Reagent for measuring anti-gastric wall cell antibodies, kit for measuring anti-gastric wall cell antibodies, and method for measuring anti-gastric wall cell antibodies in a sample

Abstract

The object of the present invention is to provide a reagent for measuring anti-gastric wall cell antibodies and a kit for measuring anti-gastric wall cell antibodies for detecting anti-gastric wall cell antibodies, and to provide a method for measuring anti-gastric wall cell antibodies in a sample. According to the present invention, a reagent for measuring anti-gastric wall cell antibodies comprises a protein having an N-linked glycosylation as any one of the following proteins (1) to (3); (1) A protein comprising at least the amino acid sequence of sequence number 1; (2) A protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO. 1, and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or (3) A protein comprising at least an amino acid sequence in which 1 to several amino acids of sequence number 1 are substituted, deleted, added and / or inserted, and also an amino acid sequence capable of binding to an anti-gastric wall cell antibody.

Description

Technology Field

[0001] The present invention relates to a reagent for measuring anti-gastric wall cell antibodies and a kit for measuring anti-gastric wall cell antibodies. The present invention also relates to a method for measuring anti-gastric wall cell antibodies in a sample using the above-mentioned reagent for measuring anti-gastric wall cell antibodies or the kit for measuring anti-gastric wall cell antibodies. Background Technology

[0002] Autoimmune gastritis (AIG) is a disease caused by the destruction and loss of parietal cells in the gastric mucosa due to autoimmune abnormalities. As chronic atrophic gastritis (in the fundus and body) is identified in the pathogenesis of AIG and is a high risk factor for gastric cancer, endoscopic follow-up is becoming necessary.

[0003] Anti-gastric parietal cell antibodies are autoantibodies against proton pumps present on the surface of gastric parietal cells, and it is known that anti-gastric parietal cell antibodies appear in about 80% of patients with AIG. Anti-gastric parietal cell antibodies are autoantibodies essential for the definitive diagnosis of autoimmune gastritis.

[0004] Currently, the measurement of anti-gastric wall cell antibodies is performed by using rat gastric sections as antigens and detecting them visually using a fluorescence microscope.

[0005] Meanwhile, Non-patent Literature 1 describes H from which the N-type sugar chain has been detached + / K + It is described that the ATPase β subunit (ATP4B) does not react with autoantibodies. In addition, Non-patent Literature 2 indicates that among the α and β subunits of the proton pump components, many anti-gastric wall cell antibodies react with the β subunit. Furthermore, Non-patent Literature 3 describes identifying the ATP4B epitope that causes autoimmune gastritis in mice using a synthetic peptide. Prior art literature

[0006] Non-patent literature 1: Autoimmunity 16: 289-295, 1993 Non-patent literature 2: Scand J Gastroenterol 3(3): 288-293, 2002 Non-patent literature 3: Immunology 96(1): 145-151, 1999 The problem to be solved

[0007] The conventional method for measuring anti-gastric wall cell antibodies (i.e., using rat gastric sections as antigens and detecting them visually using a fluorescence microscope) had the problem of being cumbersome to operate and having many non-specific detections. In addition, in non-patent literature 1 to 3, the amino acid sequence required for the reaction between human anti-gastric wall cell antibodies and ATP4B was not specified.

[0008] The present invention has the problem of providing a reagent for measuring anti-gastric wall cell antibodies and a kit for measuring anti-gastric wall cell antibodies for detecting anti-gastric wall cell antibodies. Furthermore, the present invention has the problem of providing a method for measuring anti-gastric wall cell antibodies in a sample using the above-mentioned reagent for measuring anti-gastric wall cell antibodies or the kit for measuring anti-gastric wall cell antibodies. means of solving the problem

[0009] As a result of careful consideration to solve the above problem, the inventors have completed the present invention by using a human-derived ATP4B recombinant antigen and specifying the amino acid sequence region of ATP4B required for reaction with an anti-gastric wall cell antibody. According to the present invention, the following invention is provided.

[0010] <1> A reagent for measuring anti-gastric wall cell antibodies comprising a protein having an N-linked glycosylation chain as any one of the following proteins (1) to (3);

[0011] (1) A protein comprising at least the amino acid sequence of sequence number 1;

[0012] (2) A protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO. 1, and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or

[0013] (3) A protein comprising at least an amino acid sequence in which 1 to several amino acids of sequence number 1 are substituted, deleted, added and / or inserted, and also an amino acid sequence capable of binding to an anti-gastric wall cell antibody.

[0014] <2> The above protein is any one of the proteins (4) to (6) below, <1> Reagent for measuring anti-gastric wall cell antibodies listed in;

[0015] (4) A protein containing at least the amino acid sequence of sequence number 2;

[0016] (5) A protein comprising at least an amino acid sequence having 90% or more sequence identity with SEQ ID NO. 2 and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or

[0017] (6) A protein comprising at least one amino acid sequence in which 1 to several amino acids of sequence number 2 are substituted, deleted, added and / or inserted, and also an amino acid sequence capable of binding to an anti-gastric wall cell antibody.

[0018] <3> An N-linked sugar chain is bonded to the 27th amino acid residue in sequence number 1, <1> Reagent for measuring anti-gastric wall cell antibodies listed in

[0019] <4> An N-linked glycosylation chain is bonded to the 27th and 56th amino acid residues in Sequence No. 1, <1> Reagent for measuring anti-gastric wall cell antibodies listed in

[0020] <5> <1> inside <4> A reagent for measuring anti-gastric wall cell antibodies described in any one of the following, and

[0021] Containing a labeled anti-gastric wall cell antibody binding substance,

[0022] Kit for measuring anti-gastric wall cell antibodies.

[0023] <6> It is okay to have the cover <1> inside <4> A method for measuring anti-gastric wall cell antibodies in a sample, comprising contacting the sample with a reagent for measuring anti-gastric wall cell antibodies described in any one of the above.

[0024] <7> Measuring anti-gastric wall cell antibodies in a sample by latex agglutination <6> The method described in

[0025] <8> Measuring anti-gastric wall cell antibodies in a sample based on labels, <6> or <7> The method described in

[0026] <9> The sample is whole blood, serum, plasma, or urine, <6> inside <8> A method described in any one of the following. Effects of the invention

[0027] According to the present invention, false positives can be reduced in the detection of anti-gastric wall cell antibodies. Brief explanation of the drawing

[0028] Figure 1 shows the results of confirming the expression of the target protein by CBB (Coomassie Brilliant Blue) staining and Western blotting with an anti-His-tag antibody. Figure 2 shows the reaction principle of measuring anti-gastric wall cell antibodies in a blood sample using the recombinant antigen in Example 2. Figure 3 shows the measurement results of anti-gastric wall cell antibodies in a blood sample using the recombinant antigen in Example 2. Figure 4 shows a schematic diagram of the reaction treatment of commercially available antibodies and antigen-immobilized particles and the reaction with the sample. Figure 5 shows the measurement results of anti-gastric wall cell antibodies using a latex reagent. Figure 6 shows the results of measuring the reactivity with anti-gastric wall cell antibodies in a blood sample using a recombinant antigen. Specific details for implementing the invention

[0029] The present invention will be described in detail below.

[0030] In this specification, "~" indicates a range that includes the values ​​described before and after it as the minimum and maximum values, respectively.

[0031] Reagent for measuring anti-gastric wall cell antibodies

[0032] The reagent for measuring anti-gastric wall cell antibodies of the present invention is any one of the following proteins (1) to (3) and comprises a protein having an N-linked glycosylation chain.

[0033] (1) A protein comprising at least the amino acid sequence of sequence number 1;

[0034] (2) A protein comprising at least an amino acid sequence having sequence identity of 90% or more (preferably 95% or more, more preferably 97% or more) with SEQ ID NO. 1, and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or

[0035] (3) A protein comprising at least an amino acid sequence in which 1 to several (e.g., 1 to 5, 1 to 4, or 1 to 3) amino acids are substituted, deleted, added, and / or inserted in the sequence of number 1, and also an amino acid sequence capable of binding to an anti-gastric wall cell antibody.

[0036] The reagent for measuring anti-gastric wall cell antibodies of the present invention may be supported on a carrier. The carrier is not particularly limited, but may be a plate (e.g., a plastic microtiter plate), latex particles, magnetic particles, etc. As latex particles, latex particles such as polystyrene, styrene-methacrylic acid copolymer, styrene-glycidyl (meth)acrylate copolymer, styrene-styrene sulfonate copolymer, methacrylic acid polymer, acrylic acid polymer, acrylonitrile-butadiene-styrene copolymer, vinyl chloride-acrylic acid ester copolymer, and vinyl acrylate polyacetate may be used. As magnetic particles, magnetic silica particles, etc. may be used.

[0037] In a preferred embodiment, the protein is any one of the following proteins (4) to (6).

[0038] (4) A protein containing at least the amino acid sequence of sequence number 2;

[0039] (5) A protein comprising at least an amino acid sequence having sequence identity of 90% or more (preferably 95% or more, more preferably 97% or more) with sequence No. 2, and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or

[0040] (6) A protein comprising at least an amino acid sequence in which 1 to several (e.g., 1 to 5, 1 to 4, or 1 to 3) amino acids are substituted, deleted, added, and / or inserted in the sequence of number 2, and also an amino acid sequence capable of binding to an anti-gastric wall cell antibody.

[0041] Sequence No. 1: Human H + / K + - Amino acid residues at positions 167–290 of the extracellular domain of the ATPase β subunit (sequence of 123 amino acids)

[0042] DPNFGFEEGK PCFIIKMNRI VKFLPSNGSA PRVDCAFLDQ PRELGQPLQV

[0043] KYYPPNGTFS LHYFPYYGKK AQPHYSNPLV AAKLLNIPRN AEVAIVCKVM

[0044] AEHVTFNNPH DPYEGKVEFK LKIE

[0045] Sequence No. 2: Human H + / K + - Amino acid residues at positions 64–291 of the extracellular domain of the ATPase β subunit (sequence of 227 amino acids)

[0046] QTVDPYTPDY QDQLRSPGVT LRPDVYGEKG LEIVYNVSDN RTWADLTQTL

[0047] HAFLAGYSPA AQEDSINCTS EQYFFQESFR APNHTKFSCK FTADMLQNCS

[0048] GLADPNFGFE EGKPCFIIKM NRIVKFLPSN GSAPRVDCAF LDQPRELGQP

[0049] LQVKYYPPNG TFSLHYFPYY GKKAQPHYSN PLVAAKLLNI PRNAEVAIVC

[0050] KVMAEHVTFN NPHDPYEGKV EFKLKIEK

[0051] Sequence No. 3: Human H + / K + - Amino acid residues 1 through 291 of the extracellular domain of the ATPase β subunit

[0052] MAALQEKKTC GQRMEEFQRY CWNPDTGQML GRTLSRWVWI SLYYVAFYVV

[0053] MTGLFALCLY VLMQTVDPYT PDYQDQLRSP GVTLRPDVYG EKGLEIVYNV

[0054] SDNRTWADLT QTLHAFLAGY SPAAQEDSIN CTSEQYFFQE SFRAPNHTKF

[0055] SCKFTADMLQ NCSGLADPNF GFEEGKPCFI IKMNRIVKFL PSNGSAPRVD

[0056] CAFLDQPREL GQPLQVKYYP PNGTFSLHYF PYYGKKAQPH YSNPLVAAKL

[0057] LNIPRNAEVA IVCKVMAEHV TFNNPHDPYE GKVEFKLKIE K

[0058] The protein of the present invention has an N-linked glycosylation. The N-linked glycosylation is bonded to an amide nitrogen atom in the side chain of asparagine (Asn). More preferably, the N-linked glycosylation is bonded to the 27th amino acid residue in SEQ ID NO. 1, and more preferably, it is bonded to the 27th and 56th amino acid residues in SEQ ID NO. 1. Examples of N-linked glycosylations include high mannose type, complex type, and hybrid type. As for high mannose type glycosylations, N-linked glycosylations having mannose or mannose 6-phosphate at the terminal are known, and there are high mannose type glycosylations that appear as Man3 type, Man5 type, Man6 type, Man8 type, Man9 type, etc. depending on the number of mannoses.

[0059] Preparation of reagents for measuring anti-gastric wall cell antibodies

[0060] The protein in the present invention can be obtained by constructing an expression vector comprising a nucleic acid encoding the protein of the present invention, introducing the expression vector into a suitable host, and recovering and purifying it from the host culture.

[0061] In the later embodiments, human H + / K +- Using a nucleic acid having the base sequence of SEQ No. 4 encoding the amino acid sequence of the extracellular region of the ATPase β subunit (amino acid residues 64-291: SEQ No. 2), human H + / K + - The amino acid sequence of the extracellular region of the ATPase β subunit (amino acid residues 64-291: sequence number 2) was expressed.

[0062] Sequence number 4:

[0063] CCATGGCTTACCGTATGCAGCTGCTGAGCTGCATCGCTCTGAGCCTCGCTCTGGTCACCAATTCCGCTGAGCAGCACCACCATCACCACCACGGCGTGGCTATGCCCGGTGCTGAGGATGACGTCGTGCAGACCGTGGATCCTTACACCCCCGACTACCAAGACCAACTGCGCTCCCCCGGTGTCACTCTGCGTCCCGACGTGTACGGCGAGAAGGGTCTGGAAATCGTCTACAACGTGTCCGACAACCGCACTTGGGCTGATCTGACCCAGACTCTGCACGCCTTTCTGGCTGGTTACTCCCCCGCTGCTCAAGAGGACTCCATCAATTGCACCTCCGAGCAGTACTTCTTCCAAGAGTCCTTCCGCGCTCCCAACCACACCAAGTTCAGCTGCAAGTTCACCGCCGACATGCTGCAAAATTGCTCCGGTCTGGCTGATCCCAACTTCGGCTTCGAGGAGGGCAAGCCTTGCTTCATCATCAAGATGAACCGCATTGTCAAATTCCTCCCCTCCAACGGTTCCGCCCCTCGTGTGGATTGCGCCTTCCTCGACCAACCTCGCGAGCTGGGTCAGCCTCTGCAAGTCAAGTACTATCCCCCTAACGGCACCTTCTCTCTGCACTACTTCCCCTACTACGGTAAGAAGGCCCAGCCTCACTACTCCAACCCTCTGGTCGCTGCTAAGCTGCTGAACATCCCTCGTAACGCTGAGGTGGCTATCGTGTGTAAGGTGATGGCTGAGCACGTGACCTTCAACAACCCTCACGACCCCTACGAGGGCAAGGTGGAGTTCAAGCTGAAGATCGAAAAATAACTCGAG

[0064] 5'NcoI highlighted

[0065] 3'XhoI highlighted

[0066] The combination of an expression vector and a host is known to those skilled in the art. As an expression vector, one may be used that is capable of self-replication in a host cell or introduction into a chromosome and contains a promoter at a position where the target nucleic acid can be transcribed. For example, phages or plasmids may be used as expression vectors.

[0067] Examples of hosts include bacteria, yeast, animal cells, insect cells, and plant cells. Examples of bacteria include the genus Escherichia and the genus Bacillus. Examples of animal cells include COS1 cells, COS7 cells, and CHO cells. Examples of insect cells include Sf9 cells and Sf21 cells. Examples of plant cells include cells derived from the genus Nicotiana, such as Nicotiana tabacum. Among the above, eukaryotic cells are preferred in the present invention from the perspective of being able to express a protein having a sugar chain, and animal cells or insect cells are more preferred.

[0068] As a method for introducing a recombinant expression vector into a host, for example, the calcium phosphate method, the electroporation method, the protoplast method, the spheroplast method, the lithium acetate method, the lipoprefection method, the viral vector method, etc., can be used, and it can also be carried out using various commercially available transfection reagents.

[0069] After culturing the transformant, if the recombinant protein is produced within the cell, the recombinant protein can be recovered by lysing the cell. In addition, if the recombinant protein is produced outside the cell, the culture medium is used as is, or the cell is removed by centrifugation, etc. After that, the recombinant protein can be isolated and purified by using a conventional protein isolation and purification method, namely solvent extraction, salting out with ammonium sulfate, desalting, precipitation with an organic solvent, anion exchange chromatography using diethylaminoethyl (DEAE) cepharose, cation exchange chromatography using a resin such as S-Sepharose FF (Pharmacia), hydrophobic chromatography using a resin such as butyl cepharose or phenyl cepharose, gel filtration using a molecular sieve, affinity chromatography, chromatofocusing, electrophoresis such as isoelectric point electrophoresis, or other methods, either alone or in combination.

[0070] <Anti-gastric wall cell antibody measurement kit>

[0071] The kit for measuring anti-gastric wall cell antibodies of the present invention comprises the reagent for measuring anti-gastric wall cell antibodies of the present invention described above and a labeled anti-gastric wall cell antibody binding substance. The reagent for measuring anti-gastric wall cell antibodies of the present invention and the labeled anti-gastric wall cell antibody binding substance may each be included in the kit of the present invention as different reagents. The labeled anti-gastric wall cell antibody binding substance will also be described in the <Method for Measuring Anti-Gastric Wall Cell Antibodies in a Sample> later.

[0072] In a kit for measuring anti-gastric wall cell antibodies, the reagent for measuring anti-gastric wall cell antibodies of the present invention may be supported on a carrier or may not be supported on a carrier. If the kit for measuring anti-gastric wall cell antibodies includes the reagent for measuring anti-gastric wall cell antibodies of the present invention that is not supported on a carrier, the kit may further include a carrier in addition to the reagent for measuring anti-gastric wall cell antibodies of the present invention and a labeled anti-gastric wall cell antibody binding material.

[0073] As a carrier, it is not particularly limited but may be a plate (e.g., a plastic microtiter plate), latex particles, magnetic particles, etc. As latex particles, latex particles such as polystyrene, styrene-methacrylic acid copolymer, styrene-glycidyl (meth)acrylate copolymer, styrene-styrene sulfonate copolymer, methacrylic acid polymer, acrylic acid polymer, acrylonitrile-butadiene-styrene copolymer, vinyl chloride-acrylic acid ester copolymer, and vinyl acrylate polyacetate may be used. As magnetic particles, magnetic silica particles, etc. may be used.

[0074] As a label for the labeled anti-gastric wall cell antibody binding substance, it is preferable to use an enzyme, for example, in enzyme immunoassay (EIA). Examples of enzymes include peroxidases such as alkaline phosphatase, β-galactosidase, horseradish peroxidase (HRP), and microperoxidase; glucose oxidase; glucose-6-phosphate dehydrogenase; malate dehydrogenase; luciferase; tyrosinase; acid phosphatase; etc. Among the above, alkaline phosphatase, peroxidase, and glucose oxidase are more preferred, and peroxidase is particularly preferred.

[0075] As for the anti-gastric wall cell antibody binding substance, any substance that binds to the anti-gastric wall cell antibody may be used, for example, anti-human IgG, etc.

[0076] The kit for measuring anti-gastric wall cell antibodies may further include a chromogenic substrate. Examples of chromogenic substrates include 3,3',5,5'-tetramethylbenzidine (TMB), 4-chloro-1-naphthol (4-CN), and 3,3'-diaminobenzidine (DAB).

[0077] The luminescent substrate is preferably a nitrogen-containing heterocyclic compound having an amino group or a salt thereof, examples of which include luminol, isoluminol, N-aminohexyl-N-ethylisoluminol (AHEI), N-aminobutyl-N-ethylisoluminol (ABEI) and their metal salts (alkali metal salts, etc.), 8-amino-5-chloro-7-phenylpyrido[3,4-d]pyridazine-1,4(2H,3H)-dione or its salts.

[0078] The kit for measuring anti-gastric wall cell antibodies may further include a stabilizer, an agglutination promoter, a surfactant, a buffer, etc., which are used in the method for measuring anti-gastric wall cell antibodies in a sample described below.

[0079] Method for measuring anti-gastric wall cell antibodies in a sample

[0080] A method for measuring anti-gastric wall cell antibodies in a sample according to the present invention comprises contacting a sample with a reagent for measuring anti-gastric wall cell antibodies according to the present invention, which may have a label.

[0081] As a sample, whole blood, serum, plasma, or urine may be used, although not specifically limited.

[0082] As an example of the present invention, anti-gastric wall cell antibodies in a sample can be measured based on a label.

[0083] The measurement of anti-gastric wall cell antibodies may be performed in accordance with the sandwich method, competitive method described in literature commonly practiced in the field [e.g., Enzyme Immunoassay Method, 2nd Edition (edited by Eiji Ishikawa et al., Igakushoin, 1982)] and the measurement method described in Japanese Patent Publication No. Hei 6-130063.

[0084] In the sandwich method, for example, the reagent for measuring anti-gastric wall cell antibodies of the present invention is immobilized on the surface of a solid carrier such as magnetic silica particles, and a sample, a solid carrier, and an anti-gastric wall cell antibody binding substance labeled by a label (a substance that binds to anti-gastric wall cell antibodies, for example, anti-human IgG) are mixed, and the immobilized reagent for measuring anti-gastric wall cell antibodies, the anti-gastric wall cell antibodies in the sample, and the labeled anti-gastric wall cell antibody binding substance are brought into contact. By doing so, a label complex is formed, which is a complex of the immobilized reagent for measuring anti-gastric wall cell antibodies, the anti-gastric wall cell antibodies in the sample, and the labeled anti-gastric wall cell antibody binding substance. Subsequently, the solid carrier supporting the label complex is separated by B / F, the amount of the label in the label complex is measured, and the amount of anti-gastric wall cell antibodies in the sample is measured based on the amount of the label in the label complex. As for the solid carrier, any support used in conventional immunological measurement methods (especially insoluble supports) may be used, but examples include organic materials such as polystyrene, polyacrylic acid, polymethacrylic acid, polymethyl methacrylate, polyacrylamide, polyglycidyl methacrylate, polypropylene, polyolefin, polyimide, polyuretaine, polyester, polyvinyl chloride, polyethylene, polychlorocarbonate, silicone resin, silicone rubber, agarose, dextran, and ethylene-maleic anhydride copolymer; inorganic materials such as glass, silicon oxide, diatoms, porous glass, opaque glass, alumina, silica gel, and metal oxides; magnetic materials such as iron, cobalt, nickel, magnetite, and chromite; and materials prepared using alloys of these magnetic materials. Solidification can be performed on a solid surface (e.g., any surface of beads, magnetic beads, membranes, plates, etc.). Various commercially available magnetic beads may be used. As for the magnetic beads, for example, the beads disclosed in WO2012 / 173002A may be used.In a sandwich assay, typically, the immobilized reagent for measuring anti-gastric wall cell antibodies and the labeled anti-gastric wall cell antibody binding substance do not compete with each other for binding to the anti-gastric wall cell antibody and bind to the target component simultaneously.

[0085] Specifically, for example, an anti-gastric wall cell antibody in a sample is brought into contact with a reagent for measuring anti-gastric wall cell antibodies immobilized on the surface of a solid carrier, such as magnetic silica particles, to form a complex between the reagent immobilized on the solid carrier and the anti-gastric wall cell antibody in the sample. Next, a labeled anti-gastric wall cell antibody binding substance is brought into contact with the complex to form a complex (labeled complex) of the reagent for measuring anti-gastric wall cell antibodies immobilized on the solid carrier, the anti-gastric wall cell antibody in the sample, and the labeled anti-gastric wall cell antibody binding substance. The labeled complex is separated by B / F, the amount of labeling in the labeled complex is measured, and the amount of anti-gastric wall cell antibody in the sample is measured based on the amount of labeling in the labeled complex.

[0086] In the above method, the anti-gastric wall cell antibody in the sample is reacted with the immobilized anti-gastric wall cell antibody measurement reagent, and then the labeled anti-gastric wall cell antibody binding substance is reacted; however, the labeled anti-gastric wall cell antibody binding substance and the anti-gastric wall cell antibody in the sample may be reacted with the immobilized anti-gastric wall cell antibody measurement reagent, and the three may be reacted simultaneously.

[0087] In the above sandwich method, B / F separation (Bound / Free separation) refers to the separation of a substance supported on a solid carrier from other substances.

[0088] In other words, it refers to the separation of the label complex and the labeled anti-gastric wall cell antibody binding substance that did not participate in the formation of the label complex. Specifically, it refers to the reagent for measuring anti-gastric wall cell antibodies immobilized on a solid carrier, the complex of the reagent for measuring anti-gastric wall cell antibodies immobilized on a solid carrier and the anti-gastric wall cell antibodies in the sample, and the separation of the above label complex and other components (components other than the anti-gastric wall cell antibodies in the sample, labeled anti-gastric wall cell antibody binding substance that did not participate in the formation of the label complex, etc.).

[0089] In addition, the B / F separation process is an essential step after the formation of the labeled complex, but it may also be performed after the complex of the anti-gastric wall cell antibody and the reagent for measuring the anti-gastric wall cell antibody immobilized on the surface of the solid carrier has been formed.

[0090] The sandwich method may also be performed using micro-total analysis systems (μTAS). The micro-fluidic chip is provided with a flow path, and the flow path has a sample inlet. For example, at the sample inlet, a reagent for measuring anti-gastric wall cell antibodies conjugated with a polycation or a polyanion (e.g., DNA) is brought into contact with the anti-gastric wall cell antibodies in the sample to form a complex of the reagent for measuring anti-gastric wall cell antibodies and the anti-gastric wall cell antibodies. An electric field is applied to move the complex, and when the complex comes into contact with a labeled anti-gastric wall cell antibody binding material present in the middle of the flow path, a complex of the reagent for measuring anti-gastric wall cell antibodies, the anti-gastric wall cell antibodies, and the labeled anti-gastric wall cell antibody binding material is formed. Furthermore, the complex moves through the flow path by the electric field, and the labeled complex is separated into B / F and reaches a detector on the flow path. The amount of label in the labeled complex is measured, and the amount of anti-gastric wall cell antibodies in the sample is measured based on the amount of label in the labeled complex.

[0091] The competitive method refers to a method for measuring the amount of anti-gastric cell antibodies in a sample by utilizing a reaction in which, for example, the anti-gastric cell antibody in the sample competes with a substance identical to the anti-gastric cell antibody against a reagent for measuring anti-gastric cell antibodies that specifically binds to the anti-gastric cell antibody, or the anti-gastric cell antibody in the sample competes with a substance similar to the anti-gastric cell antibody.

[0092] In one example of the competition method, the reagent for measuring anti-gastric wall cell antibodies of the present invention is immobilized on the surface of a solid carrier, and a sample, a solid carrier, and an anti-gastric wall cell antibody labeled by a label or a substance similar thereto are mixed. By doing so, the anti-gastric wall cell antibody in the sample is competed with the anti-gastric wall cell antibody labeled by a label or a substance similar thereto and brought into contact with the immobilized reagent for measuring anti-gastric wall cell antibodies, thereby forming a label complex comprising the anti-gastric wall cell antibody labeled by a label or a substance similar thereto and the immobilized reagent for measuring anti-gastric wall cell antibodies. Subsequently, the solid carrier carrying the label complex is separated by B / F, the amount of the label in the label complex is measured, and the amount of anti-gastric wall cell antibody in the sample can be measured based on the amount of the label in the label complex.

[0093] Specifically, for example, first, an anti-gastric wall cell antibody in the sample is made to compete with a labeled anti-gastric wall cell antibody or a similar substance, and then brought into contact with an immobilized reagent for measuring anti-gastric wall cell antibodies to form a labeled complex containing the labeled anti-gastric wall cell antibody or a similar substance and the immobilized reagent for measuring anti-gastric wall cell antibodies. Next, the solid carrier supporting the labeled complex is subjected to B / F separation to measure the amount of the label in the labeled complex, and the amount of anti-gastric wall cell antibody in the sample is measured based on the amount of the label in the labeled complex.

[0094] In this method, an anti-gastric wall cell antibody in a sample, a reagent for measuring immobilized anti-gastric wall cell antibodies, and a labeled anti-gastric wall cell antibody or a substance similar thereto are simultaneously subjected to a competitive reaction; however, the anti-gastric wall cell antibody in the sample may be added to the reagent for measuring immobilized anti-gastric wall cell antibodies, and then the labeled anti-gastric wall cell antibody or a substance similar thereto is added and subjected to a competitive reaction.

[0095] In the above competitive method, B / F separation refers to the separation of a substance supported on a solid carrier from other substances. Specifically, it refers to the separation of a labeled complex comprising an anti-gastric wall cell antibody or a similar substance labeled by a label, or a reagent for measuring immobilized anti-gastric wall cell antibodies, from other components (components in the sample other than the anti-gastric wall cell antibody).

[0096] As a method of contacting the anti-gastric wall cell antibody, the anti-gastric wall cell antibody measurement reagent, the labeled anti-gastric wall cell antibody binding substance, the anti-gastric wall cell antibody or a substance similar thereto in the sample, contact may be made by conventionally performed processes such as stirring and mixing. The reaction time may be appropriately set according to the sandwich method, competitive method, etc., but is typically 1 minute to 24 hours, preferably 1 minute to 1 hour, more preferably 1 to 10 minutes, and particularly preferably 1 to 5 minutes.

[0097] B / F separation is achieved, for example, by utilizing the magnetism of a solid carrier, collecting the solid carrier from the outside of the reaction vessel using a magnet, discharging the reaction liquid, adding a washing liquid, removing the magnet, mixing and dispersing the solid carrier, and washing. The above operation may be repeated 1 to 3 times. As for the washing liquid, it is not particularly limited as long as it is one that is commonly used in this field.

[0098] As a label, it is preferable to use an enzyme, for example, in enzyme immunoassay (EIA). Examples of enzymes include peroxidases such as alkaline phosphatase, β-galactosidase, horseradish peroxidase (HRP), and microperoxidase, glucose oxidase, glucose-6-phosphate dehydrogenase, malate dehydrogenase, luciferase, tyrosinase, acid phosphatase, etc. Among the above, alkaline phosphatase, peroxidase, and glucose oxidase are more preferred, and peroxidase is particularly preferred.

[0099] In the present invention, it is preferable to perform an enzymatic reaction using an enzyme as a label as described above. A preferred example of an enzymatic reaction is a reaction by peroxidase carried out in the presence of hydrogen peroxide.

[0100] In order to bind the above-mentioned label to an anti-gastric wall cell antibody binding substance, an anti-gastric wall cell antibody, or a substance similar thereto, methods commonly used in this field [e.g., *Course on Experimental Medicine in Medicine*, Vol. 8, supervised by Yuichi Yamamura, 1st edition, Nakayama Shoten, 1971; *Illustrated Fluorescent Antibodies*, written by Akira Kawaoi, 1st edition, Soft Science Co., Ltd., 1983; *Enzyme Immunoassay*, edited by Eiji Ishikawa, Tadashi Kawai, and Kiyoshi Muroi, 2nd edition, Igaku Shoin, 1982, etc.] may be used.

[0101] The amount of label used can be appropriately set depending on the type of label used. For example, when peroxidase is used as a label, it is preferable to have a molar ratio of the anti-gastric wall cell antibody binding substance and the label, for example, typically 1:1 to 20, preferably 1:1 to 10, and more preferably 1:2 to 6. In addition, the anti-gastric wall cell antibody binding substance labeled with peroxidase can be used by containing it in a buffer commonly used in this field, such as Tris buffer, phosphate buffer, Veronal buffer, boric acid buffer, Good buffer (e.g., MES (2-morpholinothanesulfonic acid) buffer, etc.).

[0102] The pH of the above buffer solution should be within a range that does not inhibit the antigen-antibody reaction, and is typically 5 to 9. In addition, such a buffer solution may contain stabilizers such as albumin, globulin, water-soluble gelatin, and polyethylene glycol, surfactants, sugars, etc., provided that they do not inhibit the antigen-antibody reaction. Furthermore, in this specification, pH refers to a value measured in accordance with JISK0400-12-10:2000 (measurement temperature 25℃).

[0103] Methods for measuring the label include colorimetric measurement or chemiluminescent immunoassays (ECLIA, CLIA, and CLEIA).

[0104] Examples of chromogenic substrates include 3,3',5,5'-tetramethylbenzidine (TMB), 4-chloro-1-naphthol (4-CN), and 3,3'-diaminobenzidine (DAB).

[0105] The luminescent substrate is preferably a nitrogen-containing heterocyclic compound having an amino group or a salt thereof, examples of which include luminol, isoluminol, N-aminohexyl-N-ethylisoluminol (AHEI), N-aminobutyl-N-ethylisoluminol (ABEI) and their metal salts (alkali metal salts, etc.), 8-amino-5-chloro-7-phenylpyrido[3,4-d]pyridazine-1,4(2H,3H)-dione or its salts.

[0106] In measurement methods utilizing antigen-antibody reactions, label-free methods include immunodiffusion, immunoturbidimetry, immunonephlometry, and latex agglutination methods using precipitation reactions. In label-free methods such as latex agglutination, labeling is unnecessary, and since the quantification of the target component is possible through photometry at a specific wavelength in the ultraviolet, visible, and near-infrared regions, only a general-purpose, compact spectroscopic device needs to be prepared, making it easy to introduce in small-scale medical facilities or the field of POCT. In particular, the latex agglutination method is a method with excellent speed, convenience, and versatility, as the preparation method for reagent manufacturing is relatively simple, and when the user uses it, measurement can be initiated simply by adding the sample to the latex reagent and performing measurements at a specific wavelength in the ultraviolet, visible, and near-infrared regions over a set period, with the measurement typically completed within a few minutes to tens of minutes. Preferably, in the present invention, anti-gastric wall cell antibodies in a sample can be measured by an agglutination method, and more preferably, anti-gastric wall cell antibodies in a sample can be measured by latex agglutination.

[0107] As for the carrier used in the agglutination method, any known carrier material used in the field of immunoagglutination reactions may be used without particular limitation. Examples of such materials include synthetic polymer powders such as polystyrene, styrene-methacrylic acid copolymer, styrene-glycidyl (meth)acrylate copolymer, styrene-styrene sulfonate copolymer, methacrylic acid polymer, acrylic acid polymer, acrylonitrile-butadiene-styrene copolymer, vinyl chloride-acrylic acid ester copolymer, and polyvinyl acrylate, and a latex in which these are uniformly suspended is preferred. In addition, other organic polymer powders, inorganic material powders, microorganisms, blood cells or cell membrane fragments, plastic microtiter plates, etc. Examples of inorganic material powders include metal fragments such as gold, titanium, and nickel, as well as silica and alumina.

[0108] The particle size of the carrier is typically 0.01 to 1.0 μm, more preferably 0.05 to 0.7 μm.

[0109] Regarding the method of loading the reagent for measuring anti-gastric wall cell antibodies of the present invention onto a carrier, either a physical adsorption method or a chemical bonding method by covalent bonding may be used. After loading the reagent for measuring anti-gastric wall cell antibodies of the present invention onto a carrier, known substances, such as BSA (bovine serum albumin), block ace, skim milk, or casein, may be used as a blocking agent to cover the surface of the carrier that is not coated with the reagent for measuring anti-gastric wall cell antibodies. If necessary, the blocking agent may be pretreated, such as by partial denaturation using heat or acid / alkali.

[0110] For measurement by agglutination, a dispersion of a carrier loaded with a reagent for measuring anti-gastric wall cell antibodies is brought into contact with a sample containing anti-gastric wall cell antibodies to initiate the reaction, and the formation of aggregates resulting from the antigen-antibody reaction is quantified by measurement at a specific wavelength in the ultraviolet, visible, or near-infrared region over a set period of time. Typically, the measurement is completed after a few minutes to several hours. The reaction may be initiated with two solutions, the carrier dispersion and the sample, or a solution containing a stabilizer or an agglutination accelerator may be prepared separately and the reaction may be carried out with three solutions. The stabilizer or the agglutination accelerator may be contained in the carrier dispersion or the sample, and these substances may be added as necessary.

[0111] Stabilizers are not particularly limited as long as they stabilize each reagent and component during the reaction or the progress of the reaction itself, such as buffer solutions like Good Buffer, synthetic or natural polymers like polyethylene glycol or polysaccharides, or surfactants. The same applies when these substances act not only as stabilizers but also as promoters of the agglutination reaction. Each reagent and component during the reaction is, for example, a reagent for measuring anti-gastric wall cell antibodies bound to a carrier or an anti-gastric wall cell antibody, and sugars or amino acids may be added to stabilize proteins such as antibodies or enzymes.

[0112] Examples of coagulation promoters include synthetic or natural polymers such as polyethylene glycol, polyglycosyl methacrylate, polyvinylpyrrolidone, carboxymethylcellulose, dextran, and pullulan. Examples of surfactants having the same action include polyethylene glycol fatty acid monoester derivatives.

[0113] The buffer that can be used needs to have buffering capacity under pH conditions where a normal antigen-antibody reaction is performed, and such pH conditions are 5 to 11, more preferably 6 to 10. Examples of buffers that have buffering capacity under these pH conditions include, for instance, phosphate buffer, Tris buffer, MES (2-morpholinethanesulfonic acid) buffer, MOPS (3-morpholinopropane-1-sulfonic acid) buffer, HEPES (2-[4-(2-hydroxyethyl)piperazine-1-yl]ethanesulfonic acid) buffer, glycine buffer, citric acid buffer, etc. Any buffer that can be used in normal biochemical experiments, including good buffers, can be used. In addition, regarding liquids involved in the agglutination reaction, such as a dispersion of a carrier loaded with a reagent for measuring anti-gastric wall cell antibodies or a sample containing anti-gastric wall cell antibodies, surfactants, synthetic or natural polymers, organic and inorganic reagents, etc., may be added as needed. For example, regarding surfactants, nonionic, anionic, cationic types, etc., which are known for immunoagglutination reactions may be used.

[0114] When performing an agglutination reaction based on an antigen-antibody reaction, methods for measuring the degree of agglutination include visual inspection, video recording, and spectroscopic methods. Spectroscopic measurement can be performed by known methods using a reaction solution in which a sample containing anti-gastric wall cell antibodies is brought into contact with a dispersion of a carrier loaded with a reagent for measuring anti-gastric wall cell antibodies; for example, changes (increase or decrease) in scattered light intensity, absorbance, or transmitted light are measured over the particle size, concentration, and reaction time of the carrier.

[0115] Next, the present invention will be described with reference to examples, but the present invention is not limited to these.

[0116] Examples

[0117] <Example 1> Preparation of Recombinant Antigen

[0118] (1) Preparation of recombinant baculovirus

[0119] Human H + / K + - A nucleic acid (sequence number 4) encoding the amino acid sequence of the extracellular region of the ATPase β subunit (64-291 amino acid residues: sequence number 2) was synthesized and introduced into the insect cell expression vector pIEx-4 DNA Novagen (manufactured by Merk) to construct an expression vector.

[0120] 25cm 2 2.0×10 in the flask 6 Sf9 cells were seeded. There, 100 μL of PSFM-J1 medium (manufactured by Fujifilm Wako Junyakusho) containing 2 μg of the above vector DNA, 90 ng of baculovirus (AcNPV; manufactured by Takara Bio) DNA, and 3 μL of ScreenFect plus (manufactured by Fujifilm Wako Junyakusho) was added. After incubation at 27°C for 7 days, the entire culture supernatant (cot-transspection solution) was collected.

[0121] (2) Culture

[0122] 1.5×10 6 To 1 L of Sf9 cells diluted with PSFM-J1 medium to a cell / mL ratio, 1 / 200 of the amount of recombinant baculovirus solution (AcNPV) transfected with the target gene prepared in (1) was added, and the mixture was cultured with shaking at 27°C for 3 days. After a set time, the culture medium was collected and centrifuged at 5000xg for 30 minutes at 4°C, and after centrifugation, the culture supernatant and precipitate were separated.

[0123] (3) Confirmation of expression

[0124] Using a portion of the sample recovered from the culture medium, the expression of the target protein was confirmed by CBB (Coomassie Brilliant Blue) staining and Western blotting with an anti-His-tag antibody. The results are shown in Figure 1. Each lane in Figure 1 represents the following.

[0125] M: WIDE-VIEW TM Prestained Protein Size Marker III

[0126] 1: Cell fraction of a virus-infected cell expressing recombinant human ATP4β protein

[0127] 2: Culture supernatant of cells infected with recombinant human ATP4β protein expression virus

[0128] 3: WAKO-BEVS (negative control) virus-infected cell fraction

[0129] 4: WAKO-BEVS (negative control) virus-infected culture supernatant

[0130] (4) Refining

[0131] The culture supernatant of the insect cells obtained in (3) above was filtered through a 0.45 μm filter, and Ni Sepharose Excel TM The sample before purification was added to the resin (manufactured by Cytiva), applied to an open column to recover the transmissible fraction, and after washing the column, the target protein was eluted. The target protein was detected on the purified fraction using CBB staining. The fraction containing a large amount of the target was pulled to obtain the recombinant antigen.

[0132] <Example 2> Measurement of anti-gastric wall cell antibodies in blood samples using recombinant antigen

[0133] 100 μL of the antigen solution (concentration 0.4 μg / well) obtained in Example 1 was added to an ELISA plate (Thermo scientific cat. 468867) and incubated overnight at 6°C to immobilize the antigen on the plate. After washing with PBS-T, 300 μL of blocking solution (MES buffer 50 mmol / L, pH 6.0, 1% blocking polymer) was added to the plate, and blocking was performed overnight at 6°C. To the antigen-immobilized plate prepared above, 100 μL of a blood sample diluted 100-fold with PBS-T was added and reacted at room temperature for 1 hour. Subsequently, washing was performed with PBS-T, and 100 μL of peroxidase (POD)-labeled anti-human antibody (self-product 10 nmol / L) was added and reacted at room temperature for 1 hour. In addition, after washing with PBS-T, 100 μL of a colorimetric reagent (3,3',5,5'-tetramethylbenzidine (TMB) solution; manufactured by Fujifilm Wako Junyaku Co., Ltd.) was added and reacted at room temperature for 30 minutes, after which 100 μL of a stop solution (0.1 mol / L sulfuric acid) was added and the OD (optical density) at 450 nm was measured. The reaction principle is shown in Fig. 2. The measurement results of the OD at 450 nm are shown in Fig. 3. As shown in Fig. 3, a significant difference in OD was confirmed between patients with autoimmune gastritis (AIG) and the non-disease group (non-AIG).

[0134] <Example 3> Estimation of Antigen Epitopes Using Commercially Available Antibodies

[0135] The antigen obtained in Example 1 was immobilized at a concentration of 3 μg per 1 mg of magnetic particles (MagRapid). Next, human H + / K +10 μg of a rabbit polyclonal antibody (anti-Hydrogen Potassium ATPase Beta / ATP4B antibody product number: ab176992, manufactured by abcam) prepared using the amino acid sequence (167-290aa) of the extracellular region of the ATPase β subunit as an antigen was added to 25 μg of magnetic particles immobilized with the antigen and reacted at room temperature for 1 hour. Afterward, the magnetic particles were dispensed into a cartridge, and the sample containing the anti-gastric wall cell antibody was measured using an automated chemiluminescent enzyme immunoassay device Accuraseed with an anti-gastric wall cell antibody analyzer (solid phase, chromogenic reagent sold separately) identical to that of Example 2. As a result, compared to the case where the commercial antibody was not reacted (top of Fig. 4), the luminescence signal of the reacted particles (bottom of Fig. 4) decreased by approximately 17–19.6%, as shown in the table below. From the above, it was found that reaction inhibition occurs due to a competitive reaction between the commercial antibody and the antibody in the sample, and that there is a high possibility that the recognition sites of the two antibodies overlap.

[0136] [Table 1]

[0137]

[0138] <Example 4> Measurement of anti-gastric wall cell antibodies using latex reagent

[0139] (1) Recombinant human H + / K + - ATPase β subunit sensitization latex reagent

[0140] Antigen obtained in Example 1 (human H + / K +0.5 ml of 5 mmol / L MES buffer (pH 5.5) containing 0.4 mg of the amino acid sequence of the extracellular region of the ATPase β subunit (recombinant of amino acid residues 64-291: sequence number 2) was mixed with 0.5 ml of 5 mmol / L MES buffer (pH 5.5) containing 1% (W / V) of polystyrene latex [average particle size 0.32 μm, manufactured by Nihon Koden Co., Ltd.] and 0.2% (W / V) of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide, Hydrochloride (WSC) (manufactured by Tojin Kagaku Genkyusho), and reacted at 7°C for 18 hours. Subsequently, the latex was separated by centrifugation and suspended in a 2.5% (W / V) aqueous solution of BSA (manufactured by WAKO CHEMICALS USA, INC.) to achieve a latex concentration of 1% (W / V), and reacted at room temperature for 2 hours. Afterward, the latex was separated by centrifugation and suspended in a 20 mmol / L MOPS buffer (pH 7.0) containing 0.5% (W / V) BSA to achieve a latex concentration of 1% (W / V), and the resulting substance was human H + / K + - It was used with ATPase β subunit antigen sensitization latex solution [1].

[0141] (2) Preparation of the measuring solution

[0142] A 20 mmol / L HEPES buffer solution (pH 7.0) containing 0.1% (W / V) BSA was used as reagent [2], and the human H prepared in Example 4 (1) was used with this reagent [2]. + / K + - ATPase β subunit antigen sensitization latex solution [1] was used.

[0143] (3) Measurement sample

[0144] Four plasma samples purchased from Bizcom Japan Co., Ltd. and six serum samples purchased from TRINA BIOREACTIVES AG were measured using the same ELISA method as in Example 2, and an OD of 0.5 or less was classified as antibody-negative, and 1.0 or more as antibody-positive. Five negative samples and five positive samples were used.

[0145] (4) Measurement of anti-gastric wall cell antibodies (endpoint analysis method: EPA method)

[0146] The following measurements were performed using JCA-BM9130 (manufactured by Nihon Denshi Co., Ltd.). After mixing 45 μL of reagent [2] with 1.5 μL of the measurement sample of (3) above, the mixture was heated at 37°C for 5 minutes. After that, the human H of (1) above + / K + 15 μL of ATPase β subunit antigen sensitization latex solution [1] was mixed and kept warm at 37°C for 5 minutes. The change in absorbance at 805 nm was measured from 30 seconds after the addition of the latex solution [1] to 5 minutes after.

[0147] (5) Result

[0148] The measurement results are shown in Figure 5. As shown in Figure 5, a significant difference of OD×10000 was confirmed.

[0149] <Example 5> Reactivity of anti-gastric wall cell antibodies in blood samples using recombinant antigen

[0150] By the same method as in Example 1, [1] a recombinant antigen of sequence number 1 (167-290 amino acid residues) and [2] a recombinant antigen with the 56th N-type glycosylation deleted by substituting the 56th amino acid of sequence number 1 from N (asparagine) to A (alanine). In addition, [3] human H of E. coli origin without glycosylation modification + / K +- ATPase β subunit antigen (MY BioSource) was obtained. The samples from [1] to [3] above were mixed with sample buffer (Fujifilm Wako Junyaku Co., Ltd.) in a 3:1 ratio. After heat treatment at 98°C for 5 minutes, the samples were applied to a polyacrylamide gel and SDS-PAGE was performed by electrophoresis at 200V for 60 minutes. After electrophoresis, the protein was transferred to a membrane using a protein transfer device (Transblot Turbo: manufactured by Biorad), and the membrane was blocked at room temperature for 1 hour with a 4% (W / V) solution of Block Ace powder UK-B500 (Yukijirushi Megmilk). After that, plasma samples (3 positive and 3 negative samples) purchased from TRINA BIOREACTIVES AG and the membrane were reacted at room temperature for 1 hour, and after reacting with POD-labeled anti-human IgG antibodies (self-made), chemiluminescence was detected using Immunoster® Zeta (Fujifilm Wako Junyaku).

[0151] The results are shown in Fig. 6. As shown in Fig. 6, in the negative sample, no bands were detected in any of the series [1] to [3], and in the positive sample, specific signals were detected in [1] and [2], indicating a reaction with the sample.

[0152] [Ranking Table]

[0153] International application based on the Patent Cooperation Treaty 23F01280W1JP25004095_1.xml

Claims

Claim 1 A reagent for measuring anti-gastric wall cell antibodies comprising any one of the following proteins (1) to (3), wherein the protein has an N-linked glycosylation chain; (1) a protein comprising at least the amino acid sequence of SEQ ID NO. 1; (2) a protein comprising at least the amino acid sequence having at least 90% sequence identity with SEQ ID NO. 1 and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or (3) a protein comprising at least the amino acid sequence in which 1 to several amino acids of SEQ ID NO. 1 are substituted, deleted, added, and / or inserted, and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody. Claim 2 A reagent for measuring anti-gastric wall cell antibodies according to claim 1, wherein the protein is any one of the following proteins (4) to (6); (4) a protein comprising at least the amino acid sequence of SEQ ID NO. 2; (5) a protein comprising at least the amino acid sequence having at least 90% sequence identity with SEQ ID NO. 2 and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody; or (6) a protein comprising at least the amino acid sequence in which 1 to several amino acids of SEQ ID NO. 2 are substituted, deleted, added and / or inserted, and also comprising an amino acid sequence capable of binding to an anti-gastric wall cell antibody. Claim 3 A reagent for measuring anti-gastric wall cell antibodies according to claim 1, wherein the N-linked glycosylation chain is bound to the 27th amino acid residue in sequence number 1. Claim 4 A reagent for measuring anti-gastric wall cell antibodies according to claim 1, wherein the N-linked glycosylation chain is bound to the 27th and 56th amino acid residues of sequence no.

1. Claim 5 A kit for measuring anti-gastric wall cell antibodies, comprising a reagent for measuring anti-gastric wall cell antibodies as described in claim 1 or claim 2 and a labeled anti-gastric wall cell antibody binding substance. Claim 6 A method for measuring anti-gastric wall cell antibodies in a sample, comprising contacting the sample with a reagent for measuring anti-gastric wall cell antibodies described in claim 1 or claim 2, which may have a label. Claim 7 A method according to claim 6 for measuring anti-gastric wall cell antibodies in a sample by latex agglutination. Claim 8 A method according to claim 6 for measuring anti-gastric wall cell antibodies in a sample based on a label. Claim 9 In claim 6, the sample is whole blood, serum, plasma, or factor, method.

Images