Primer set for genotyping of the Cicindela (Abroscelis) anchoralis and noninvasive genotyping method using the same
Patent Information
- Application Number
- KR1020250027543
- Authority / Receiving Office
- KR · KR
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2026-09-14
Smart Images
Figure PAT00001_ABST
Abstract
Description
Technology Field
[0001] The present invention relates to a method for analyzing the genetic diversity of a propagated population using residual genetic material in the molted shells of Anchusa larvae and primers for genotype analysis. Specifically, the present invention relates to a method for extracting and diluting residual genetic material within the molted shells of Anchusa larvae and a PCR method using primers for genotype analysis. More specifically, the present invention relates to a method for confirming the genotype using a non-invasive method before releasing a population composed of Anchusa larvae artificially propagated for restoration into a habitat. Background Technology
[0002] Cicindel (Abroscelis) anchoralis is an insect designated as a Class I endangered wild animal by the Ministry of Environment. It is a type of ground beetle that used to inhabit sandbars along the West Coast, but is currently confirmed to inhabit only two regions: Taean-gun in South Chungcheong Province and Sinan-gun in South Jeolla Province. It primarily lives on beaches composed of wide mudflats and fine sand, feeding on crabs, beach flies, and the like.
[0003] Adults are active from early to mid-June until early August, laying approximately 50 to 100 eggs on moist beach sand. However, due to recent coastal development along the West Sea (docks, ports), the construction of stone embankments and breakwaters to prevent seawater flooding caused by rising sea levels, and the increase in human recreational activities such as swimming, the population and individual numbers have declined rapidly; as of 2024, it was confirmed that only about 100 individuals were active in their habitat. Accordingly, starting in 2023, the Center for Restoration of Endangered Species at the National Institute of Ecology developed indoor artificial breeding techniques to restore the Anchor-patterned Ground Beetle. Furthermore, conservation activities are currently being carried out by releasing larvae secured through these artificial breeding techniques into restoration habitats.
[0004] One of the considerations when releasing pioneer populations—that is, breeding populations for introduction—into new habitats is whether the target organisms are adapted to the habitat. It is known that the success of habitat adaptation (environmental adaptability) and restoration of such introduced and released populations increases as the genetic diversity of the initial introduced and released populations increases. However, there have been no cases to date where the genetic diversity of the domestic population of the Japanese tiger beetle has been analyzed, and consequently, it was not possible to know how the genetic diversity of the breeding population secured through indoor artificial breeding technology is composed.
[0005] In order to analyze such genetic diversity, it is unavoidable to collect a portion of tissue from the target species. However, the larvae of the spotted tiger beetle intended for release into habitats have bodies composed of cuticles that are easily physically damaged. Therefore, if a portion of tissue is collected, there is a very high probability of mortality, and they fail to develop into normal adults due to developmental disorders. Accordingly, the present invention has developed a method to amplify specific genetic sequences using molted exoskeletons produced during the growth process of the larvae, without physically harming the spotted tiger beetle larvae intended for release into habitats for restoration. Prior art literature
[0006] Republic of Korea Published Patent Document No. 10-2021-0153462 (December 17, 2021) The problem to be solved
[0007] The object of the present invention is to provide a primer set for non-invasive genotyping analysis of the ark-patterned ground beetle.
[0008] Another objective of the present invention is to provide a kit for non-invasive genotyping of the ark-patterned ground beetle comprising the above primer set.
[0009] Another objective of the present invention is to provide a non-invasive method for genotyping using molted shells of the larvae of the Japanese tiger beetle. means of solving the problem
[0010] In this invention, we aimed to analyze genetic diversity within a population artificially propagated from adult *Aquilegia chinensis* inhabiting Sinan, Jeollanam-do. To this end, the cytochrome c oxidase subunit I gene, one of the mitochondrial electron transport system proteins with a relatively high variation rate, was selected. To amplify regions capable of confirming all genotypes within the propagated population, primers for genotype analysis were developed, and an amplification method was established. Furthermore, a method was established to analyze genetic diversity by extracting genetic material remaining within molted exoskeletons without physically damaging the *Aquilegia chinensis* larvae.
[0011] Through the present invention, a foundation has been laid to analyze the genetic diversity of a breeding population by confirming the genotype of the larvae of the endangered wild animal, the Japanese tiger beetle, without physically harming them before releasing them into their habitat. Analyzing the genetic diversity of the breeding population before release into the habitat is expected to have a major effect in increasing the possibility of habitat restoration through the release of the breeding population by enabling the formation of rich genetic diversity of the Japanese tiger beetle.
[0012] The present invention provides a primer set for genotyping analysis of a breeding population of *Cicindela (Abroscelis) anchoralis*, comprising a forward primer composed of the nucleotide sequence of SEQ ID NO. 1, preferably AnCOI-st-F, and a reverse primer composed of the nucleotide sequence of SEQ ID NO. 2, preferably AnCOI-st-R. By using the primer set comprising the forward primer composed of the nucleotide sequence of SEQ ID NO. 1, preferably AnCOI-st-F, and the reverse primer composed of the nucleotide sequence of SEQ ID NO. 2, preferably AnCOI-st-R, a target sequence can be amplified from residual gDNA extracted from the molted shells of *Cicindela (Abroscelis) anchoralis* larvae, thereby enabling genetic diversity analysis capable of distinguishing individual genotypes of a breeding population of *Cicindela (Abroscelis) anchoralis* obtained through artificial breeding.
[0013] The sequence number is as follows.
[0014] Primer name Sequence information (5'→3') Sequence number AnCOI-st-F GTTTGGGAATTGACTTGTTCC 1 AnCOI-st-R GTTGATATAGAATAGGGTCCC 2
[0015] According to a preferred embodiment of the present invention, when molted shells of the larva
[0016] According to a preferred embodiment of the present invention, the molted shell of the anchor-patterned tiger beetle larva may include epithelial cells separated from the body of the anchor-patterned tiger beetle larva.
[0017] According to a preferred embodiment of the present invention, the genotype may be a cytochrome c oxidase subunit I genotype present in a population of the Japanese tiger beetle, but is not limited thereto. Using the primer set for genotype analysis, three cytochrome c oxidase subunit I genotypes present in an artificially bred population of the Japanese tiger beetle can be identified.
[0018] According to a preferred embodiment of the present invention, the primer set for genotype analysis can identify the individual COI (cytochrome c oxidase subunit I) genotype within a breeding population using the molted shells of the larvae of the Japanese tiger beetle.
[0019] The present invention also provides a kit for non-invasive genotyping of the anchor beetle comprising the above primer set.
[0020] According to a preferred embodiment of the present invention, the kit may further include a DNA polymerase for amplification reaction, dNTPs, and a reaction buffer.
[0021] The present invention also provides a non-invasive genotyping method for a spotted ground beetle, comprising: i) a step of extracting and diluting residual gDNA from the molted shell of a spotted ground beetle larva; ii) a step of performing an amplification reaction of a target sequence using a primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO. 2, using the gDNA isolated in step i) as a template; and iii) a step of detecting the amplified product of step ii).
[0022] According to a preferred embodiment of the present invention, in step ii), the target sequence may be the cytochrome c oxidase subunit I, but is not limited thereto.
[0023] According to a preferred embodiment of the present invention, the detection in step iii) may be confirmed by checking whether a DNA band is formed through electrophoresis or whether fluorescence is emitted using a luminescent substance, but is not limited thereto. For example, the present invention may further perform a step of adding a luminescent substance to visually confirm the amplification product generated by PCR amplification. That is, it is possible to prepare a reaction solution containing the primer set of the present invention, add a sample thereto to proceed with DNA synthesis, and then add a luminescent substance. The luminescent substance may be a commonly used one, but preferably, Evagreen, SYBR green, or Picogreen may be used.
[0024] Accordingly, the present invention can be effectively used to enrich the genetic diversity of a population artificially bred through non-invasive genotyping analysis without physically harming the larvae of the Japanese snail beetle, thereby enriching the genetic diversity of the population before release into the habitat. Effects of the invention
[0025] The non-invasive genotype analysis method using molted exoskeletons of the larvae of the larvae of the present invention allows for genotype analysis without physically harming the larvae of Brief explanation of the drawing
[0026] Figure 1 is a schematic diagram showing the experimental steps for collecting molted shells, extracting and diluting residual gDNA, PCR amplification, and genotype analysis of the larvae of the spotted ground beetle, which is the subject of the present invention. FIG. 2 shows the cytochrome c oxidase subunit I genotype of the bred population of the Anchusa japonica according to the present invention, the Drosophila cytochrome c oxidase subunit I nucleotide sequence, and the sequences of primers for genotype analysis (black triangle: nucleotide sequence locus capable of distinguishing genotypes). Figure 3 shows the results of extracting gDNA from the molted shells of *Anchor-patterned Ground Beetle* larvae using the electrophoresis of the present invention and comparing the amplification of target sequences via the PCR method according to the dilution ratio of the lysate (Mk: 100 base pair DNA marker, stock lysate, amplification product of the stock molted shell lysate using direct extraction buffer; 2-fold dilution, amplification product of a solution mixed with stock molted shell lysate and nuclease-free water in a 1:1 ratio; 5-fold dilution, amplification product of a solution mixed with stock molted shell lysate and nuclease-free water in a 1:4 ratio; 10-fold dilution, amplification product of a solution mixed with stock molted shell lysate and nuclease-free water in a 1:9 ratio; 20-fold dilution, amplification product of a solution mixed with stock molted shell lysate and nuclease-free water in a 1:19 ratio; 50-fold dilution, amplification product of a solution mixed with stock molted shell lysate and nuclease-free water in a 1:49 ratio Amplification product of the solution; control group, product amplified after extracting gDNA from larval carcasses using QIAgen's DNeasy Blood & Tissue kit). FIG. 4 is a diagram showing the recovery rate and genotype ratio of intact molted exoskeletons of *Anchusa japonica* larvae within the artificially propagated population of the present invention (recovery rate, average value of molted exoskeletons recovered from 6 populations (total 126 individuals) of the propagation population; genotype ratio, ratio of cytochrome c oxidase subunit I genotypes (A, B, C) within the propagation population). Figure 5 shows the results of confirming how long residual gDNA in the molted exoskeletons of *Anchusa japonica* larvae can be detected and amplified by exposing them to rearing environment conditions (26 ± 2℃, relative humidity 50-60%) at 5-day intervals for up to 30 days using the electrophoresis of the present invention (Mk, 100 base pair DNA marker; Day 5, molted exoskeletons repeat 1-8 on day 5 of environmental exposure after molting; Day 10, molted exoskeletons repeat 1-8 on day 10 of environmental exposure after molting; Day 15, molted exoskeletons repeat 1-8 on day 15 of environmental exposure after molting; Day 20, molted exoskeletons repeat 1-8 on day 20 of environmental exposure after molting; Day 25, molted exoskeletons repeat 1-8 on day 25 of environmental exposure after molting; Day 30, molted exoskeletons repeat 1-8 on day 30 of environmental exposure after molting). Specific details for implementing the invention
[0027] The present invention will be described in more detail below.
[0028] As mentioned above, the larva of the Japanese tiger beetle has an exoskeleton composed of a cuticle that is physically easy to damage, so there is a high probability of mortality when tissue is taken for genotyping analysis, and there is no reported information on the genotypes of the Japanese tiger beetle inhabiting Korea for the analysis of genetic diversity within the Japanese tiger beetle population.
[0029] The primer set for genotype analysis using residual gDNA within the molted shells of larvae according to the present invention utilizes gDNA derived from epithelial cells remaining within the molted shells of the larvae of the Japanese tiger beetle, so it is not necessary to collect tissue from the larvae of the Japanese tiger beetle to obtain genetic material of the Japanese tiger beetle. Accordingly, the present invention allows for the extraction of gDNA from the molted shells of the larvae of the Japanese tiger beetle, and the amplification of the gDNA using a PCR method to distinguish genotypes and analyze genetic diversity within a propagated population.
[0030] The present invention utilized PCR (Polymerase Chain Reaction) to analyze the genotype of the endangered wild animal, the larva of the endangered wild animal, the larva of the endangered wild animal (Fig. 1), to extract gDNA from epithelial cells remaining inside the molted shell of the endangered wild animal, the larva of the endangered wild animal (Fig. 1), gDNA was extracted using a direct extraction buffer (20 mM sodium hydroxide, 5% polyethylene glycol 200, and 5% dimethyl sulfoxide) (Fig. 1), and a primer set capable of amplifying the gDNA to analyze the genotype was prepared (Fig. 2). The primers for genotyping analysis described above are a primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1 AnCOI-st-F and a reverse primer consisting of the nucleotide sequence of SEQ ID NO. 2 AnCOI-st-R. Primers specific to COI (Cytochrome c oxidase subunit I) of the mitochondrial DNA (mtDNA) of *Anchorbital* were designed to maximize the amplification of the cytochrome c oxidase subunit I genetic sequence present in weak larval molts and to confirm all genotypes within the propagated population. Using the primers for genotyping analysis, gDNA extracted from *Anchorbital* larval carcasses and molts was PCR-amplified, and a final amplified product of approximately 508 base pairs was confirmed by electrophoresis (Figs. 3 and 5). Sequencing analysis of PCR amplification products to analyze individual genotypes confirmed that there were 3 COI genotypes in the artificially bred population of the Japanese tiger beetle (Fig. 2).
[0031] The present invention will be described in detail below through examples. However, these examples are intended to explain the invention more specifically, and the scope of the invention is not limited to these examples.
[0033] Example 1. Method for extracting and diluting residual gDNA within the molted shells of *Anchor-patterned Ground Beetle* larvae
[0034] The method for extracting residual gDNA from the molted exoskeletons of the larvae of the Japanese tiger beetle is shown in Fig. 1. For the extraction of residual gDNA from the molted exoskeletons using a direct extraction buffer (20 mM sodium hydroxide, 5% polyethylene glycol 200, and 5% dimethyl sulfoxide), one molted exoskeleton (approximately 2–3 mm in size) produced during the development of a first-instar larva of the Japanese tiger beetle into a second-instar larva was placed in a 1.5 mL tube, and 200 mL of direct extraction buffer was added. The mixture of the molted exoskeleton and extraction buffer was crushed using a plastic mortar and pestle, and then reacted at room temperature (23–25°C) for 10 minutes, with the mixture being stirred once every 3 minutes to ensure that the crushed exoskeleton material and the extraction buffer were mixed.
[0035] To determine the optimal dilution ratio of the crushed defoliated shells, after the crushed shells had completely settled following a 10-minute reaction, 5 μL of the supernatant was transferred to a new 1.5 mL tube. Then, 5 μL, 20 μL, 45 μL, 95 μL, and 245 μL of nuclease-free water were added to dilute the crushed shells by 2, 5, 10, 20, and 50 times, respectively. Finally, 5 μL of the final diluted solution was used as the PCR reaction mixture to compare amplification efficiency. As shown in Figure 3, the amplification efficiency was compared using 20 ng of gDNA (control group) extracted from residual gDNA in the defoliated shells using a commercial gDNA extraction kit and 5 μL of the undiluted supernatant (stock lysate) as the PCR reaction mixture (Figure 3).
[0037] Example 2. Amplification of Residual gDNA in Molted Shells of Larvae of the Japanese Ground Beetle and Selection of Optimal Dilution Ratio
[0038] PCR was used to amplify the COI (Cytochrome c oxidase subunit I) gene region of mitochondrial DNA (mtDNA) of epithelial cells that are weakly present in the molted shells of *Anchodian beetle* larvae. 50 μL of PCR reaction mixture [10 pmol / μL of AnCOI-st-F forward primer (GTTTGGGAATTGACTTGTTCC), 10 pmol / μL of AnCOI-st-R reverse primer (GTTGATATAGAATAGGGTCCC), one AccuPower PCR Premix tube, 5 μL of the final dilution of residual gDNA extracted in the molted shells of *Anchodian beetle* larvae in Example 1, and 45 μL of nuclease-free water] was added to a PCR tube and mixed well. The above PCR tube was tested on a PCR machine at 95°C for 3 minutes, followed by 40 cycles of 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 40 seconds, and finally, the PCR reaction was terminated by testing at 72°C for 3 minutes. Electrophoresis was performed to determine the amplification product, which was approximately 508 base pairs in size. As a result, it was confirmed that the COI (cytochrome c oxidase subunit I) genetic sequence target region in the residual gDNA within the molted shells of the Japanese tiger beetle larvae was amplified (Fig. 3). In order to select the optimal dilution ratio for extracting residual gDNA from molted shells of Japanese tiger beetle larvae using direct extraction buffer, the amplification efficiency was compared according to the dilution ratio. It was confirmed that no amplification reaction occurred in the undiluted lysate, and the amplification reaction increased up to a dilution ratio of 10 times but decreased from 20 times. Among the 5-fold and 10-fold dilutions of the lysate, the 10-fold dilution, which showed a similar degree of amplification compared to the control group (gDNA from carcasses of larvae using a commercial extraction kit), was selected as the optimal dilution ratio for the method of extracting residual gDNA from molted shells of Japanese tiger beetle larvae using direct extraction buffer.
[0040] Example 3. Genotype analysis of molted exoskeletons of *Anchor-patterned Ground Beetle* larvae
[0041] As in Examples 1 and 2, residual gDNA was extracted from the molted exoskeletons of larvae, and the target regions of the COI genetic sequences in the molted exoskeletons of 40 individuals of the spotted tiger beetle were amplified using the PCR method. Sequencing analysis was performed to determine the types of genotypes and genotype ratios within the spotted tiger beetle breeding population using the PCR amplification products. The results showed that the COI genotypes of the spotted tiger beetle breeding population consisted of a total of three types, genotypes A, B, and C, as shown in Fig. 2, with genotypes A, B, and C accounting for 20%, 52.5%, and 27.5%, respectively (Fig. 4).
[0043] Example 4. Investigation of the detection limit of amplification of residual gDNA in molted shells of *Anchor-patterned Ground Beetle* larvae
[0044] We aimed to determine within what timeframe after molting the molted exoskeletons of *Anchor-patterned Ground Beetle* larvae must be retrieved for consistent PCR amplification of residual gDNA within the exoskeletons using the direct extraction method. A total of 48 exoskeletons were exposed to indoor rearing conditions for up to 30 days after molting. Eight exoskeletons were retrieved at 5-day intervals, and residual gDNA within the exoskeletons was extracted and amplified as in Examples 1 and 2. The presence or absence of amplification was determined by comparing the amplified products on an electrophoresis. The detection limit was set as the point where all residual gDNA in the eight exoskeletons at each time point was amplified. While amplification reactions were observed in 5 out of 8 exoskeletons up to the 30th day of exposure to the rearing environment, amplification occurred in all 8 exoskeletons only after 5 days of exposure. This confirmed that *Anchor-patterned Ground Beetle* larval exoskeletons must be retrieved within 5 days of molting for amplification to occur via the direct extraction method and PCR (Fig. 5). Therefore, it was found that the molted exoskeletons of the larvae of the present invention must be collected within 5 days immediately after molting for genetic analysis.
Claims
Claim 1 A primer set for genotyping a breeding population of *Cicindela (Abroscelis) anchoralis*, comprising: a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1; and a reverse primer consisting of the nucleotide sequence of SEQ ID NO. 2; wherein the primer set is a primer set for non-invasive genotyping of *Cicindela (Abroscelis) anchoralis*, using *Cicindela (Abroscelis) anchoralis* larval molted shells as a sample. Claim 2 A primer set for non-invasive genotyping analysis of an anchor-patterned tiger beetle, wherein the larval molted shell comprises epithelial cells separated in vitro from the body of an anchor-patterned tiger beetle larva. Claim 3 A primer set for non-invasive genotyping analysis of an anchor beetle, wherein the genotype of claim 1 is the cytochrome c oxidase subunit I genotype present in the anchor beetle population. Claim 4 A kit for non-invasive genotyping of the anchored mantis beetle comprising a primer set of any one of claims 1 to 3. Claim 5 A kit for non-invasive genotyping of the Japanese tiger beetle according to claim 4, characterized in that the kit further comprises a DNA polymerase for amplification reaction, dNTPs, and a reaction buffer. Claim 6 i) a step of extracting and diluting residual gDNA from the molted shell of a larva of a spotted tiger beetle; ii) a step of performing an amplification reaction of a target sequence using a primer set comprising a forward primer consisting of the nucleotide sequence of SEQ ID NO. 1 and a reverse primer consisting of the nucleotide sequence of SEQ ID NO. 2, using the gDNA isolated in step i) as a template; and iii) a step of detecting the amplified product of step ii). Claim 7 A non-invasive genotyping method for *Anchovy*, wherein, in step ii) above, the target sequence is *Anchovy* cytochrome c oxidase subunit I.