting from day 5 after the first induction. Additionally, while ear thickness showed a tendency to gradually increase with the number of DNFB applications and the elapsed time, results were confirmed that the increase in ear thickness was significantly inhibited in the Baeksan tea extract treatment group compared to the AD group starting from day 11 (Fig. 5).

[0112] Regarding disease severity, the AD group showed significantly higher clinical scores compared to the Naive group, whereas the clinical scores in the Baeksan tea extract treatment group decreased significantly compared to the AD group, confirming that Baeksan tea extract has a significant effect on alleviating the symptoms of atopic dermatitis (Fig. 6).

[0114] 4.3. Measurement of Cytokines in Ear Tissue

[0115] The ear tissue collected during the mouse necropsy of Example 4.1 was quantified, and 500 μL of T-PER (Tissue Protein Extraction Reagent, Thermo scientific, 78510) and an equal amount of 1.4 mm zirconium oxide beads (Zirconium oxide beads, Prevellys, P000927-LYSK0-A) were added. The mixture was then ground 8 times for 30 seconds at a frequency of 30.0 / s using TissueLyser II (Qiagen). The T-PER (Tissue Protein Extraction Reagent) containing the ground ear tissue was centrifuged at 10,000 rpm for 10 minutes, and the supernatant was collected and used as a protein sample for measuring cytokines in the ear tissue.

[0116] To measure the amount of IL-6 cytokine, an inflammatory marker associated with inflammatory cell infiltration and activity in ear tissue in an atopic dermatitis model, from the supernatant of homogenized mouse ear tissue, experiments were performed using the IL-6 BD OptEIA™ MOUSE ELISA (enzyme-linked immunosorbent assay) kit. Briefly, a capture antibody was added to a 96-well immunoplate and incubated overnight at 4°C to coat the plate with the antibody. After washing with washing buffer, a blocking process was performed by aliquoting 100 µL of PBS containing 10% FBS for 1 hour. Next, 100 µL of standard solution and the ear tissue supernatant were aliquoted into each well of the coated plate, incubated at room temperature for 2 hours, and then washed. Subsequently, 100 µL of a biotinylated primary antibody and a secondary antibody conjugated with streptavidin-horseradish peroxidase (streptavidin-HRP) were dispensed into each well and reacted at room temperature for 1 hour. After the reaction, a substrate solution was added and the color was developed at room temperature for 30 minutes. Then, 50 µL of a stop solution was added to each well to stop the color development reaction, and the absorbance was measured at 450 nm using a microplate reader to quantitatively calculate the IL-6 concentration.

[0117] As a result of measuring the secretion of IL-6 cytokine, it was confirmed that IL-6 secretion increased significantly in the DNFB-induced AD group compared to the naive group, whereas IL-6 secretion was significantly decreased in the Baeksan tea extract-treated group (Fig. 7).

[0118] In addition, mRNA expression levels of IL-6, TNF-α, and IL-1β, inflammatory cytokines associated with inflammatory cell infiltration and activation in ear tissues in atopic dermatitis, were measured. To measure expression levels, an equal volume of 1.4 mm zirconium oxide beads (Prevellys, P000927-LYSK0-A) as the tissue was added, and the sample was ground eight times for 30 seconds at a frequency of 30.0 rpm using a TissueLyser II (Qiagen). RNA from the ground tissue samples was extracted using the AccuPrep® Universal RNA Extraction Kit (Bioneer, Daejeon, Korea) according to the manufacturer's instructions. cDNA was synthesized from the extracted RNA using the ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). RT-PCR cycles were performed at 37°C for 15 minutes, 50°C for 5 minutes, and 98°C for 5 minutes according to the manufacturer's instructions. qRT-PCR was performed using a 20 μL volume prepared by mixing 10 μL of Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA), 0.1 μg of cDNA, and 1 μM of each primer (Table 2). Thermal cycling was performed using a StepOne Real-Time PCR system (Applied Biosystems); initial denaturation was carried out at 95°C for 5 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 30 seconds. Relative gene expression levels were standardized to the housekeeping gene β-actin. 2 -ΔΔCT The relative change in gene expression calculated using the method was expressed as a multiple change compared to the control sample.

[0119] gene primer Sequence (5' → 3') Sequence number IL-6 F TAGTCCTTCCTACCCCAATTTCC 7 R TTGGTCCTTAGCCACTCCTTC 8 TNF-α F GACGTGGAACTGGCAGAAGAG 9 R TTGGTGGTTTGTGAGTGTGAG 10 IL-1β F GCAACTGTTCCTGAACTCAACT 11 R ATCTTTTGGGGTCCGTCAACT 12 GAPDH F AGGTCGGTGTGAACGGATTTG 13 R TGTAGACCATGTAGTTGAGGTCA 14

[0120] As a result of the experiment, it was confirmed that the mRNA expression levels of IL-6, TNF-α, and IL-1β in the ear tissue of the AD group were significantly increased compared to the Naive group, whereas the mRNA expression levels of IL-6, TNF-α, and IL-1β in the Baeksan tea extract-treated group were decreased compared to the AD group (Figs. 8 to 10).

[0122] 4.4. Measurement of Immunoglobulins in Blood

[0123] Example 4.1 Blood was collected by orbital blood sampling during mouse necropsy, and serum was separated by centrifugation at 3000 rpm for 15 minutes. The separated serum was used to measure the total concentration of IgE, one of the major indicators of atopic dermatitis.

[0124] As a result of measuring serum IgE concentrations, it was confirmed that total IgE secretion increased significantly in the DNFB-induced AD group compared to the naive group, whereas IgE secretion decreased in the group treated with Baeksan tea extract. Through this, it was confirmed that Baeksan tea extract has an effect of inhibiting the oversecretion of IgE in an atopic dermatitis model (Fig. 11).

[0126] 4.5. Measurement of Draining Lymph Node (dLN) Area

[0127] Lymph nodes were collected from the necropsy mouse of Example 4.1, images of a specific size were acquired, and the dLN area was measured using the open-source program ImageJ (NIH, USA). The image was converted to an 8-bit format by selecting Image > Type > Select 8-bit, and a threshold value was set using the Image > Adjust > Threshold function. In this process, the dLN was clearly separated from the background, and the dLN size was analyzed using the Analyze-analyze particles function. The acquired dLN size values ​​were quantified by setting the size value of the Naive group to 1.

[0128] Based on the known fact that the size of dLNs increases in atopic dermatitis models, the size of dLNs in DNFB-induced mice was measured. It was confirmed that the size of dLNs significantly increased in the AD group compared to the naive group, whereas the size of dLNs significantly decreased in the group treated with Baeksancha extract (Fig. 12).

[0130] 4.6. Measurement of pathological changes in ear tissue

[0131] For histopathological evaluation, ear tissue collected during the mouse necropsy of Example 4.1 was fixed in a 10% (v / v) paraformaldehyde solution. The fixed ear tissue was dehydrated, cleared, and embedded to form a paraffin block, which was then sectioned to a thickness of 5 μm and attached to a slide. After deparaffinization, the ear tissue attached to the slide was stained with hematoxylin for nuclear staining and eosin for cytoplasmic staining. The stained tissue was dehydrated and cleared, then covered with a mounting solution and fixed with a cover glass. The completed H&E-stained ear tissue was observed using an Olympus BX40 microscope (Olympus, BX40).

[0132] As a result of observing pathological changes in ear tissue through H&E staining and microscopic analysis, it was confirmed that the infiltration of immune cells into the ear tissue and the tissue thickness were significantly improved compared to the AD group when treated with Baeksan tea extract, thereby alleviating symptoms of atopic dermatitis due to treatment with Baeksan tea extract (Figs. 13 and 14).

[0134] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Claim 1 A food composition for preventing or improving atopic dermatitis containing white tea extract as an active ingredient. Claim 2 A food composition according to claim 1, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or a mixture thereof. Claim 3 A food composition according to claim 1, characterized in that the composition inhibits the production of one or more selected from the group consisting of interleukin-5 (IL-5), interleukin-6 (IL-6), TNF-α, and interleukin-1β (IL-1β). Claim 4 A food composition according to claim 1, characterized in that the composition inhibits the production of IgE (immunoglobulin E). Claim 5 A food composition according to claim 1, characterized in that the composition inhibits the expression of one or more selected from the group consisting of TARC and RANTES. Claim 6 A health functional food for the prevention or improvement of atopic dermatitis containing white tea extract as an active ingredient. Claim 7 A health functional food according to claim 6, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or a mixture thereof. Claim 8 In claim 6, the health functional food is characterized by inhibiting the production of one or more selected from the group consisting of interleukin-5 (IL-5), interleukin-6 (IL-6), TNF-α, and interleukin-1β (IL-1β). Claim 9 In claim 6, the above health functional food is characterized by inhibiting the production of IgE (immunoglobulin E). Claim 10 In claim 6, the above health functional food is characterized by inhibiting the expression of one or more selected from the group consisting of TARC and RANTES. Claim 11 A pharmaceutical composition for the prevention or treatment of atopic dermatitis comprising white tea extract as an active ingredient. Claim 12 A pharmaceutical composition according to claim 11, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or a mixture thereof. Claim 13 A pharmaceutical composition according to claim 11, characterized in that the composition inhibits the production of one or more selected from the group consisting of interleukin-5 (IL-5), interleukin-6 (IL-6), TNF-α, and interleukin-1β (IL-1β). Claim 14 A pharmaceutical composition according to claim 11, characterized in that the composition inhibits the production of IgE (immunoglobulin E). Claim 15 A pharmaceutical composition according to claim 11, characterized in that the composition inhibits the expression of one or more selected from the group consisting of TARC and RANTES. Claim 16 A quasi-drug composition for preventing or improving atopic dermatitis containing white tea extract as an active ingredient. Claim 17 A quasi-drug composition according to claim 16, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or a mixture thereof. Claim 18 A quasi-drug composition according to claim 16, characterized in that the composition inhibits the production of one or more selected from the group consisting of interleukin-5 (IL-5), interleukin-6 (IL-6), TNF-α, and interleukin-1β (IL-1β). Claim 19 A quasi-drug composition according to claim 16, characterized in that the composition inhibits the production of IgE (immunoglobulin E). Claim 20 A quasi-drug composition according to claim 16, characterized in that the composition inhibits the expression of one or more selected from the group consisting of TARC and RANTES. Claim 21 A feed composition for preventing or improving atopic dermatitis containing white tea extract as an active ingredient. Claim 22 A feed composition according to claim 21, wherein the extract is a crude extract obtained by extraction with a solvent selected from the group consisting of water, alcohols having 1 to 4 carbon atoms, or a mixture thereof. Claim 23 A feed composition according to claim 21, characterized in that the composition inhibits the production of one or more selected from the group consisting of interleukin-5 (IL-5), interleukin-6 (IL-6), TNF-α, and interleukin-1β (IL-1β). Claim 24 A feed composition according to claim 21, characterized in that the composition inhibits the production of IgE (immunoglobulin E). Claim 25 A feed composition according to claim 21, characterized in that the composition inhibits the expression of one or more selected from the group consisting of TARC and RANTES.

Images