Immunostimulant RNA molecules and their compositions, vaccines and kits

Abstract

The present invention provides an immune-enhancing RNA molecule, a composition thereof, a vaccine, and a kit, which belong to the field of biotechnology. The present invention provides an RNA molecule, wherein the coding region of the RNA molecule includes an HSP domain, a SIG domain, and an AN domain, and the HSP domain encodes an HSP protein family or a variant, fragment, or derivative thereof. The HSP protein family includes full-length, truncated, and mutant forms of HSP70 and its cognate proteins, which enhance antigen-specific immune responses by multi-dimensionally increasing antigen uptake, activation levels, and antigen presentation. Furthermore, the present invention provides a composition, a vaccine, and a kit comprising the RNA molecule, which can be applied to the prevention and treatment of various diseases such as cancer, infectious diseases, autoimmune diseases, hypersensitivity reactions, or graft-versus-host disease.

Description

Technology Field

[0001] The present invention claims priority to the Chinese patent application No. 202410234227.6, filed with the Chinese Intellectual Property Office on March 1, 2024, with the title of the invention “Immune-enhancing RNA molecule and composition thereof, vaccine and kit”. The entire contents of the application are incorporated by reference.

[0002] The present invention belongs to the field of biotechnology and, specifically, relates to an immune-enhancing RNA molecule and its composition, as well as vaccines and kits. Background Technology

[0003] DNA vaccines are vaccines that transfect immune target cells with DNA sequences encoding specific antigens. The mechanism of action of DNA vaccines involves injecting genetically engineered plasmids containing DNA sequences encoding antigens that trigger the required immune response, thereby causing cells to directly produce the antigens and induce a protective immune response. Unlike traditional protein subunit vaccines and viral vector vaccines, DNA vaccines trigger an immune response by injecting DNA sequences into the body, after which the body's cells utilize this DNA to synthesize antigen proteins. Various companies and research institutions are conducting research on DNA vaccines for a wide range of diseases, including AIDS, influenza, malaria, and oncology. However, to date, no DNA vaccine products have been approved worldwide, due to the following challenges facing DNA vaccines.

[0004] (1) Efficacy and Durability: The efficacy and durability of DNA vaccines are inferior to those of traditional vaccines, requiring further research and improvement; this is attributed to the difficulty in generating sufficient antigen proteins within cells, which prevents DNA vaccines from eliciting a strong immune response. (2) Delivery Method: DNA vaccines require a specialized delivery system to ensure that DNA is effectively taken up by cells and subsequently transcribed and translated; this process demands higher technical capabilities. Currently, electroporation is the primary delivery method, which may limit the application of DNA vaccines. (3) Safety: In-depth research is still needed regarding the long-term safety of DNA vaccines, particularly concerning potential genetic modifications or side effects.

[0005] To enhance the efficacy of DNA vaccines, various enhancers have been designed and introduced into the DNA, and the major types are as follows.

[0006] (1) Secretion-promoting elements: After electroporation, DNA vaccines are primarily ingested by muscle cells at the injection site. Since these cells have low antigen presentation and antigen-specific T cell activation capabilities, adding secretion-promoting elements to induce the secretion of antigen proteins outside the cells allows antigen-presenting cells (APCs), such as dendritic cells (DCs), to ingest the antigens more effectively. For example, the VGX-3100 HPV DNA vaccine includes an IgE leader peptide to induce protein synthesis and secretion; the GX-188 DNA vaccine includes a tissue fibrinogen activator (tPA) leader peptide to help the fusion protein enter the secretory pathway. (2) Antigen presentation-promoting elements: Since the complete antigen protein itself is not directly recognized by T cells, complexes of polypeptides and MHC formed by DCs ingesting and processing the antigen are presented on the surface of the DCs to activate antigen-specific T cell responses. The introduction of antigen presentation-promoting elements can enhance antigen presentation and improve the strength of antigen-specific T cell responses. For example, there are cases where Flt3L, CRT, and HSP70 have been introduced into the GX-188 DNA vaccine. (3) DC targeting element: This activates the processing and presentation of the antigen and subsequent antigen-specific T cell response levels by causing the fusion antigen to be more uptaken by target cells such as DCs. For example, CTLA-4 is being applied in preclinical studies.

[0007] However, despite the introduction of these enhancement elements, the efficacy of DNA vaccines falls short of expectations, which is attributed to the inherently limited potency of DNA vaccines. Unlike DNA vaccines, mRNA encoding antigens must enter the cytoplasm and be directly translated to produce target proteins. The field of mRNA vaccines has recently advanced rapidly. mRNA is recognized as an innovative technology in the biopharmaceutical sector and can be utilized in various fields, including tumor treatment, preventive vaccines, and the development of drugs for metabolic diseases. The core objective of mRNA vaccines is to treat diseases by delivering mRNA encoding antigen proteins into the human body to translate those proteins and induce the body to generate a specific immune response. Compared to traditional drugs, mRNA drugs possess advantages such as rapid onset of efficacy, high safety, diverse target selectivity, and ease of production and development. Currently, mRNA technology is being increasingly applied in clinical practice and has been widely utilized in drug research and development, including COVID-19 and oncology vaccines. During the COVID-19 pandemic, the superior short-term preventive effects of mRNA vaccines were extensively demonstrated, and the U.S. FDA designated mRNA oncology vaccines as breakthrough therapies. Katarin Carico, who invented the nucleoside modification technology that played a key role in the development of COVID-19 mRNA vaccines ) and Drew Weissman won the 2023 Nobel Prize in Physiology or Medicine, contributing significantly to the advancement of the mRNA vaccine field.

[0008] Currently, research on immune-enhancing elements in mRNA vaccines is limited. BioNTech can improve the presentation of MHC I and II epitopes in human and mouse DCs by combining the N-terminal leader peptide of an MHC I molecule with the C-terminal MHC I transport signal (MITD) and introducing them into the mRNA sequence encoding the target antigen. There are currently no other enhancement elements available for mRNA vaccines. Furthermore, the development of strategies to significantly improve antigen-specific T cell responses by simultaneously enhancing antigen targeting of DCs, DC activation, and antigen presentation is still lacking. The problem to be solved

[0009] In response to the above defects, the present invention provides an immune-enhancing RNA molecule, a composition thereof, a vaccine, and a kit. The present invention provides an RNA molecule comprising an HSP domain, a SIG domain, and an AN domain in the coding region of the RNA molecule, wherein the HSP domain encodes an HSP protein family or a variant, fragment, or derivative thereof. The HSP protein family includes full-length, truncated, and mutant forms of HSP70 and its cognate proteins, which enhance antigen-specific immune responses by multi-dimensionally increasing antigen uptake, activation levels, and antigen presentation. Furthermore, the present invention provides a composition, a vaccine, and a kit comprising the RNA molecule, which can be applied to the prevention and treatment of various diseases such as cancer, infectious diseases, autoimmune diseases, hypersensitivity reactions, or graft-versus-host disease.

[0010] Based on unexpected findings, the present invention confirmed that antigen fusion functional combination elements within RNA vaccines effectively target these antigens to dendritic cells (DCs), activate DCs, and enhance antigen presentation, thereby improving antigen-specific T-cell immune responses and antibody production levels. These functional combination elements include full-length, truncated, and mutant forms of HSP70 and its cognate proteins, and the sequences of the HSP70 protein and related forms effectively increase the levels of antigen uptake, presentation, and activation of antigen-presenting cells (APCs), such as DCs. The above HSP70 protein and related forms include wild-type and mutant HSP70, HSP10, HSP27, HSP40, HSP60, HSP90, HSP110, gp96, caleticulin, etc., as well as other inductive forms such as truncated and mutant forms thereof. The above secretion-promoting sequence can promote the secretion of antigens outside the cell, and the antigens secreted outside the cell help APCs, such as DCs, to effectively ingest, process, and utilize the HSP70-antigen fusion protein for antigen presentation. Therefore, unlike other existing technologies, the immune enhancement method of the present invention can simultaneously promote antigen ingestion, presentation, and activation levels of DCs following RNA vaccine immunization, thereby enhancing antigen-specific immune responses in multiple ways. APCs, such as DCs, that have ingested the nucleic acid vaccine can directly improve antigen presentation and activation levels; and muscle cells that ingest the nucleic acid vaccine at the injection site and lack antigen-presenting ability secrete the fusion antigen protein outside the cell, which the DCs ingest and subsequently process to contribute to antigen presentation.

[0011] The objective of targeting and enhancing antigen presentation while simultaneously activating DCs is achieved by utilizing the full-length amino acid sequence or a desired specific domain (e.g., SBD) of HSP70 and its cognate proteins together with a suitable signal peptide having targeting and secretion-promoting functions. The immune enhancement strategy presented herein utilizes the functions of HSP70 and its cognate proteins in targeting DCs, enhancing antigen presentation, and promoting DC activation in full-length, truncated, and mutant forms. HSP70 binds to CD91 on the surface of DCs to promote DC antigen uptake and activates the expression of DC co-stimulatory molecules and cytokines through downstream signals, while HSP70 enters the endoplasmic reticulum via a co-degradation peptide fragment to enhance antigen presentation. Therefore, the immune enhancement method introduced herein improves antigen-specific immune responses in various ways by utilizing the characteristics of DC antigen uptake, DC antigen presentation, and activation level enhancement mediated by HSP70 and related proteins. means of solving the problem

[0012] To this end, the present invention prepared RNA molecules encoding such antigen fusion proteins and investigated their therapeutic potential in tumor models. Accordingly, target antigenic proteins, peptides, or epitopes are linked to selective domains or full-length proteins derived from several HSP70 and related proteins. Typically, nucleic acid constructs are designed by linking antigens / epitopes to selective domains or full-length proteins of HSP70 and related proteins. They may include signaling peptides, which optimize transport and fixation to intracellular vesicular compartments and extracellular membrane locations. Additionally, suitable linker sites may be introduced to allow MHC type I and type II molecules to correctly present immunogenic peptides. They may include T helper cell epitopes to increase the induction of antigen-specific immune responses to the encoded epitopes. This design strategy allows specific epitopes or complete antigens to be targeted and enriched into cellular compartments rich in MHC type I and type II molecules.

[0013] Unexpectedly, the immune-enhancing antigen RNA complex can effectively induce antigen-specific T cell responses and demonstrated an effect of effectively inhibiting tumor growth in a mouse model.

[0014] The novel immune enhancement method presented in the text provides a simple and effective means to desirablely secure enhanced antigen presentation. Accordingly, the immune enhancement strategy preferably enhances the induction of an antigen-specific immune response to an antigenic peptide, protein, or epitope, and opens up new possibilities for improving the therapeutic efficacy of RNA vaccines.

[0015] In the present invention, the term “RNA molecule” may be understood as a non-natural RNA molecule. Such RNA molecules may be non-natural due to a unique sequence (which is a sequence that does not exist naturally) and / or other modifications such as structural modifications of nucleotides that do not exist naturally. Typically, artificial nucleic acid molecules corresponding to a desired artificial nucleotide sequence (heterogeneous sequence) can be designed or generated through genetic engineering methods. In this case, the artificial sequence is typically a sequence that does not exist naturally, i.e., differs from the wild-type sequence by at least one nucleotide. The RNA molecule of the present invention may encode an antigenic polypeptide construct, which comprises full-length, truncated, and mutant amino acid sequences derived from several (identical or different) HSP70 and its cognate proteins, several (identical or different) RNA antigenic peptides or proteins, and other (poly)peptides, proteins, or protein domains (e.g., signal peptides, peptide linkers, T-auxiliary epitopes) in any combination disclosed herein. However, the RNA molecule of the present invention is considered to encode an “antigenic polypeptide construct,” which comprises at least one antigenic peptide or protein and at least one full-length, truncated, and mutant amino acid sequence of HSP70 and its cognate protein.

[0016] In the present invention, the term “wild-type RNA molecule” can be understood as a naturally occurring sequence.

[0017] In the present invention, the term “stabilized RNA molecule” refers to an RNA molecule that is more stable against degradation or decay by environmental factors or enzymatic digestion, such as exonucleases or endonucleases, compared to an unmodified RNA molecule. Preferably, in the context of the present invention, the stabilized nucleic acid molecule is stable in prokaryotic or eukaryotic cells, preferably in human cells among mammalian cells. Stabilization may be achieved outside the cell, such as in a buffer solution, or during the process of preparing a pharmaceutical composition containing the stabilized nucleic acid molecule.

[0018] In the present invention, the term “RNA” generally refers to a commonly used abbreviation for ribonucleic acid, which is a nucleic acid molecule, namely a polymer composed of nucleotides. These nucleotides are typically adenosine monophosphate monomers, uridine monophosphate monomers, guanosine monophosphate monomers, and cytidine monophosphate monomers, which are linked to each other by a backbone. The backbone is formed by phosphodiester bonds between the ribose, which is the sugar portion of the first monomer, and the phosphate portion of the second adjacent monomer. A specific sequence of monomers is referred to as an RNA sequence.

[0019] The engineered combination RNA sequence described in the text comprises a sequence encoding a leader peptide / signal peptide, wherein the protein expressed in this region enables the auxiliary antigen sequence to perform (a) organelle targeting and (b) extracellular secretion functions, ultimately influencing the DC targeting and uptake of the protein expressed by the RNA drug. Preferably, at least one of the leader sequence / signal peptide proteins has these functions. To avoid being limited by any specific theory, it is considered that any organelle localization protein or secretory protein may utilize a portion of its sequence. Alterations to the localization of the antigen protein affect the therapeutic effect of the RNA drug.

[0020] In the present invention, the term “leader sequence” refers to a sequence located prior to the coding region of a structural gene, which is transcribed but not translated. The leader peptide contains all the information necessary for protein localization of a cell organelle.

[0021] In the present invention, the term “signal peptide” refers to a short peptide chain that guides a newly synthesized protein to be secreted outside the cell, and means an N-terminal amino acid sequence that guides the transmembrane transport of the protein within the newly synthesized polypeptide chain. Almost all secreted proteins contain a signal sequence, and the signal sequence generally consists of 20 to 40 amino acids and is ultimately removed by a signal peptide hydrolase during transmembrane transport.

[0022] In the present invention, the term “cell organelle resident protein” refers to a functional protein that is formed only after a polypeptide chain enters the endoplasmic reticulum cavity, folds, and is assembled. Some of these proteins are transported to other parts of the cell, while others remain in the endoplasmic reticulum; the latter are called endoplasmic reticulum resident proteins, and these proteins contain four specific amino acid residues in a carboxyl group as a resident signal. These resident proteins can assist in the folding and assembly of proteins that need to be transferred.

[0023] In the present invention, the term “secreted protein” refers to a protein, such as enzymes (primarily synthesized by attached ribosomes), antibodies, and some hormones (e.g., protein-based hormones), that is synthesized within a cell and then secreted outside the cell to exert its effects. Secreted proteins synthesized in ribosomes are not transported directly to the cell membrane but must pass through the endoplasmic reticulum and the Golgi apparatus.

[0024] The above-mentioned organelle resident proteins or signal peptide proteins include, but are not limited to, the proteins listed in Table 1 below:

[0025] Table 1

[0026]

[0027] Accordingly, the leader sequence / signal peptide used in the present invention is expressed by fusing with the antigen, but is ultimately not realized within the antigen protein and influences the localization or secretion of the antigen protein within the cellular organelle. Additionally, the cellular organelle-resident protein or secreted protein presented in the present invention may be expressed by directly fusing with the antigen sequence, thereby conferring a function corresponding to that of the antigen protein. Preferably, the leader sequence / signal peptide assists in antigen translation or significantly promotes the secretion of the antigen to induce other immune cells to ingest it, thereby increasing the maximum utilization efficiency of nucleic acid drugs to provide a more potent immune effect.

[0028] In the present invention, the term “linker” refers to a short peptide, also called a linker molecule, that serves to connect an antigen and an immuno-enhancing protein within a fusion protein and is expressed by being fused to the antigen and the immuno-enhancing protein. As an essential component in fusion protein recombination, the linker molecule plays a crucial role in constructing a fusion protein that is stable and biologically active. The linker molecule is an amino acid chain that acts as a link between two fusion proteins and possesses a certain degree of flexibility, allowing both proteins to function independently. Protein linker molecules are typically classified into three types: flexible linker molecules, rigid linker molecules, and cleavable linker molecules. The linker molecule should generally be between 10 and 15 amino acids and should not be too long or too short. If the linker molecule sequence is too long, the yield of the fusion protein decreases and immunogenicity problems may occur; if the linker molecule sequence is too short, the gap between the two proteins becomes excessively close, affecting high-dimensional structural folding and causing mutual interference, which may result in loss of protein function. The secondary structure within the linker molecule can limit the flexibility of the fusion protein, thereby affecting the functional activity of the fusion protein;

[0029] The above rigid linker molecule is primarily helical in structure, is proline-rich, and its major structure is (EAAAK)m, (XP)n. This maintains the distance between the two fusion protein domains;

[0030] The above-mentioned cleavable linker molecule is typically composed of amino acids capable of forming disulfide bonds, and its sequence can be degraded by proteases, often resulting in the separation of the two connected protein components within the body;

[0031] The above-mentioned flexible linker molecule is composed mainly of small, hydrophilic amino acids, and its main structure is (GSSS)m, (G)n; it enhances the spatial separation of the two domains to ensure interactions between specific domains of the two fusion proteins.

[0032] In the present invention, a flexible linking molecule of the GS sequence is selected to maintain a certain degree of freedom at the ends of the antigen and the immune-enhancing protein, thereby preventing mutual interference between the two proteins while significantly shortening the length of the nucleic acid sequence, thus avoiding the formation of unnecessary secondary structures and allowing the nucleic acid sequence to be expressed more easily.

[0033] In the present invention, the terms “peptide” or “polypeptide” typically refer to a polymer of amino acid monomers linked by peptide bonds. This typically comprises fewer than 50 monomer units. However, the term “peptide” does not exclude molecules comprising 50 or more monomer units. Typically, a long peptide having 50 to 600 monomer units is also referred to as a polypeptide.

[0034] In the present invention, the term “protein” typically comprises one or more peptides or polypeptides. Proteins are typically folded into a three-dimensional shape necessary for performing biological functions.

[0035] In the present invention, the term “derived from” typically means that a sequence is separated from, related to, based on, or homologous to a reference sequence. Accordingly, “derived from” a reference sequence includes a sequence identical to said reference sequence (i.e., a full-length sequence exhibiting 100% sequence identity with said reference sequence) and variants, fragments, and derivatives of said reference sequence. This definition applies to both amino acid sequences and nucleic acid sequences.

[0036] In the present invention, the term “derivative” refers to a modified reference or parent (poly)peptide, protein, or amino acid sequence that may acquire or lose additional biological properties or functions. For example, a derivative may be modified by introducing or removing structural domains that confer specific biological functions, such as the ability to bind to (another) target or enzymatic activity. Other modifications may modulate pharmacokinetic / pharmacodynamic properties, such as stability, biological half-life, bioavailability, absorption, distribution, and / or reduced clearance. A “derivative” may be prepared by introducing or deleting amino acid sequences post-translationally or at the nucleic acid sequence level. A “derivative” corresponds to a modified full-length wild-type (poly)peptide, protein, or amino acid sequence, or its allomorphs, homologs, fragments, or variants. The term “derivative” further comprises (poly)peptides, proteins, or amino acid sequences that are capable of undergoing post-translational chemical modification or modifications such as PEGylation or PAS-ization.

[0037] In the present invention, the term “(poly)peptide / protein variant” typically means “sequence variant,” i.e., a (poly)peptide or peptide protein having an amino acid sequence in which at least one amino acid residue differs from the reference amino acid sequence of the reference (poly)peptide or protein. Accordingly, the variant (poly)peptide or variant protein may preferably include at least one amino acid mutation, substitution, insertion, or deletion in the amino acid sequence compared to each reference sequence. Substitutions may be selected from conservative or non-conservative substitutions. The (poly)peptide variant or protein variant may include at least one conservative amino acid substitution, wherein amino acids derived from the same category are exchanged with one another. In the present invention, a (poly)peptide variant or a protein variant means a (poly)peptide / protein having at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the amino acid sequence of a naturally occurring wild-type (poly)peptide / protein or its fragments and derivatives. Preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, further more preferably at least 90%, most preferably at least 95% or 97%.

[0038] In the present invention, the term “(poly)peptide / protein variant fragment” typically refers to a (poly)peptide / protein composed of a continuous subsequence of the full-length amino acid sequence of a reference (poly)peptide / protein, wherein this amino acid sequence may be cleaved at the N-terminus, C-terminus, and / or within the sequence compared to the amino acid sequence of the reference (poly)peptide / protein. This cleavage may occur at the amino acid level or at the nucleic acid level, respectively. In other words, “fragment” typically refers to a short portion of the full-length sequence of an amino acid sequence. Thus, a fragment typically consists of a sequence identical to the corresponding fragment within the full-length amino acid sequence. This term includes naturally occurring fragments (e.g., fragments generated through the activity of naturally occurring in vivo proteases) and engineered fragments. In the present invention, a (poly)peptide / protein fragment may mean a (poly)peptide / protein having an amino acid sequence comprising at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, or at least 250 consecutive amino acid residues.In the context of the present invention, a preferred sequence fragment consists of a continuous fragment of nucleic acid, and this continuous fragment of nucleic acid corresponds to a continuous fragment of the nucleic acid or gene entity that derived the said fragment, which represents at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, and most preferably at least 80% of the whole (i.e., whole length) nucleic acid sequence or gene that derived the said fragment. It is preferable that the sequence identity represented by such a fragment refers to the whole nucleic acid sequence or gene. Preferably, the “fragment” may comprise a nucleic acid sequence having at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the reference nucleic acid sequence or gene that derives them. Preferably, at least 70%, preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% or even 97% sequence identity.

[0039] In the present invention, the term “HSP protein family” refers to a type of cellular chaperone protein produced after living cells are stimulated by a stressor, which exerts important functions in the activation of lymphocytes and macrophages, antigen progenitor and cross-presentation pathways, acting as an adjuvant to enhance the immunogenicity of antigens, and regulating the in vivo immune response. Heat shock proteins (HSPs) perform important regulatory functions as immune adjuvants. These include, but are not limited to, HSP70, HSP10, HSP27, HSP40, HSP60, HSP90, HSP110, HSPE1, HSPB1, HSPB3, gp96, or full-length, truncated, or mutant elements of caleticulin. The HSP protein family includes, but is not limited to, the proteins listed in Table 2 below:

[0040] Table 2

[0041]

[0042] According to a preferred embodiment, the immune-enhancing RNA composition of the present invention may encode at least one full-length, truncated, and mutant amino acid sequence of at least one HSP and its cognate protein in at least one coding region.

[0043] In the present invention, the term “HSP domain” is a functional combination element and includes full-length, truncated, and mutant forms of the HSP protein family; the HSP domain preferably precisely targets an antigenic protein or polypeptide to a target cell compartment and enhances antigen presentation to enhance an antigen-specific immune response. Fusing an antigenic peptide or protein with a functional combination element sequence can simultaneously enhance the antigen’s ability to target dendritic cells (DCs), DC activation, and antigen presentation, thereby enhancing the antigen-specific T cell immune response and antibody production levels; the HSP domain guides the antigenic protein or peptide (preferably in a fused form) to MHC type I and MHC type II processing compartments to enhance CD8+T / CD4+T cell responses, thereby increasing CD8+ CTL / CD4+ CTL and / or antibody-mediated immunity.

[0044] In the present invention, HSP70 is composed of a 45 kDa N-terminal nucleotide binding domain and a 25 kDa C-terminal substrate binding domain:

[0045] The N-terminal nucleotide-binding domain (NBD) is also known as the ATP enzyme domain. The NBD has the function of binding to and hydrolyzing ATP, and consists of two subdomains (I and II), which are further divided into four subdomains (IA, IIA, IB, IIB). A gap exists between the two subdomains, I and II, and the nucleotide binding sites are located at the bottom of this gap. When ATP is hydrolyzed into ADP, the stereochemical structure of the NBD changes.

[0046] The C-terminal substrate-binding domain (SBD), also known as the peptide binding domain, is located between amino acids 394 and 509. The SBD consists of a β-sandwich domain (β-SBD) containing substrate binding sites and a flexible α-helical cap domain (α-SBD) capable of regulating affinity for misfolded proteins. The types and stereostructures of SBD domains are highly heterogeneous and include N-terminal, C-terminal, and intermediate domains. A common characteristic of these various SBD domains is that they possess surface properties, such as hydrophilicity, lipophilicity, or charge distribution, enabling them to recognize and bind to substrate molecules.

[0047] HSP70 instantaneously binds to short hydrophobic peptide fragments within substrate proteins via SBD to aid in protein folding; consequently, the cyclic process of substrate binding and unbinding is facilitated by the conversion of ATP / ADP within NBD. The key to HSP70's molecular chaperone function lies in the conversion between the open and closed stereochemical configurations of SBD. When NBD and ATP are bound, the substrate binding cavity of SBD assumes an open stereochemical configuration, causing α-SBD and β-SBD to separate and come into contact with different faces of NBD, thereby allowing SBD to exhibit low affinity and a rapid exchange rate toward the substrate. When ATP binds to NBD, the binding affinity of SBD to the substrate protein becomes relatively weak. Conversely, when ADP binds to NBD, the stereochemical change increases the affinity of SBD toward the substrate protein.

[0048] The “RNA molecule” of the present invention encodes a full-length antigenic peptide or protein, or preferably a fragment thereof. The fragment may include or be composed of (functional) epitopes of said antigenic peptide or protein. Preferably, said fragment or epitope is expressed within a host cell within an MHC type I, preferably MHC type II, processing compartment, and may be recognized by immune cells, immune cell receptors, and antibodies of the adaptive immune system. The “antigenic peptide or protein” that undergoes processing by intracellular mechanisms and is presented to immune cells on the MHC molecule, preferably inducing an antigen-specific immune response, may be the RNA molecule of the present invention, and preferably is a translation product of RNA.

[0049] The "antigenic peptide or protein" of the present invention typically means any (poly)peptide or protein that can interact with or be recognized by a component of the immune system (e.g., an antibody or immune cell) under suitable conditions. The antigenic peptide or protein preferably interacts with or is recognized by a component of the immune system through its “epitope” or “antigenic determinant.” The antigenic peptide or protein comprises a “poly”peptide of at least one (functional) epitope, a “poly”peptide composed of at least one (functional) epitope, or a (poly)peptide capable of providing at least one (functional) epitope. The selection of a suitable antigenic peptide or protein typically depends on the pathology or disease to be treated or prevented. Typically, an RNA molecule may encode any antigenic peptide or protein (or any necessary combination of antigenic peptides or proteins) in at least one coding region.

[0050] In the present invention, the term “tumor antigen” refers to an antigenic substance that is newly generated or overexpressed during the development and progression of a tumor. The mechanisms by which tumor antigens are generated in living organisms are as follows: ① gene mutation; ② activation of genes that were not originally expressed during the process of cell carcinogenesis; ③ partial abnormality during the antigen synthesis process (e.g., generation of protein-specific degradation products due to glycosylation abnormalities); ④ abnormal or ectopic expression of embryonic antigens or differentiation antigens; ⑤ overexpression of certain gene products, particularly signaling molecules; ⑥ expression of exogenous genes (e.g., viral genes). There are various classification methods for tumor antigens, and there are two widely accepted classification methods. The first is a classification based on the specificity of the tumor antigen, which divides tumor antigens into tumor-specific antigens and tumor-associated antigens; and the second is a classification based on the circumstances of tumor induction and development, which divides tumor antigens into tumor antigens induced by chemical or physical factors, virus-induced tumor antigens, spontaneous tumor antigens, embryonic antigens, differentiation antigens, and overexpressed antigens.

[0051] The aforementioned “tumor-specific antigen” refers to a novel antigen that is unique to tumor cells or exists only in specific tumor cells and is absent in normal cells. This antigen is demonstrated in tumor transplantation experiments between allogeneic animals and is also referred to as tumor-specific transplantation antigen or tumor rejection antigen; most of the antigens falling into this category include tumor antigens induced by chemical or physical factors, spontaneous tumor antigens, and virus-induced tumor antigens.

[0052] The aforementioned “tumor-associated antigen” refers to an antigen that is not unique to tumor cells but is present in normal cells and other tissues, yet whose content increases significantly upon cellular carcinogenesis. This antigen exhibits only quantitative differences and does not display strict tumor specificity. A representative example is embryonic antigen.

[0053] The aforementioned “tumor antigens induced by chemical or physical factors” exhibit high antigenicity and low antigenicity, as well as distinct individual specificity. Even tumors induced by the same type of chemical carcinogen or physical radiation show varying immunogenicity depending on the individual within a specific race or lineage, or by specific site within the same individual. Since there are almost no cross-components between mutant tumor antigens, there are difficulties in diagnosing and treating these tumors using immunological techniques.

[0054] The above “virus-induced tumor antigen” refers to an antigen produced by a virus (including DNA viruses or RNA viruses). For example, hepatitis B and C viruses (HBV, HCV) are associated with primary liver cancer. A characteristic feature is that they possess strong antigenicity. Although these antigens are encoded by viral genes, they are distinguished from the virus itself and are referred to as virus tumor-associated antigens.

[0055] The aforementioned “spontaneous tumor antigens” are antigens that arise in tumors without a clear inducing factor. Their characteristic is that some possess unique antigenicity similar to chemo-induced tumors, while others possess common antigenicity similar to viral induction.

[0056] The aforementioned “embryonic antigens” are normal components produced by embryonic tissues during the embryonic development stage; they decrease in the late embryonic stage and gradually disappear or remain in minute quantities after birth, but these antigens are resynthesized when cells become cancerous. There are two types of these: alpha-fetoprotein and carcinoembryonic antigens.

[0057] The aforementioned “differentiation antigens” are normal molecules expressed during the development of biological organs and cells. Since malignant tumor cells typically remain in an immature stage of cell development and resemble undifferentiated embryonic cells in both form and function, this process is referred to as dedifferentiation or retrodifferentiation of tumor cells. Consequently, tumor cells can express differentiation antigens from other normal tissues; for example, gastric cancer cells can express ABO blood group antigens or embryonic differentiation antigens of the corresponding tissue itself. Melan-A, gp100, and tyrosinase are examples of such antigens.

[0058] The aforementioned “overexpressed antigen” refers to an antigen in which tissue cells, after becoming cancerous, overexpress multiple signaling molecules at levels much higher than those of normal cells. These signaling molecules may be normal proteins or mutant proteins, and this overexpression possesses anti-apoptotic activity and helps the long-term survival of tumor cells. Such antigens include gene products such as ras and c-myc. These antigens are recognized by immune cells, and antigen-presenting cells can be destroyed by cytotoxic T cells. Additionally, tumor antigens may exist on the surface of tumors in the form of mutant receptors and are recognized by antibodies.

[0059] In the present invention, the term “homologous-heterogeneous antigen” is also referred to as homologous antigen or heterologous antigen, and is an antigenic substance present in different individuals of the same species (excluding identical twins) of humans and animals of the same species. When cells or tissues of one individual enter another living organism, they can induce an immune response. Both red blood cell blood group antigens and leukocyte antigens in human blood belong to this category. For example, if type A red blood cells are transfused to a type B living organism, anti-A antibodies in the body of type B agglutinate the type A red blood cells, and the type A red blood cells are hemolyzed under the participation of complement, thereby causing a transfusion reaction. RNA encoding an antigenic protein or peptide derived from the homologous-heterogeneous antigen is provided, and, for example, immune tolerance to the said homologous-heterogeneous antigen can be induced.

[0060] In the present invention, the term “autoantigen” refers to a self tissue component capable of inducing an autoimmune response, and includes hidden autoantigens and modified autoantigens.

[0061] The aforementioned “hidden autoantigen” refers to an antigen that is not recognized as an autoimmune substance in the body because it has never come into contact with autolymphocytes during the embryonic stage; examples include crystalline proteins, brain tissue, and sperm.

[0062] The aforementioned “modified autoantigen” refers to a condition in which the three-dimensional structure of self tissue changes due to the influence of factors such as infection, drugs, burns, or ionizing radiation, thereby becoming an autoantigen. Although it is a normal component of the body, it induces an autoimmune response within the host.

[0063] In the present invention, the term “T cell epitope” refers to an antigen epitope recognized by a T cell receptor. The epitope component is a peptide formed by the degradation of a protein, primarily located within the antigen molecule, and is recognized by the TCR in the form of a complex formed by processing by antigen-presenting cells and binding to MHC molecules. T cell epitopes can also be classified into two types: a. Epitopes recognized by CD8+ T cells, containing 8–10 amino acids, wherein the 2nd and 9th amino acids are anchor amino acids; b. Epitopes recognized by CD4+ T cells, containing 13–17 amino acids. Most epitope types are linear epitopes, and T cell recognition of them is MHC-restricted.

[0064] T cell epitopes are recognized by T cells to induce cell-mediated immune responses, whereas B cells cannot recognize epitopes. Because T cell antigen receptors have a small portion exposed to the outside of the membrane, they cannot bind to free antigens like antibody molecules; instead, they can only recognize epitopes that have bound to MHC molecules from antigen-presenting cells. Therefore, antigens recognized by T cells must first undergo a specific process—specifically, the protein must be degraded and converted into a polypeptide before binding to an MHC molecule. However, since structural epitopes can be destroyed during protein degradation, potentially preventing peptide fragments from being recognized by T cells, T cell epitopes are primarily sequencing epitopes and are not necessarily located on the surface of the antigen molecule. Like antibody molecules, T cells can cross-react with common antigens, but this is not as effective as binding to the originally induced antigen.

[0065] T cell epitopes can induce a cellular immune response, making them targets for attack by cytotoxic T cells, and are also necessary for inducing an antibody response; this is because B cell activation requires the assistance of T cell activation, and T cell epitopes are essential for T cell activation. Therefore, each antigen molecule must contain at least one T cell epitope for the antigen to be immunogenic. Molecules containing only B cell epitopes can be antibody targets but cannot induce an antibody response on their own. However, there may be a few exceptions.

[0066] Preferably, the immune sequence of the immune-enhancing RNA drug used in the text enables antigen-specific T cell epitopes to be effectively delivered to T cells through processes such as the secretion of antigens, capture of antigen-presenting cells, presentation of antigen-presenting cells, and activation of antigen-presenting cells, thereby inducing a cellular immune response and promoting T cells to perform functions against specific antigens.

[0067] In the present invention, the term “RNA drug” refers to a drug comprising a vector or delivery system that typically includes an engineered genetic construct, wherein the active ingredient is RNA. The aim is to treat and prevent diseases by introducing an exogenous gene into target cells or tissues to replace, supplement, block, or modify a specific gene. Preferably, the RNA drug may be modified from its DNA template. An immuno-enhancing sequence is introduced into an engineered genetic construct, the target site is cleaved with a specific restriction enzyme, and the immuno-enhancing sequence, with its identical sticky end modified by DNA ligase, is inserted into a vector to fuse the immuno-enhancing sequence with the antigen, thereby forming a fusion protein.

[0068] In the present invention, the term “restriction enzyme” refers to a restriction endonuclease, which is a type of enzyme capable of recognizing a specific nucleotide sequence within a double-stranded DNA molecule and cleaving phosphodiester bonds of the DNA strand at a specific location, and is abbreviated as restriction enzyme.

[0069] In the present invention, the term “DNA ligase” is also referred to as DNA ligase and plays an important role in molecular biology. It connects two adjacent DNA strands into a complete strand by connecting the 3’-OH end of a DNA strand to the 5’-P end of another DNA strand to form a phosphodiester bond, and ATP is consumed in the catalytic action of the ligase.

[0070] In the present invention, the term “sticky end” refers to a single-stranded DNA end having unpaired bases formed after a double-stranded DNA end is cleaved by a specified restriction endonuclease. Such single-stranded DNA can be recombined or linked by mutually binding with other DNA fragments having complementary sticky end sequences. Identical sticky ends have identical nucleic acid sequences and thus possess identical single-stranded DNA sequences.

[0071] In the present invention, the term “fusion protein” refers to a recombinant protein in which a target protein gene to be expressed and a fusion protein gene are linked on an expression vector through DNA recombination technology, and the protein expressed in this manner includes the target gene protein and the fusion gene protein. Fusion protein expression is a strategy for recombinant protein expression, and fusion expression is a method. Additionally, a sequence for fusion expression of an immune enhancement sequence and an antigen can be constructed using a chemical de novo synthesis method. First, the sequence to be synthesized is designed with several complementary single-stranded primers; these primers are synthesized using a chemical synthesis method; a double-stranded gene is created by splitting the synthesized primers using a PCR method; the double-stranded gene is cloned into a vector; and the accuracy of the synthesized gene is verified by sequencing.

[0072] The DNA template of the RNA drug used in the text must be further converted into the corresponding RNA product through chemical or biological methods to exert the necessary drug activity. In a preferred embodiment, the nucleic acid drug is an RNA vaccine, and the RNA vaccine includes mRNA vaccines, circRNA vaccines, and saRNA vaccines.

[0073] In the case of a desirable mRNA vaccine, messenger RNA (mRNA) is transcribed from a DNA template and carries genetic information to instruct the production of intracellular proteins, membrane proteins, and extracellular proteins. It is a universal technology platform that can theoretically express all proteins and can currently be applied to infectious disease prevention vaccines, oncology vaccines, protein replacement therapy, CAR-T, gene editing, etc.

[0074] In the present invention, the circRNA vaccine is a novel non-coding RNA produced by reverse splicing of an mRNA precursor (pre-mRNA). Unlike traditional linear RNA, circRNA has a closed ring structure formed by covalent bonds and lacks a 5' end cap and a 3' end poly(A) tail, so it is not affected by RNA exonucleases, is expressed more stably, and is not easily degraded.

[0075] Regarding desirable saRNA vaccines, self-amplifying RNA, or saRNA, is an emerging technology currently used to research and develop novel drugs and vaccines using RNA. IVT saRNA retains the advantages of conventional mRNA, such as rapid development speed, modular design, production without cell culture, and high safety. Its most significant feature is its ability to self-replicate and amplify after entering the cell, which enhances the expression efficacy of IVT mRNA. When the positive sense strand RNA molecule enters the cell, ribosomes first translate four non-structural protein components—nsP1, nsP2, nsP3, and nsP4—which are then assembled into a polyprotein form to form an RNA replication enzyme complex. nsP1 through nsP4 each possess specific functions, with nsP4 acting as an RNA polymerase using RNA as a template. Rep first synthesizes a saRNA antisense strand using the saRNA that initially entered the cell, and then uses this antisense strand as a template to create a new copy of saRNA, thereby realizing the self-amplification of saRNA. Simultaneously, Rep recognizes sgPr and synthesizes subgenomic RNA downstream. This subgenomic RNA is 10 within the host cell 6It accumulates in large quantities close to the copy number. In saRNA vaccine design, subtype genomic RNA encodes antigen genes and translates large amounts of antigen molecules, thereby triggering cellular antigen presentation.

[0076] In the present invention, the terms “RNA in vitro transcription” or “in vitro transcription” relate to the process of synthesizing RNA in a cell-free system (in vitro). DNA, particularly plasmid DNA (or PCR product), is typically used as a template to generate RNA transcription copies. RNA can be obtained through DNA-dependent in vitro transcription of a suitable DNA template, and the suitable DNA template according to the present invention is preferably linearized plasmid DNA, which mainly comprises the T7 promoter (TAATACGACTCACTATAGGG) or SP6 promoter (ATTTAGGTGACACTATAG) sequence. The DNA template for in vitro RNA transcription can be obtained through nucleic acid cloning, in particular by cloning cDNA corresponding to each RNA to be transcribed in vitro and inserting it into a suitable vector for in vitro transcription, e.g., plasmid DNA. In a preferred embodiment of the present invention, the DNA template is linearized with a suitable restriction enzyme prior to in vitro transcription. cDNA can be obtained by reverse transcription of mRNA or chemical synthesis. In addition, DNA templates for in vitro RNA synthesis can also be obtained through gene synthesis. A commonly used method involves synthesizing RNA in vitro using RNA polymerase, utilizing linearized plasmid DNA or PCR amplification products as templates. Under T7 or SP6 RNA polymerase conditions, mRNA complementary to one strand of the template DNA is synthesized using NTPs as substrates, thereby obtaining a large amount of mRNA molecules simply and rapidly. Additionally, a cap structure is added to the 5' end and a poly-A tail to the 3' end to enhance the stability of the mRNA. Subsequently, high-purity mRNA is produced through a series of processes including isolation and purification.

[0077] When nucleic acid drugs enter the body, a portion is eliminated by phagocytes, while another portion performs its corresponding function; the efficiency of this portion ultimately determines the fate of the nucleic acid drug. The immune-enhancing sequence presented in this invention is crucial for the performance of both of these nucleic acid drug functions. This can increase the expression of the nucleic acid drug, broaden its distribution range within the body, and enhance the therapeutic effect by increasing the responsiveness of effector cells.

[0078] The preferred RNA immunoadjuvant elements constructed in the present invention include chemical modification, sugar modification, backbone modification, base modification, lipid modification, sequence modification, G / C content modification, codon optimization, rare codon substitution, A / U content modification, unstable sequence element (DSE) modification, combination modification, 5' cap, poly-A tail, polycytosine, and UTR improvement optimization. The RNA immunoadjuvant elements of the present invention may be provided in the form of modified nucleic acids.

[0079] In the present invention, the term “modification” may mean chemical modification including functional structural and signal peptide backbone modification and sugar modification or base modification. In the present invention, the term “modified” immune-enhancing element comprises a nucleotide analog / modifier (modified nucleotide or nucleoside) and includes, for example, backbone modification, sugar modification or base modification.

[0080] Skeletal modification related to the present invention refers to a chemical modification of the phosphate backbone of the nucleotides contained in the immune-enhancing element, preferably the RNA of the text. Sugar modification related to the present invention is a chemical modification of the ribose region of the nucleotides within the immune-enhancing element. In addition, base modification related to the present invention is a chemical modification of the base portion of the nucleotides in the immune-enhancing element-related region. In the text, it is preferable that the nucleotide analog or variant be a nucleotide analog that is advantageous for transcription and / or translation.

[0081] “Sugar modification” is an improvement made by modifying the nucleoside / nucleotide site. For example, the 2′-hydroxyl group (OH) is modified or substituted with a different “oxy” or “deoxy” substituent.

[0082] An embodiment modified with a -2′ hydroxyl group of the "oxy" substituent is an alkoxy group or an aryloxy group (-OR, e.g., R=H, alkyl group, cycloalkyl group, aryl group, arylalkyl group, heteroaryl group or sugar); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR); "lock" nucleic acid (LNA), wherein the 2′-hydroxyl group is connected to the 4′ carbon of the same ribose, for example, by a methylene bridge; and an amino (-O-amino, where the amino, for example NRR, is an alkylamino group, a dialkylamino group, a heterocyclic group, an arylamino group, a diarylamino group, a heteroarylamino group, or a diheteroarylamino group, ethylenediamine, a polyamino) or an amino alkoxy group; but is not limited thereto.

[0083] The “deoxy” modification comprises hydrogen, an amino group (e.g., NH2; alkylamino group, dialkylamino group, heterocyclic group, arylamino group, diarylamino group, heteroarylamino group, diheteroarylamino group, or amino acid); or an amino group connected to a sugar via a linker, wherein the linker comprises one or more of C, N, and O atoms;

[0084] The sugar functional group may include one or more additional carbons, and its stereochemical structure may be opposite to that of the corresponding carbon in ribose. Thus, the modified immune-enhancing element may include, for example, a nucleotide containing arabinose as a sugar.

[0085] “Skeleton modification” refers to a modification of the phosphate skeleton portion of a nucleoside / nucleotide. The phosphate functional group of the skeleton may be modified by replacing one or more oxygen atoms with different substituents. Additionally, the modified nucleoside / nucleotide may completely replace the unmodified phosphate ester portion with the modified phosphate ester according to the text. Embodiments of the modified phosphate ester functional group include, but are not limited to, thiophosphate esters, selenophosphate esters, boron phosphates, voronophosphate esters, hydrogen phosphates, aminophosphate esters, alkyl or aryl phosphate esters, and phosphate triesters. A dithiophosphate ester is one in which both unbonded oxy groups are replaced by thio groups. Phosphate ester linkers can also be modified by replacing the linked oxy groups with nitrogen (bridged amino phosphate ester), thio (bridged thio phosphate ester), and carbon (bridged methylene phosphate ester).

[0086] “(Nuclear)base modification” is a chemical modification and improvement of the nucleobase portion. Nucleobases used in RNA sequences include, but are not limited to, adenine, guanine, cytosine, uracil, and pseudouridine. For example, nucleosides and nucleotides according to the text may undergo chemical modification in the large furrow. In some embodiments, chemical modification of the large furrow may include modification of amino groups, thiol groups, alkyl groups, or halogen functional groups.

[0087] “Lipid-modified” immuno-enhancing elements, preferably RNA of the present invention, typically comprise (i) an immuno-enhancing element, preferably RNA as defined in the text, (ii) at least one linker covalently bonded to said immuno-enhancing element, preferably covalently bonded to RNA, and (iii) at least one lipid covalently bonded to each linker. A lipid-modified immuno-enhancing element comprises at least one immuno-enhancing element and at least one (dual-functional) lipid covalently bonded (without a linker) to said immuno-enhancing element. A lipid-modified immuno-enhancing element comprises (i) an immuno-enhancing element, (ii) at least one linker covalently bonded to said immuno-enhancing element, and (iii) at least one lipid covalently bonded to each linker, and (iv) at least one (dual-functional) lipid covalently bonded (without a linker) to said immuno-enhancing element. In this case, a particularly preferred lipid modification is present at the end of a linear immuno-enhancing element.

[0088] “Sequence modifications” may include at least one of the following sequence modifications. Such sequence modifications, which are not bound by any specific theory, may increase the stability of the immune-enhancing element of the present invention and / or enhance the expression of the immune-enhancing element.

[0089] In "G / C content modification," the G / C modified RNA sequence typically refers to a nucleic acid comprising the following sequence, which is based on a modified wild-type RNA sequence and contains guanines and / or cytosines whose number has been altered compared to said wild-type RNA sequence. Such alteration of the number of G / C nucleotides may occur by replacing a codon containing adenosine or thymine with a "synonymous" codon containing guanosine or cytosine. Correspondingly, it is preferable that the codon substitution specifically alters the G / C content of the RNA without altering the encoded amino acid residue.

[0090] In a preferred embodiment, the G / C content of the encoding sequence of the immune-enhancing element of the present invention is modified and, in particular, increased compared to the G / C content of the encoding sequence of the corresponding wild-type, i.e., unmodified RNA. It is preferable that the amino acid sequence encoding the immune-enhancing element of the present invention remains unchanged when compared to the amino acid sequence encoding the corresponding wild-type RNA.

[0091] This modification of the immune-enhancing element of the present invention is based on the following fact: the sequence of any RNA region within the coding region plays an important role in the efficient translation of said RNA. Therefore, the composition of the RNA and various nucleotide sequences are important. It is necessary to clarify that sequences with a high G (guanine) / C (cytosine) content are more stable than sequences with a high A (adenine) / U (uracil) content.

[0092] According to the present invention, the codon of the immune-enhancing element of the present invention can be selectively optimized compared to the corresponding wild-type sequence, thereby increasing the G / C nucleotide content while maintaining the translated amino acid sequence.

[0093] Since multiple codons can encode the same amino acid (degenerative nature of genetic codons), it is necessary to select the codon most advantageous for stability (selecting so-called alternative codons). When compared to the amino acid encoded by the RNA preferred by the immune-enhancing element of the present invention, there is a high possibility of varying the nucleic acid sequence relative to the wild-type sequence. Amino acids encoded by codons containing only G or C nucleotides do not require codon modification.

[0094] Another preferred modification of the immune-enhancing element of the present invention is based on the finding that translation efficiency is determined by differences in the frequency of tRNA appearance within the cell. Thus, when so-called “rare codons” are present to an increased degree in the immune-enhancing element of the present invention, the corresponding modified RNA sequence is translated to a significantly lower degree compared to when codons encoding relatively “common” tRNA are present.

[0095] In some preferred embodiments, compared to the corresponding region of wild-type nucleic acid, the protein-coding region of the modified immune-enhancing element, preferably the RNA defined in the text, is modified so that at least one codon of the wild-type sequence encoding a relatively rare tRNA in the cell is replaced with a codon of a tRNA that is relatively common and carries the same amino acid as the rare tRNA.

[0096] Thus, the sequence of the immune-enhancing element according to the present invention is modified so that a common tRNA codon can be inserted. In other words, through this modification of the present invention, all codons encoding the wild-type sequence of a relatively rare tRNA within the cell can be replaced with codons encoding a tRNA having the same amino acid as a relatively rare tRNA in various situations that is relatively common within the cell. Those skilled in the art know which tRNAs are relatively common within the cell and which tRNAs appear less frequently, and particularly prefer the tRNA codons most frequently used for specific amino acids, for example, in human cells, the Gly codon of tRNA is most common.

[0097] According to the present invention, particularly preferably, the sequence G / C content in the modified immune-enhancing element of the present invention is increased, and particularly "common" codon combinations are maximized, but the amino acid sequence encoded by the immune-enhancing element, preferably the RNA-coding sequence, is not modified. Such a preferred embodiment allows for the provision of a (modified) immune-enhancing element capable of particularly efficient translation and stabilization.

[0098] “A / U content modification” means that the A / U content within the environment of the ribosome binding site of the immuno-enhancing element of the present invention, preferably RNA, is increased compared to each wild-type nucleic acid. This modification (increase in A / U content around the ribosome binding site) improves the efficiency of binding between the ribosome and the immuno-enhancing element, preferably RNA. The ribosome effectively binds to the ribosome binding site (Kozak sequence), thereby enabling efficient translation of the immuno-enhancing element.

[0099] “DSE modification” means a modification of the immune-enhancing element of the present invention to a potential unstable sequence element. In particular, it is desirable that the coding sequence and / or 5′ and / or 3′ untranslated regions (UTRs) of the immune-enhancing element modify the respective wild-type nucleic acids so that they do not contain unstable sequence elements, and that the coding amino acid sequence of the modified immune-enhancing element does not alter the coding amino acid sequence of the respective wild-type sequence.

[0100] Unstable sequence elements (DSEs) present within the sequence of eukaryotic RNA are known to bind to intracellular signaling proteins and regulate RNA enzymatic degradation. To further enhance the stability of the modified immune-enhancing element, such modifications are performed on the corresponding region of the wild-type nucleic acid in at least one coding region so that this region contains no or minimal unstable sequence elements.

[0101] A more preferred modification of the immune-enhancing element of the present invention is based on the following finding: codons encoding the same amino acid typically appear at different frequencies. According to another preferred embodiment, the modified immune-enhancing element modifies the encoding sequence relative to the corresponding region of the wild-type nucleic acid so that the frequency encoding the same amino acid codon is adjusted to match the frequency at which the corresponding codon naturally appears according to human codon selection.

[0102] As previously explained, all codons of the wild-type sequence encoding a relatively rare tRNA within the cell can be replaced with codons encoding a tRNA that is relatively common within the cell and has the same amino acid as the relatively rare tRNA in various situations.

[0103] Therefore, particularly preferably, the most common codon is used for each amino acid that encodes. This optimization process increases the Codon Adaptation Index (CAI) and ultimately maximizes the CAI. In the context of the invention, a sequence in which the CAI is increased or maximized is typically referred to as a “codon-optimized” sequence and / or a “CAI-increased” and / or “CAI-maximized” sequence. Preferably, the immune-enhancing element of the invention may comprise at least one coding sequence, wherein the coding sequence is a codon-optimized sequence according to the text. More preferably, the Codon Adaptation Index (CAI) of at least one coding sequence is at least 0.5, at least 0.8, at least 0.9, or at least 0.95. The Codon Adaptation Index (CAI) of the coding sequence may be 1.

[0104] For example, if the amino acid alanine (Ala) is present in the amino acid sequence encoded by at least one encoding sequence of the immune-enhancing element of the present invention, the wild-type encoding sequence is regulated as follows: the most common human codon "GCC" is always used for said amino acid or said amino acid cysteine ​​(Cys), and the wild-type sequence is also regulated as follows: the most common human codon "TGC" is always used for said amino acid, etc.

[0105] The "C optimized sequence" can modify the immune-enhancing element of the present invention, preferably by increasing the cytosine (C) content of the immune-enhancing element, the preferred RNA, and in particular, can modify at least one coding sequence.

[0106] It is preferable that the C content in the encoding sequence of the immune-enhancing element of the present invention be changed, specifically increased, compared to the C content in the encoding sequence of the corresponding wild-type (unmodified) nucleic acid. It is preferable not to change the amino acid sequence encoded by at least one encoding sequence of the immune-enhancing element of the present invention compared to the amino acid sequence encoded by the corresponding wild-type nucleic acid.

[0107] Through modification of the above-mentioned modified immune-enhancing element, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the theoretically possible maximum cytosine content, or at least 90% or even the maximum cytosine content is obtained. At least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or even 100% of the codons of the wild-type nucleic acid sequence in which the "cytosine content is optimized" are replaced with codons in which the cytosine content is higher than the cytosine content present in the wild-type sequence.

[0108] More preferably, some codons within the wild-type encoding sequence may be modified separately so that relatively rare tRNA codons in the cell are replaced with relatively common tRNA codons in the cell, such that the relatively common tRNA codons carry the same amino acid as the relatively rare tRNA of the original wild-type codons. Preferably, all codons of relatively rare tRNA in the cell are replaced with codons of relatively common tRNA, except for codons encoding amino acids (encoding only with codons that have no cytosine) or codons encoding glutamine (Gln) (encoding with two codons, each containing the same number of cytosines).

[0109] The modified immune-enhancing element is modified to encode a codon of a relatively common intracellular tRNA, reaching at least 80% or at least 90% of the theoretically possible maximum cytosine content, or even reaching the maximum cytosine content, wherein the amino acid sequence is preferably not altered.

[0110] Due to the natural degeneracy of genetic codons, one or more codons can encode specific amino acids. Thus, 18 of the 20 naturally occurring amino acids are encoded by one or more codons (excluding Tryp and Met), for example, by two codons (e.g., Cys, Asp, Glu), three codons (e.g., Ile), four codons (e.g., Al, Gly, Pro), or six codons (e.g., Leu, Arg, Ser). However, not all codons encoding the same amino acid are used with the same frequency under in vivo conditions. Typical codon selection patterns have been established for each individual organism.

[0111] As used in the context of the present invention, the term "cytosine content optimized codon" refers to a codon that has a lower cytosine content compared to other codons encoding the same amino acid. Therefore, any case in which a wild-type codon is replaced with another codon encoding the same amino acid and exhibiting a higher number of cytosines among codons can be considered cytosine optimizable (C-optimizable). Performing such a replacement of a C-optimizable wild-type codon with a specific C-optimizable codon within the wild-type encoding sequence increases the overall C content and results in a C-rich modified RNA sequence.

[0112] Preferably, the immune-enhancing element of the present invention, in particular at least one coding sequence, may comprise or be composed of a C-maximized sequence, wherein the C-maximized sequence comprises a C-optimized codon targeting all possible C-optimizable codons. Thus, preferably 100% or theoretically all replaceable C-optimizable codons are replaced by C-optimized codons throughout the entire length of the coding sequence.

[0113] "Combination modification" is considered to be a modification of the sequence modification according to the text to the encoding sequence of the immune-enhancing element according to the text, preferably RNA. If appropriate or necessary, modifications (chemical modifications, lipid modifications, and sequence modifications) may be combined at will, provided that the combined modifications do not interfere with one another, and preferably, the condition is that the encoding antigen fusion protein maintains the expected function or property described above.

[0114] Preferably, the artificial nucleic acid of the present invention comprises at least one coding sequence defined in the text, said coding sequence modified as previously described to encode an antigen fusion protein defined in the text.

[0115] According to a preferred embodiment, the immune-enhancing element of the present invention comprises at least one coding sequence defined in the text, wherein (a) the G / C content of at least one coding sequence of the immune-enhancing element is increased relative to the C content of the corresponding coding sequence in the corresponding wild-type nucleic acid, and / or (b) wherein the C content of at least one coding sequence of the immune-enhancing element is increased relative to the C content of the corresponding coding sequence in the corresponding coding sequence, and / or (c) wherein the codons of at least one coding sequence of the immune-enhancing element are adapted for human codon selection use, and wherein the codon fit index (CAI) is increased or maximized within at least one coding sequence of the immune-enhancing element, and wherein the immune-enhancing element is encoded

[0116] In the present invention, the term "5′ cap" or "5'CAP" modifies the RNA molecule defined herein by adding a so-called "5′ cap" structure according to a preferred embodiment, and the "5′ cap" structure preferably stabilizes the immune-enhancing element according to the present invention. The "5′ cap" is an entity that is typically "capped" at the 5′ end of mature mRNA. The 5′ cap can typically be formed from a modified nucleic acid, in particular a derivative of guacine nucleotide. Preferably, the 5′ cap is connected to the 5′ end by a 5′-5′-triphosphate bond. The 5′ cap can be methylated, for example, in the form m7GpppN, where N represents the 5′ end nucleotide of the nucleic acid having the 5′ cap (typically the 5′ end of mRNA). Since m7GpppN is naturally present in mRNA transcribed by polymerase II as a 5′ cap structure, it is preferable that it not be considered as a modification included in the “modified” mRNA in this case. Accordingly, the “modified” immuno-enhancing element may include m7GpppN as a 5′ cap, but in addition, the said modified immuno-enhancing element, preferably RNA, typically includes at least one of the other modifications defined in the text. A 5′-cap (cap 0 or cap 1) structure can be formed using a cap analogue during chemical RNA synthesis or in vitro transcription (co-transcription capping) of RNA.

[0117] In the present invention, the term “lipid nanoparticle” is also referred to as “LNP” and is not limited to any specific form but includes all forms produced when a cationic lipid and one or more optional other lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. For example, liposomes, lipid complexes, lipid complexes, etc. are included in the category of LNP. RNA molecules of the present invention and / or any other nucleic acids disclosed herein may be prepared with aminoalcohol lipids. The aminoalcohol lipids of the present invention may be prepared by the method described in U.S. Patent No. 8450298, which is incorporated into the text by reference.

[0118] LNPs typically comprise one or more excipients selected from cationic lipids, neutral lipids, charged lipids, steroids, and polymer-bound lipids (e.g., PEGylated lipids). RNA may be encapsulated within the lipid portion of the LNP, or encapsulated within an aqueous space surrounded by part or all of the lipid portion of the LNP. RNA or part thereof may bind to and complex with the LNP. LNPs may comprise any lipid capable of forming particles, to which nucleic acids are attached or one or more nucleic acids are encapsulated. Preferably, LNPs containing nucleic acids comprise one or more cationic lipids and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and PEGylated lipids.

[0119] The cationic lipids in the LNP may be cationic, that is, when the pH is lowered below the pK of the ionizable functional group of the lipid, the lipid becomes protonated and gradually becomes neutral at high pH. Under pH conditions lower than pK, the lipid can bind to negatively charged nucleic acids. In some embodiments, the cationic lipid comprises a positively charged ionic lipid that becomes positively charged when the pH is lowered.

[0120] LNPs may include any cationic lipid suitable for forming lipid nanoparticles. Preferably, the cationic lipid carries a pure positive charge under physiological pH conditions. The cationic lipid may be an amino lipid.

[0121] In the present invention, the term “amino lipid” refers to a lipid having one or two fatty acids or fatty alkyl chains and an amino head functional group (including alkylamino or dialkylamino), which can be protonated at physiological pH to form a cationic lipid.

[0122] In the present invention, the term “polycationic compound” typically refers to a charged molecule that carries a positive charge (cation) at a pH value of 1 to 9, preferably 9 or less than 9 (e.g., 5 to 9), 8 or less than 8 (e.g., 5 to 8), 7 or less than 7 (e.g., 5 to 7), and most preferably at a physiological pH (e.g., 7.3 to 7.4). Accordingly, “polycationic compound” may be any positively charged compound or polymer that carries a positive charge under physiological conditions, particularly in vivo physiological conditions, and is preferably a cationic peptide or protein. “Polycationic peptide or protein” may include at least one positively charged amino acid, or one or more positively charged amino acids.

[0123] In the present invention, the term “vaccine” is understood as a preventive or therapeutic substance that provides at least one antigen, preferably comprising an antigenic peptide or protein, and providing at least one antigen means, for example, that the vaccine contains an antigen or, for example, that the vaccine contains a molecule encoding an antigen.

[0124] In the present invention, the “safe dose at which the drug exerts optimal efficacy” refers to a therapeutic dose capable of achieving the targeted biological effect within a “patient,” “individual,” “subject,” non-human animal, tissue, and / or organ. The “safe dose at which the drug exerts optimal efficacy” refers to a dose capable of alleviating the disease of the subject being treated, reducing symptoms, and / or preventing the onset of the disease. Furthermore, the “safe dose at which the drug exerts optimal efficacy” is sufficient to avoid serious side effects; the “safe dose at which the drug exerts optimal efficacy” may be modified according to similar factors such as the subject’s gender, age, weight, physical health status, dietary composition, underlying diseases, medication use status, onset and progression rate of the disease, severity of the disease, course of treatment, concomitant treatment status, and specific adjuvants and / or additives used. It may also be modified according to the administered nucleic acid sequence, preferably linear mRNA. The safe dose at which the drug exerts optimal efficacy is determined through the evaluation of the drug’s efficacy and safety, pharmacological and pharmacological effects, drug side effects, and in vivo pharmacological effects. For example, it serves as an indicator to determine the safety of a drug by evaluating the therapeutic index and safety margin on living cells or experimental animals. The therapeutic index is the LD. 50 (50% of the colony is the lethal dose) and ED 50 Therapeutic index LD50 as the ratio (where 50% of the group is at the effective dose). 50 / ED 50 The higher the ratio, the higher the safety of the drug. The safety range consists of LD1 (lethal dose at 1% of the group) and ED. 99 The ratio of (99% of the population at the effective dose) or LD5 (5% of the population at the lethal dose) and ED 95It refers to the difference between (95% of the population is an effective dose), and the greater this difference in safety range, the better the safety. Generally, a dose with high safety is desirable. Safe and effective doses selected from living cell experiments and animal experiments can be applied to the preparation of human pharmaceuticals. For example, the safe and effective therapeutic dose of a drug (vaccine), reagent set, or kit prepared with the RNA sequence provided in the present invention is approximately 10μg-500μg per dose, the preferred therapeutic dose is approximately 50μg-400μg per dose, and the more preferred therapeutic dose is approximately 50μg-200μg per dose. Furthermore, the safe and effective therapeutic dose of a drug (vaccine), reagent set, or kit prepared with the RNA molecule or composition provided in the present invention may be 10 μg to 500 μg per person per dose unit, a preferred therapeutic dose is about 50 μg to 400 μg per person per dose unit, and a more preferred therapeutic dose is 50 μg to 200 μg per person per dose unit. The safe and effective therapeutic dose is determined by animal experiments, and the animal models to which this applies include, but are not limited to, mice, rats, guinea pigs, domestic rabbits, cats, dogs, and non-human primates. If the animals have stronger tolerance, the safe and effective therapeutic dose obtained through animal experiments must be converted into an equivalent dose applicable to humans.

[0125] In the present invention, the term “pharmaceuticalally acceptable” means a compound or reagent that is compatible with one or more active agents (indeed, RNA molecules) and does not interfere with each other or / or hardly impairs the drug activity. The pharmaceutically acceptable carrier and / or excipient preferably has sufficiently high purity and sufficiently low toxicity so as to be administered to the target to be treated.

[0126] In the present invention, the term “excipient” refers to an additional substance included in a drug formulation in addition to the active ingredient, and is also referred to as an adjuvant. For example, adhesives, fillers, disintegrants, and lubricants in tablets; alcohol, vinegar, medicinal juice, etc. in herbal pills; the substrate portion in semi-solid formulations such as ointments and creams; and preservatives, antioxidants, flavorings, fragrances, solubilizing aids, emulsifiers, solubilizers, osmotic pressure regulators, coloring agents, etc., in liquid formulations can all be referred to as excipients. Excipients must have stable properties, not be incompatible with the active ingredient, not cause side effects, and not interfere with therapeutic effects; they must not deform, crack, or be damaged by mold or insects at room temperature; they must be harmless to the human body and not perform physiological functions; and they must not interact chemically or physically with the active ingredient and must not affect the measurement of the active ingredient's content. In a medicinal mixture (syrup, lard, or liquid petroleum jelly) in which no chemical reaction occurs, a drug having a therapeutic effect is added to it and adhered to other ingredients. It refers to an inactive substance of an adjuvant constituting a drug or antigen (e.g., gum arabic, syrup, lanolin, or starch); in particular, it refers to a substance added to impart viscosity to the mixture to form pills or tablets when there is a sufficient amount of liquid in the drug mixture.For example, phosphate or citrate buffered saline, fixed oils, vegetable oils, e.g., peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, ethanol, polyhydric alcohols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.); lecithin; surfactants; preservatives, e.g., benzyl alcohol, 4-hydroxybenzoate, chlorobutanol, phenol, ascorbic acid, thiomersalal, etc.; isosmotic agents, e.g., sugars, polyhydric alcohols, e.g., mannitol, sorbitol, or sodium chloride; aluminum monostearate or gelatin; antioxidants, e.g., ascorbic acid or sodium bisulfite; chelating agents, e.g., ethylenediaminetetraacetic acid (EDTA); buffers, e.g., acetates, citrates, or phosphates; and tension-regulating reagents, e.g., sodium chloride or glucose; microcrystalline cellulose, tragacanth gum, or gelatin; Starch or lactose; sugars, e.g., lactose, glucose, and sucrose; starch, e.g., corn starch or potato starch; cellulose and its derivatives, e.g., sodium carboxymethylcellulose, ethylcellulose, cellulose acetate; disintegrants, etc.

[0127] In the present invention, the term “vector” comprises a complete RNA molecule of an immune-enhancing element and constructs one or more LNPs or CLANs in a form that is complexed or combined with lipids (particularly cationic lipids and / or neutral lipids).

[0128] In the present invention, the term “complex” means that, according to a preferred embodiment, the RNA molecule of the present invention is complexed with one or more cationic or polycationic compounds, and it is preferable that it be complexed with a cationic or polycationic polymer, a cationic or polycationic peptide or protein, such as protamine, a cationic or polycationic polysaccharide and / or a cationic or polycationic lipid.

[0129] Means and methods for providing a “complexed” RNA molecule are described in the “complexed” portion and apply equally to the composition or drug (vaccine) of the present invention after necessary modification. Specifically, a portion of the RNA molecule forming the (drug) composition or vaccine of the present invention may be complexed with a lipid, a (poly)cationic compound, and a vector (preferably selected from (poly)cationic amino acids, peptides, proteins, (poly)cationic polysaccharides, (poly)cationic lipids, (poly)cationic polymers, or polymer vectors such as those above).

[0130] According to a preferred embodiment, a portion of RNA molecules forming a composition or drug (vaccine) of the present invention may be combined with a polymer vector formed of a cationic component crosslinked by a disulfide bond, preferably a cationic peptide crosslinked by a disulfide bond, wherein the polymer vector comprises a peptide of the formula (CAT-I), (CAT-Ia) and / or (CAT-Ib) as described above and / or a compound according to the formula (Cat-II)(L-P1-S-[S-P2-S]nS-P3-L).

[0131] In the present invention, the route of the term “systemic administration” includes, for example, intravenous injection (intramuscular injection and intravenous administration), intramuscular injection (intramuscular injection, subcutaneous injection, intradermal injection), gastrointestinal administration (oral administration), mucosal administration (sublingual administration, oral spray, oral patch, eye drops, rectal or vaginal suppository), or skin administration (transdermal absorption).

[0132] In the present invention, the route of the term “local administration” includes not only administration through organs such as the body cavity-joint cavity, trachea, respiratory tract, vagina, and anus, but also administration at pathological sites such as within a lesion, within a tumor, around a tumor, intracranial, within the lungs, within the heart, and within a nodule.

[0133] Furthermore, different parts of the different drugs (vaccines) or kits of the present invention may use different routes of administration.

[0134] In the present invention, a “kit” is a set comprising two or more parts, typically containing various components according to the text in suitable containers. For example, each container may be a vial, bottle, compression bottle, wide-mouth bottle, sealed sleeve, envelope or pouch, tube, blister packaging, or any other suitable form, provided that the container is configured to prevent the components from being mixed too early. Different components may be provided individually, or some different components may be provided together (i.e., within the same container). The container may also be a vial, tube, wide-mouth bottle, envelope, sleeve, blister packaging, or internal compartment or partition that is separated so that the contents of one compartment do not come into physical contact with the contents of another compartment until intentionally mixed by a pharmacist or physician. Optionally, the reagent set may include at least one other reagent, antimicrobial agent, RNA degradase inhibitor, solubilizer, buffer, etc., as defined in the text regarding the drug composition. In a preferred embodiment, the kit may include a portion of lactic acid Ringer’s solution.

[0135] In the present invention, the terms “patient,” “individual,” or “subject” include human and non-human animals such as mammals, fish, amphibians, reptiles, and birds. For example, primates include pygmy lemurs, lemurs, indris, squirrel monkeys, lorises, galagos, pygmy lemurs, euphoria, apes, northern white-cheeked gibbons, tarsiers, capuchin monkeys, Aotidae, saki monkeys, spider monkeys, Old World monkeys, gibbons, and snails; Mammal animals include tigers, wolves, rats, deer, martens, monkeys, tapirs, sloths, zebras, dogs, foxes, bears, elephants, leopards, sao, lions, red pandas, warthogs, antelopes, reindeer, koalas, rhinoceroses, lynxes, pangolins, giraffes, pandas, anteaters, snails, manatees, otters, civets, dolphins, walruses, platypuses, hedgehogs, Arctic foxes, koalas, polar bears, kangaroos, armadillos, hippos, seals, whales, and weasels; and various genetically modified animals, genetically engineered animals, and model animals; and in the present invention, the terms “patient,” “individual,” and “subject” preferably mean non-human primates or humans, and most preferably humans.

[0136] The terms “treatment,” “cure,” or “management” refer to the prevention of symptoms (i.e., prevention of disease onset); suppression of symptoms (i.e., prevention of disease progression); eradication of symptoms (i.e., disappearance of disease); and / or stabilization of symptoms (i.e., non-progression of disease). However, in clinical practice, the onset and progression of symptoms occur due to various causes and multifaceted factors, so the distinction between “prevention,” “suppression,” and / or “stabilization” of symptoms may not be clear; therefore, the term “prevention” encompasses, to some extent, the types of “treatment” and “cure” including “prevention,” “suppression,” and / or “stabilization.” Accordingly, the terms “treatment” and “cure” include “prevention” and “eradication.”

[0137] The technical solution of the present invention is as follows:

[0138] On the one hand, the present invention provides an RNA molecule, wherein the coding region of the RNA molecule comprises an HSP domain, a SIG domain, and an AN domain; said HSP domain encodes an HSP protein family or a variant, fragment, or derivative thereof; said SIG domain encodes a signal peptide; and said AN domain encodes the same or different RNA antigenic peptide or protein.

[0139] Specifically, the HSP protein family includes HSP70, HSP110, HSP10, HSP27, HSP40, HSP60, HSP90, HSPE1, HSPB1, HSPB3, gp96, or the full-length, truncated, or mutant elements of caleticulin.

[0140] More specifically, the HSP protein family includes the full-length element, truncated element, or mutant element of HSP70 or HSP110.

[0141] Preferably, the HSP protein family is an HSP70 full-length element, an HSP70 SBD element, an HSP110 full-length element, or an HSP110 SBD element.

[0142] More preferably, the HSP protein family comprises any one amino acid sequence represented by SEQ ID NO. 5-8 or a fragment, variant, or derivative thereof;

[0143] Specifically, the HSP domain has one or more nucleotide sequences represented by SEQ ID NO.1-4.

[0144] More specifically, the HSP70 full-length element has a nucleotide sequence represented by SEQ ID NO.1 and an amino acid sequence represented by SEQ ID NO.5;

[0145] The above HSP70 SBD element has a nucleotide sequence represented by SEQ ID NO.2 and an amino acid sequence represented by SEQ ID NO.6;

[0146] The above HSP110 full-length element has a nucleotide sequence represented by SEQ ID NO.3 and an amino acid sequence represented by SEQ ID NO.7;

[0147] The above HSP110 SBD element has a nucleotide sequence represented by SEQ ID NO.4 and an amino acid sequence represented by SEQ ID NO.8.

[0148] Specifically, the AN domain encodes one, two, three, four, five, six, seven, eight, nine, or ten identical or different RNA antigenic peptides or proteins.

[0149] More specifically, the RNA antigenic peptide or protein includes tumor antigens, viral antigens, bacterial antigens, protozoal antigens, fungal antigens, allogeneic antigens, or autoantigens.

[0150] Preferably, the RNA antigenic peptide or protein is a tumor antigen.

[0151] More preferably, the tumor antigen includes HPV16 E6, HPV16 E7, Adpgk, or MAGE-1.

[0152] Specifically, the signal peptide comprises, but is not limited to, the full length or fragment of LAMP1, CRT, IgE, tPA, IL12, and HLA I.

[0153] More specifically, the signal peptide has an amino acid sequence or a fragment, variant, or derivative thereof represented by any one of SEQ ID NO. 9-14; the SIG domain comprises a nucleic acid sequence or a fragment, variant, or derivative thereof represented by any one of SEQ ID NO. 15-20.

[0154] Preferably, the LAMP1 has an amino acid sequence represented by SEQ ID NO. 9 and a nucleotide sequence represented by SEQ ID NO. 15;

[0155] The above CRT has an amino acid sequence represented by SEQ ID NO.10 and a nucleotide sequence represented by SEQ ID NO.16;

[0156] The above IgE has an amino acid sequence represented by SEQ ID NO.11 and a nucleotide sequence represented by SEQ ID NO.17;

[0157] The above tPA has an amino acid sequence represented by SEQ ID NO.12 and a nucleotide sequence represented by SEQ ID NO.18;

[0158] The above IL12 has an amino acid sequence represented by SEQ ID NO.13 and a nucleotide sequence represented by SEQ ID NO.19;

[0159] The above HLA I has an amino acid sequence represented by SEQ ID NO.14 and a nucleotide sequence represented by SEQ ID NO.20.

[0160] More preferably, the signal peptide is LAMP1 and has an amino acid sequence represented by SEQ ID NO.9 and a nucleotide sequence represented by SEQ ID NO.15.

[0161] Specifically, the coding region of the RNA molecule has the following structure:

[0162] 5'-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3';

[0163] or 5'-(SIG)a-(L)b-[(HSP)m-(L)d]e-(AN)c-3';

[0164] or 5'-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3';

[0165] Here, the L domain encrypts a linker sequence; b and d are each independently selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; and a, c, e, m are each independently selected from integers 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0166] More specifically, the linker is a non-immunogenic linker and includes, but is not limited to, flexible linker molecules, rigid linker molecules, and cleavable linker molecules.

[0167] Preferably, the linker comprises GS flexible linker-1, GS flexible linker-2, GS flexible linker-3, monopeptide-1, monopeptide-2, T2A, P2A, E2A, and a furin cleavage linker.

[0168] Preferably, the linker has an amino acid sequence represented by any one of GS, AAA, AGA, or SEQ ID NO.21-26, or a fragment, variant, or derivative thereof; the L domain comprises a nucleic acid sequence represented by any one of GGCAGC, GCCGCCGCC, GCCGGCGCC, or SEQ ID NO.27-32, or a fragment, variant, or derivative thereof.

[0169] The above GS flexibility linker-1 has an amino acid sequence represented by GS and a nucleotide sequence represented by GGCAGC;

[0170] The above GS flexibility linker-2 has an amino acid sequence represented by SEQ ID NO.21 and a nucleotide sequence represented by SEQ ID NO.27;

[0171] The above GS flexibility linker-3 has an amino acid sequence represented by SEQ ID NO.22 and a nucleotide sequence represented by SEQ ID NO.28;

[0172] The above monopeptide-1 has an amino acid sequence represented as AAA and a nucleotide sequence represented as GCCGCCGCC;

[0173] The above monopeptide-2 has an amino acid sequence represented as AGA and a nucleotide sequence represented as GCCGGCGCC;

[0174] The above T2A has an amino acid sequence represented by SEQ ID NO.23 and a nucleotide sequence represented by SEQ ID NO.29;

[0175] The above P2A has an amino acid sequence represented by SEQ ID NO.24 and a nucleotide sequence represented by SEQ ID NO.30;

[0176] The above E2A has an amino acid sequence represented by SEQ ID NO.25 and a nucleotide sequence represented by SEQ ID NO.31;

[0177] The above purine cleavage linker has an amino acid sequence represented by SEQ ID NO.26 and a nucleotide sequence represented by SEQ ID NO.33.

[0178] More preferably, the linker is GS flexible linker-1, having an amino acid sequence represented by GS and a nucleotide sequence represented by GGCAGC.

[0179] Specifically, the G / C content of the nucleic acid sequence of the coding region of the RNA molecule is increased compared to the G / C content of the nucleic acid sequence of the corresponding wild-type RNA molecule;

[0180] or the C content of the nucleic acid sequence of the coding region increases compared to the C content of the nucleic acid sequence of the corresponding wild-type RNA molecule;

[0181] Or, the codons of the nucleic acid sequence of the coding region are adapted for human codon selection use, wherein the codon fit index (CAI) is preferably increased or maximized within the nucleic acid sequence of the RNA molecule; and the amino acid sequence encoded by the nucleic acid sequence of the RNA molecule has not changed compared to the amino acid sequence encoded by the corresponding nucleic acid sequence of the wild-type RNA molecule.

[0182] Specifically, the coding region of the RNA molecule comprises a nucleic acid sequence represented by any one of SEQ ID NO.33-42; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by any one of SEQ ID NO.33-42.

[0183] The coding region of the RNA molecule according to Example 1 of the present invention has a nucleotide sequence represented by SEQ ID NO.33; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.33.

[0184] The coding region of the RNA molecule according to Example 2 of the present invention has a nucleotide sequence represented by SEQ ID NO.34; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.34.

[0185] The coding region of the RNA molecule according to Example 3 of the present invention has a nucleotide sequence represented by SEQ ID NO.35; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.35.

[0186] The coding region of the RNA molecule according to Example 4 of the present invention has a nucleotide sequence represented by SEQ ID NO.36; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.36.

[0187] The coding region of the RNA molecule according to Example 5 of the present invention has a nucleotide sequence represented by SEQ ID NO.33, SEQ ID NO.37, or SEQ ID NO.38; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.33, SEQ ID NO.37, or SEQ ID NO.38.

[0188] The coding region of an RNA molecule according to Example 6 of the present invention has a nucleotide sequence represented by SEQ ID NO.34, SEQ ID NO.39, or SEQ ID NO.40; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.34, SEQ ID NO.39, or SEQ ID NO.40.

[0189] The coding region of the RNA molecule according to Example 7 of the present invention has a nucleotide sequence represented by SEQ ID NO.41; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.41.

[0190] The coding region of the RNA molecule according to Example 8 of the present invention has a nucleotide sequence represented by SEQ ID NO.42; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by SEQ ID NO.42.

[0191] Specifically, the coding region of the RNA molecule is located between the 5' UTR and the 3' UTR.

[0192] Preferably, the coding region of the RNA molecule is located downstream of the 5' UTR and upstream of the 3' UTR.

[0193] Specifically, the RNA includes mRNA, viral RNA, replicator RNA, or circular RNA.

[0194] Preferably, the RNA is mRNA.

[0195] Specifically, the RNA includes a single cistron RNA, a double cistron RNA, or a multiple cistron RNA.

[0196] Specifically, the RNA is a modified RNA.

[0197] Preferably, the RNA is stabilized RNA.

[0198] Specifically, the RNA molecule contains a polyadenine sequence.

[0199] Preferably, the RNA molecule comprises 10 to 200, 10 to 100, 40 to 80, or 50 to 70 adenine nucleotides.

[0200] Specifically, the RNA molecule contains a polycytosine sequence.

[0201] Preferably, the RNA molecule comprises 10 to 200, 10 to 100, 20 to 70, 20 to 60, or 10 to 40 cytosine nucleotides.

[0202] Specifically, the RNA molecule has the following structure:

[0203] 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy;

[0204] or 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy;

[0205] or 5'CAP-5'UTR-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3'UTR-3'Ploy.

[0206] Specifically, the 5'CAP includes m7GpppN, ARCA cap, or cap 1.

[0207] Preferably, the amino acid sequence of the 5'CAP is AG.

[0208] Specifically, the 5'-UTR comprises a nucleic acid sequence represented by SEQ ID NO.43-48 or a fragment, variant, or derivative thereof; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by any one of SEQ ID NO.43-48.

[0209] In Example 1 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.43.

[0210] In Example 2 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.44.

[0211] In Example 3 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.45.

[0212] In Example 4 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.46.

[0213] In Example 5 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.47.

[0214] In Example 6 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.48.

[0215] In Example 7 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.44.

[0216] In Example 8 of the present invention, the 5'-UTR has a nucleic acid sequence represented by SEQ ID NO.44.

[0217] Specifically, the 3'-UTR comprises a nucleic acid sequence represented by SEQ ID NO.49-54 or a fragment, variant, or derivative thereof; and a corresponding amino acid sequence encoded by a nucleic acid sequence represented by any one of SEQ ID NO.49-54.

[0218] In Example 1 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.49.

[0219] In Example 2 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.50.

[0220] In Example 3 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.51.

[0221] In Example 4 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.52.

[0222] In Example 5 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.53.

[0223] In Example 6 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.54.

[0224] In Example 7 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.50.

[0225] In Example 8 of the present invention, the 3'-UTR includes a nucleic acid sequence represented by SEQ ID NO.50.

[0226] Specifically, 3' Poly contains a polyadenine tail or a polycytosine tail.

[0227] Preferably, the polyadenine tail comprises 10 to 1000, 10 to 500, 10 to 300, 10 to 200, 10 to 100, 40 to 80, or 50 to 70 adenine nucleotides.

[0228] Preferably, the amino acid sequence of the 3' Ploy is represented by SEQ ID NO.55.

[0229] On the other hand, the present invention provides a composition, said composition comprising the RNA molecule and the pharmaceutically acceptable carrier or excipient thereof.

[0230] Specifically, the RNA molecule is combined with one or more cationic compounds or polycationic compounds.

[0231] Preferably, the cationic compound comprises a cationic polymer, a cationic peptide or protein, a cationic polysaccharide or a cationic lipid.

[0232] Preferably, the polycationic compound comprises a polycationic polymer, a polycationic peptide or protein, a polycationic polysaccharide or a polycationic lipid.

[0233] More preferably, the RNA molecule is combined with one or more cationic lipids or polycationic lipids to form lipid nanoparticles, lipid complexes, or liposomes.

[0234] Preferably, the N / P ratio between the RNA molecule and the cationic compound or polycationic compound is 0.1:1 to 10:1.

[0235] More preferably, the N / P ratio between the RNA molecule and the cationic compound or polycationic compound is 6:1.

[0236] On the other hand, the present invention provides an application of the RNA molecule or composition in manufacturing a drug or kit.

[0237] Specifically, the formulations of the above-mentioned drug include ointments, suppositories, aerosols, pastes, gels, decoctions, powders, pills, solutions, syrups, emulsions, suspensions, injections, sprays, and lyophilized agents.

[0238] According to a more optimized embodiment, a drug prepared from the composition of the present invention is provided primarily in the form of a lyophilized agent to maintain optimal stability of the drug. The lyophilized drug product must be diluted to a suitable concentration in an appropriate buffer solution before administration, and this buffer solution is primarily based on an aqueous carrier such as, for example, sodium citrate buffer solution, phosphate buffer solution, etc.

[0239] According to a more optimized embodiment, a drug prepared from the composition of the present invention is provided in the form of a lipid-based formulation. The formulation based on the nano-delivery system may include lipid nanoparticles, protein / peptide nanoparticles, cation / lipid nanoparticles, and inorganic material nanoparticles.

[0240] According to a more optimized embodiment, a drug prepared from the composition of the present invention is provided in the form of a spray formulation. The formulation based on a spray delivery system is delivered through a nebulizer, such as a nasal infusion spray device. Preferably, the drug is a vaccine.

[0241] Specifically, the above applications include applications in preventing, treating, or diagnosing tumors, cancer, infectious diseases, autoimmune diseases, graft-versus-host disease, or hypersensitivity reactions.

[0242] Preferably, the infectious disease may manifest as a local or systemic reaction.

[0243] Preferably, the autoimmune disease includes, but is not limited to, type 1 diabetes, rheumatoid arthritis, psoriasis / psoriatic arthritis, multiple sclerosis, systemic lupus erythematosus (SLE), inflammatory bowel disease, Addison's disease, Graves' disease, Sjögren's syndrome, Hashimoto's thyroiditis, myasthenia gravis, autoimmune vasculitis, pernicious anemia, and celiac sprue.

[0244] Preferably, the above application further comprises combination therapy, wherein the subjects of said combination therapy receive treatment in combination with the drugs (vaccines) or kits provided in the present invention, in addition to surgery, radiation therapy, chemotherapy, immunotherapy, targeted therapy, endocrine therapy, stem cell transplantation, RNA precision therapy, antifungal agents, antiviral agents, and / or anti-infectious treatments acting on tumors, cancer, or infectious diseases according to the text. The application of combination therapy is determined according to the type of disease, malignancy, stage of progression, and current efficacy of the drugs. In combination therapy, the drugs (vaccines) or kits provided in the present invention may typically be administered alone or simultaneously before or after treatment.

[0245] Preferably, the target of application of the above drug (vaccine) or kit may be a tumor or cancer patient who has already received or is currently receiving surgery (surgical anesthesia, cryosurgery, laser therapy, heat therapy, photodynamic therapy), radiation therapy (extracorporeal radiation, intracorporeal radiation), chemotherapy (neoadjuvant chemotherapy, adjuvant chemotherapy), immunotherapy (CTLA-4 and PD-1 immune checkpoint inhibitors, adoptive cell transfer therapy, therapeutic antibody therapy), targeted therapy (monoclonal antibodies, small molecule drugs), endocrine therapy, stem cell transplantation, and DNA precision therapy, or a patient who has relapsed after receiving one or more of the above therapies.

[0246] Preferably, prevention or treatment includes, but is not limited to, any combination of conventional administration regimens and any combination of drugs (vaccines), reagent sets, or kits provided in the present invention, e.g., conventional therapeutic surgery (surgical anesthesia, cryosurgery, laser therapy, heat therapy, photodynamic therapy), radiation therapy (extracorporeal radiation, intracorporeal radiation), chemotherapy (neoadjuvant chemotherapy, adjuvant chemotherapy), immunotherapy (CTLA-4 and PD-1 immune checkpoint inhibitors, adoptive cell transfer therapy, therapeutic antibody therapy), targeted therapy (monoclonal antibodies, small molecule drugs), endocrine therapy, stem cell transplantation, and DNA precision therapy and any combination of kits provided in the present invention.

[0247] Preferably, the above drug (vaccine) or kit may be administered before, simultaneously with, and / or after another treatment of the disease according to the text.

[0248] Specifically, the above application is implemented by administering an effective dose of RNA molecules or compositions to a required target.

[0249] Preferably, the application is implemented by administering a safe dose of an RNA molecule or composition to a required target, at which the drug exerts optimal efficacy;

[0250] Preferably, the administration method comprises the following: the drug (vaccine) or kit may be administered to a target, patient, or individual several times a day, once a day, several times a week, once a week, or monthly; or the drug (vaccine) or kit may be administered systemically or locally; or the drug (vaccine) or kit may be administered simultaneously or sequentially.

[0251] On the other hand, the present invention provides a vaccine, said vaccine comprising the RNA molecule or composition.

[0252] Specifically, the vaccine is applied by subcutaneous, intradermal, intradermal, topical, or transdermal administration.

[0253] Preferably, the vaccine is applied for administration within a lesion or tumor.

[0254] On the other hand, the present invention provides a kit, said kit comprising the RNA molecule or composition.

[0255] Specifically, the kit further includes technical instructions regarding the administration and dosage information of the liquid carrier or the RNA molecule or composition.

[0256] On the other hand, the present invention provides a method for processing cells in vitro, said method, said method

[0257] (1), step of providing cells in vitro;

[0258] (2) The method is characterized by including the step of contacting the cell according to step (1) with the RNA molecule, composition, vaccine, and kit.

[0259] Specifically, the above method involves transfection, wherein an exogenous nucleic acid comprising the nucleic acid sequence provided in the present invention is introduced into a specific cell, the exogenous nucleic acid is translated into a specific protein encoding the exogenous nucleic acid, and presented to an APC (e.g., a dendritic cell) via an MHC molecule to activate T cells in vivo and ex vivo. Effects of the invention

[0260] The positive and advantageous effects of the present invention are as follows:

[0261] The present invention provides an RNA molecule comprising an HSP domain, a SIG domain, and an AN domain in the coding region of the RNA molecule, wherein the HSP domain encodes an HSP protein family or a variant, fragment, or derivative thereof. The HSP protein family includes full-length, truncated, and mutant forms of HSP70 and its cognate proteins, which enhance antigen-specific immune responses by multi-dimensionally increasing antigen uptake, activation levels, and antigen presentation. Furthermore, the present invention provides a composition, vaccine, and kit comprising the RNA molecule, which can be applied to the prevention and treatment of various diseases such as cancer, infectious diseases, autoimmune diseases, hypersensitivity reactions, or graft-versus-host disease. Brief explanation of the drawing

[0262] Figure 1 shows a situation in which an HPV antigen RNA vaccine using HSP70 full-length elements detects IFN-γ production after immunization by ELISpot. Figure 2 shows a situation in which an HPV antigen RNA vaccine using HSP70 full-length elements detects IFN-γ production after immunization by ICS. Figure 3 shows the results of tumor treatment using an HPV antigen RNA vaccine with HSP70 full-length elements. Figure 4 shows a situation in which an HPV antigen RNA vaccine using the HSP70 SBD element detects IFN-γ production after immunization by ELISpot. Figure 5 shows a situation in which an HPV antigen RNA vaccine using the HSP70 SBD element detects IFN-γ production after immunization by ICS. Figure 6 shows the results of tumor treatment using an HPV antigen RNA vaccine with HSP70 SBD elements. Figure 7 shows a situation in which an HPV antigen RNA vaccine using HSP110 full-length elements detects IFN-γ production after immunization by ICS. Figure 8 shows the results of tumor treatment using an HPV antigen RNA vaccine with HSP110 full-length elements. Figure 9 shows a situation in which an HPV antigen RNA vaccine using the HSP110 SBD element detects IFN-γ production after immunization by ICS. Figure 10 shows the results of tumor treatment using an HPV antigen RNA vaccine with HSP110 SBD elements. Figure 11 shows a situation in which an HPV antigen RNA vaccine using HSP70 full-length elements produced in different construction sequences detects IFN-γ production after immunization by ICS. Figure 12 shows the results of tumor treatment using an HPV antigen RNA vaccine with HSP70 full-length elements produced in different construction sequences. Figure 13 shows a situation in which an HPV antigen RNA vaccine using HSP70 SBD elements produced in different construction sequences detects IFN-γ production after immunization by ICS. Figure 14 shows the tumor treatment results of an HPV antigen RNA vaccine using HSP70 SBD elements produced in different construction sequences. Figure 15 shows a situation in which a colon cancer carcinoembryonic antigen RNA vaccine using the HSP70 SBD element detects IFN-γ production after immunization by ICS. Figure 16 shows the results of tumor treatment using a colon cancer embryonic antigen RNA vaccine with HSP70 SBD elements. Figure 17 shows a situation in which a melanoma-associated antigen RNA vaccine using the HSP70 SBD element detects IFN-γ production after immunization by ICS. Figure 18 shows the results of tumor treatment using a melanoma-associated antigen RNA vaccine with HSP70 SBD elements. Specific details for implementing the invention

[0263] Although the present invention is described in detail below, it should be understood that the invention is not limited to the specific methods, measures, and reagents described herein. Furthermore, the terms used herein are not intended to limit the scope of the invention, and the scope of the invention is limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by a person skilled in the art.

[0264] The components of the present invention are described below. While these components are listed with specific embodiments, it should be understood that these elements may be combined in any manner and quantity to constitute other embodiments. The various examples and preferred embodiments described should not be interpreted as embodiments intended to explicitly limit the present invention. This description should be understood to support and include all embodiments that combine the explicitly described embodiments and the disclosed and / or preferred elements. Furthermore, unless otherwise indicated by the context, any arrangement and combination of all elements described in this application should be deemed to be disclosed in this application.

[0265] Throughout this specification and in the subsequent claims, unless otherwise required by context, terms such as “comprising,” “including,” and “containing,” and their variations, mean including specified components, integers, or steps, but not excluding other unspecified components, integers, or steps. The term “consists of…” is a specific embodiment of “including,” excluding other unspecified components, integers, or steps. In the context of the invention, the term “including” implies the term “consists of…”. For example, “composition including X” may consist only of X, or it may be other contents including X + Y.

[0266] In the context of the invention, particularly in the claims, quantitative indications mean that the elements of the invention may be singular or plural, unless otherwise specified or clearly contradictory in the context. The listing of numerical ranges in the text is intended to briefly indicate each individual value within such range. Unless otherwise specified, each individual value is deemed to be included in the specification, as if separately cited in the text. No language used in the specification shall be interpreted as including any unclaimed elements essential to carrying out the invention.

[0267] The term “basically” does not exclude “completely,” and, for example, a composition “basically not containing Y” may not completely contain Y. If necessary, the term “basically” may be omitted from the definition of the invention.

[0268] For a numerical value x, the term “approximately” means a range of x ± 10.

[0269] Unless otherwise indicated in the present invention, different features of alternative methods and embodiments are interchangeable.

[0270] Next, the present invention will be described in detail in the form of specific embodiments. Unless otherwise specified, all chemical reagents used in the embodiments of the present invention were obtained through general commercial channels.

[0271] Experimental animals

[0272] In the present invention, C57BL / 6 mice are used as experimental animals, which were purchased from Beijing HFK Bioscience Co., Ltd. in China, and female mice aged 6-8 weeks with a body weight of approximately 18g are selected.

[0273] Experimental Method 1: Method for preparing mRNA lipid nanoparticles (LNP)

[0274] 1. Prepare a lipid mother liquor with a total concentration of 10 mM, wherein the molar ratio of the four lipids is SM102 : DSPC : Cholesterol : DMG-PEG2000 = 50 : 10 : 38.5 : 1.5;

[0275] 2. Prepare a sodium citrate buffer solution to pH 4.0;

[0276] (1) Preparation of a 100 mmol / L sodium citrate solution (weighing 14.705 g of sodium citrate powder and dissolving it in 500 mL of MilliQ);

[0277] (2) Preparation of a 100 mmol / L citric acid solution (weigh 10.507 g of sodium citrate powder and dissolve it in 500 mL of MilliQ);

[0278] (3) Combine the prepared sodium citrate solution and citric acid solution and adjust the pH to 4.0;

[0279] (4) The working concentration of the sodium citrate buffer is 10 mmol / L; diluted 10-fold with DEPC-treated water and filtered through a 0.22 μm filter head;

[0280] 3. Prepare mRNA-LNP;

[0281] (1) Calculate the mRNA mass required for mouse immunity each time, and divide the mRNA mass by 0.09174 (the ratio of nitrogen to phosphorus in the lipid mother liquor composition is fixed, and the molar amount of mRNA can be calculated through the known mRNA mass and the molecular weight of a single nucleotide, and the molar amount of other lipids is calculated by defining the nitrogen to phosphorus ratio as 6:1, and then the mass is recalculated based on that molar amount and molecular weight, and then the concentration is recalculated by applying a ratio of mRNA aqueous volume to lipid aqueous volume of 3:1) to calculate the aqueous volume (inhaled mRNA volume + sodium citrate buffer).

[0282] (2) The ratio of the volume of the lipid mother liquor to the volume of the aqueous phase is 1:3.

[0283] (3) The lipid phase and aqueous phase are drawn from the left and right tubes of the microfluidic device, respectively; the fluid transfer rates of the lipid phase and aqueous phase are 4 mL / min and 12 mL / min, respectively, on the left and right.

[0284] (5) After collecting the synthetic solution, immediately dilute it 10 times with ultrapure water.

[0285] (6) Ultrafiltration and centrifugation at 3000 rpm, washing with DEPC water once during the ultrafiltration process, and concentrating until the required injection volume is reached, and isosmotic adjustment with 10 times PBS solution before injection.

[0286] Example 1: Effects of an HPV antigen RNA vaccine using HSP70 full-length elements

[0287] mRNA lipid nanoparticles (designated as mRNA-HSP70) are prepared by the manufacturing method according to Experimental Method 1, wherein the mRNA coding region sequentially encodes a signal peptide, an HPV antigen, and an HSP70 full-length element from the 5' end to the 3' end. The coding region of the mRNA has a nucleotide sequence indicated by SEQ ID NO.33, and the HSP domain has a nucleotide sequence indicated by SEQ ID NO.1.

[0288] 1. Detection of IFN-γ

[0289] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7 (purchased from iCell (Shanghai) Bioscience Co., Ltd., part number iCell-m080), with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0290] Experimental group injection drug: mRNA-lipid nanoparticles (mRNA-HSP70);

[0291] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0292] Splenocytes were collected from mice in the experimental and control groups one week after the end of immunity, lymphocytes were isolated, and the lymphocytes were divided into two parts and subsequently used for IFN-γ detection.

[0293] 1.1 Detection of IFN-γ production after immunoassay using ELISpot

[0294] After stimulating lymphocytes with HPV16 E7 antigen peptide (synthesized by Wuhan DG peptides Co., Ltd.) at a final concentration of 10 μg / mL for 48 hours, the cell culture supernatant was collected and used in an enzyme-linked immunosorbent assay to detect post-immunization IFN-γ production by referring to the steps in the instructions of the ELISpot kit (Shenzhen Dakewe Biotech Co., Ltd., Part No. 2210005).

[0295] The detection results are shown in Figure 1, and an antigen-specific T cell response was observed in the mRNA-HSP70 group.

[0296] 1.2 Detection of IFN-γ production after ICS-induced immunization

[0297] After stimulating lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, cells were collected and CD8 by flow cytometry + The level of intracellular IFN-γ production was analyzed.

[0298] The detection results are shown in Figure 2, and an antigen-specific T cell response was observed in the mRNA-HSP70 group.

[0299] 2. Tumor Treatment Results

[0300] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0301] Experimental group injection drug: mRNA-lipid nanoparticles (designated as mRNA-HSP70);

[0302] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0303] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0304] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0305] Changes in mouse tumor volume are shown in Figure 3, and significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 group.

[0306] Example 2: Effects of HPV antigen RNA vaccine using HSP70 SBD element

[0307] mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD) are prepared by the preparation method according to Experimental Method 1, wherein the mRNA coding region sequentially encodes a signal peptide, an HPV antigen, and an HSP70 SBD element from the 5' end to the 3' end. The coding region of the mRNA has a nucleotide sequence indicated by SEQ ID NO. 34, wherein the HSP domain has a nucleotide sequence indicated by SEQ ID NO. 2.

[0308] 1. Detection of IFN-γ

[0309] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0310] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD);

[0311] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0312] Splenocytes were collected from mice in the experimental and control groups one week after the end of immunity, lymphocytes were isolated, and the lymphocytes were divided into two parts and subsequently used for IFN-γ detection.

[0313] 1.1 Detection of IFN-γ production after immunoassay using ELISpot

[0314] After stimulating lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 48 hours, the cell culture supernatant was collected and used in an enzyme-linked immunosorbent assay to detect post-immunization IFN-γ production by referring to the steps in the ELISpot kit instructions.

[0315] According to the detection results (Fig. 4), an antigen-specific T cell response was observed in the mRNA-HSP70 SBD group.

[0316] 1.2 Detection of IFN-γ production after ICS-induced immunization

[0317] After stimulating lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, cells were collected and CD8 by flow cytometry + The level of intracellular IFN-γ production was analyzed.

[0318] The detection results are shown in Figure 5, and an antigen-specific T cell response was observed in the mRNA-HSP70 SBD group.

[0319] 2. Tumor Treatment Results

[0320] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0321] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD);

[0322] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0323] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0324] Volume (mm) 3)=Length (mm)×Width 2 (mm)÷2

[0325] Changes in mouse tumor volume are shown in Figure 6, and significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 SBD group.

[0326] Example 3: Effects of HPV antigen RNA vaccine using HSP110 full-length elements

[0327] mRNA lipid nanoparticles (designated as mRNA-HSP110) are prepared by the preparation method according to Experimental Method 1, wherein the mRNA coding region sequentially encodes a signal peptide, an HPV antigen, and a full-length element of HSP110 from the 5' end to the 3' end. The coding region of the mRNA has a nucleotide sequence indicated by SEQ ID NO. 35, wherein the HSP domain has a nucleotide sequence indicated by SEQ ID NO. 3.

[0328] 1. Detection of IFN-γ production after ICS-induced immunization

[0329] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0330] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP110);

[0331] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0332] For mice in the experimental and control groups, spleens were collected one week after the completion of immunization, and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, cells were collected and analyzed for CD8 + The level of intracellular IFN-γ production was analyzed.

[0333] The detection results are shown in Figure 7, and an antigen-specific T cell response was observed in the mRNA-HSP110 group.

[0334] 2. Tumor Treatment Results

[0335] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0336] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP110);

[0337] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0338] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0339] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0340] Changes in mouse tumor volume are shown in Figure 8, and significant inhibition of mouse tumor growth was observed in the mRNA-HSP110 group.

[0341] Example 4: Effects of HPV antigen RNA vaccine using HSP110 SBD element

[0342] mRNA lipid nanoparticles (designated as mRNA-HSP110 SBD) are prepared by the preparation method according to Experimental Method 1, wherein the mRNA coding region sequentially encodes a signal peptide, an HPV antigen, and an HSP110 SBD element from the 5' end to the 3' end. The coding region of the mRNA has a nucleotide sequence indicated by SEQ ID NO. 36, wherein the HSP domain has a nucleotide sequence indicated by SEQ ID NO. 4.

[0343] 1. Detection of IFN-γ production after ICS-induced immunization

[0344] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0345] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP110 SBD);

[0346] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0347] For mice in the experimental and control groups, spleens were collected one week after the completion of immunization, and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, cells were collected and analyzed for CD8 + The level of intracellular IFN-γ production was analyzed.

[0348] The detection results are shown in Figure 9, and antigen-specific T cell responses were observed in the mRNA-HSP110 SBD group.

[0349] 2. Tumor Treatment Results

[0350] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0351] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP110 SBD);

[0352] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0353] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0354] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0355] Changes in mouse tumor volume are shown in Figure 10, and significant inhibition of mouse tumor growth was observed in the mRNA-HSP110 SBD group.

[0356] Example 5: HPV antigen RNA vaccines prepared with different construction sequences of HSP70 full-length elements

[0357] mRNA lipid nanoparticles 1-3 were prepared using the preparation method according to Experimental Method 1, and the information regarding mRNA lipid nanoparticles 1-3 is as follows:

[0358] The encoding region of mRNA lipid nanoparticle 1 sequentially encodes a signal peptide, HPV antigen, and HSP70 full-length element from the 5' end to the 3' end and has a nucleotide sequence denoted by SEQ ID NO.33, where the HSP domain has a nucleotide sequence denoted by SEQ ID NO.1.

[0359] The coding region of mRNA lipid nanoparticle 2 sequentially encodes a signal peptide, an HSP70 full-length element, and an HPV antigen from the 5' end to the 3' end, and has a nucleotide sequence denoted by SEQ ID NO.37, where the HSP domain has a nucleotide sequence denoted by SEQ ID NO.1.

[0360] The coding region of mRNA lipid nanoparticle 3 sequentially encodes the HSP70 full-length element, signal peptide, and HPV antigen from the 5' end to the 3' end and has a nucleotide sequence denoted by SEQ ID NO.38, where the HSP domain has a nucleotide sequence denoted by SEQ ID NO.1.

[0361] 1. Detection of IFN-γ production after ICS-induced immunization

[0362] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into four groups (Group 1, Group 2, Group 3, and Control Group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0363] Group 1 injectable drug: mRNA lipid nanoparticles 1;

[0364] Group 2 Injectable Drug: mRNA Lipid Nanoparticles 2;

[0365] Group 3 Injectable Drug: mRNA Lipid Nanoparticles 3;

[0366] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0367] Splenocytes were collected from mice in Groups 1, 2, 3, and the control group one week after the completion of immunization, and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and analyzed for CD8 by flow cytometry. + The level of intracellular IFN-γ production was analyzed.

[0368] The detection results are shown in Figure 11, and antigen-specific T cell responses were observed in all vaccine immune groups, showing a significant difference from the control group. Although there was no statistical difference in immune responses among the three vaccines, Group 1 showed the best effect, followed by Group 2 and Group 3.

[0369] 2. Tumor Treatment Results

[0370] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into four groups (Group 1, Group 2, Group 3, and Control Group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0371] Group 1 injectable drug: mRNA lipid nanoparticles 1;

[0372] Group 2 Injectable Drug: mRNA Lipid Nanoparticles 2;

[0373] Group 3 Injectable Drug: mRNA Lipid Nanoparticles 3;

[0374] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0375] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0376] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0377] The detection results are shown in Figure 12, and significant inhibition of mouse tumor growth was observed in all three vaccine immunization groups, showing a significant difference from the control group. Although there was no statistical difference in tumor volume among the three vaccines, Group 1 showed the best effect, followed by Group 2 and Group 3.

[0378] Example 6: HPV antigen RNA vaccines prepared with different construction sequences of HSP70 SBD elements

[0379] mRNA lipid nanoparticles 1-3 were prepared using the preparation method according to Experimental Method 1, and the information regarding mRNA lipid nanoparticles 1-3 is as follows:

[0380] The encoding region of mRNA lipid nanoparticle 1 sequentially encodes a signal peptide, HPV antigen, and HSP70 SBD element from the 5' end to the 3' end and has a nucleotide sequence denoted by SEQ ID NO.34, where the HSP domain has a nucleotide sequence denoted by SEQ ID NO.2.

[0381] The encoding region of mRNA lipid nanoparticle 2 sequentially encodes a signal peptide, an HSP70 SBD element, and an HPV antigen from the 5' end to the 3' end, and has a nucleotide sequence denoted by SEQ ID NO.39, where the HSP domain has a nucleotide sequence denoted by SEQ ID NO.2.

[0382] The coding region of mRNA lipid nanoparticle 3 sequentially encodes HSP70 SBD, signal peptide, and HPV antigen from the 5' end to the 3' end and has a nucleotide sequence denoted by SEQ ID NO.40, where the HSP domain has a nucleotide sequence denoted by SEQ ID NO.2.

[0383] 1. Detection of IFN-γ production after ICS-induced immunization

[0384] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into four groups (Group 1, Group 2, Group 3, and Control Group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0385] Group 1 injectable drug: mRNA lipid nanoparticles 1;

[0386] Group 2 Injectable Drug: mRNA Lipid Nanoparticles 2;

[0387] Group 3 Injectable Drug: mRNA Lipid Nanoparticles 3;

[0388] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0389] Splenocytes were collected from mice in Groups 1, 2, 3, and the control group one week after the completion of immunization, and lymphocytes were isolated. After stimulating the lymphocytes with HPV16 E7 antigen peptide at a final concentration of 10 μg / mL for 6 hours, the cells were collected and analyzed for CD8 by flow cytometry. + The level of intracellular IFN-γ production was analyzed.

[0390] The detection results are shown in Figure 13, and antigen-specific T cell responses were observed in all vaccine immune groups, showing a significant difference from the control group. Although there was no statistical difference in immune responses among the three vaccines, Group 1 showed the best effect, followed by Group 2 and Group 3.

[0391] 2. Tumor Treatment Results

[0392] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into four groups (Group 1, Group 2, Group 3, and Control Group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using TC-1 cells expressing HPV16 E6 and HPV16 E7, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0393] Group 1 injectable drug: mRNA lipid nanoparticles 1;

[0394] Group 2 Injectable Drug: mRNA Lipid Nanoparticles 2;

[0395] Group 3 Injectable Drug: mRNA Lipid Nanoparticles 3;

[0396] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0397] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0398] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0399] The detection results are shown in Figure 14, and significant inhibition of mouse tumor growth was observed in all three vaccine immunization groups, showing a significant difference from the control group. Although there was no statistical difference in tumor volume among the three vaccines, Group 1 showed the best effect, followed by Group 2 and Group 3.

[0400] Example 7: Effects of a Colon Cancer Carcinoembryonic Antigen RNA Vaccine Using HSP70 SBD Factor

[0401] mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD) are prepared by the preparation method according to Experimental Method 1, wherein the mRNA coding region sequentially encodes a signal peptide, an Adpgk neoantigen, and an HSP70 SBD element from the 5' end to the 3' end. The coding region of the mRNA has a nucleotide sequence indicated by SEQ ID NO. 41, and the HSP domain has a nucleotide sequence indicated by SEQ ID NO. 2.

[0402] 1. Detection of IFN-γ production after ICS-induced immunization

[0403] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted into the right subcutaneous tissue of C57BL / 6 mice using MC38 cells expressing the Adpgk neoantigen (purchased from Beyotime, product number C7399), with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0404] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD);

[0405] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0406] Splenocytes were collected from mice in the experimental and control groups one week after the termination of immunization, and lymphocytes were isolated. After stimulating the lymphocytes with the Adpgk novel antigen peptide ASMTNMELM (synthesized by Wuhan DG Peptides Co., Ltd.) at a final concentration of 10 μg / mL for 6 hours, the cells were collected and analyzed for CD8 + The level of intracellular IFN-γ production was analyzed.

[0407] The detection results are shown in Figure 15, and an antigen-specific T cell response was observed in the mRNA-HSP70 SBD group.

[0408] 2. Tumor Treatment Results

[0409] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using MC38 cells expressing the Adpgk neoantigen, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0410] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD);

[0411] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0412] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0413] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0414] Changes in mouse tumor volume are shown in Figure 16, and significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 SBD group.

[0415] Example 8: Effects of a melanoma-associated antigen RNA vaccine using the HSP70 SBD element

[0416] mRNA lipid nanoparticles (denoted as mRNA-HSP70 SBD) are prepared by the preparation method according to Experimental Method 1, wherein the mRNA coding region sequentially encodes a signal peptide, a MAGE-1 antigen, and an HSP70 SBD element from the 5' end to the 3' end. The coding region of the mRNA has a nucleotide sequence indicated by SEQ ID NO. 42, wherein the HSP domain has a nucleotide sequence indicated by SEQ ID NO. 2.

[0417] 1. Detection of IFN-γ production after ICS-induced immunization

[0418] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using B16-F10 cells expressing MAGE-1 antigen (purchased from the Cell Bank of the Chinese Academy of Sciences, product number SCSP-5233), with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection volume: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0419] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD);

[0420] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0421] Splenocytes were collected from mice in the experimental and control groups one week after the completion of immunization, and lymphocytes were isolated. After stimulating the lymphocytes with a MAGE-1 antigen peptide library (synthesized by Wuhan DG Peptides Co., Ltd.) at a final concentration of 10 μg / mL for 6 hours, the cells were collected and analyzed for CD8 by flow cytometry. + The level of intracellular IFN-γ production was analyzed.

[0422] The detection results are shown in Figure 17, and antigen-specific T cell responses were observed in the mRNA-HSP70 SBD group.

[0423] 2. Tumor Treatment Results

[0424] Healthy C57BL / 6 mice were acclimatized for one week and then randomly divided into two groups (experimental group and control group). Tumors were implanted subcutaneously into the right side of C57BL / 6 mice using B16-F10 cells expressing MAGE-1 antigen, with 1 million cells (volume 50μL PBS) implanted per mouse. On days 4, 7, and 13 after tumor inoculation, the corresponding drug (injection dose: 50μL, containing 5μg of drug) was injected into the thigh muscles of the mice in the experimental and control groups.

[0425] Experimental group injection drug: mRNA lipid nanoparticles (designated as mRNA-HSP70 SBD);

[0426] Control group injection drug: Drug-free lipid nanoparticles (designated as eLNP).

[0427] During the experiment, the condition of the animals was observed twice daily, mouse body weight was measured three times a week for at least 30 consecutive days, and tumor growth was monitored by measuring the three-dimensional tumor size with calipers. Tumor volume was calculated using the following formula:

[0428] Volume (mm) 3 )=Length (mm)×Width 2 (mm)÷2

[0429] Changes in mouse tumor volume are shown in Figure 18, and significant inhibition of mouse tumor growth was observed in the mRNA-HSP70 SBD group.

[0430] The above detailed description is merely a specific description of an implementable embodiment of the present invention, and such embodiment is not intended to limit the scope of the patent of the present invention. It should be noted that any equivalent embodiment or modification that does not depart from the present invention should be included within the scope of the technical solution of the present invention. Accordingly, the scope of patent protection of the present invention should be determined by the appended claims.

Claims

Claim 1 An RNA molecule, wherein the coding region of the RNA molecule comprises an HSP domain, a SIG domain, and an AN domain; wherein the HSP domain encodes an HSP protein family or a variant, fragment, or derivative thereof; wherein the SIG domain encodes a signal peptide; wherein the AN domain encodes the same or different RNA antigenic peptide or protein; and wherein the HSP protein family comprises a full-length element, a truncated element, or a mutant element of HSP70, HSP110, HSP10, HSP27, HSP40, HSP60, HSP90, HSPE1, HSPB1, HSPB3, gp96, or caleticulin. Claim 2 In claim 1, the RNA molecule is characterized in that the HSP protein family comprises a full-length element, a truncated element, or a mutant element of HSP70 or HSP110. Claim 3 An RNA molecule characterized in that, in paragraph 2, the HSP protein family is an HSP70 full-length element, an HSP70 SBD element, an HSP110 full-length element, or an HSP110 SBD element. Claim 4 In paragraph 3, the RNA molecule is characterized in that the HSP protein family comprises any one amino acid sequence or a fragment, variant, or derivative thereof represented by SEQ ID NO. 5-8. Claim 5 An RNA molecule according to claim 1, characterized in that the HSP domain has any one nucleotide sequence represented by SEQ ID NO.1-4. Claim 6 An RNA molecule according to claim 1, characterized in that the AN domain encodes one, two, three, four, five, six, seven, eight, nine, or ten identical or different RNA antigenic peptides or proteins. Claim 7 An RNA molecule according to claim 1, characterized in that the RNA antigenic peptide or protein comprises a tumor antigen, a viral antigen, a bacterial antigen, a protozoal antigen, a fungal antigen, a homologous antigen, or an autoantigen. Claim 8 In claim 1, the RNA molecule is characterized in that the tumor antigen comprises HPV16 E6, HPV16 E7, Adpgk, or MAGE-1. Claim 9 An RNA molecule according to claim 1, wherein the signal peptide has an amino acid sequence represented by any one of SEQ ID NO. 9-14 or a fragment, variant, or derivative thereof; and the SIG domain comprises a nucleic acid sequence represented by any one of SEQ ID NO. 15-20 or a fragment, variant, or derivative thereof. Claim 10 The RNA molecule according to claim 1, wherein the coding region of the RNA molecule has the following structure: 5'-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'; or 5'-(SIG)a-(L)b-[(HSP)m-(L)d]e-(AN)c-3'; or 5'-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3'; wherein the L domain encodes a linker sequence; b and d are each independently selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; and a, c, e, m are each independently selected from integers 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. Claim 11 An RNA molecule according to claim 10, wherein the linker is a non-immunogenic linker and has an amino acid sequence represented by any one of GS, AAA, AGA, or SEQ ID NO. 21-26, or a fragment, variant, or derivative thereof; and wherein the L domain comprises a nucleic acid sequence represented by any one of GGCAGC, GCCGCCGCC, GCCGGCGCC, or SEQ ID NO. 27-32, or a fragment, variant, or derivative thereof. Claim 12 An RNA molecule according to claim 1, characterized in that the G / C content of the nucleic acid sequence of the coding region of the RNA molecule is increased compared to the G / C content of the nucleic acid sequence of the corresponding wild-type RNA molecule; or the C content of the nucleic acid sequence of the coding region is increased compared to the C content of the nucleic acid sequence of the corresponding wild-type RNA molecule; or the codons of the nucleic acid sequence of the coding region are adapted for human codon selection use, wherein the codon fit index (CAI) is increased or maximized within the nucleic acid sequence of the RNA molecule; and the amino acid sequence encoded by the nucleic acid sequence of the RNA molecule is not changed compared to the amino acid sequence encoded by the nucleic acid sequence of the corresponding wild-type RNA molecule. Claim 13 An RNA molecule according to claim 1, wherein the coding region of the RNA molecule comprises a nucleic acid sequence represented by any one of SEQ ID NO.33-42; or a corresponding amino acid sequence encoded by a nucleic acid sequence represented by any one of SEQ ID NO.33-42. Claim 14 An RNA molecule according to claim 1, characterized in that the coding region of the RNA molecule is located between the 5' UTR and the 3' UTR. Claim 15 An RNA molecule according to claim 1, characterized in that the RNA comprises mRNA, viral RNA, replicator RNA, or circular RNA. Claim 16 An RNA molecule according to claim 1, characterized in that the RNA comprises a single cistron RNA, a double cistron RNA, or a multiple cistron RNA. Claim 17 An RNA molecule characterized in that, in claim 1, the RNA is a modified RNA. Claim 18 The RNA molecule according to claim 1, characterized in that the RNA molecule comprises a polyadenine sequence and comprises 10 to 200, 10 to 100, 40 to 80, or 50 to 70 adenine nucleotides. Claim 19 The RNA molecule according to claim 1, characterized in that the RNA molecule comprises a polycytosine sequence and comprises 10 to 200, 10 to 100, 20 to 70, 20 to 60, or 10 to 40 cytosine nucleotides. Claim 20 The RNA molecule of claim 1, wherein the RNA molecule has the following structure: 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy; or 5'CAP-5'UTR-(SIG)a-(L)b-[(AN)c-(L)d]e-(HSP)m-3'UTR-3'Ploy; or 5'CAP-5'UTR-(HSP)m-(L)b-[(SIG)a-(L)d]e-(AN)c-3'UTR-3'Ploy. Claim 21 In claim 20, the RNA molecule is characterized in that the 5'CAP comprises m7GpppN, ARCA cap, or cap 1. Claim 22 An RNA molecule according to claim 21, characterized in that the amino acid sequence of the 5'CAP is AG. Claim 23 An RNA molecule according to claim 20, wherein the 5'-UTR comprises a nucleic acid sequence represented by SEQ ID NO. 43-48 or a fragment, variant, or derivative thereof; or a corresponding amino acid sequence encoding a nucleic acid sequence represented by any one of SEQ ID NO. 43-48. Claim 24 An RNA molecule according to claim 20, wherein the 3'-UTR comprises a nucleic acid sequence represented by SEQ ID NO. 49-54 or a fragment, variant, or derivative thereof; and a corresponding amino acid sequence encoded by any one of SEQ ID NO. 49-54. Claim 25 In claim 20, the RNA molecule is characterized in that the 3' Poly comprises a polyadenine tail or a polycytosine tail. Claim 26 An RNA molecule according to claim 25, characterized in that the polyadenine tail comprises 10 to 1000, 10 to 500, 10 to 300, 10 to 200, 10 to 100, 40 to 80, or 50 to 70 adenine nucleotides. Claim 27 An RNA molecule according to claim 26, characterized in that the polycytosine tail comprises 10 to 200, 10 to 100, 20 to 70, 20 to 60, or 10 to 40 cytosine nucleotides. Claim 28 A composition characterized in that, in the composition, the composition comprises an RNA molecule according to any one of claims 1 to 27 and a pharmaceutically acceptable carrier or excipient thereof. Claim 29 A composition according to claim 28, characterized in that the RNA molecule is combined with one or more cationic compounds or polycationic compounds. Claim 30 A composition according to claim 29, wherein the cationic compound comprises a cationic polymer, a cationic peptide or protein, a cationic polysaccharide or a cationic lipid; and the polycationic compound comprises a polycationic polymer, a polycationic peptide or protein, a polycationic polysaccharide or a polycationic lipid. Claim 31 A composition according to claim 30, characterized in that the RNA molecule is combined with one or more cationic lipids or polycationic lipids to form lipid nanoparticles, lipid complexes, or liposomes. Claim 32 A composition according to claim 29, characterized in that the N / P ratio between the RNA molecule and the cationic compound or polycationic compound comprises 0.1:1 to 10:

1. Claim 33 A composition according to claim 32, characterized in that the N / P ratio between the RNA molecule and the cationic compound or polycationic compound is 6:

1. Claim 34 Application of an RNA molecule according to any one of claims 1 to 27 or a composition according to any one of claims 28 to 33 in the manufacture of a drug or kit. Claim 35 In paragraph 34, the application is characterized by being implemented by administering an effective dose of RNA molecules or compositions to a required target. Claim 36 In paragraph 35, the application is characterized by including an application in manufacturing a drug or kit for preventing, treating, or diagnosing tumors, cancer, infectious diseases, autoimmune diseases, graft-versus-host disease, or hypersensitivity reactions. Claim 37 In Clause 34, the application is characterized in that the above drug is a vaccine. Claim 38 A vaccine characterized in that the vaccine comprises an RNA molecule according to any one of claims 1 to 27 or a composition according to any one of claims 28 to 33. Claim 39 In paragraph 38, the vaccine is characterized by being applied by subcutaneous, intradermal, intradermal, topical, or transdermal administration. Claim 40 A kit characterized in that the kit comprises an RNA molecule according to any one of claims 1 to 27 or a composition according to any one of claims 28 to 33. Claim 41 In claim 40, the kit is characterized by further including a technical description regarding the administration and dosage information of the liquid carrier or the RNA molecule or composition. Claim 42 A method for processing cells in vitro, wherein the method comprises: (1) a step of providing cells in vitro; (2) a step of contacting the cells according to step (1) with an RNA molecule according to any one of claims 1 to 27, a composition according to any one of claims 28 to 33, a vaccine according to any one of claims 38 to 39, or a kit according to any one of claims 40 to 41.

Images